Method of culturing segmented filamentous bacteria in vitro
11725183 · 2023-08-15
Assignee
- Institut Pasteur (Paris, FR)
- Fondation Imagine (Paris, FR)
- ASSISTANCE PUBLIQUE—HOPITAUX DE PARIS (Paris, FR)
- UNIVERSITE PARIS CITE (PARIS, FR)
- Institut National De La Sante Et De La Recherche Medicale (Inserm) (Paris, FR)
Inventors
- Gerard Eberl (Paris, FR)
- David Bikard (Paris, FR)
- Pamela Schnupf (Paris, FR)
- Nadine Cerf Bensussan (Paris, FR)
- Valerie Gaboriau-Routhiau (Clamart, FR)
- Philippe Sansonetti (Paris, FR)
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N13/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an in vitro method of culturing a segmented filamentous bacterium strain, comprising co-culturing said segmented filamentous bacterium strain with a eukaryotic host cell, wherein the culture is performed at an O.sub.2 level inferior to 5% in a rich tissue culture liquid medium containing bacterial medium components including iron. The present invention also relates to methods for genetically modifying a segmented filamentous bacterium strain comprising a step a culturing the strain in vitro.
Claims
1. A genetically modified segmented filamentous bacteria (SFB) strain expressing a foreign antigen of interest obtained from a microorganism or a cell different from a SFB.
2. The genetically modified SFB strain according to claim 1, wherein the SFB strain is in the form of a filament, an intracellular offspring or a spore.
3. The genetically modified SFB strain according to claim 1, wherein said foreign antigen of interest is obtained from a bacterium, a virus or a fungus organism.
4. The genetically modified SFB strain according to claim 3, wherein said foreign antigen of interest is obtained from mainly surface proteins of the diarrheal pathogens Shigella, enterotoxic Escherichia coli (ETEC) or attaching and effacing lesion (A/E)-inducing enteropathogenic E. coli (EPEC).
5. The genetically modified SFB strain according to claim 1, wherein said foreign antigen of interest is obtained from a tumor cell.
6. The genetically modified SFB strain according to claim 1, wherein said foreign antigen of interest elicits a Th17 response.
7. The genetically modified SFB strain according to claim 1, wherein the genetically modified SFB strain is obtained by co-culturing a SFB strain with a eukaryotic host cell at an O.sub.2 level of less than 5% in a rich tissue culture liquid medium comprising bacterial medium components and iron, and wherein the co-culture is performed until the SFB strain releases intracellular offspring or spores; and by genetically transforming the SFB strain by conjugation, electroporation or chemical transformation.
8. An immunogenic composition comprising the genetically modified SFB strain according to claim 1.
9. A method of treatment of a disease caused by a microorganism in a subject in need thereof comprising administering to said subject an effective amount of the genetically modified SFB strain of claim 1 expressing a foreign antigen of interest obtained from said microorganism.
10. The method according to claim 9, wherein said SFB strain is administered by oral ingestion or by parenteral administration.
11. A method of treatment of a cancer in a subject in need thereof comprising administering to said subject an effective amount of the genetically modified SFB strain of claim 1 expressing a foreign antigen of interest obtained from said cancer.
12. The method according to claim 11, wherein said SFB strain is administered by mucosal routes or by parenteral administration.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
EXAMPLE 1: GROWTH AND HOST INTERACTION OF MOUSE SEGMENTED FILAMENTOUS BACTERIA IN VITRO
(6) Materials and Methods
(7) Cell Culture and SFB-Specific Culture Medium
(8) TC7, CMT93, and HeLa cells were cultured in DMEM (Gibco 31885) with 10% inactivated fetal calf serum (FCS; AbCys CVFSVF00-0U) and non-essential amino acids (Invitrogen 11140-035). mICcl2 were maintained in DMEM/F12 advanced medium (Gibco 12634) with 2% inactivated FCS and Glutamax (Gibco 35050) and supplemented with 10 nM hEGF (Sigma E9644), 50 nM dexamethasone (Sigma D4902) and 1 nM triiodothyronine (Sigma T5516). HeLa cells were obtained from ATCC. All cell lines were tested for mycoplasma every 2 weeks and always found to be negative. Cells were plated either on regular 12-well tissue culture plates or on Costar transwell plates with 0.4-μm filters (Sigma CLS3460 and Fisher Scientific W2127P) from 1 to 3 days before the experiment such that a monolayer was present at the start of the experiment and added to a low oxygen chamber overnight for slowly lowering oxygen concentrations in the medium of the cells. At the start of SFB culturing, the TC7, CMT93, HeLa and mICcl2 medium is first replaced with (equilibrated: 1% oxygen) medium before SFB addition (directly to the TC7 cells).
(9) SFB medium was made up as follows: DMEM/F12 advanced medium with 2% FCS, Glutamax and 12.5 mM HEPES (Sigma H0887) with the following supplementation: 1 in 100 dilution of (1) brain—heart infusion (BD Difco 237500) 5× concentrated, (2) peptone/yeast (BBL Biosafe 211862) at 10% and casein amino acids at 5% (DIFCO 0320-01-1), (3) ribose/cellobiose/mannose (Sigma: R9629, C7252, M6020) at 200 mM; 1 in 1,000 dilution of (1) ferrous sulphate (Merck 3965) at 10 mM, (2) ferric ammonium citrate (LabGuard 0658) at 12.5 mM, (3) Hemin (Sigma 51280) at 1.5 mM in 50% ethanol with 1.4 N NH4OH, (4) sodium ascorbate at 10 mg ml.sup.−1 with 1-phosphoascorbate at 500 mM (Sigma: A4034, 49752); 1 in 10,000 dilution of retinoic acid (Sigma R2625) at 30 mg ml.sup.−1 in DMSO; 1 in 500 dilution of (1) sperm DNA (Life Technologies 15632-011) at 10 mg ml.sup.−1 digested for 1 h with 10 μl DNaseI (Roche 04 716 728 001) at 37° C. and heat inactivated at 75° C. for 30 min, (2) RNA at 10 mg ml.sup.−1 (Sigma R6750) undigested. SFB medium specific medium supplements, except for the nucleotides and hemin were prepared fresh every 2 weeks and otherwise stored at 4 or −20° C. for retinoic acid, and nucleotides. When mICcl2 cells were used, SFB medium was further supplemented with hEGF, dexamethasone, and triiodothyronine. Notably, additional supplementation with 0.2% yeast extract (BD 212750; 1/100 from 20%) further improves SFB growth and it is not necessary to add ascorbate, phosphoascorbate or hemin.
(10) Purification of Intracellular Offspring from SFB-Monoassociated Mice and Infection Protocol
(11) All liquids used for the isolation of intracellular offspring were pre-equilibrated overnight in an anaerobic chamber set to 0% oxygen. SFB-monoassociated JH.sup.−/− mice were killed aseptically in a tissue culture hood and then placed in an anaerobic cabinet for dissection. The ileal, caecal, and colonic contents were resuspended in 50 ml PBS and homogenized by vortexing. Homogenates were passed through a 100-μm mesh to remove large faecal debris. The filtrate was spun at 8,000 g for 5 min to pellet bacteria and insoluble material, and the pellet was resuspended in 3 ml PBS per mouse killed, layered onto 3 ml 50% and 2 ml 30% Nycodenz (AbCYS 1002424) solution made with PBS in 15 ml Falcon tubes and spun for 10 min at 4,000 g. SFB within the 30% fraction were collected, diluted in PBS, and bacteria were pelleted for 10 min at 8,500 g. Pellets were resuspended in 15 ml pre-equilibrated PBS by pipetting/vortexing and filtered through a 5-μm filter (Sigma Z612502). The filtrate was again centrifuged for 5 min at 8,000 g and the pellet was resuspended in an appropriate amount of pre-equilibrated culture medium. Usually one mouse was killed for every four 12-well plates used, and 50 μl of bacterial suspension was added to each well. To facilitate adhesion, cells challenged with SFB were sealed in ziplock bags within the cabinets, removed from the cabinet, and spun for 10 min at 300 g.
(12) SFB are allowed to grow in the presence of eukaryotic cells for 3 days during which the oxygen concentration is increased incrementally from 1% on day 0 to 1.5% on day 1, to 2% on day 2, and to 2.5% on day 3. Subcultures can be prepared on day 3 by taking aliquots of the culture supernatant and using this to challenge freshly prepared eukaryotic cells (prepared as described above on transwell filters and at low oxygen conditions).
(13) SFB Recovery, and Quantification and Analysis of SFB Growth
(14) To recover SFB, the culture supernatant was collected and centrifuged for 4 min at 8,000 g and the pellet was resuspended in 100 μl PBS, of which 20 μl was spotted on glass slides for the Gram stain, 30 μl was mixed with an equal volume of 50% glycerol and frozen at −80° C., and the remaining 50 μl was used for DNA extraction. The DNA was isolated with a Qiagen stool kit (51504; without the use of the inhibitor tablet) and diluted 1 in 20. SFB growth was enumerated by qPCR analysis of the 16S rRNA genes using the following primer pairs: the SFB specific F: 5′-AGGAGGAGTCTGCGGCACATTAGC-3′ (SEQ ID NO: 1); and the universal R: 5′-TCCCCACTGCTGCCTCCCGTAG-3′ (SEQ ID NO: 2). For qPCR, 6 μl of diluted SFB DNA was mixed with 1.5 μl of a 4 mM primer mix and 7.5 μl of Power SybrGreen Master mix (Applied 4368708) and run on an ABI 7900HT machine in a 384-well plate. Statistical analysis used a two-tailed Student's t-test (*P=<0.05, **P=<0.01, ***P=<0.001). SFB segment length analysis used ImageJ. For SEM analysis, SFB-containing supernatants were washed with PBS and suctioned onto 0.1-μm filters (Watman 110405) and fixed in 0.1 M cacodylate buffer containing 2.5% glutaraldehyde before being processed. Cells for SEM were fixed in PHEM buffer (18.14 g PIPES, 6.5 g HEPES, 3.8 g EGTA, 0.99 g MgSO4 per litre with 10 M KOH to pH 7.0) containing 4% sucrose and 2.5% glutaraldehyde, and processed for SEM. For fluorescence, cells were fixed in PBS/3.7% PFA, peimeabilized with PBS/0.1% Triton X-100, stained with DAPI and A568-phalloidin, and stacks of 0.4-μm slices were taken on a Leica SP5 confocal microscope.
(15) Colonization of Germ Free Mice with In Vitro-Grown SFB
(16) This experiment was done independently twice with similar results; one experiment is shown. SFB grown in vitro for 3 days on TC7 and mICcl2 cells on transwells were divided in equal parts and one half was filtered through a 5-μm filter to obtain a fraction containing intracellular offspring only. Bacteria were concentrated by centrifugation to obtain 0.25 ml of bacteria in PBS per mouse. The number of animals used followed availability of animals, isolators, and input quantities. Randomization or blinding was otherwise not performed. Two groups of four 11-week-old C57BL/6 male and female mice maintained at the germ-free facility were starved for one night, gavaged with 0.25 ml 400 mM sodium bicarbonate, followed by 0.25 ml of in vitro-grown SFB. Age-matched control mice were colonized with in vivo-derived SFB as described below. Faecal samples were collected for each mouse at various times during a 3 week period, SFB DNA was extracted using a Qiagen stool kit and quantified on the basis of qPCR analysis of 16S rDNA and comparison with a SFB DNA sample of known SFB genome concentration as determined by Illumina sequencing. To monitor SFB associated with the ileum, DNA was extracted from frozen ileal biopsies using the method in Godon et aL, 1997.
(17) Isolation and Staining of Lamina Propria Lymphocytes from C57BL/6 Mice
(18) Age-matched germ-free B6 mice and mice colonized with either in vitro- or in vivo-grown SFB for 3 weeks were analysed for their innate and adaptive immune response as described in Ivanov et al., 2009. Briefly, after excision of Peyer's patches, the mouse small intestine was washed in PBS, and ileal samples were placed in RNAlater for RNA extraction, complementary DNA (cDNA) synthesis, and qPCR analysis using SYBR or Taqman technologies (Applied Biosystems) and a QuantStudio7 qPCR machine. Values were normalized to TfrC.
(19) Lamina propria lymphocytes (LPL) were prepared as previously described by Gaboriau-Routhiau et al., 2009. The remaining small intestine was incubated four times in 60 ml of PBS-3 mM EDTA (Sigma) for 10 min at 37° C., and digested in 60 ml of RPMI 1640 with 20% FCS (Gibco), 100 U ml.sup.−1 collagenase (Sigma), and 175 U ml.sup.−1 DNase I (Sigma) for 40 min at 37° C. LPL were then purified on a 40-80% Percoll gradient run for 15 min at 2,000 g and resuspended in DMEMGlutamax with 8% FCS, 1 mM HEPES, 0.02 mM folic acid, 0.67 mM L-arginine, and 0.27 mM L-asparagine (all from Sigma).
(20) Analysis of LPL for surface antigens and intracellular expression of IL-17 and IL-10 was by flow cytometry as described 5. Briefly, LPL were stimulated for 4 h with 100 ng ml.sup.−1 phorbol 12-myristate 13-acetate and 1 μg ml.sup.−1 ionomycin, in the presence of Brefeldin A (10 μg ml.sup.−1) (all from Sigma). Cells used for surface analysis were left unstimulated. For surface staining, LPL were labelled for 20 min at 4° C. with a cocktail of the following antibodies: FITC-anti-GL7 (clone GL7), PerCP-anti-CD8a (clone 53-6.7), APC-H7-anti CD4 (clone GK1.5), AF647-anti-B220 (clone RA3-6B/2) (all from BD Pharmingen), PE-anti-IgA (Southern Biotech), and eFluor450-anti-CD45 (clone 30-F11) and PECy7-anti-CD3 (clone 145-2C11) (both from eBioscience).
(21) For intracellular cytokine staining, cells were further fixed in 2% PFA for 20 min at room temperature (—24° C.), and washed and stained overnight at 4° C. with PE-anti-IL-17 (clone TC11-18H10) and APC-anti-IL-10 (clone JES5-16E3) (BD Pharmingen) diluted in PBS-1% FCS-0.5% saponin (Sigma). Labelled cells were analysed with a FACSCanto II and FACSDiva software (BD Biosciences). Gates were set on living cells after Aqua live/dead dye exclusion (Invitrogen).
(22) For qPCR analysis, the median value of germ-free mice was calculated and used as the reference value of 1 for comparison of the median value of the test samples.
(23) Colonization of Germ-Free Mice with SFB From Faeces and E. coli
(24) Germ-free male and female C3H/HeN mice were obtained from INRA (ANAXEM platform) germ-free facilities. Eight- to nine-week-old germ-free mice were gavaged with 0.5 ml of either fresh anaerobic cultures of E. coli MG1655 or faecal homogenate from SFB monoassociated mice (Ivanov et al., 2009). Colonization by SFB was monitored in faeces through bacterial DNA extraction and 16S rDNA amplification by qPCR using specific primer pairs for SFB. Values were normalized to Ccl25, a constitutively expressed epithelial cell marker, and compared with the median value from germ-free control mice. Germ-free and gnotobiotic mice were maintained in plastic isolators and fed ad libitum on a commercial diet sterilized by γ-irradiation (40 kGy). The numbers of animals used followed availability of animals, isolators, and were obtained from two independent experiments. Randomization or blinding was otherwise not performed. Gnotobiotic mice were killed on day 21 after colonization in parallel with age-matched germ-free controls. All animal procedures were performed in accordance with French legislation and EEC regulations for the care and use of laboratory animals, approved by the local ethics committee and authorized by the French Ministry of Research.
(25) Host Response In Vitro to SFB Growth and MAMP Stimulation
(26) Host response to SFB and MAMPs included pooled results from four independent experiments with three technical samples. Generally a minimum of triplicate biological replicates were used and increased if trends were clear but significance not. After 3 days of in vitro growth of SFB on either mICcl2 or TC7 cells on transwells in SFB medium lacking hemin and sodium ascorbate, at 1-2.5% oxygen, cells were lysed and RNA was extracted using a Nucleospin RNA kit (Macherey-Nagel). cDNA was synthesized using RNA superscript II, oligo dT, RNaseout, and dNTPs (Invitrogen), and pPCR was performed on an ABI 7900HT and QuantStudio7 (Life Technologies) qPCR machine using the protocol described by Schnupf et al., 2012. TaqMan assays were performed as suggested by the supplier. Values were normalized to B2M and Ct values for Reg3γ, Tnfα, and Fabp2 were set to 41 in control cells owing to the lack of transcript detection. MAMP stimulation used the following agonists at the highest concentrations recommended by the supplier (Invivogen): Pam2CSK4 (tlrlpm2 s-1) at 100 ng ml.sup.−1, Pam3CSK4 (tlrl-pms) at 300 ng ml.sup.−1, peptidoglycan of E. coli K12 (Tlr-ksspgn) at 10 μg ml.sup.−1, MDP (tlrl-mdp) at 10 μg ml.sup.−1, CpG (tlr-1584) at 3 μg ml.sup.−1, flagellin (tlrl-pstfla-5) at 100 ng ml.sup.−1. Excess for flagellin (10×) was also tested and found to be similar.
(27) Mouse and Human qPCR Primers Used
(28) Mouse Taqman® Assays:
(29) B2M Mm00437762_m1, TfrC Mm00441941_m1, Ccl25 Mm00436443_m1, Fabp2 Mm00433188_m1, Reg3g Mm01181783_g1, Fut2 Mm00490152_S1, Aqp3 Mm01208559_m1, Pigr Mm00465049_m1, Ltf Mm00434787_m1, Tff3 Mm00495590_m1, Tnfa Mm00443258_m1, IL1a Mm00439620_m1, IL1b Mm00434228_m1, IL6 Mm00446190_m1, IL15 Mm00434210_m1, IL18 Mm00434225_m1, Cxcl2 Mm00436450_m1, Ccl2 Mm00436450_m1, Ccl5 Mm01302428_m1, Ccl7 Mm01308393_g1, Ccl20 Mm01268754_m1, Ccl28 Mm00445039_m1, Csf2 Mm01290062_m1
(30) Mouse Sybr® Primers
(31) TABLE-US-00001 B2M: F: (SEQ ID NO: 3) tcagtcgtcagcatggctcgc; R: (SEQ ID NO: 4) tccggtgggtggcgtgagtatac iNos: F: (SEQ ID NO: 5) cagctgggctgtacaaacctt; R: (SEQ ID NO: 6) cattggaagtgaagcgtttcg Saa1: F: (SEQ ID NO: 7) catttgttcacgaggcatcc; R: (SEQ ID NO: 8) gtttttccagttagcttccttcatgt Saa2: F: (SEQ ID NO: 9) tgtgtatcccacaaggtttcaga; R: (SEQ ID NO: 10) ttattaccctctcctcctcaagca Saa3: F: (SEQ ID NO: 11) cgcagcacgagcaggat; R: (SEQ ID NO: 12) ccaggatcaagatgcaaagaatg Cxcl1: F: (SEQ ID NO: 13) tggctgggattcacctcaag; R: (SEQ ID NO: 14) caagcctcgcgaccattct Cxcl10: F: (SEQ ID NO: 15) gccgtcattttctgcctcat; R: (SEQ ID NO: 16) gcttccctatgcccctcatt
(32) Human Taqman® Assays:
(33) B2M Hs00984230_m1, Saa1 Hs00761940_s1, Saa2 Hs01667582_m1, IL6 Hs00985639_m1, IL8 Hs99999034_m1, Ccl20 Hs01011368_m1, Reg3g Hs00417999_m1, iNos Hs01075529_m1, Cxcl10 Hs00171042_m1, Fut2 Hs00382834_m1, IL15 Hs01003716_m1, IL18 Hs01038788_m1, Ccl5 Hs00982282_m1
(34) Results
(35) SFB—Host Cell Co-Culturing System
(36) SFB strain (Bolotin et al., 2014) isolated from monoassociated mice was deposited at CNCM (Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, Paris) on Dec. 23, 2014, under the accession number CNCM 1-4932 (Arthromitus muris strain referred to as SFB-mouse-NL). SFB were cultured with eukaryotic cells grown in low but physiological oxygen conditions (He et al., 1999) in a rich tissue culture medium containing bacterial medium components and additional supplements. SFB from monoassociated mice were collected, filtered through a 100-μm mesh, separated from most other faecal matter using a Nycodenz column and passed through a 5-μm filter to obtain a pure culture of unicellular intracellular offspring (average 0.7 μm) (
(37) Growth Requirements for SFB
(38) SFB growth had a striking dependence on host cell number, decreasing in number with decreasing cell density (
(39) In the 1970s, transmission electron microscopy studies of SFB present in the murine gut led to a proposed life cycle: attachment to epithelial cells via the holdfast at the intracellular offspring tip leads to filamentous growth and is followed by a complex developmental progression that starts at the distal tip and ultimately leads to intracellular offspring formation and release (
(40) In vitro, growth of SFB on TC7 cells often yielded considerable quantities of long filaments that could be clumped together in a hairball-like phenotype easily seen with the naked eye (
(41) Viability and Infectivity of In Vitro Formed Intracellular Offspring
(42) SFB were first grown on TC7 cells under aerobic conditions (
(43) SFB—Host Interaction and the Host Response to SFB Growth.
(44) Despite the apparent requirement for close contact between host cells and SFB for efficient growth, a tight interaction was not readily observed. However, when the interaction was promoted by gently spinning intracellular offspring onto cells, SFB filaments were found attached to mICcl2 cells (
Conclusion
(45) These data demonstrate the successful culturing of SFB in vitro and provide new insights into SFB growth requirements and the host response to SFB challenge. These data suggest that in vivo, attachment of SFB to the ileal surface is an important feature to elicit epithelial cell responses, whereas in vitro, where attachment remained infrequent, the close proximity of SFB and cells appears largely to bypass the need for attachment to deliver the stimulating signal(s). These findings highlight the importance of the privileged location of the replicative niche of SFB at the ileal epithelial surface in mediating the stimulatory potential of SFB.
EXAMPLE 2: METHODS FOR GENETICALLY MODIFYING A SFB STRAIN
(46) A series of modular shuttle vectors designed for use in Clostridia species (Heap et al., 2009) are tested for their ability to be stably introduced into SFB during in vitro growth using both conjugation and transformation. Each plasmid contains a different origin of replication with a choice of antibiotic resistance cassettes, multiple cloning sites and promoters. Conjugation and transformation are performed during in vitro growth of SFB.
(47) Conjugation
(48) An auxotrophic E. coli strain requiring the addition of Diaminopimelic acid to the medium for growth is used as a donor strain as this strain can be easily selected against in rich medium with the absence of diaminopimelic acid.
(49) SFB strain is purified from monoassociated mice as described above and intracellular offsprings (IOs) are added to host cells (TC7 cells) grown on either tissue culture or transwell plates under conditions described for SFB growth above.
(50) After substantial growth has occurred (2-4 days), diaminopimelic acid (100 ug/ml) and the donor E. coli strain (requiring dap addition for growth and carrying a plasmid) is added and centrifuged together with cells and SFB and maintained for a given time (e.g., 4-8 hours).
(51) Alternatively, in vitro grown (cultured) SFB are collected and mixed with the aforementioned E. coli strain and pelleted (all under low oxygen) and maintained in a pellet for varying amounts of time (e.g., 4-8 hours).
(52) Bacteria are collected and washed 2× with regular SFB growth medium lacking diaminopimelic acid before being put on fresh eukaryotic cells (always at low oxygen) with regular SFB medium but complemented with the appropriate antibiotic to which the conjugal plasmid gives SFB resistance to.
(53) After a given time (0-24 hours), SFV are collected and gavaged into germfree mice.
(54) Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water. The optimal and minimal regime of antibiotic use in the drinking water that is needed to cure SFB monoassociated mice from SFB is determined prior and used to select for recombinant SFB.
(55) Transformation by Electroporation
(56) As described above, SFB are grown (cultured) in vitro for 2-4 days on TC7 cells.
(57) SFB are collected and put on ice. Under low oxygen conditions and working with solutions put on ice, SFB are washed 6×with 10% glycerol/pre-equilibrated water before being resuspended and concentrated with 10% glycerol/H2O.
(58) Purified plasmid DNA is added and SFB is electroporated (6.5 kV.Math.cm.sup.−1 to 25 kV.Math.cm.sup.−1).
(59) SFB are placed in regular SFB medium again and spun onto fresh cells. SFB are allowed to recover for 3-24 hours before selective antibiotic be added overnight.
(60) SFB are gavaged into GF mice.
(61) Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water.
(62) Transformation by the Chemical Method: Calcium Chloride and Heat Shock
(63) As described above, SFB are grown in vitro for 2-4 days on TC7 cells.
(64) SFB are collected and put on ice. Under low oxygen conditions and working with solutions put on ice, SFB are washed 5×with 0.1M calcium chloride before being resuspended and concentrated with 10% glycerol/0.1M calcium chloride.
(65) Purified plasmid DNA is added to SFB and incubated for 30 minutes.
(66) SFB are heat shocked at 42° C. for 30 seconds before being placed in regular SFB medium again and spun onto fresh cells. SFB are allowed to recover for 3-24 hours before selective antibiotic be added overnight.
(67) SFB are gavaged into GF mice.
(68) Alternatively, the above procedure may be performed at room temperature only without heat shock.
(69) Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water.
REFERENCES
(70) Bolotin, A. et a, Genome Announc. 2, 1-2 (2014). Chappert, P. et al., Immunity 38, 1198-1210 (2013). Chase, D. G. & Erlandsen, S. L., J Bacteria 127, 572-583 (1976). Danchin A., Molec. gen. Genet. 150, 293-299 (1977). Davis, C. P. and Savage, D. C., Infection and Immunity 13, 180-188 (1976). Ericsson, A. C., et al., Comparative Medicine, 64, 90-98 (2014). Ferguson, D. J. & Birch-Andersen, A., Acta Pathol. Microbiol. Scand. B 87, 247-252 (1979). Ferreira, P. C. D. et al., FEMS Immunol Med Microbiol. 54, 245-254 (2008). Ferreira, P. C. D. et al., Clinical and Vaccine Immunology 18, 1823-1833 (2011). Fleckenstein, J. et al., Expert Review of Vaccines 13, 631-639 (2014). Gaboriau-Routhiau, V. et al. Immunity 31, 677-689 (2009). Ghaem-Maghami, M. et al., Infect. Immun. 69, 5597-5605 (2001). Godon, J. J. et al., Appl. Environ. Microbiol. 63, 2802-2813 (1997). Goto, Y. et al., Science 345, 1254009 (2014). He, G. et al., Proc. Natl Acad. Sci. USA 96, 4586-4591 (1999). Heap, J. T., et al., J Microbiol. Methods, 78, 79-85 (2009). Heine, S. J. et al., Vaccine 31, 2919-2929 (2013). Ivanov, I. I. et al., Cell 139, 485-498 (2009). Jepson, M. A. et al., Infect. Immun. 61, 4001-4004 (1993). Kaper, J. B. et al., Nat Rev Micro 2, 123-140 (2004). Klaasen, H. et al., FEMS Microbiol. 88, 165-180 (1992). Kriegel, M. A. et al., Proc. Natl Acad. Sci. USA 108, 11548-11553 (2011). Kuwahara, T. et al., DNA Res. 18, 291-303 (2011). Lécuyer, E. et al., Immunity 40, 608-620 (2014). Lee, Y. K. Proc. Natl Acad. Sci. USA 108 (Suppl 1), 4615-4622 (2011). Martinez-Becerra, F. J. et al., Infect. Immun. 80, 1222-1231 (2012). Mills, J. A. et al., Infect. Immun. 56, 2933-2941 (1988). Paccez J. D. et al., Vaccine 25, 4671-4680 (2007). Pamp, S. J. et al., Genome Res. 22, 1107-1119 (2012). Parsot, C. Curr. Opin. Microbiol. 12, 110-116 (2009). Prakash, T. et al., Cell Host Microbe 10, 273-284 (2011). Schnupf, P. & Sansonetti, P. J., PLoS ONE 7, e36446 (2012). Schnupf, P. et al., Semin. Immunol. 25, 342-351 (2013). Sczesnak, A. et al., Cell Host Microbe 10, 260-272 (2011). Shima, T. et al., FEMS Immunol. Med. Microbiol. 52, 69-77 (2008). Tannock, G. W. et al., Appl. Environ. Microbiol. 47, 441-442 (1984). Wu, H. J. et al., Immunity 32, 815-827 (2010). Yang, Y. et al., Nature 510, 152-156 (2014). Yin, Y. et al. ISME J. 7, 615-621 (2012). Yurkovetskiy, L. et al., Immunity 39, 400-412 (2013).