IMMUNOPOTENTIATING OR ANTICANCER ACTIVITY-AUGMENTING COMPOSITION COMPRISING MAL-EXPRESSED STEM CELL LIKE MEMORY T CELL AS ACTIVE INGREDIENT
20220133851 · 2022-05-05
Inventors
Cpc classification
A61K35/17
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
Abstract
The present invention relates to an immunopotentiating or anticancer activity-augmenting composition comprising MAL-expressed, stem cell like memory T cells as an active ingredient. According to the present invention, myelin and lymphocyte (MAL) augments the differentiation, viability, and activity of stem cell like memory cells (Tscm) and MAL-expressed Tscm can be utilized in an immunopotentiating or anticancer activity-augmenting composition. MAL can be advantageously used in a composition for cancer immunotherapy, a composition for induction of Tscm differentiation, a method for screening a cancer immunotherapy agent, a method for screening a Tscm differentiation inducing agent, etc.
Claims
1. A composition for immunopotentiating or anticancer activity-augmenting comprising a stem cell like memory T cell (Tscm) in which MAL (myelin and lymphocyte) is expressed, as an active ingredient.
2. The composition of claim 1, wherein the amino acid sequence of the MAL is represented by SEQ ID NO:1.
3. The composition of claim 1, wherein the base sequence of the MAL is represented by SEQ ID NO:2.
4. The composition of claim 1, wherein the stem cell like memory T cell is a CD3+, CD8+, CCR7+, CD45RO−, and CD95+T cell.
5. The composition of claim 1, wherein the stem cell like memory T cell is differentiated by IL17 and IL-15.
6. (canceled)
7. (canceled)
8. A composition for differentiating stem cell like memory T cell comprising an activator for MAL protein expression or activity as an active ingredient.
9. A method for screening a cancer immunotherapy agent comprises: (a) separating a CD3+ T cell from a sample isolated from a human; (b) differentiating the CD3+ T cell into stem cell like memory T cell by treating with IL-17, IL-15 and test substances and followed by culturing; (c) measuring an expression level of MAL in the stem cell like memory T cell; and (d) selecting a substance having an increased expression or activity level of MAL among the test substances, compared to a control without treating with the test substance.
10. The method of claim 9, wherein the expression or activity level of MAL is measured by any one method selected from a group consisting of reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, microarray, ELISA, immunoprecipitation, immunohistochemistry, western blot and FACS.
11. A method for screening a stem cell like memory T cell differentiation inducing agent comprises: (a) Separating a CD3+ T cell from a sample isolated from a human; (b) differentiating the CD3+ T cell into stem cell like memory T cell by treating with IL-17, IL-15 and test substances and followed by culturing; (c) measuring an expression level of MAL in the stem cell like memory T cell; and (d) selecting a substance having an increased expression or activity level of MAL among the test substances, compared to a control without treating with the test substance.
12. The method of claim 11, wherein the expression or activity level of MAL is measured by any one method selected from a group consisting of reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, microarray, ELISA, immunoprecipitation, immunohistochemistry, western blot and FACS.
Description
DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
MODES OF THE INVENTION
[0025] The inventors confirmed that MAL is specifically overexpressed in stem cell-like memory T (Tscm) cells among the various types of memory T cells in differentiation using CD3+ T cells isolated from the blood of a normal person, and the MAL improves the differentiation, survival and activation of Tscm cells, and thus the present invention was completed.
[0026] Accordingly, the present invention provides a composition for immunopotentiating or anticancer activity-augmenting comprising a stem cell like memory T cell (Tscm) in which MAL (myelin and lymphocyte) is expressed, as an active ingredient.
[0027] The amino acid sequence of the MAL may be represented by SEQ ID NO:1, the base sequence of the MAL may be represented by SEQ ID NO:2.
[0028] The stem cell like memory T cell may be differentiated by IL-17 and IL-15, and may be a CD3+CD8+CCR7+CD45RO−CD95+T cell.
[0029] Also, the present invention provides a composition for cancer immunotherapy comprising an activator for MAL protein expression or activity as an active ingredient.
[0030] The activator for MAL protein expression and activation may be a compound, peptide, peptide mimetic, aptamer, antibody or natural substance, which specifically binds to the MAL protein, but the present invention is not limited thereto.
[0031] When the composition of the present invention is a pharmaceutical composition, for administration, other than the above-described active ingredient, a pharmaceutically acceptable carrier, excipient or diluent may be included. The carrier, excipient and diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.
[0032] The pharmaceutical composition of the present invention may be formulated into an oral preparation such as a powder, a granule, a tablet, a capsule, a suspension, an emulsion, a syrup or an aerosol, a preparation for external use, a suppository or a sterilized injectable solution. Specifically, for formulation, a surfactant or an excipient such as a filler, a thickener, a binder, a wetting agent, a disintegrant, a diluent, which is generally used, may be prepared. As a solid preparation for oral administration, a tablet, a pill, a powder, a granule or a capsule is used, but the present invention is not limited thereto. Such a solid preparation may be prepared by mixing at least one of excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin and the like, in addition to the active ingredient. In addition, other than simple excipients, lubricants such as magnesium stearate and talc may be used. Other than liquids for oral administration or liquid paraffin, various excipients, such as a wetting agent, a sweetening agent, a flavor, and a preservative may be added in formulation. A formulation for parenteral administration may be a sterilized aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilizing agent or a suppository. As the non-aqueous solvent or suspension, propylene glycol, polyethylene glycol, a vegetable oil such as olive oil, or an injectable ester such as ethyl oleate may be used. As a suppository base, Witepsol, Macrogol, Tween 61, cacao butter, laurinum, or glycerogelatin may be used.
[0033] A suitable dosage of the pharmaceutical composition of the present invention depends on a patient's condition and body weight, severity of a disease, a dosage form, an administration route and duration, but may be selected by those of ordinary skill in the art, and a daily dose of the composition is preferably 0.001 to 50 mg/kg, and if necessary, may be administered once or in divided portions.
[0034] In addition, the present invention provides a healthy functional food composition for cancer immunotherapy comprising an activator for MAL protein expression or activity as an active ingredient.
[0035] The activator for MAL protein expression and activity may be a compound, peptide, peptide mimetic, aptamer, antibody or natural substance, which specifically binds to the MAL protein, but the present invention is not limited thereto.
[0036] When the composition of the present invention is a health functional food composition, various nutrients, vitamins, minerals (electrolytes), flavoring agents including synthetic and natural flavoring agents, coloring agents, fillers (cheese, chocolate, etc.), pectic acid and a salt thereof, alginic acid and a salt thereof, organic acids, protective colloidal thickening agents, pH adjusters, stabilizers, preservatives, glycerin, alcohols, or carbonizing agents used in carbonated beverages may be included. In addition, it may contain pulp for manufacturing natural fruit juices, synthetic fruit juices and vegetable beverages. Such ingredients may be used independently or in combination. In addition, the health food composition may be an any one type of meat, sausage, bread, chocolate, candy, snacks, confectioneries, pizza, ramen, gum, ice cream, various soups, beverages, tea, functional water, drinks, alcoholic beverages and vitamin complexes.
[0037] In addition, the health food composition may further include a food additive, and unless specified otherwise, the suitability as a food additive is determined by standards and criteria for a corresponding item in accordance with the general provisions and general test methods in the Korean Food Additives Codex approved by the Ministry of Food and Drug Safety.
[0038] The items listed in the Korean Food Additives Codex may be, for example, chemical synthetics such as ketones, glycine, potassium citrate, nicotinic acid and cinnamic acid, natural additives such as a persimmon pigment, a licorice extract, crystalline cellulose, a Kaoliang color and guar gum, and mixed preparations such as L-sodium glutamate, alkali agents for noodles, a preservative formulation and a tar color formulation.
[0039] Here, a content of the composition according to the present invention added to food in the process of preparing a health food composition may be suitably added or removed as needed.
[0040] In addition, the present invention provides a composition for Tscm cell differentiation, which includes an activator for MAL protein expression or activity as an active ingredient.
[0041] The activator for MAL protein expression and activity may be a compound, peptide, peptide mimetic, aptamer, antibody or natural substance, which specifically binds to the MAL protein, but the present invention is not limited thereto.
[0042] In addition, the present invention provides a method for screening a cancer immunotherapy agent comprising (a) separating a CD3+ T cell from a sample isolated from a human; (b) differentiating the CD3+ T cell into stem cell like memory T cell by treating with IL-17, IL-15 and test substances and followed by culturing; (c) measuring an expression level of MAL in the stem cell like memory □cell; and (d) selecting a substance having an increased expression or activity level of MAL among the test substances, compared to a control without treating with the test substance.
[0043] In addition, the present invention provides a method for screening a stem cell like memory T cell differentiation inducing agent comprising (a) Separating a CD3+ □cell from a sample isolated from a human; (b) differentiating the CD3+ □cell into stem cell like memory T cell by treating with IL-17, IL-15 and test substances and followed by culturing; (c) measuring an expression level of MAL in the stem cell like memory □cell; and (d) selecting a substance having an increased expression or activity level of MAL among the test substances, compared to a control without treating with the test substance.
[0044] The expression or activity level of MAL may be measured by any one method selected from a group consisting of reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, microarray, ELISA, immunoprecipitation, immunohistochemistry, western blot and FACS, but the present invention is not limited thereto.
EXAMPLES
[0045] Hereinafter, the present invention will be described in further detail with reference to examples. These examples are merely provided to illustrate the present invention, and it is obvious to those of ordinary skill in the art that scope of the present invention is not limited to these examples according to the gist of the present invention.
Example 1
Isolation of CD3+ T Cells from Blood and Induction of Memory T Cell Differentiation
[0046] 1-1. PBMC Isolation from Blood
[0047] Blood of four normal people was collected in blood collection tubes, the collected blood was transferred to a 50 ml tube, and the same amount of phosphate buffered saline (PBS, 2% serum) was added to dilute the blood. Afterward, the same amount of a LymphoPrep Solution (Cat NO. 07851, STEMCELL) was slowly injected into the blood from the bottom of the 50 ml tube such that it was not mixed with the diluted blood. Subsequently, following centrifugation at 4 ° C. and 800 g for 20 minutes, a buffy coat layer was transferred to a fresh tube, PBS (2% serum) was added, and then a supernatant was removed after centrifugation at 400 g. The washing process was repeated three times, peripheral blood mononuclear cells (PBMCs) were recovered to calculate a cell count and then frozen and stored before use in an experiment.
[0048] 1-2. Isolation of CD3+ T Cells from PBMCs
[0049] CD3-expressing T cells were isolated using PBMCs isolated in Example 1-1. Briefly, CD3-expressing T cells were obtained by methods of removing cells expressing CD14, CD15, CD16, CD19, CD34, CD36, CD56, CD123 and CD235a using a Pan T cell isolation kit (Miltenyi Biotec, 130-096-535).
[0050] After isolation, as shown in
[0051] 1-3. Induction of Memory T Cell Differentiation from CD3+ T Cells
[0052] The isolated CD3-expres sing T cells were seeded in an anti-CD3 antibody-coated plate, and was incubated for 72 hours using a culture solution containing 1 μg/ml of anti-CD28 antibodies. 10 μg/ml IL-7 and 10 μg/ml IL-15 were contained in a medium for inducing differentiation, and a control did not include these interleukins. After 72-hour culture, an increase in Tscm cells was confirmed by FACS analysis.
[0053] As shown in
Example 2
Cell Sorting by Type of Memory T Cell and RNA Extraction
[0054] 2-1. Cell Sorting by Type of Memory T Cell
[0055] Finally, the CD8+ T cells, Tscm (CD3+CD8+CCR7+CD45RO−CD95+) cells, Tcm cells and Tem cells were sorted as described in Example 1-3 using an FACS sorter, and then used in an experiment.
[0056] 2-2. RNA Extraction
[0057] To extract total RNA per type of memory T cell, TRIzol (Invitrogen, Carlsbad, USA) was used. Each cell was put into a 1.5 ml tube, 1.0 ml of TRIzol was added and mixed, 0.2 ml of chloroform was added, followed by reaction at room temperature for 2 minutes. Subsequently, after centrifugation at 13,000 rpm for 15 minutes, 0.5 ml of a supernatant was transferred to a fresh tube. Afterward, 0.5 ml of isopropanol was added and mixed, and reacted at room temperature for 10 minutes, followed by centrifugation at 13,000 rpm for 10 minutes. 75% alcohol was added to the pellet obtained by the centrifugation and centrifuged at 7,500 rpm for 5 minutes, and the resulting pellet was dried in air, and 20 to 50 μl of RNase-free water was added according to an amount of the pellet to lyse the pellet. Afterward, RNA was quantified at a wavelength of 260 nm.
Example 3
Screening of Gene Specifically Expressed According to the Type of Memory T Cell
[0058] 3-1. mRNA Sequencing (Transcriptome)
[0059] Extracted RNA was fragmented by fragmentation, and cDNA was synthesized through reverse transcription using a TruSeq Stranded mRNA LT Sample Prep Kit and then adapters were attached to both ends thereof. PCR amplification was performed for an amount that enables sequencing, thereby obtaining an insert size of 200 to 400 bp through a size selection process. Sequencing was performed using a HiSeq 2500 system.
[0060] 3-2. Screening of Gene Specifically Expressed According to the Type of Memory T Cell
[0061] The quality control analysis of raw reads obtained by sequencing was conducted. Basic statistics such as the quality of total reads, total bases, total reads, GC (%) were produced. The reads that had undergone pre-processing were mapped to the reference genome using a HISAT2 program considering a splice, and then aligned reads were generated. Transcript assembly using a StringTie program was carried out, and Fragments Per Kilobase of transcript per Million mapped reads (FRKM) values was calculated using an expression level obtained by the transcript quantification of each sample, which are normalization values considering a read count, a transcript length and a depth of coverage. As a result, as shown in
Example 4
Verification of MAL Expression Specifically Expressed in Tscm Cells
[0062] The expression of the MAL gene increased specifically in Tscm cell was analyzed using the PBMCs collected in Example 1. CD3+ T cells were isolated from PBMCs in Samples 1, 3 and 4 used in transcriptome analysis, and differentiation was induced using IL-7/-15. Afterward, to analyze the expression of the MAL gene according to the type of T cell, quantitative PCR was performed. The expression of the MAL gene was normalized to the expression of GAPDH expressed in each cell type and analyzed.
[0063] 2 μg of the extracted RNA was synthesized to cDNA using an Omniscript RT kit (Qiagen, 205111). 2 μg of RNA, 0.5 mM dNTP, 1 μM oligo dT, 10 units RNase inhibitor, 4 units RTase, and RT buffer were added to each tube to allow a final volume to be 20 μl, and reacted at 37° C. for 60 minutes, thereby synthesizing cDNA. Real-time PCR was performed with the synthesized cDNA template using a MAL-specific primer, and specific information on the primers used in the experiment is shown in Table 1 below.
TABLE-US-00001 TABLE 1 Forward Reverse Gene primer (5′.fwdarw.3′) primer (5′.fwdarw.3′) MAL GGGTGATGTTCGTGTCTG ACTGAGGCGCTGAGGTAAAA TG (SEQ ID NO: 3) (SEQ ID NO: 4)
[0064] As a result, as shown in
Example 5
Verification of MAL Function Inducing Tscm Cell Differentiation
[0065] 5-1. Induction of MAL Expression Inhibition
[0066] According to a method provided by Invitrogen, 50 nM ON-TARGETplus Human MAL siRNA (L-011723-00-0010, Dharmacon, Inc.) or 50 nM ON-TARGETplus Non-targeting Pool (negative control siRNA, siScramble, as a control, not affect any gene in cells, D-001810-10-20, Dharmacon, Inc.) and 1.0 μl Lipofectamine 3000 was mixed in a tube containing an OPTI-MEM solution, and reacted at room temperature for 15 minutes to induce vesicle formation.
[0067] Specific information on the MAL siRNA used herein is as follows.
TABLE-US-00002 (SEQ ID NO: 5) 5′-UCAUAAAGCCGCAGUAGAA-3′ (SEQ ID NO: 6) 5′-GCGGUGUUCUCUUUAAUCA-3′ (SEQ ID NO: 7) 5′-CGACUUGCUCUUCAUCUUU-3′ (SEQ ID NO: 8) 5′-CUACAUAGCCACUCUGCUC-3′
[0068] After the reaction, the vesicle-containing OPTI-MEM was mixed with the culture solution and was treated, and 18 hours later, the medium was replaced with a fresh medium. After 48 hours, RNA was extracted from the cells, and MAL expression was confirmed by the method described in Example 4.
[0069] As a result, referring to
[0070] 5-2. Memory T Cell Type Analysis According to Inhibition of MAL Expression
[0071] By the method described in Example 5-1, siRNA was treated, and by the method described in Example 1-3, differentiation from CD3+ T cells to memory T cells was induced. After differentiation was induced for 72 hours, the distribution of stem cell-like memory T (Tscm) cells and naive T cells (Tn) was analyzed by FACS analysis.
[0072] As a result, as the result shown in
[0073] The result can also be confirmed by an increase in cells that could not relatively differentiate into Tscm cells and that maintain a Tn cell state.
Experimental Example 6
Verification of MAL Function Regulating In Vivo Lymphocyte Survival
[0074] 6-1. Confirmation of Cloning and Expression for Inducing MAL Overexpression
[0075] To produce a retrovirus expressing the MAL gene, a pBABE retroviral vector was used as a backbone vector. As shown in
[0076] 6-2. Induction of Inhibition of MAL Expression Using shRNA
[0077] Lentiviruses were produced in HEK293 cells using Human MAL TRIPZ Lentiviral shRNA (RHS4696-200762536, Dharmacon, Inc.) and a non-silencing-TRIPZ Lentiviral shRNA control (RHS4743, Dharmacon, Inc.) vector as a control. The pTRIPZ vector induced shRNA expression by tetracycline treatment, and CD3+ cells were transfected with the produced viruses, and then the medium was replaced with a tetracycline-containing medium. The MAL expression-inhibitory efficiency was confirmed by FACS analysis as shown in
[0078] 6-3. Verification of In Vivo Lymphocyte Survival
[0079] 6-week-old lymphocyte-free NOD-SCID mice were used. The CD3-expressing T cells obtained by the method as described in Examples 1-1 and 1-2 were induced to have MAL overexpression or inhibition using the MAL expressing regulatory systems of Example 6-1 and 6-2. Three days after 1×10.sup.6 cells per mouse were injected, blood was recovered from the femoral vein. Red blood cells were removed from the recovered blood, and stained using the APC/Cy7 anti-human CD3 Antibody (Cat #300318, BioLegend, Inc.), and subjected to FACS analysis as shown in
[0080] As a result, as the following result shown in
[0081] From the above results, it was confirmed that MAL plays a role in the in vivo survival of lymphocytes.
[0082] As above, as specific parts of the specification have been described in detail, although it is clear to those skilled in the art that this specific technique is merely a preferred embodiment, the scope of the specification is not limited thereto. Thus, the substantial scope of the specification will be defined by the accompanying claims and their equivalents.
[0083] The scope of the present invention is represented by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.