Double-Stranded DNA Deaminases

20230257730 · 2023-08-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein, among other things, is a method for deaminating a double-stranded nucleic acid. In some embodiments, the method may comprise contacting a double-stranded DNA substrate that comprises cytosines and a double-stranded DNA deaminase having an amino acid sequence that is at least 80% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and/or 99 to produce a deamination product that comprises deaminated cytosines. Enzymes and kits for performing the method are also provided.

Claims

1. A method for deaminating a double-stranded nucleic acid, the method comprising: contacting: a double-stranded DNA substrate that comprises cytosines; and a double-stranded DNA deaminase having an amino acid sequence that is at least 80% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and 99; to produce a deamination product that comprises deaminated cytosines.

2. The method of claim 1, wherein the double-stranded DNA substrate further comprises a modified cytosine.

3. The method of claim 1, wherein the modified cytosine is a 5fC, 5CaC, 5mC, 5hmC, N4mC, 5ghmC, or pyrrolo-C.

4. The method of claim 1, wherein the method further comprises: sequencing the deamination product, or amplifying the deamination product to produce amplification products and sequencing the amplification products, in each case, to produce sequence reads.

5. The method of claim 4, wherein the method further comprises: analyzing the sequence reads to identify a modified cytosine in the double-stranded DNA substrate.

6. The method of claim 1, wherein the double-stranded DNA substrate is eukaryotic or bacterial DNA.

7. The method of claim 1, wherein the double-stranded DNA substrate is human cfDNA.

8. The method of claim 1, wherein the double-stranded DNA deaminase has an amino acid sequence that is at least 90% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and 99.

9. The method of claim 1, wherein the double-stranded DNA substrate is pre-treated with a TET methylcytosine dioxygenase and DNA beta-glucosyltransferase.

10. The method of claim 9, wherein the double-stranded DNA deaminase has an amino acid sequence that is at least 90% identical to any of the SEQ ID NOS for MGYPDa829 (SEQ ID NO: 96), MGYPDa06 (SEQ ID NO: 4), CrDa01 (SEQ ID NO: 12), AvDa02 (SEQ ID NO: 2), CsDa01 (SEQ ID NO: 9), LbsDa01 (SEQ ID NO: 10), FIDa01 (SEQ ID NO: 8), MGYPDa26 (SEQ ID NO: 7), MGYPDa23 (SEQ ID NO: 6), chimera_10 (SEQ ID NO: 97) and AncDa04 (SEQ ID NO: 95).

11. The method of claim 1, wherein the double-stranded DNA substrate is pre-treated with a TET methylcytosine dioxygenase but not DNA beta-glucosyltransferase.

12. The method of claim 11, wherein the double-stranded DNA deaminase has an amino acid sequence that is at least 90% identical to any of the SEQ ID NOS for CseDa01 (SEQ ID NO: 3) and LbDa02 (SEQ ID NO: 1).

13. The method of claim 1, wherein the double-stranded DNA substrate is not pre-treated with either a TET methylcytosine dioxygenase or DNA beta-glucosyltransferase.

14. The method of claim 1, wherein the double-stranded DNA substrate comprises at least one N4mC.

15. The method of claim 14, wherein the double-stranded DNA substrate is bacterial DNA.

16. The method of claim 13, wherein the double-stranded DNA deaminase has an amino acid sequence that is at least 90% identical to any of the SEQ ID NOS for MGYPDa20 (SEQ ID NO: 11), NsDa01 (SEQ ID NO: 27), and AshDa01 (SEQ ID NO: 40).

17. The method of claim 1 further comprising: (a) ligating a hairpin adapter to a double-stranded fragment of DNA to produce a ligation product; (b) enzymatically generating a free 3′ end in a double-stranded region of the hairpin adapter in the ligation product; and (c) extending the free 3′ end in a dCTP-free reaction mix that comprises a strand-displacing or nick-translating polymerase, dGTP, dATP, dTTP and modified dCTP. to produce the double stranded DNA substrate.

18. The method of claim 17, wherein the modified dCTP is 5mdCTP, pyrrolo-dCTP, 5hmdCTP or N4-mdCTP.

19. The method of claim 17, wherein the double-stranded DNA deaminase has an amino acid sequence that is at least 90% identical to any of the SEQ ID NOS for MGYPDa20 (SEQ ID NO: 11), NsDa01 (SEQ ID NO: 27), AshDa01 (SEQ ID NO:40).

20. An enzyme comprising an amino acid sequence that is at least 80% identical to the C-terminal deaminase domain of a naturally-occurring protein, wherein the enzyme: (a) has a double-stranded DNA deaminase activity; and (b) does not comprise the N-terminus of the naturally-occurring protein.

21. The enzyme of claim 20, wherein the enzyme is no more than 300 amino acids in length.

22. The enzyme of claim 20, wherein the enzyme is at least 80% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and 99.

23. The enzyme of claim 20, wherein the enzyme is fused with a catalytically dead Cas9 (dCas9) or a nicking Cas9 (nCas9) or Transcription activator-like effector nucleases (TALEN).

24. A kit comprising: (a) an enzyme of claim 20; and (b) a reaction buffer.

25. The kit of claim 24, wherein the kit further comprises: a TET methylcytosine dioxygenase and a DNA beta-glucosyltransferase; or a TET methylcytosine dioxygenase and no DNA beta-glucosyltransferase

26. The kit of claim 24, wherein the kit is free of TET methylcytosine dioxygenase and DNA beta-glucosyltransferase.

27. The kit of claim 24, wherein the kit further comprises a modified dCTP selected from 5mdCTP, pyrrolo-dCTP, 5hmdCTP and N4-mdCTP.

28. A reaction mix comprising: (a) a double-stranded DNA substrate that comprises cytosines; and (b) a double-stranded DNA deaminase having an amino acid sequence that is at least 80% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and 99.

29. The reaction mix of claim 28, wherein the double-stranded DNA substrate comprises cytosines and at least one modified cytosine.

30. The reaction mix of claim 29, wherein the modified cytosine is a 5fC, 5caC, 5mC, 5hmC, N4mC or pyrrolo-C.

31. The reaction mix of claim 28, wherein the double-stranded DNA substrate comprises eukaryotic or bacterial DNA.

32. The reaction mix of claim 28, wherein the double-stranded DNA substrate is human cfDNA.

33. The reaction mix of claim 28, wherein the deaminase has an amino acid sequence that is at least 90% identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and 99.

Description

BRIEF DESCRIPTION OF FIGURES

[0010] The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

[0011] FIG. 1 shows the topology of a maximum likelihood phylogenetic tree of cytosine deaminases surrounded by illustrative activity data arranged in concentric rings, with each phylogenetic tree terminus, enzyme name, and set of activity results aligned along a radial axis. The enzymatic activity results for various substrates shown in these rings were measured by an in vitro screening assay with an Illumina short-read sequencing-based detection method (Example 3). Total area of the circles corresponds to total activity and the relative sizes of colored sectors show relative activity on the indicated substrates. The inner-most ring shows relative deamination activity on unmodified cytosines in double-stranded DNA (blue sectors) compared to single-stranded DNA (red sectors). The middle ring shows activity on 5-methylated cytosine in double-stranded DNA. The outermost ring shows activity on 5-hydroxymethylated cytosine in double-stranded DNA. Enzyme names are colored according to their phylogenetic family.

[0012] FIGS. 2A-C show enzymatic activity for cytosine deaminases assayed in accordance with the screening method of Example 3. Activities are expressed as deaminated fraction of total cytosines in the sample. FIG. 2A shows activity results for example deaminases on double stranded DNA vs. single stranded DNA. FIG. 2B shows activity results for example deaminases on unmodified cytosine in the CG context vs the CH (combination of CA, CC, and CT) context. FIG. 2C shows activity results for example deaminases on cytosine vs. 5-methylcytosine in all sequence contexts.

[0013] FIGS. 3A-3D shows example workflows for identifying the positions of modified cytosines in a DNA. FIG. 3A shows an example workflow of APOBEC3A deamination of ssDNA while FIGS. 3B, 3C, and 3D show example workflows in which APOBEC3A is substituted by a cytosine deaminase that deaminates dsDNA. FIG. 3B shows an example single pot workflow in which use of a dsDNA deaminase that is active on ssDNA and dsDNA eliminates a DNA denaturation step. As shown, a DNA deaminase can be added to a reaction mix following reactions with TET and BGT without intermediate clean up and denaturing steps thereby enhancing detection of target methylated sites on genomic DNA and methylome mapping. FIG. 3C shows an example workflow in which the substrate is contacted with a deaminase that does not deaminate 5fC or 5caC without requiring or including pre-treatment with BGT. FIG. 3D shows an example methylome analysis workflow in which the substrate is contacted with a single enzyme—a dsDNA deaminase.

[0014] FIGS. 4A-4C show example results of a workflow to detect 5mC and 5hmC that, like FIG. 3C, does not require or include a BGT glycosyltransferase pretreatment and the dsDNA deaminase used, CseDa01, does not deaminate 5caC and 5fC. FIG. 4A shows that CseDa01 DNA deaminase efficiently deaminates cytosine C, 5mC, 5hmC and 5ghmC in both single-stranded and double-stranded substrates. FIG. 4B shows that CseDa01 DNA deaminase exhibits no sequence bias and the deamination efficiencies were greater than 95% for both the CpG and CpH contexts in E. coli genome for both ssDNA and dsDNA substrates. FIG. 4C shows that CseDa01 DNA deaminase does not deaminate 5caC and 5fC and may be useful to detect 5mC and 5hmC without a BGT glucosylation step.

[0015] FIGS. 5A-5B show example results of using CseDa01 and TET2 to perform single tube oxidation of 5mC. The X-axis labels show serial dilutions of the deaminase, with 1× being the most concentrated enzyme, and 32× being a dilution by a factor of 32 compared to 1×. FIG. 5A shows results illustrating efficient deamination of a single-stranded substrate. FIG. 5B shows results illustrating efficient deamination of a double-stranded substrate.

[0016] FIGS. 6A-6B show example results of using MGYPDa20, a modification-sensitive deaminase to efficiently deaminate cytosines to uracil. However, it does not deaminate 5-methylcytosine and 5-hydroxymethylcytosine in dsDNA and ssDNA. This deaminase may be used to detect 5mC and 5hmC without the protection of these modified bases. FIG. 6A shows that MGYPDa20 DNA deaminase efficiently deaminates cytosine C but not 5mC, 5hmC or 5ghmC. FIG. 6B shows that MGYPDa20 DNA deaminase exhibits no sequence bias. The sequence logos were generated using the cytosine sites that have >=90% deamination efficiency in the E. coli genome.

[0017] FIGS. 7A-7B show example results of using another modification-sensitive dsDNA deaminase, NsDa01, which may be used to detect 5mC and 5hmC without the protection of modified bases. FIG. 7A shows that NsDa01 DNA deaminase efficiently deaminates cytosine C but not 5mC, 5hmC or 5ghmC. FIG. 7B shows that NsDa01 DNA deaminase exhibits no sequence bias. The sequence logos were generated using the cytosine sites that have >=90% deamination efficiency in the E. coli genome.

[0018] FIGS. 8A-8B show example results of using a CpG-specific modification-sensitive dsDNA deaminase, RhDa01, which may be used to detect 5mC and 5hmC in the CpG context with or without the protection of modified bases. FIG. 8A shows that RhDa01 DNA deaminase efficiently deaminates cytosine C in CpG context but not 5mC, 5hmC or 5ghmC. FIG. 8B shows that RhDa01 DNA deaminase exhibits CpG sequence specificity. The sequence logos were generated using the cytosine sites that have >=90% deamination efficiency in the E. coli genome.

[0019] FIGS. 9A-B shows example results of using a CpG-specific modification-sensitive dsDNA deaminase, MmgDa02, which may be used to detect 5mC and 5hmC in the CpG context with or without the protection of modified bases. FIG. 9A shows that MmgDa02 DNA deaminase efficiently deaminates cytosine C in CpG context but not 5mC, 5hmC or 5ghmC. FIG. 9B shows that MmgDa02 DNA deaminase exhibits a CpG sequence specificity. The sequence logos were generated using the cytosine sites that have >=90% deamination efficiency in the E. coli genome.

[0020] FIG. 10 shows example results of using a one-tube-one-enzyme EM-seq method to map 5mC in human using a modification-sensitive dsDNA deaminase, MGYPDa20. It shows that 5mC and 5hmC in the human GM12878 genome may be correctly detected using a modification-sensitive DNA deaminase MGYPDa20. Two types of adapters were used in these experiments,—all Cs were replaced by 5mC or Pyrrolo-dC. In both cases the overall methylation level in the human GM12878 genome was identified correctly.

[0021] FIGS. 11A-11B shows example results of using sequence logos of not deaminated sites by the CseDa01 deaminase from the N4mC-containing substrates of different genomes with different methyltransferase sequence specificities, namely Paenibacillus species JDR-2 (CCGG target sequence) and Salmonella enterica FDAARGOS_312 (CACCGT target sequence). Eukaryotic deaminase family of APOBEC3A deaminates N4mC, but bacterial deaminases do not, therefore, the newly characterized bacterial deaminases may be used to detect N4mC modifications. FIG. 11A shows that the detected N4mC motif matches the expected CCGG methyltransferase motif in Paenibacillus species JDR-2. FIG. 11B shows that the detected N4mC motif matches CACCGT from Salmonella enterica FDAARGOS_312.

DETAILED DESCRIPTION

[0022] The present disclosure provides double-stranded DNA deaminases, variants, ancestors, fusions, compositions, systems, apparatus, methods, and workflows for deaminating double-stranded DNA (in duplex form, without denaturation). Applications of these deaminases include, for example, EM-seq, methyl-SNP-seq, and N4mC detection, among others.

[0023] Aspects of the present disclosure can be understood in light of the provided descriptions, figures, sequences, embodiments, section headings, and examples, none of which should be construed as limiting the entire scope of the present disclosure in any way. Accordingly, the innovations set forth herein should be construed in view of the full breadth and spirit of the disclosure.

[0024] Each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the components and/or features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. Unless otherwise expressly stated to be required herein, each component, feature, and method step disclosed herein is optional and the disclosure contemplates embodiments in which each optional element may be expressly excluded.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Still, certain terms are defined herein with respect to embodiments of the disclosure and for the sake of clarity and ease of reference.

[0026] Sources of commonly understood terms and symbols may include: standard treatises and texts such as Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton, et al., Dictionary of Microbiology and Molecular biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) and the like.

[0027] As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. For example, the term “a protein” refers to one or more proteins, i.e., a single protein and multiple proteins. Optional elements may be expressly excluded where exclusive terminology is used, such as “solely,” “only”, in connection with the recitation of the optional elements or when a negative limitation is specified.

[0028] Numeric ranges are inclusive of the numbers defining the range. All numbers should be understood to encompass the midpoint of the integer above and below the integer i.e., the number 2 encompasses 1.5-2.5. The number 2.5 encompasses 2.45-2.55 etc. When sample numerical values are provided, each alone may represent an intermediate value in a range of values and together may represent the extremes of a range unless specified.

[0029] In the context of the present disclosure, “buffer” and “buffering agent” refer to a chemical entity or composition that itself resists and, when present in a solution, allows such solution to resist changes in pH when such solution is contacted with a chemical entity or composition having a higher or lower pH (e.g., an acid or alkali). Examples of suitable non-naturally occurring buffering agents that may be used in disclosed compositions, kits, and methods include HEPES, MES, MOPS, TAPS, tricine, and Tris. Additional examples of suitable buffering agents that may be used in disclosed compositions, kits, and methods include ACES, ADA, BES, Bicine, CAPS, carbonic acid/bicarbonic acid, CHES, citric acid, DIPSO, EPPS, histidine, MOPSO, phosphoric acid, PIPES, POPSO, TAPS, TAPSO, and triethanolamine.

[0030] In the context of the present disclosure, “deaminase substrate” refers to a polynucleotide (e.g., a DNA) molecule that optionally may be exclusively double-stranded, partially double-stranded and partially single-stranded, or exclusively single-stranded. A deaminase substrate may comprise one or more cytosines, one or more modified cytosines, one or more adenines, one or more modified adenines, or combinations thereof. A DNA substrate may comprise one or more adapters.

[0031] In the context of the present disclosure, “double-stranded DNA deaminase” refers to a hydrolyase that deaminates cytosines in double-stranded DNA to uracils and/or deaminates adenines in double-stranded DNA to hypoxanthines. A double-stranded DNA deaminase may deaminate cytosines and/or adenines in double-stranded DNA as well as or better than it deaminates cytosines and/or adenines, respectively, in single-stranded DNA. For example, a double-stranded DNA deaminase may deaminate cytosines double-stranded DNA, but not deaminate cytosines in single-stranded DNA. A double-stranded DNA may be modification sensitive. For example, a double-stranded DNA deaminase may deaminate an unmodified cytosine or adenine in double-stranded DNA, but not deaminate one or more corresponding modified cytosines or adenines.

[0032] In the context of the present disclosure, “duplex” and “double stranded” refer to any conformation of a polynucleotide in which two polynucleotide strands (e.g., separate molecules or spatially separated portions of a single molecule) are arranged anti parallel to one another in a helix with complementary bases of each strand paired with one another (e.g., in Watson-Crick base pairs). Paired bases may be stacked relative to one another to permit pi electrons of the bases to be shared.

[0033] Duplex stability, in part, may be related to the ratio of complementary bases to mismatches (if any) in the two strands, ratio of pairs with three hydrogen bonds (e.g., G:C) to pairs with two hydrogen bonds (e.g., A:T, A:U) in the duplex, and the length of the strands with higher ratios and longer strands generally associated with higher stability. Duplex stability, in part, may be related to ambient conditions including, for example, temperature, pH, salinity, and/or the presence, concentration and identity of any buffer(s), denaturant(s) (e.g., formamide), crowding agent(s) (e.g., PEG), detergent(s) (e.g., SDS), surfactant(s), polysaccharide(s) (e.g., dextran sulfate), chelator(s) (e.g., EDTA), and nucleic acid(s) (e.g., salmon sperm DNA). A duplex polynucleotide may comprise one or more unpaired bases including, for example, a mismatched base, a hairpin loop, a single-stranded (5′ and/or 3′) end.

[0034] Duplex polynucleotides (e.g., double-stranded DNA deaminase substrates) may have any desired length. For example, a duplex polynucleotide may have a length of 50 nucleotides, 10-200 nucleotides, 80-400 nucleotides, 50-500 nucleotides, ≤500 nucleotides, ≤1 kb, ≤2 kb, ≤5 kb or 10 kb. Duplex polynucleotides may have any desired number of mismatched or unpaired nucleotides, for example, ≤1 per 100 nucleotides, ≤2 per 100 nucleotides, ≤3 per 100 nucleotides, ≤5 per 100 nucleotides, or ≤10 per 100 nucleotides.

[0035] In the context of the present disclosure, “fusion protein” refers to a protein composed of two or more polypeptide components that are un-joined in their native state. Fusion proteins may be a combination of two, three or four or more different proteins. For example, a fusion protein may comprise two naturally occurring polypeptides that are not joined in their respective native states. A fusion protein may comprise two polypeptides, one of which is naturally occurring and the other of which is non-naturally occurring. The term polypeptide is not intended to be limited to a fusion of two heterologous amino acid sequences. A fusion protein may have one or more heterologous domains added to the N-terminus, C-terminus, and or the middle portion of the protein. If two parts of a fusion protein are “heterologous”, they are not part of the same protein in its natural state. Examples of fusion proteins include proteins comprising a double-stranded DNA deaminase fused to another enzyme (e.g., an endonuclease), an antibody, a binding domain suitable for immobilization such as maltose binding domain (MBP), a histidine tag (“His-tag”), a chitin binding domain, an alpha mating factor or a SNAP-Tag® (New England Biolabs, Ipswich, Mass. (see for example U.S. Pat. Nos. 7,939,284 and 7,888,090)), a DNA-binding domain, and/or albumin with the deaminase optionally positioned closer to the N-terminus or closer to the C-terminus than the other component(s). A binding peptide may be used to improve solubility or yield of the deaminase during the production of the protein reagent. Other examples of fusion proteins include fusions of a deaminase and a heterologous targeting sequence, a linker, an epitope tag, a detectable fusion partner, such as a fluorescent protein, β-galactosidase, luciferase and/or functionally similar peptides. Components of a fusion protein may be joined by one or more peptide bonds, disulfide linkages, and/or other covalent bonds.

[0036] In the context of the present disclosure, “modified cytosine” refers to any covalent modification of cytosine including naturally occurring and non-naturally occurring modifications. Modified cytosines include, for example, 1-methylcytosine (1mC), 2-O-methylcytosine (m2C), 3-ethylcytosine (e3C), 3,N.sup.4-ethylenocytosine (εC), 3-methylcytosine (3mC), 4-methylcytosine (4mC), 5-carboxylcytosine (5CaC), 5-formylcytosine (5fC), 5-hydroxymethylcytosine (5hmC), 5-methylcytosine (5mC), N.sup.4-methylcytosine (N4mC), and pyrrolo-cytosine (pyrrolo-C). Additional examples of modified nucleotides may be found at https://dnamod.hoffmanlab.org.

[0037] In the context of the present disclosure, “non-naturally occurring” refers to a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature. Such a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides polypeptides, carbohydrates, lipids, or compositions in one or more respects. For example, a polymer (e.g., a polynucleotide, polypeptide, or carbohydrate) may differ in the kind and arrangement of the component building blocks (e.g., nucleotide sequence, amino acid sequence, or sugar molecules). A polymer may differ from a naturally occurring polymer with respect to the molecule(s) to which it is linked. For example, a “non-naturally occurring” protein may differ from naturally occurring proteins in its secondary, tertiary, or quaternary structure, by having a chemical bond (e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others) to a polypeptide (e.g., a fusion protein), a lipid, a carbohydrate, or any other molecule. Similarly, a “non-naturally occurring” polynucleotide or nucleic acid may contain one or more other modifications (e.g., an added label or other moiety) to the 5′-end, the 3′ end, and/or between the 5′- and 3′-ends (e.g., methylation) of the nucleic acid. A “non-naturally occurring” composition may differ from naturally occurring compositions in one or more of the following respects: (a) having components that are not combined in nature; (b) having components in concentrations not found in nature; (c) omitting one or components otherwise found in naturally occurring compositions; (d) having a form not found in nature, e.g., dried, freeze dried, crystalline, aqueous; and (e) having one or more additional components beyond those found in nature (e.g., buffering agents, a detergent, a dye, a solvent or a preservative).

[0038] With reference to an amino acid, “position” refers to the place such amino acid occupies in the primary sequence of a peptide or polypeptide numbered from its amino terminus to its carboxy terminus. A position in one primary sequence may correspond to a position in a second primary sequence, for example, where the two positions are opposite one another when the two primary sequences are aligned using an alignment algorithm (e.g., BLAST (Journal of Molecular Biology. 215 (3): 403-410) using default parameters (e.g., expect threshold 0.05, word size 3, max matches in a query range 0, matrix BLOSUM62, Gap existence 11 extension 1, and conditional compositional score matrix adjustment) or custom parameters). An amino acid position in one sequence may correspond to a position within a functionally equivalent motif or structural motif that can be identified within one or more other sequence(s) in a database by alignment of the motifs. Analogously, with reference to a nucleotide, “position” refers to the place such nucleotide occupies in the nucleotide sequence of an oligonucleotide or polynucleotide numbered from its 5′ end to its 3′ end.

[0039] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Reagents referenced in this disclosure may be made using available materials and techniques, obtained from the indicated source, and/or obtained from New England Biolabs, Inc. (Ipswich, Mass.).

Double-Stranded DNA Deaminases

[0040] The present disclosure relates to naturally occurring and non-naturally occurring double-stranded DNA deaminases. A non-naturally occurring double-stranded DNA deaminase may relate to, but differ from, a naturally occurring protein. Naturally-occurring proteins often include a deaminase as a single domain of a larger, multi-domain structure with the deaminase domain positioned at the most C-terminal end. Non-naturally occurring double-stranded DNA deaminases may constitute truncated versions of a naturally-occurring protein, in which cases, the non-naturally occurring double-stranded DNA deaminases may have a high degree of identity to a portion of a naturally-occurring sequence, but lack, for example, structural and/or functional domains or sub-units of the corresponding naturally-occurring proteins. A non-naturally occurring double-stranded DNA deaminase may have any number of insertions, deletions, or substitutions relative to a naturally occurring enzyme. For example, a non-naturally occurring double-stranded DNA deaminase may have less than 100% identity, less than 99% identity, less than 98% identity, less than 90% identity, less than 85% identity, less than 80% identity, less than 70% identity, less than 60% identity, less than 50% identity, less than 40% identity, less than 30% identity, or less than 20% identity to a naturally occurring enzyme. Non-naturally occurring double-stranded DNA deaminases may include expression and/or purification tags. Non-naturally occurring double-stranded DNA deaminase disclosed herein may have an amino acid sequence that is at least 80% identical (e.g., at least 90% identical, at least 95% identical or at least 98% identical or at least 99% identical to) the C-terminal deaminase domain of a naturally-occurring protein, wherein the double-stranded DNA deaminase possesses a double-stranded DNA deaminase activity and does not comprise the N-terminus of the corresponding naturally-occurring protein (if any). In some embodiments, a non-naturally occurring double-stranded DNA deaminase lacks at least 10, at least 20, at least 50 or at least 100 of the N-terminal amino acids of the corresponding naturally-occurring protein. In some embodiments, a double-stranded DNA deaminase is no more than 300 amino acids in length, e.g., no more than 200 amino acids in length or no more than 150 amino acids in length.

[0041] According to some embodiments, a double-stranded DNA deaminase may comprise an amino acid sequence having at least 80%, at least 85%, at least 88% identical, at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of SEQ ID NOS: 1-152. In some embodiments, a double-stranded DNA deaminase may be encoded by a nucleic acid sequence that, when transcribed, translated, and/or processed, results in an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of SEQ ID NOS: 1-152. A double-stranded DNA deaminase may have an amino acid sequence at least 90% (e.g., at least 95%, at least 98%, at least 99%) identical to any of SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and/or 99. In some embodiments, a non-naturally occurring double-stranded DNA deaminase lacks the N-terminus of its corresponding naturally-occurring protein, for example, at least 10, at least 20, at least 50 or at least 100 of the N-terminal amino acids. Variants can be designed using sequence alignments and structural information. In some embodiments, a double-stranded DNA deaminase may contain a fragment of a wild type protein, where the fragment contains a deaminase domain, but lacks other domains of the wild type protein that may be C-terminal and/or N-terminal to the deaminase domain. Examples of non-naturally-occurring double-stranded DNA deaminases include SEQ ID NOS: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 24, 26, 27, 28, 33, 40, 49, 50, 63, 95, 96, 97, and/or 99.

[0042] In some embodiments, a double-stranded DNA deaminase may be a fusion protein. For example, a double-stranded DNA deaminase may have a purification tag (e.g., a His tag or the like) at either end. In some embodiments, a double-stranded DNA deaminase may be fused to a DNA binding protein (e.g., the DNA binding domain of a transcription factor) or the protein component of a nucleic acid-guided endonuclease (e.g., a catalytically dead Cas9 (dCas9) or a Cas9 nickase (nCas9) or TALEN (transcription activator-like effector nucleases)) so that the fusion protein can affect site-specific C to T substitutions in a genome. Example methods of “base editing” are described in, for example, Komor et al (Nature 533: 420-424), among other publications.

[0043] A double-stranded DNA deaminase optionally may deaminate cytosine, but not adenine (a “dsDNA cytosine deaminase”), deaminate adenine, but not cytosine (a “dsDNA adenine deaminase”), or deaminase both adenine and cytosine (appreciating that one may be a better substrate than the other under otherwise equivalent conditions). A double-stranded DNA deaminase may be modification sensitive. For example, a double-stranded DNA deaminase may deaminate cytosine, but not deaminate one or more modified cytosines in double stranded DNA. For example, a double-stranded DNA deaminase may deaminate cytosine, but not deaminate 5mC or N4mC or it may deaminate C and 5mC, but not 5hmC, 5ghmC or N4mC.

Double-Stranded DNA Deaminase Compositions

[0044] The present disclosure provides double-stranded DNA deaminase compositions including, for example, reaction mixtures. According to some embodiments, deaminase compositions may comprise (a) a double-stranded DNA deaminase and (b) a double-stranded DNA. A deaminase composition may comprise, for example, a deaminase variant (e.g., having an amino acid sequence at least 80% identical to one or more of SEQ ID NOS:1-152). A double-stranded DNA deaminase composition may be free of one or more other catalytic activities. For example, a double-stranded DNA deaminase composition may be free of nucleases that cleave dsDNA, free of nucleases that cleave ssDNA, free of polymerase activity, free of DNA modification activity, and/or free of protease activity, in each case, under desired test conditions (e.g., conditions of time, temperature, pH, salinity, model substrate and/or others), for example, conditions intended to replicate conditions of a specific use of the double-stranded DNA deaminase composition or intended to represent conditions for a range of uses.

[0045] In some embodiments, double-stranded DNA deaminases and compositions comprising one or more double-stranded DNA deaminase may have any desirable form including, for example, a liquid, a gel, a film, a powder, a cake, and/or any dried or lyophilized form. A double-stranded DNA deaminase composition may comprise a double-stranded DNA deaminase and a support or matrix, for example, a film, gel, fabric, or bead comprising, for example, a magnetic material, agarose, polystyrene, polyacrylamide, and/or chitin.

[0046] In some embodiments, a reaction mix may comprise: a double-stranded DNA substrate that comprises cytosines and a double-stranded DNA deaminase. A double-stranded DNA substrate may comprise cytosines and at least one modified cytosine, e.g., a 5fC, 5CaC, 5mC, 5hmC, N4mC or pyrrolo-C. A double-stranded DNA substrate may be eukaryotic DNA (e.g., plant or animal) or bacterial. In some embodiments, the double-stranded DNA substrate may be mammalian, e.g., from a human. In some embodiments, the double-stranded DNA substrate may be human cfDNA. The reaction mix may additionally comprise one or more of a TET methylcytosine dioxygenase (e.g., TET2) and a DNA beta-glucosyltransferase, as described herein and/or a ligase, a polymerase, a proteinase K, and/or a thermolabile proteinase K. A reaction mix may be free of unwinding agents (e.g., gyrases, topoisomerases, single-stranded DNA binding proteins, or helicases) and/or free of denaturants.

Double-Stranded DNA Deaminase Methods

[0047] The present disclosure provides methods for identifying the type and/or position of modified nucleotides in, for example, DNA using a deaminase. In some embodiments, a method may comprise providing a double-stranded DNA substrate of any desired length. For example, a double-stranded DNA substrate may have a length of 50 nucleotides, 10-200 nucleotides, 80-400 nucleotides, 50-500 nucleotides, ≤500 nucleotides, 1 kb, ≤2 kb, ≤5 kb or 10 kb. A double-stranded DNA substrate, in some embodiments, may be a fragment of genomic DNA, organelle DNA, cDNA, or other DNAs of interest and can be or arise from any desired source (e.g., human, non-human mammal, plants, insects, microbial, viral, or synthetic DNA). A DNA substrate may be prepared, in some embodiments by extracting (e.g., genomic DNA) from a biological sample and, optionally, fragmenting it. In some embodiments, fragmenting DNA may comprise mechanically fragmenting the DNA (e.g., by sonication, nebulization, or shearing) or enzymatically fragmenting the DNA (e.g., using a double stranded DNA “dsDNA” fragmentation mix. Examples of enzymes for fragmentation include NEBNext® Fragmentase®, Ultrashear, and FS systems (New England Biolabs, Ipswich Mass.)), among others. In some embodiments, DNA for deamination may already be fragmented (e.g., as is the case for FFPE samples and circulating cell-free DNA (cfDNA)).

[0048] According to some embodiment, a method may include polishing DNA ends (e.g., the ends of fragmented DNA). For example, DNA ends may be contacted with (a) a proofreading polymerase to excise 3′ overhanging nucleotides, if any, (b) a proofreading and/or non-proofreading polymerase to fill in 5′ overhangs, if any, and/or (c) a polynucleotide kinase (PNK) to phosphorylate unphosphorylated 5′ ends, if any. In some embodiments, a method may comprise contacting DNA ends (e.g., blunt ends) with a non-proofreading polymerase to add an untemplated A-tail (e.g., a single base overhang comprising adenine) to the 3′ end. Methods may include, according to some embodiments, ligating one or more adapters to DNA ends. Adapters may comprise one or more sample tags, unique molecular identifiers (UMIs), modified nucleotides, primer sequences (e.g., for sequencing). In some embodiments, adapters may comprise cytosines (or adenines) that are not substrates for the deaminase to be used. If desired, polishing products and/or ligation products may be cleaned up, for example, to separate polishing products or ligation products, as applicable, from enzymes, unreacted nucleotides and/or adapters.

[0049] In some embodiments, a method may comprise contacting (a) a deaminase substrate and (b) a glucosyltransferase (e.g., T4-BGT) and/or Ten-eleven translocation (TET) dioxygenase to produce a modified deaminase substrate. BGT may glucosylate 5hmC to form 5ghmC. TET may oxidize 5mC to 5caC. If subsequently treated with sodium bisulfite or Apolipoprotein B mRNA editing enzyme subunit 3A (APOBEC3A), all Cs except 5ghmC in the modified deaminase substrate would be deaminated. Deaminases disclosed herein may obviate the need to denature the DNA prior to deamination (e.g., with APOBEC3A) and may provide methylation sensitivities.

[0050] A method may comprise contacting a double-stranded DNA substrate that comprises cytosines and a double-stranded DNA deaminase to produce a deamination product that comprises deaminated cytosines. A double-stranded DNA substrate may further comprise one or more modified cytosines, e.g., one or more modified cytosines selected from 5fC, 5CaC, 5mC, 5hmC, N4mC and pyrrolo-C, 4mC, εC, 3mC, e3C, m2C, and 1mC. A double-stranded DNA deaminase substrate does not need to be denatured before or during deamination. As such, methods can be practiced in the absence of a denaturation step. In some embodiments, deamination methods may comprise contacting a double-stranded DNA substrate comprising cytosines and a double-stranded DNA deaminase to produce a reaction mix to produce a deamination product comprising deaminated cytosines.

[0051] Deamination methods may further comprise amplifying the deamination product to produce an amplification product, thereby copying any deaminated Cs in the original strand to Ts in the amplification product. Deamination methods may further comprise ligating an asymmetric (or “Y”) adapter, e.g., an Illumina P5/P7 adapter, onto the deamination product and amplifying the deaminated product using primers complementary to sequences in the adapter. In some embodiments, a method may comprise sequencing a deamination product, or amplifying a deamination product to produce amplification products and sequencing the amplification products, in each case, to produce sequence reads. Deamination products and/or amplification products may be sequenced using any suitable system including Illumina's reversible terminator method (see, e.g., Shendure et al, Science 2005 309: 1728). In some embodiments, a deaminated product may be sequenced directly, without amplification, for example, by nanopore or PacBio sequencing. A sequencing step may result in at least 10,000, at least 100,000, at least 500,000, at least 1M, at least 10M, at least 100M, at least 1B or at least 10B sequence reads per reaction. In some cases, the reads may be paired-end reads. A method may comprise analyzing sequence reads to identify a modified cytosine in the double-stranded DNA substrate, where a modified cytosine can be identified as a “C” because it is deaminase-resistant.

[0052] Double-stranded DNA deaminases that are “blocked” by or do not deaminate modified cytosines (e.g., 5mC, 5hmC, 5ghmC, N4mC) may be used in a variety of “EM-seq”-like workflows for the analysis of modified cytosines. Current implementations of EM-seq employ a deaminase that has a preference for single-stranded substrates. As such, the current EM-seq workflow has a denaturation step (see, e.g., FIG. 3A, Sun et al Genome Res. 2021 31: 291-300 and Vaisvila et al Genome Res. 2021 31: 1280-1289). In the present workflow, the denaturation step can be eliminated, thereby making EM-seq workflow faster and more efficient.

[0053] Workflows for example deamination methods are shown in FIGS. 3B-D. As illustrated in FIG. 3B, a double-stranded DNA substrate may be prepared by pre-treating a double-stranded DNA with a TET methylcytosine dioxygenase (e.g., TET2) and DNA beta-glucosyltransferase to convert the 5mC and 5hmC in the starting DNA to forms resistant to double-stranded DNA deaminases, e.g., the MGYPDa829, MGYPDa06, CrDa01, AvDa02, CsDa01, LbsDa01, FIDa01, MGYPDa26, MGYPDa23, chimera_10 and AncDa04. Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa829 (SEQ ID NO:96), MGYPDa06 (SEQ ID NO: 4), CrDa01 (SEQ ID NO: 12), AvDa02 (SEQ ID NO: 21), CsDa01 (SEQ ID NO: 9), LbsDa01 (SEQ ID NO: 10), FIDa01 (SEQ ID NO: 8), MGYPDa26 (SEQ ID NO: 7), MGYPDa23 (SEQ ID NO: 6), chimera_10 (SEQ ID NO: 97) and AncDa04 (SEQ ID NO: 95) double-stranded DNA deaminases. As illustrated, the double-stranded DNA deaminase can be added to the reaction without any clean-up, denaturation or addition of unwinding agents.

[0054] As illustrated in FIG. 3C, a double-stranded DNA substrate may be prepared by pre-treating a double-stranded DNA with a TET methylcytosine dioxygenase (e.g., TET2) but not DNA beta-glucosyltransferase to convert 5mC in the starting DNA to a form resistant to double-stranded DNA deaminases, e.g., the CseDa01 and LbDa02. Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of CseDa01 (SEQ ID NO: 3) and LbDa02 (SEQ ID NO: 1) double-stranded DNA deaminases. In this embodiment, the double-stranded DNA deaminase can be added to the reaction without any clean-up, denaturation or addition of unwinding agents.

[0055] As illustrated in FIG. 3D, a double-stranded nucleic acid may not be contacted with a TET methylcytosine dioxygenase nor a DNA beta-glucosyltransferase (nor any other enzyme that converts a modified cytosine to a form resistant to a selected double-stranded DNA deaminase) at any point in the workflow. For example, a selected double-stranded DNA deaminase may be blocked by 5-hydroxymethylcytosine and 5-methylcytosine. Double-stranded DNA deaminases useful in the illustrated workflow may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa20 (SEQ ID NO: 11), NsDa01 (SEQ ID NO: 27), and AshDa01 (SEQ ID NO: 40) double-stranded DNA deaminases.

[0056] In some embodiments, a double-stranded DNA substrate may comprise at least one N4mC (N4-methyl-cytosine) which is a cytosine modification that is resistant to some double-stranded DNA deaminases. Double-stranded DNA deaminases useful for detecting N4mC may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of SEQ ID NOS:1-28. For example, double-stranded DNA deaminases useful for detecting N4mC may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of CseDa01 (SEQ ID NO:3) and LbDa01 (SEQ ID NO:19) double-stranded DNA deaminases. In these embodiments, the double-stranded DNA substrate may be or comprise prokaryotic or archaeal DNA.

[0057] In some embodiments, the double-stranded DNA deaminase may be used in a “methyl-SNP-seq” workflow (see, e.g., Yan et al, Genome Res. 2022; gr.277080.122). For example, a method may comprise; (a) ligating a hairpin adapter to a double-stranded fragment of DNA to produce a ligation product, (b) enzymatically generating a free 3′ end in a double-stranded region of the hairpin adapter in the ligation product; and (c) extending the free 3′ end in a dCTP-free reaction mix that comprises a strand-displacing or nick-translating polymerase, dGTP, dATP, dTTP and modified dCTP to produce the double-stranded DNA substrate, as described in U.S. Provisional Application Ser. No. 63/399,970, filed on Aug. 22, 2022, which application is incorporated by reference herein. Examples of modified dCTPs include 5mdCTP, pyrrolo-dCTP, and N4mdCTP among other modified dCTPs that can be incorporated by a polymerase. Deaminases may have an amino acid sequence that is at least 90% identical to the amino acid sequence of any of MGYPDa20 (SEQ ID NO: 11), NsDa01 (SEQ ID NO: 27), AshDa01 (SEQ ID NO: 40).

[0058] According to some embodiments, a double-stranded DNA deaminase composition may comprise a double-stranded DNA deaminase and, optionally, any of (including one or more of) a buffering agent (e.g., a storage buffer, a reaction buffer), an excipient, a salt (e.g., NaCl, MgCl.sub.2, CaCl.sub.2), a protein (e.g., albumin, an enzyme), a stabilizer, a detergent (for example, ionic, non-ionic, and/or zwitterionic detergents (e.g., octoxinol, polysorbate 20)), a polynucleotide, a cell (e.g., intact, digested, or any cell-free extract), a biological fluid or secretion (e.g., mucus, pus), an aptamer, a crowding agent, a sugar (e.g., a mono, di, tri, tetra, or higher saccharide), a starch, cellulose, a glass-forming agent (e.g., for lyophilization), a lipid, an oil, aqueous media, a support (e.g., a bead) and/or (non-naturally occurring) combinations thereof. Combinations may include for example, two or more of the listed components (e.g., a salt and a buffer) or a plurality of a single listed component (e.g., two different salts or two different sugars). Examples of proteins that may be included in a double-stranded DNA deaminase composition include one or more enzymes that alter the deamination susceptibility of one or more modified cytosines (e.g., a TET methylcytosine dioxygenase and/or a DNA beta-glucosyltransferase).

Double-Stranded DNA Deaminase Kits

[0059] The present disclosure relates, in some embodiments, to a deaminase kit comprising a double-stranded DNA deaminase. A kit may comprise any of the components described herein. A double-stranded DNA deaminase composition or kit may include, for example, double-stranded DNA deaminase and, optionally, a storage buffer (e.g., comprising a buffering agent and comprising or lacking glycerol), and/or a reaction buffer. A reaction buffer for a deaminase composition or a deaminase kit may be in concentrated form, and the buffer may include one or more additives (e.g., glycerol), one or more salts (e.g. KCl), one or more reducing agents, EDTA, one or more detergents, one or more non-ionic surfactants, one or more ionic (e.g. anionic or zwitterionic) surfactants, and/or crowding agents. A kit comprising dNTPs may include one, two, three of all four of dATP, dTTP, dGTP and dCTP. A kit may further comprise one or more modified nucleotides.

[0060] One or more components of a kit may be included in one container for a single step reaction, or one or more components may be contained in one container, but separated from other components for sequential use or parallel use. For example, a kit may comprise two components in a single tube (e.g., a deaminase and a storage buffer) and all other components in separate, individual tubes, in each case, with the contents provided in any desired form (e.g., liquid, dried, lyophilized). One tube in a kit may contain a mastermix, for example, for receiving and amplifying a DNA (e.g., a deaminated DNA). For example, a double-stranded DNA deaminase may be deposited in the cap of a tube while components for transcribing a template nucleic acid are deposited in the body of the tube. As desired, for example, upon completion of the deamination reaction, the tube may be tapped, shaken, turned, spun, or otherwise moved to contact the deposited double-stranded DNA deaminase with the deamination reaction mixture. A kit may include a double-stranded DNA deaminase and the reaction buffer in a single tube or in different tubes and, if included in a single tube, the double-stranded DNA deaminase and the buffer may be present in the same or separate locations in the tube. For example, a kit may comprise a double-stranded DNA deaminase, as described above, and a reaction buffer (e.g., a 5× or 10× buffer). The contents of a kit may be formulated for use in a desired method or process. In some embodiments, the kit may further comprise (a) a TET methylcytosine dioxygenase (e.g., TET2) and a DNA beta-glucosyltransferase or (b) a TET methylcytosine dioxygenase and no DNA beta-glucosyltransferase. In some embodiments, a kit does not contain either a TET methylcytosine dioxygenase or DNA beta-glucosyltransferase. In some embodiments, a kit further comprises a modified dCTP selected from 5hmdCTP, 5fdCTP, 5cadCTP, 5mdCTP, pyrrolo-dCTP and N4mdCTP and/or a strand-displacing or nick translating polymerase. In some embodiments, a kit may additionally comprise a ligase, a polymerase, a proteinase K, and/or a thermolabile proteinase K. A double-stranded DNA deaminase may be lyophilized or in a buffered storage solution that contains glycerol.

[0061] As would be apparent to those having the benefit of the present disclosure, a double-stranded DNA deaminase may be used in a variety of genome analysis methods, particularly methods whose goal is to identify the position and/or identity of one or more modified cytosines and/or determine the methylation status of a cytosine. In other embodiments, a double-stranded DNA deaminase can be a component of a fusion protein for based editing, i.e., generating site-specific C to T substitutions in a genome.

Embodiments

[0062] The present disclosure further relates to embodiments disclosed in U.S. Provisional Application No. 63/264,513 including all of the following:

[0063] Embodiment 1. A polypeptide comprising at least 90% sequence identity with any of SEQ ID NOs: 1-8, not including 100% identity to SEQ ID NO: 3.

[0064] Embodiment 2. The polypeptide according to embodiment 1, comprising at least 90% sequence identity with any of SEQ ID NOs: 1-3 not including 100% identity to SEQ ID NO: 3.

[0065] Embodiment 3. The polypeptide according to embodiment 1, comprising at least 90% sequence identity with any of SEQ ID NOs: 1 or 2.

[0066] Embodiment 4. The polypeptide according to any of embodiments 1-3, capable of deaminating cytosine in double stranded DNA (dsDNA) with no sequence bias.

[0067] Embodiment 5. The polypeptide according to any of embodiments 1-3, capable of deaminating cytosine in single stranded DNA (ssDNA) with no sequence bias.

[0068] Embodiment 6. The polypeptide of any of embodiments 1-5, comprising a fusion protein.

[0069] Embodiment 7. The polypeptide of any of embodiments 1-6, wherein the polypeptide is lyophilized.

[0070] Embodiment 8. The polypeptide of any of embodiments 1-7, wherein the polypeptide is immobilized on a substrate.

[0071] Embodiment 9. The polypeptide of any of embodiments 1-8, wherein the polypeptide is combined with one or more reagents in a mixture wherein one or more reagents in the mixture comprises a second polypeptide.

[0072] Embodiment 10. The polypeptide of embodiment 9, wherein the second polypeptide is selected from the group consisting of a ligase, a polymerase, a methylcytosine (mC) dioxygenase, DNA glucosyltransferase, a Proteinase K, and a Thermolabile Proteinase K.

[0073] Embodiment 11. The polypeptide of any of embodiments 9-10, wherein the one or more reagents in the mixture further comprises a reversible inhibitor of the deaminase.

[0074] Embodiment 12. The polypeptide of any of embodiments 1-11, wherein the mixture further comprises DNA.

[0075] Embodiment 13. A method for methylome analysis comprising

[0076] (a) combining a reaction mixture containing genomic DNA with a double stranded DNA (dsDNA) deaminase having no sequence bias;

[0077] (b) deaminating at least 50% of the cytosine in the genomic DNA to uracil, without a denaturing step to convert dsDNA into single stranded (ssDNA).

[0078] Embodiment 14. The method according to embodiment 13, wherein prior to (a) adding to the reaction mixture, a methylcytosine (mC) dioxygenase to the genomic DNA for converting mC to hydroxymethylcytosine (hmC).

[0079] Embodiment 15. The method according to any of embodiments 13-14, wherein prior to (a) adding a hydroxymethylcytosine (hmC) modifying reagent to the reaction mixture.

[0080] Embodiment 16. The method according to any of embodiments 13-15, wherein (b) further comprises inactivating the DNA deaminase with a Proteinase K or Thermolabile Proteinase K.

[0081] Embodiment 17. The method according to any of embodiments 13-16, wherein (b) further comprises amplifying the DNA containing the converted cytosines.

[0082] Embodiment 18. The method according to any of embodiments 13-17, further comprising sequencing the amplified DNA.

[0083] Embodiment 19. The method according to any of embodiments 13-18, further comprising determining the location of methylcytosine (mC) in genomic DNA.

[0084] Embodiment 20. A kit comprising a deaminase capable of deaminating cytosine in double stranded DNA (dsDNA) and optionally single stranded DNA (ssDNA) with no sequence bias.

[0085] Embodiment 21. The kit according to embodiment 20, further comprising a methyl dioxygenase in a separate container from the dixoygenase.

[0086] Embodiment 22. The kit according to embodiment 20 or 21, further comprising a hydroxymethylcytosine (hmC) modifying enzyme in the same container with the dioxygenase or in a different container.

EXAMPLES

Example 1: Expression of DNA Deaminases In Vitro

[0087] Candidate DNA deaminase genes first were codon-optimized and then flanking sequences were added to each end, specifically, sequences containing T7 promoter at 5′ end and T7 terminator at 3′ end. These sequences were ordered as liner gBlocks from Integrated DNA Technologies (Coralville, Iowa, USA). Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase using gBlocks as template and flanking primers. The PCR products were purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, Mass., USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, Mass., USA). 100-400 ng PCR fragments were used as template DNA to synthesize analytic amounts of DNA deaminases using PURExpress In Vitro Protein Synthesis kit (New England Biolabs, Inc., Ipswich, Mass., USA) following manufacturer's recommendations.

Example 2: Deamination Assay on Single and Double Stranded Substrates

[0088] To test the activity of in vitro expressed DNA deaminases, a 2 μl aliquot of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate) or ΦX174 RF I DNA (dsDNA substrate) in buffer containing 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100 and incubated for 1 h at 37° C. The deaminated ΦX174 DNA was purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, Mass., USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, Mass., USA). 150 ng of deaminated DNAs were digested to nucleosides with the Nucleoside Digestion Mix (New England Biolabs, Inc., Ipswich, Mass., USA) following manufacturer's recommendations. LC-MS/MS analysis was performed by injecting digested DNAs on an Agilent 1290 Infinity II UHPLC equipped with a G7117A diode array detector and a 6495C triple quadrupole mass detector operating in the positive electrospray ionization mode (+ESI). UHPLC was carried out on a Waters XSelect HSS T3 XP column (2.1×100 mm, 2.5 μm) with a gradient mobile phase consisting of methanol and 10 mM aqueous ammonium acetate (pH 4.5). MS data acquisition was performed in the dynamic multiple reaction monitoring (DMRM) mode. Each nucleoside was identified in the extracted chromatogram associated with its specific MS/MS transition: dC [M+H].sup.+ at m/z 228.1.fwdarw.112.1; dU [M+H].sup.+ at m/z 229.1.fwdarw.113.1; d.sup.mC [M+H].sup.+ at m/z 242.14126.1; and dT [M+H].sup.+ at m/z 243.1.fwdarw.127.1. External calibration curves with known amounts of the nucleosides were used to calculate their ratios within the samples analyzed.

Example 3: NGS Deamination Assay

[0089] 50 ng of E. coli C2566 genomic DNA was combined with control modified DNA's:

TABLE-US-00001 DNA Modification DNA amount (ng) E. coli C2566 C 46.8 Lambda phage, dcm− C 1 XP12 phage 5mC 1 1783 bp PCR 5hmC 0.1 fragment amplified with 5hmdCTP T4 phage, AGT− 5ghmC 1 pRSSM1.Plell N4mC 0.1

DNA Prep

[0090] Then the DNA was transferred to a Covaris microTUBE (Covaris, Woburn, Mass., USA) and sheared to 300 bp using the Covaris S2 instrument. The 50 μl of sheared material was transferred to a PCR strip tube to begin library construction. NEBNext DNA Ultra II Reagents (New England Biolabs, Ipswich, Mass., USA) were used according to the manufacturer's instructions for end repair, A-tailing, and adaptor ligation using an Illumina-compatible adapter. The ligated samples were mixed with 110 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 17 μl of water.

Deamination

[0091] The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 μl of dsDNA deaminase synthesized as described above with an incubation time of 1 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. 5 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (New England Biolabs, Ipswich, Mass., USA) were added to the DNA and PCR amplified. The PCR reaction samples were mixed with 50 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 15 μl of water. The libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100. The whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2×75 bp) was performed for all the sequencing runs. Base calling and demultiplexing were carried out with the standard Illumina pipeline. Results of CseDa01 are shown in FIGS. 4A and 4B.

Example 4: 1-Tube-3-Enzyme EM-Seq (dsDNA Deaminase MGYPDa829+TET2+BGT)

[0092] 50 ng of NA12878 genomic DNA was combined with 0.1 ng of CpG methylated pUC19 and 1 ng of unmethylated lambda control DNA and made up to 50 μl with 5 mM Tris pH=8.0. DNA was prepared according to Example 3 and the library was eluted in 29 μl of water. DNA was oxidized in a 50 μl reaction volume containing 50 mM Tris HCl pH 8.0, 1 mM DTT, 5 mM Sodium-L-Ascorbate, 20 mM a-KG, 2 mM ATP, 50 mM Ammonium Iron (II) sulfate hexahydrate, 0.04 mM UDG-glucose (NEB, Ipswich, Mass.), 16 μg mTET2, 10 U T4-BGT (NEB, Ipswich, Mass.). The reaction was initiated by adding Fe (II) solution to a final reaction concentration of 40 μM and then incubated for 1 h at 37° C. The DNA was then deaminated, using 1 μl of MGYPDa829 dsDNA deaminase with an incubation time of 3 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. and 15 min at 60° C. At the end of the incubation, DNA was purified using 70 μl of resuspended NEBNext Sample Purification Beads according to the manufacturer's protocol. The sample was eluted in 16 μl water and 15 μl was transferred to a new tube. 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were added to the DNA and PCR amplified. The libraries were analyzed and quantified with an Agilent Bioanalyzer 2100 DNA analyzer. The whole-genome libraries were sequenced, and analyzed as described below.

[0093] Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads due to adapter/quality trimming were also removed during this process. The trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting (Langmead and Salzberg 2012). The aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75 bp) were removed because they are likely resulted from conversion errors. The numbers of T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C+# of T). FIG. 3C illustrates this workflow.

Example 5: CseDa01 DNA Deaminase does not Deaminate 5caC and 5fC

[0094] 1500 ng of oligonucleotides (ACACCCATCACATTTACAC(5caC)GGGAAAGAGTTGAATGTAGAGTTGG; SEQ ID NO: 157) or ACACCCATCACATTTACAC(5fC)GGGAAAGAGTTGAATGTAGAGTTGG; SEQ ID NO:158 with one modified cytosine (5caC or 5fC) were treated with CseDa01 DNA deaminase for 4 h in buffer containing 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100 and incubated for 1 h at 37° C. The deaminated oligonucleotides were purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, Mass., USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, Mass., USA). 1500 ng of deaminated DNAs were digested to nucleosides with the Nucleoside Digestion Mix (New England Biolabs, Inc., Ipswich, Mass., USA) following manufacturer's recommendations. UHPLC-MS analysis was performed using an Agilent 1290 Infinity II UHPLC equipped with G7117A Diode Array Detector and 6135 XT MS Detector, on a Waters XSelect HSS T3 XP column (2.1×100 mm, 2.5 μm) with the gradient mobile phase consisting of methanol and 10 mM ammonium acetate buffer (pH 4.5). The identity of each peak was confirmed by MS. The relative abundance of each nucleoside was determined by the integration of each peak at 260 nm or their respective UV absorption maxima. Results are shown in FIG. 4C.

Example 6: 1-Tube-2-Enzyme EM-Seq Using the dsDNA Deaminase CseDa01+TET2

[0095] 50 ng of NA12878 genomic DNA was combined with 0.1 ng of CpG methylated pUC19 and 1 ng of unmethylated lambda control DNA and made up to 50 μl with 5 mM Tris pH=8.0. DNA was prepared according to Example 3 and the library was eluted in 29 μl of water. DNA was oxidized in a 50 μl reaction volume containing 50 mM Tris HCl pH 8.0, 1 mM DTT, 5 mM Sodium-L-Ascorbate, 20 mM a-KG, 2 mM ATP, 50 mM Ammonium Iron (II) sulfate hexahydrate, and 16 μg mTET2. The reaction was initiated by adding Fe (II) solution to a final reaction concentration of 40 μM and then incubated for 1 h at 37° C. The DNA was then deaminated, using 1 μl of CseDa01 dsDNA deaminase with an incubation time of 3 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. and 15 min at 60° C. At the end of the incubation, DNA was purified using 70 μl of resuspended NEBNext Sample Purification Beads according to the manufacturer's protocol. The sample was eluted in 16 μl water and 15 μl was transferred to a new tube. 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were added to the DNA and PCR amplified. The libraries were analyzed and quantified with an Agilent Bioanalyzer 2100 DNA analyzer. The whole-genome libraries were sequenced, and analyzed as described below. Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads due to adapter/quality trimming were also removed during this process. The trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting (Langmead and Salzberg 2012). The aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75 bp) were removed because they are likely resulted from conversion errors. The numbers of T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C+# of T). FIG. 3C illustrates this workflow.

Example 7: DNA Deaminase CseDa01 Works Very Efficiently in the TET2 Buffer Allowing to Perform Single-Tube 5mC Oxidation and DNA Deamination Reactions

[0096] To test the activity of CseDa01 DNA deaminase in TET2 buffer a 2 μl of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate) or ΦX174 RF I DNA (dsDNA substrate) in buffer containing 50 mM Tris HCl pH 8.0, 1 mM DTT, 5 mM Sodium-L-Ascorbate, 20 mM a-KG, 2 mM ATP, 50 mM Ammonium Iron (II) sulfate hexahydrate, 0.04 mM, and incubated for 1 h at 37° C. The deaminated ΦX174 DNA was purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, Mass., USA). DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, Mass., USA). 150 ng of deaminated DNAs were digested to nucleosides with the Nucleoside Digestion Mix (New England Biolabs, Inc., Ipswich, Mass., USA) following manufacturer's recommendations. LC-MS/MS analysis was performed by injecting digested DNAs on an Agilent 1290 Infinity II UHPLC equipped with a G7117A diode array detector and a 6495C triple quadrupole mass detector operating in the positive electrospray ionization mode (+ESI). UHPLC was carried out on a Waters XSelect HSS T3 XP column (2.1×100 mm, 2.5 μm) with a gradient mobile phase consisting of methanol and 10 mM aqueous ammonium acetate (pH 4.5). MS data acquisition was performed in the dynamic multiple reaction monitoring (DMRM) mode. Each nucleoside was identified in the extracted chromatogram associated with its specific MS/MS transition: dC [M+H].sup.+ at m/z 228.1.fwdarw.112.1; dU [M+H].sup.+ at m/z 229.14113.1; d.sup.mC [M+H].sup.+ at m/z 242.14126.1; and dT [M+H].sup.+ at m/z 243.1.fwdarw.127.1. External calibration curves with known amounts of the nucleosides were used to calculate their ratios within the samples analyzed. Results are shown in FIGS. 4A, 4B, 4C, 5A, and 5B.

Example 8: Modification-Sensitive Deaminases Efficiently Deaminate Cytosines to Uracil, However, do not Deaminate 5-Methylcytosine and 5-Hydroxymethylcytosine in dsDNA and ssDNA

[0097] 50 ng of E. coli C2566 genomic DNA was combined with 2 ng unmethylated lambda, phage XP12 (all cytosines are 5-methylcytosines) and T4 phage DNA (all cytosines are 5-hydroxymethyl cytosines) control DNAs and made up to 50 μl with 10 mM Tris, pH 8.0. Then the DNA was prepared according to Example 3 with a sheared size of 240-290 bp and a library elution volume of 15 μl of water. The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 μl of a modification-sensitive dsDNA deaminase (e.g., MGYPDa20 or NsDa01) synthesized as described above with an incubation time of 1 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were added to the DNA and PCR amplified. The PCR reaction samples were mixed with 50 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 15 μl of water. The libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100. The whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2×75 bp) was performed for all the sequencing runs. Base calling and demultiplexing were carried out with the standard Illumina pipeline. Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads owing to adapter/quality trimming were also removed during this process. The trimmed read sequences were C-to-T converted and were then mapped to a composite reference sequence including the E. coli C2566 genome and the complete sequences of lambda, phage XP12, and T4 controls using the Bismark program with the default Bowtie 2 setting.

[0098] The first 5 bp at the 5′ end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded. Next deamination events (C->T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program. The 20 bp flanking sequences (10 bp upstream and 10 bp downstream) of all the covered cytosines from the individual genomes were then extracted and the cytosines sites were divided into different groups based on their deamination rates (>=90%, >=50%, >=25% or ≤=10%). Flanking sequences of each cytosine group were used to make sequence logo using WebLogo 3 to infer deamination sequence preference. Results are shown in FIGS. 6A and 6B for MGYPDa20, FIGS. 7A and 7B for NsDa01, FIGS. 8A and 8B for RhDa01_extN10, and FIGS. 9A and 9B for MmgDa02.

Example 9: Applying the 1-Tube-1-Enzyme EM-Seq Method to Map 5mC in Human Using a Modification-Sensitive dsDNA Deaminase MGYPDa20

[0099] 50 ng of NA12878 genomic DNA was combined with 0.1 ng of CpG methylated pUC19 and 1 ng of unmethylated lambda control DNA and made up to 50 μl with 5 mM Tris pH=8.0. DNA was prepared according to Example 3 and the library was eluted in 17 μl of molecular grade water. The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 μl of MGYPDa20 dsDNA deaminase with an incubation time of 3 hours at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. 5 μM of NEBNext Unique Dual Index Primers, 20 μM deaminated DNA and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were combined and PCR amplified. The PCR reaction samples were mixed with 50 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 15 μl of water. The libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100. The whole-genome libraries were sequenced using the Illumina NextSeq platform and analyzed as described below. Raw reads were first trimmed by the Trim Galore software to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads due to adapter/quality trimming were also removed during this process. The trimmed read sequences were C to T converted and were then mapped to a composite reference sequence including the human genome (GRCh38) and the complete sequences of lambda and pUC19 controls using the Bismark program with default Bowtie2 setting (Langmead and Salzberg 2012). The aligned reads were then subjected to two post-processing QC steps: 1, alignment pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded; 2, reads that aligned to the human genome and contained excessive cytosines in non-CpG context (e.g., more than 3 in 75 bp) were removed because they are likely resulted from conversion errors. The numbers of T's (converted not methylated) and C's (unconverted modified) of each covered cytosine position were then calculated from the remaining good quality alignments using Bismark methylation extractor, and the methylation level was calculated as # of C/(# of C+# of T). FIG. 3D illustrates this workflow. Results are shown in FIG. 10.

Example 10: Preparation of Methyl-SNP-Seq Library Using MGYPDa20 DNA Deaminase

[0100] For whole human genome methyl-SNP-seq sequencing 4 mg of NA12878 gDNA and 40 ng of unmethylated lambda DNA as spiked in to monitor the deamination efficiency were used. The genomic DNA was fragmented using 250 bp sonication protocol using a Covaris S2 sonicator. Two technical replicates were set up. The fragmented gDNA was end repaired and dA-tailed (NEB Ultra II E7546 module), then ligated to the custom hairpin adapter using NEB ligase master mix (NEB, M0367). The incomplete ligation product (fragment having only one or no adaptor ligated) was removed using two exonucleases (NEB exoIII and NEB exoVII). Two nick sites were created at the uracil positions in the hairpin adapters at both ends after being treated with UDG and EndoVIII. The nick sites were translated towards 3′ terminus by DNA polymerase I in the presence of dATP, dGTP, dTGP and 5-methyl-dCTP. The nick translation causes double stranded DNA break when DNA polymerase I encounters the other nick on the opposite strand. The resulting fragments have one end ligated to a hairpin adapter and blunt end on the other side. The blunt end was dA-tailed and ligated with methylated Illumina adapter. The ligated product was deaminated at 37° C. for 3 h with double stranded DNA deaminase MGYPDa20. The deaminated DNA product was amplified using NEBNext Q5U Master Mix (NEB, M0597). The resulting indexed library was used for Illumina sequencing. The human Methyl-SNP-seq libraries were sequenced using an Illumina Novaseq 6000 sequencer for 100 bp paired end reads.

Example 11: Detection of N4mC Modified DNA with CseDa01 dsDNA Deaminase

[0101] 50 ng of Paenibacillus species JDR-2 (CCGG target sequence) and Salmonella enterica FDAARGOS_312 (CACCGT target sequence) DNAs were combined with 0.1 ng of CpG methylated pUC19 and 1 ng of unmethylated lambda control DNA and made up to 50 μl with 5 mM Tris pH=8.0. DNA was prepared according to Example 3 with a sheared size of 240-290 bp and an elution volume of 15 μl of water. The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 μl of CseDa01 dsDNA deaminase synthesized as described above with an incubation time of 1 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were added to the DNA and PCR amplified. The PCR reaction samples were mixed with 50 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 15 μl of water. The libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100. The whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2×75 bp) was performed for all the sequencing runs. Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads owing to adapter/quality trimming were also removed during this process. The trimmed read sequences were C-to-T converted and were then mapped to the reference sequence and the complete sequences of lambda and pUC19 controls using the Bismark program with the default Bowtie 2 setting. The first 5 bp at the 5′ end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded. Next deamination events (C->T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program. An N4mC modified site is called when it is largely undeaminated (C->T conversion rate<=20%). The flanking 20 bp sequences of all the called N4mC sites were extracted and a sequence logo using WebLogo 3 was generated. Results are shown in FIGS. 11A and 11B.

Example 12: Detection of N4mC and 5mC Modified DNA with CseDa01 dsDNA Deaminase and MGYPDa20 dsDNA Deaminase

[0102] 50 ng of NEB1569 Thermus species M and NEB 394 Acinetobacter species H genomic DNAs was combined with 0.1 ng of CpG methylated pUC19 and 1 ng of unmethylated lambda control DNA and made up to 50 μl with 5 mM Tris pH=8.0. Then the DNA was prepared according to Example 3 with a sheared size of 240-290 bp and a library elution volume of 15 μl of water. The DNA was then deaminated in 50 mM Bis-Tris pH 6.0, 0.1% Triton X-100, using 1 μl of dsDNA deaminase synthesized as described above with an incubation time of 1 hour at 37° C. After deamination reaction, 1 μl of Thermolabile Proteinase K (P8111S, New England Biolabs, Ipswich, Mass.) was added and incubated additional 30 min at 37° C. 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, Mass.) were added to the DNA and PCR amplified. The PCR reaction samples were mixed with 50 μl of resuspended NEBNext Sample Purification Beads and cleaned up according to the manufacturer's instructions. The library was eluted in 15 μl of water. The libraries were analyzed and quantified by High sensitivity DNA analysis using a chip inserted into an Agilent Bioanalyzer 2100. The whole-genome libraries were sequenced using the Illumina NextSeq platform. Pair-end sequencing of 150 cycles (2×75 bp) was performed for all the sequencing runs. Base calling and demultiplexing were carried out with the standard Illumina pipeline. Raw reads were first trimmed by the Trim Galore to remove adapter sequences and low-quality bases from the 3′ end. Unpaired reads owing to adapter/quality trimming were also removed during this process. The trimmed read sequences were C-to-T converted and were then mapped to a composite reference sequence including the NEB1569 Thermus species M and NEB 394 Acinetobacter species H and the complete sequences of lambda and pUC19 controls using the Bismark program with the default Bowtie 2 setting. The first 5 bp at the 5′ end of R2 reads were removed to reduce end-repair errors and aligned read pairs that shared the same alignment start positions (5′ ends) were regarded as PCR duplicates and were discarded. Next deamination events (C->T) were called by comparing the remaining good alignment sequences to the reference sequences using Bismark methylation extractor program. The N4mC modification is called from the CseDa01 deaminase-treated library. An N4mC modified site is called when it is largely undeaminated (C->T conversion rate<=20%). For 5mC modification detection, a differential methylation analysis was conducted between the MGYPDa20 deaminase-treated library (detect both N4mC and 5mC) and the CseDa01 deaminase-treated library (detect only N4mC) of the same sample to identify modified sites (i.e., 5mC) that are only detected in the MGYPDa20 library. The differentially methylated sites were called by a logistic regression method with SLIM corrected Q value<=0.01, and methylation difference >=80% using the Methylkit program. To identify methyltransferase recognition sequences, the 9 bp flanking sequences were extracted, including 4 bp upstream and 4 bp downstream of all the modified sites, and the unique 9 bp sequences were clustered using a hierarchical linkage method based on the difference between each pair of sequences. A sequence logo was generated using WebLogo 3 for each cluster representing a distinct methyltransferase recognition motif.

Example 13: Candidate Selection

[0103] A list of HMMER3 (Eddy, S. R. Accelerated Profile HMM Searches. PLOS Comput. Biol. 7, e1002195 (2011)) cytosine deaminase sequence profiles was curated. 29 profiles came from the CDA clan (CL0109) from the Pfam (Mistry, J. et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 49, D412-D419 (2021)) database (excluding the TM1506, LpxI_C, FdhD-NarQ, and AICARFT_IMPCHas, which do not encode deaminases), 17 profiles were built from multiple sequence alignments (MSAs) of deaminase families defined by Iyer et al. (Nucleic Acids Res. 39, 9473-9497, 2011), and one profile was built from a multiple sequence alignment found in Zhang et al. (Biol. Direct 7, 18, 2012).

[0104] Some candidate sequences were selected directly from the MSAs listed in Iyer et al. (2011), and Zhang et al. (2012). Others were selected from hmmsearch hits of the profiles described above against six different databases: UniProt, Mgnify, IMG/VR, IMG/M, wastewater treatment plant metagenomes, and GenBank (respectively, The UniProt Consortium. UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49, D480-D489 (2021); Mitchell, A. L. et al. MGnify: the microbiome analysis resource in 2020. Nucleic Acids Res. 48, D570-D578 (2020); Paez-Espino, D. et al. IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses. Nucleic Acids Res. 45, gkw1030 (2017); Chen, I.-M. A. et al. The IMG/M data management and analysis system v.6.0: new tools and advanced capabilities. Nucleic Acids Res. 49, D751-D763 (2021); Singleton, C. M. et al. Connecting structure to function with the recovery of over 1000 high-quality metagenome-assembled genomes from activated sludge using long-read sequencing. Nat. Commun. 12, 2009 (2021); and Da, B. et al. GenBank. Nucleic Acids Res. 41, (2013)).

[0105] Most of the deaminases tested were found as fusions to larger proteins, for example as parts of polymorphic toxin systems. To determine the boundaries of the deaminase domain, AlphaFold2 (Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 1-11 (2021) doi:10.1038/s41586-021-03819-2) structural predictions were generated and visualized. N-terminal truncation sites were generally selected at several amino acids before helix 1 of the deaminase domain.

[0106] For convenience, each screened sequence was given a short name. The names are arbitrary, but relate somehow to the database or species of origin for the sequence. Da=deaminase, MGYP=Mgnify protein, Hm=hot metagenome, VR=IMG/VR, WWTP=waste water treatment plant, chimera=chimeric sequence, Anc=ancestral sequence reconstruction. Other prefixes are mostly two or three letters drawn from the name of the source organism or the source environment of the metagenome data. Some sequences also have prefixes or suffixes of the form extN #, extC #, d #, Cd #, which indicate, respectively, N-terminal extensions, C-terminal extensions, N-terminal deletions, and C-terminal deletions of the indicated number of residues, compared to the candidate with the un-affixed name.

[0107] Amino acid sequence alignments were all calculated using MAFFT (v7.490) (Katoh, K. & Standley, D. M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772-780 (2013)) using globalpair mode. Trees were generated using raxml-ng (v. 1.1)(Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35, 4453-4455 (2019)). Ancestral sequence reconstructions were built from phylogenetic trees using raxml-ng (v. 1.1).

Example 14: Summary Tables

[0108] Assay results for 29 deaminases are shown in Table 1 below, in which APOBEC3A (a single-stranded DNA deaminase) served as a negative control. The other 28 deaminases (double-stranded DNA deaminases) in the table all have significant activity on a double-stranded DNA substrate.

[0109] Double-stranded DNA deaminases disclosed herein may be used in many methods, processes, and workflows including, for example, the applications shown in Table 2 below. Deamination products may contain one or more modified cytosines, for example, where the substrate dsDNA included such modified cytosines and the operative deaminase does not or only poorly deaminases such modified cytosines. Each of the listed methods/applications may further comprise (a)(i) sequencing the deamination products and/or (ii) amplifying (e.g., by PCR) the deamination products to produce amplification products and sequencing the amplification products, in each of (a)(i) and (a)(ii), to produce sequence reads, and (b) optionally determining the kind and/or position of modified cytosines in the dsDNA substrate from the sequence reads.

[0110] Screening results for over 100 deaminases are shown in Table 3 below, in which APOBEC3A (a single-stranded DNA deaminase) served as a negative control. Many were observed to have double-stranded DNA deaminase activity under the conditions tested. Relatedness of the enzymes tested is illustrated in FIG. 1 and, in this light, deaminases that displayed limited or modest activity under the specific conditions tested may have higher activity under alternative or optimized conditions.

[0111] The names and SEQ ID NOS of certain double-stranded DNA deaminases disclosed herein are shown in Table 4 along with the corresponding names included in U.S. Provisional Application No. 63/264,513 filed Nov. 24, 2022.

TABLE-US-00002 TABLE 1 Name SEQ ID C:C_dsDNA C:C_ssDNA C:CG_dsDNA C:CH_dsDNA 5mC:C_dsDNA 5hmC:C_dsDNA AcDa01 49 0.243 0.566 0.790 0.014 0.180 0.053 AncDa04 95 0.992 0.998 0.985 0.995 0.929 0.733 AshDa01 40 0.342 0.623 0.699 0.193 0.010 0.005 AvDa02 2 0.998 1.000 1.000 0.998 0.979 0.763 BaDa01 24 0.612 0.718 0.632 0.603 0.104 0.041 BcDa02 15 0.772 0.746 0.863 0.734 0.069 0.028 chimera_10 97 0.950 0.995 0.954 0.949 0.671 0.676 CbDa01 50 0.240 0.668 0.760 0.022 0.089 0.059 CrDa01 12 0.811 0.952 0.786 0.821 0.135 0.310 CsDa01 9 0.913 0.783 0.896 0.920 0.180 0.084 CseDa01 3 0.998 0.984 0.998 0.998 0.999 0.981 d22_Cd4_PeDa01 99 0.641 0.602 0.800 0.575 0.541 0.506 d38_MGYPDa829 5 0.993 0.993 0.994 0.993 0.812 0.770 EcDa01 28 0.566 0.736 0.801 0.468 0.121 0.214 FlDa01 8 0.928 0.848 0.926 0.929 0.290 0.059 LbDa02 19 1.000 1.000 1.000 1.000 0.999 1.000 LbsDa01 10 0.889 0.872 0.889 0.889 0.328 0.216 MGYPDa01 16 0.748 0.845 0.885 0.691 0.578 0.330 MGYPDa06 4 0.997 0.984 0.996 0.998 0.961 0.782 MGYPDa16 14 0.780 0.901 0.894 0.732 0.211 0.339 MGYPDa20 11 0.857 0.785 0.924 0.829 0.049 0.021 MGYPDa23 6 0.935 0.923 0.994 0.911 0.383 0.275 MGYPDa26 7 0.929 0.860 0.952 0.919 0.109 0.040 MGYPDa829 96 0.956 0.952 0.954 0.957 0.517 0.326 MmgDa02 63 0.133 0.256 0.446 0.002 0.017 0.011 NsDa01 27 0.597 0.616 0.783 0.519 0.059 0.017 RaDa01 33 0.465 0.697 0.460 0.467 0.173 0.136 SaDa02 26 0.607 0.558 0.819 0.519 0.508 0.391 APOBEC3A (control) 154 0.331 0.995 0.333 0.330 0.058 0.006 Key: C:C_dsDNA: fraction of unmodified cytosines deaminated in double-stranded DNA C:C_ssDNA: fraction of unmodified cytosines deaminated in single-stranded DNA C:CG_dsDNA: fraction of unmodified cytosines in CpG context, deaminated in double-stranded DNA C:CH_dsDNA: fraction of unmodified cytosines followed by an adenine, cytosine, or thymine, deaminated in double-stranded DNA 5mC:C_dsDNA: fraction of cytosines with the 5-methyl modification, deaminated in double-stranded DNA. 5hmC:C_dsDNA: fraction of cytosines with the 5-hydroxymethyl modification, deaminated in double-stranded DNA.

TABLE-US-00003 TABLE 2 Deaminase Contacting (in one Deaminase No Applications specificity or more steps) properties Example deaminases 1 1-tube3- NCN A TET, a BGT, a High activity MGYPDa829, MGYPDa06, enzyme EM- deaminase on dsDNA, CrDa01, AvDa02, CsDa01, seq (dsDNA substrate, and a blocked by LbsDa01, FIDa01, deaminase + dsDNA deaminase 5ghmC MGYPDa26, MGYPDa23, TET + BGT) to produce chimera_10, AncDa04 deamination products comprising deaminated cytosines (uracils) and optionally 5ghmC 2 1-tube2- NCN A TET, a deaminase High activity CseDa01, LbDa02 enzyme EM- substrate, and a on dsDNA, seq (dsDNA dsDNA deaminase blocked by 5fC deaminase + to produce and 5CaC TET) deamination products comprising deaminated cytosines (uracils) and optionally 5fC and/or 5CaC 3 1-tube1- NCN A deaminase High activity MGYPDa20, NsDa01, enzyme EM- substrate and a on dsDNA, AshDa01 seq (dsDNA dsDNA deaminase blocked by modification to produce 5mC and sensitive deamination 5hmC deaminase) products comprising deaminated cytosines (uracils) and optionally 5mC and/or 5hmC 4 1-tube3- NCG A TET, a BGT, a High activity AncDa03, AcDa01, CbDa01, enzyme CpG- deaminase on dsDNA in RhDa01, MmgDa02, specific substrate, and a CpG context, AncDa06, AshDa01 deaminase EM- dsDNA deaminase blocked by seq(CpG- to produce 5ghmC specific dsDNA deamination deaminase + products comprising TET + BGT) deaminated cytosines (uracils) in CpG context and optionally 5ghmC 5 1-tube2- NCG ATET, a deaminase High activity AncDa03, AcDa01, CbDa01, enzyme CpG substrate (e.g., a on dsDNA in RhDa01, MmgDa02, specific EM-seq dsDNA), and a CpG context, AncDa06, AshDa01 (CpG-specific dsDNA deaminase blocked by 5fC dsDNA to produce and 5CaC deaminase + deamination TET) products comprising deaminated cytosines (uracils) in CpG context and optionally 5fC and/or 5CaC 6 1-tube1- NCG A deaminase High activity RhDa01, MmgDa02 enzyme CpG substrate (e.g., a on dsDNA in specific EM-seq dsDNA) and a CpG context, (CpG-specific dsDNA deaminase blocked by and to produce 5mC and modification- deamination 5hmC sensitive products comprising dsDNA deaminated deaminase) cytosines (uracils) in CpG context and optionally 5mC and/or 5hmC 7 N4mC NCN A deaminase High activity CseDa01, LbDa02 detection substrate (e.g., a on dsDNA of C dsDNA) and a and 5mC, dsDNA deaminase blocked by to produce N4mC deamination products comprising deaminated cytosines (uracils) and optionally N4mC 8 Detection of NCN (1) A deaminase 1.sup.st enzyme: Any enzyme from N4mC and 5mC substrate and a High activity Application 7 (N4mC (two enzymes, dsDNA deaminase on dsDNA of C detection) + two reactions) to produce and 5mC, Any enzyme from deamination blocked by Application 3 (One-enzyme products comprising N4mC EM-seq) deaminated 2.sup.nd enzyme: cytosines (uracils) High activity and optionally on dsDNA of C, N4mC; and blocked by (2) a deaminase 5mC and substrate and a N4mC (second) dsDNA deaminase to produce deamination products comprising deaminated cytosines (uracils) and optionally N4mC, 5mC and/or 5hmC 9 Simultaneous NCN A deaminase dsDNA MGYPDa829, Chimera_10, detection of substrate and a deaminase MGYPDa23, LbsDa01, N4mC and 5mC dsDNA deaminase with FIDa01 (one enzyme to produce differential on reaction) deamination activity on C products comprising and 5mC, and deaminated blocked by cytosines (uracils) N4mC and optionally 5mC and N4mC 10 Methyl-SNP- NCN A deaminase High activity Any enzyme from seq substrate and a on dsDNA, Application 3 (One-enzyme dsDNA deaminase blocked by EM-seq) to produce 5mC and deamination 5hmC products comprising deaminated cytosines (uracils) and optionally 5mC and 5hmC, wherein the dsDNA substrate is prepared by (1) ligating a hairpin adapter to a double-stranded fragment of DNA to produce a ligation product, (2) enzymatically generating a free 3′ end in a double- stranded region of the hairpin adapter in the ligation product; and (3) extending the free 3′ end in a dCTP- free reaction mix that comprises a strand-displacing or nick-translating polymerase, dGTP, dATP, dTTP and modified dCTP to produce the double-stranded DNA substrate 11 Base editing by ACN, GCN A fusion protein High activity MBO1351307, BaDa01, fusing dsDNA CCN, TCN, with a target on dsDNA with DddA, Chimera_17 cytosine etc. sequence to various (there are many more, deaminases produce an edited specificities almost any active enzyme) with the ZF or target sequence TALE-DNA comprising at least binding one deaminated modules cytosine or deaminated modified cytosine, wherein the fusion protein comprises a dsDNA deaminase fused to a ZF and/or TALE DNA binding module 12 Base editing by ACN, GCN A fusion protein High activity HcDa01, Chimera_01, fusing ssDNA CCN, TCN, with a target on ssDNA and SsDa01, MGYPDa13, cytosine etc. sequence to no/low activity d38_Cd11_MGYPDa829, deaminases produce an edited on dsDNA with HgmDa02, etc. with target sequence various catalytically comprising at least specificities inactivated one deaminated Cas9 cytosine or deaminated modified cytosine, wherein the fusion protein comprises a dsDNA deaminase fused to a catalytically inactivated type II-A Cas (e.g., Cas9) and optionally further comprising a guide RNA complementary to at least a portion of the targeted sequence 13 Heavily NCN A fusion protein High activity CseDa01, LbDa02 modified with a target on modified C jumbo phages sequence to base editing produce an edited target sequence comprising at least one deaminated cytosine or deaminated modified cytosine, wherein the fusion protein comprises a dsDNA deaminase fused to a ZF and/or TALE DNA binding module or the fusion protein comprises a dsDNA deaminase fused to a catalytically inactivated type II-A Cas (e.g., Cas9) and optionally further comprising a guide RNA complementary to at least a portion of the targeted sequence 14 Genome wide NCN A deaminase activity on HcDa01, Chimera_01, single- substrate (e.g., a ssDNA only SsDa01 stranded-DNA genomic DNA region substrate) and a detection (e.g., ssDNA deaminase, R-loop, stem- in non-denaturing loop structure) conditions 15 BisMapR NCN A dsDNA plus activity on Any enzyme from (strand-specific ssDNA substrate ssDNA only application 14 (Single- R-loop and a ssDNA stranded DNA mapping) detection deaminase, in non- method) denaturing conditions, to produce deamination products comprising deaminated cytosines (uracils) in ssDNA regions of the substrate 16 Screening for NCN A dsDNA substrate A combination CseDa01 + APOBEC3A novel cytosine or a dsDNA plus of deaminases modifications ssDNA substrate that and one or more deaminate all dsDNA or ssDNA the known deaminases to cytosine produce modifications deamination in all sequence products comprising context (e.g., deaminated CseDa01 + cytosines (uracils) APOBEC3A) and optionally modified cytosines 17 Mapping of NCN A dsDNA substrate Activity on CseDa01 chromatin from a eukaryotic dsDNA accessibility source and a dsDNA including Long- deaminase to range single- produce molecule deamination applications products comprising deaminated cytosines and/or deaminated modified cytosines in non-histone bound regions of the substrate, in conditions that preserve the histones and the natural DNA- histone contacts 18 Z-DNA mapping NCN A dsDNA plus Activity on CseDa01 ssDNA substrate dsDNA and a dsDNA deaminase, in non- denaturing conditions, to produce deamination products comprising deaminated cytosines and/or deaminated modified cytosines in non Z-form DNA regions of the substrate 19 Genome-wide NCN A dsDNA or a Activity on CseDa01, LbDa02, protein-DNA dsDNA plus a ssDNA dsDNA MGYPDa829, MGYPDa06, interaction site substrate and a CrDa01, AvDa02 mapping fusion protein comprising a dsDNA deaminase fused to any DNA binding protein to produce deamination products comprising deaminated cytosines and/or deaminated modified cytosines, in the bound regions of the DNA- binding protein. 20 Inactivation of NCN A deaminase Activity on Any enzyme from single stranded substrate (e.g., a ssDNA only, or application 14 (Single- DNA viruses ssDNA viral high activity stranded DNA mapping) (e.g., where a substrate) and one on ssDNA and plant variety or more ssDNA low activity on comprising a deaminases to dsDNA cytoplasmic produce ssDNA deamination deaminase is to products comprising be engineered deaminated to have innate cytosines and/or immunity) deaminated modified cytosines 21 Removing NCN (1) A deaminase Activity on Any enzyme from primers from substrate (e.g., a ssDNA only, or application 14 (Single- PCR reaction ssDNA substrate) high activity stranded DNA mapping) and one or more on ssDNA and (combined with USER ® ssDNA deaminases low activity on enzyme) to produce dsDNA deamination products comprising deaminated cytosines and/or deaminated modified cytosines in ssDNA regions (2) Deamination products with a uracil DNA glycosylase and an endonuclease VIII (e.g., USER ® Enzyme, M5505, NEB, Inc.) 22 Random NCN A deaminase Activity on CseDa01, LbDa02, mutagenesis substrate (e.g., dsDNA MGYPDa829, MGYPDa06, (C −> T) dsDNA or a dsDNA CrDa01, AvDa02 (all the plus ssDNA) and a non-specific dsDNA dsDNA deaminase deaminases) to produce deamination products comprising deaminated cytosines and/or deaminated modified cytosines randomly distributed in the substrate 23 EasyScreen ™ & NCN (1) A deaminase High activity CseDa01 3base ™ substrate (e.g., on dsDNA Technology genomic DNA with (Genetic a high GC content) Signatures) and a dsDNA deaminase to produce deamination products comprising deaminated cytosines (uracils) (2) the deamination products (or amplification products thereof) with a primer complementary to a target sequence comprising one or more of the deaminated cytosines 24 Making dsDNA NCN A dsDNA substrate Activity on CseDa01, LbDa02, deaminase and a dsDNA dsDNA MGYPDa829, MGYPDa06, converted deaminase to CrDa01, AvDa02 duplexes for produce (dsDNA deaminase creates the strand- deamination C > T transitions at unique specific products comprising positions in each strand. detection and deaminated Amplification of the (+) and quantification cytosines and/or (−) strands with primers that of rare deaminated are amplicon and strand- mutations modified cytosines specific allows for targeted that also include amplification and addition the positions of the of molecular barcodes; rare mutations. Mattox, Austin K., et al. “Bisulfite-converted duplexes for the strand- specific detection and quantification of rare mutations.” Proceedings of the National Academy of Sciences 114.18 (2017): 4733-4738.)

TABLE-US-00004 TABLE 3 SEQ ID paper name C:C_dsDNA C:C_ssDNA C:CG_dsDNA C:CH_dsDNA 5mC:C_dsDNA 5hmC:C_dsDNA 1 LbDa02 1.000 1.000 1.000 1.000 0.999 1.000 2 AvDa02 0.998 1.000 1.000 0.998 0.979 0.763 3 CseDa01 0.998 0.984 0.998 0.998 0.999 0.981 4 MGYPDa06 0.997 0.984 0.996 0.998 0.961 0.782 5 d38_MGYPDa829 0.993 0.993 0.994 0.993 0.812 0.770 6 MGYPDa23 0.935 0.923 0.994 0.911 0.383 0.275 7 MGYPDa26 0.929 0.860 0.952 0.919 0.109 0.040 8 FlDa01 0.928 0.848 0.926 0.929 0.290 0.059 9 CsDa01 0.913 0.783 0.896 0.920 0.180 0.084 10 LbsDa01 0.889 0.872 0.889 0.889 0.328 0.216 11 MGYPDa20 0.857 0.785 0.924 0.829 0.049 0.021 12 CrDa01 0.811 0.952 0.786 0.821 0.135 0.310 13 d22_PeDa01 0.785 0.572 0.883 0.744 0.735 0.639 14 MGYPDa16 0.780 0.901 0.894 0.732 0.211 0.339 15 BcDa02 0.772 0.746 0.863 0.734 0.069 0.028 16 MGYPDa01 0.748 0.845 0.885 0.691 0.578 0.330 17 PfDa01 0.701 0.972 0.694 0.704 0.323 0.641 18 PpDa03 0.685 0.618 0.855 0.613 0.269 0.121 19 LbDa01 0.670 0.972 0.540 0.725 0.402 0.373 20 MGYPDa10 0.637 0.973 0.612 0.647 0.183 0.183 21 AvDa01 0.636 0.703 0.703 0.607 0.201 0.132 22 PbDa01 0.636 0.813 0.680 0.617 0.106 0.016 23 PwDa01 0.621 0.562 0.817 0.538 0.229 0.093 24 BaDa01 0.612 0.718 0.632 0.603 0.104 0.041 25 PpDa04 0.609 0.535 0.748 0.551 0.036 0.015 26 SaDa02 0.607 0.558 0.819 0.519 0.508 0.391 27 NsDa01 0.597 0.616 0.783 0.519 0.059 0.017 28 EcDa01 0.566 0.736 0.801 0.468 0.121 0.214 29 HgDa01 0.559 0.942 0.388 0.631 0.271 0.324 153 BadTF3 0.539 0.527 0.656 0.490 0.399 0.311 30 AmDa01 0.534 0.515 0.734 0.450 0.396 0.375 31 MGYPDa408 0.497 0.707 0.458 0.514 0.300 0.320 32 SzDa01 0.471 0.528 0.458 0.477 0.188 0.105 33 RaDa01 0.465 0.697 0.460 0.467 0.173 0.136 34 MGYPDa624 0.448 0.900 0.415 0.462 0.137 0.093 35 EcDa04 0.427 0.403 0.645 0.335 0.284 0.189 36 BlDa01 0.419 0.406 0.600 0.344 0.036 0.012 37 d16_MGYPDa17 0.418 0.654 0.869 0.230 0.170 0.155 38 CgmDa01 0.402 0.962 0.634 0.306 0.137 0.103 39 NoDa01 0.359 0.856 0.232 0.416 0.196 0.333 40 AshDa01 0.342 0.623 0.699 0.193 0.010 0.005 41 MGYPDa18 0.331 0.688 0.437 0.287 0.051 0.017 154 APOBEC3A 0.331 0.995 0.333 0.330 0.058 0.006 42 MGYPDa687 0.315 0.558 0.320 0.313 0.258 0.185 43 PpDa02 0.305 0.254 0.474 0.235 0.136 0.145 44 MGYPDa03 0.294 0.300 0.486 0.214 0.254 0.093 155 DddA 0.266 0.240 0.258 0.270 0.081 0.100 45 LsfDa01 0.255 0.223 0.339 0.220 0.005 0.005 46 MGYPDa02 0.250 0.378 0.390 0.191 0.139 0.124 47 PvmDa01 0.243 0.330 0.481 0.144 0.062 0.045 58 MGYPDa917 0.243 0.442 0.253 0.239 0.206 0.137 49 AcDa01 0.243 0.566 0.790 0.014 0.180 0.053 50 CbDa01 0.240 0.668 0.760 0.022 0.089 0.059 51 HmDa03 0.238 0.289 0.370 0.184 0.164 0.157 52 WWTPDa05 0.221 0.063 0.309 0.185 0.171 0.096 53 d22_SjDa01 0.217 0.133 0.361 0.156 0.083 0.112 54 MGYPDa09 0.204 0.950 0.095 0.249 0.097 0.071 156 ssdA 0.203 0.469 0.161 0.220 0.102 0.057 55 MGYPDa05 0.201 0.442 0.539 0.059 0.058 0.029 56 VsDa01 0.199 0.094 0.206 0.196 0.023 0.007 57 BaDa02 0.195 0.107 0.291 0.155 0.018 0.005 58 HmDa02 0.174 0.171 0.320 0.113 0.078 0.046 59 SaDa03 0.164 0.515 0.275 0.118 0.113 0.031 60 PdDa01 0.152 0.495 0.254 0.109 0.003 0.003 61 BcDa01 0.151 0.093 0.257 0.107 0.069 0.039 62 DaDa01 0.149 0.684 0.328 0.074 0.024 0.005 63 MmgDa02 0.133 0.256 0.446 0.002 0.017 0.011 64 MGYPDa21 0.078 0.115 0.050 0.090 0.005 0.003 65 RhDa01 0.069 0.087 0.231 0.002 0.004 0.003 66 MsDa01 0.066 0.200 0.058 0.070 0.009 0.005 67 HgmDa01 0.064 0.160 0.212 0.002 0.004 0.003 68 XcDa01 0.054 0.155 0.001 0.076 0.022 0.007 69 AoDa01 0.049 0.185 0.042 0.052 0.009 0.008 70 HmDa01 0.041 0.090 0.102 0.015 0.022 0.015 71 HgmDa02 0.038 0.298 0.118 0.005 0.002 0.001 72 MGYPDa13 0.038 0.707 0.024 0.043 0.032 0.013 73 MGYPDa11 0.036 0.035 0.031 0.038 0.131 0.029 74 d36_PaDa02 0.032 0.243 0.021 0.037 0.003 0.002 75 BbDa01 0.031 0.144 0.031 0.031 0.004 0.003 76 PbDa02 0.027 0.211 0.062 0.013 0.002 0.002 77 PsDa01 0.015 0.046 0.010 0.017 0.047 0.016 78 AdDa01 0.013 0.034 0.041 0.001 0.005 0.002 79 KsDa01 0.011 0.025 0.026 0.005 0.002 0.003 80 VRDa06 0.010 0.005 0.021 0.006 0.002 0.004 81 ScDa03 0.009 0.149 0.012 0.008 0.004 0.008 82 WWTPDa04 0.004 0.126 0.008 0.002 0.001 0.002 83 CaDa01 0.002 0.002 0.006 0.000 0.000 0.001 84 SpDa01 0.002 0.001 0.004 0.001 0.000 0.001 85 MGYPDa14 0.001 0.048 0.001 0.001 0.003 0.002 86 AmDa03 0.001 0.087 0.001 0.001 0.000 0.001 87 xp12da 0.000 0.001 0.001 0.000 0.000 0.002 88 gp317 0.000 0.001 0.000 0.000 0.000 0.002 89 AbcDa01 0.000 0.000 0.000 0.000 0.000 0.001 90 WcDa01 0.000 0.000 0.000 0.000 0.000 0.001 91 XinDa01 0.000 0.004 0.000 0.000 0.000 0.001 92 XjaDa01 0.000 0.001 0.000 0.000 0.000 0.001 93 HcDa01 0.000 0.941 0.000 0.000 0.001 0.001 94 SsDa01 0.003 0.539 0.004 0.003 0.005 0.002 95 AncDa04 0.992 0.997 0.985 0.995 0.928 0.733 96 MGYPDa829 0.956 0.952 0.955 0.957 0.517 0.326 97 chimera_10 0.950 0.995 0.954 0.949 0.671 0.676 98 chimera_09 0.706 0.878 0.770 0.680 0.343 0.384 99 d22_Cd4_PeDa01 0.641 0.602 0.800 0.575 0.541 0.506 100 chimera_05 0.585 0.956 0.996 0.413 0.373 0.254 101 chimera_07 0.563 0.973 0.990 0.383 0.329 0.244 102 chimera_20 0.407 0.626 0.690 0.288 0.067 0.094 103 MGYPDa17 0.368 0.512 0.819 0.179 0.155 0.134 104 chimera_19 0.307 0.503 0.609 0.181 0.034 0.046 105 AncDa05 0.300 0.278 0.457 0.234 0.016 0.009 106 PeDa01 0.288 0.147 0.482 0.207 0.248 0.102 107 AncDa03 0.254 0.626 0.815 0.020 0.089 0.049 108 chimera_08 0.233 0.618 0.392 0.167 0.033 0.074 109 MGYPDa18_extN 0.197 0.271 0.303 0.153 0.022 0.007 110 chimera_18 0.159 0.314 0.426 0.048 0.015 0.013 111 d22_HmDa02 0.131 0.129 0.262 0.077 0.053 0.029 112 AncDa06 0.129 0.765 0.416 0.009 0.014 0.006 113 d41_MGYPDa917 0.128 0.332 0.144 0.122 0.103 0.042 114 RhDa01_extN10 0.095 0.145 0.319 0.001 0.007 0.005 115 d21_HcDa01 0.082 0.972 0.156 0.052 0.010 0.035 116 chimera_06 0.081 0.541 0.266 0.003 0.022 0.011 117 chimera_17 0.053 0.119 0.162 0.008 0.003 0.002 118 d38_Cd11_MGYPDa829 0.042 0.480 0.038 0.044 0.003 0.002 119 chimera_01 0.001 0.362 0.001 0.001 0.001 0.001 120 AncDa07 121 AncDa08 122 AncDa09 123 AncDa10 124 AncDa11 125 AncDa12 126 BpDa02 127 KsDa02 128 PaDa01 129 PaDa02 130 BsDa02 131 EcDa03 132 AsDa01 133 NgDa02 134 EcDa02 135 SrDa01 136 NgDa01 137 AmDa02 138 TuDa01 139 OlDa01 140 NpDa01 141 OTT-1508 142 BsDa01 143 PpDa01 144 SaDa01 145 CpDa01 146 ScDa01 147 BpDa01 148 ScDa02 149 SsDa02 150 KcDa01 151 PlDa01 152 BmDa01 Key: C:C_dsDNA: fraction of unmodified cytosines deaminated in double-stranded DNA C:C_ssDNA: fraction of unmodified cytosines deaminated in single-stranded DNA C:CG_dsDNA: fraction of unmodified cytosines in CpG context, deaminated in double-stranded DNA C:CH_dsDNA: fraction of unmodified cytosines followed by an adenine, cytosine, or thymine, deaminated in double-stranded DNA 5mC:C_dsDNA: fraction of cytosines with the 5-methyl modification, deaminated in double-stranded DNA. 5hmC:C_dsDNA: fraction of cytosines with the 5-hydroxymethyl modification, deaminated in double-stranded DNA.

TABLE-US-00005 TABLE 4 SEQ ID Current name Provisional name 5 d38_MGYPDa829 d38_MGYP001104162829 31 MGYPDa408 MGYP000983427408 34 MGYPDa624 MGYP001011623624 42 MGYPDa687 MGYP000859226687 48 MGYPDa917 MGYP000473187917 96 MGYPDa829 MGYP001104162829