METHOD FOR MULTIPLEX NUCLEIC ACID DETECTION BASED ON CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEAT

Abstract

A method for multiplex nucleic acid detection based on clustered regularly interspaced short palindromic repeat (CRISPR), a system, and a kit for detecting a target nucleic acid based on CRISPR are provided. The detection method includes: adding any one, any two, any three, or four from the group consisting of a first nucleic acid detection composition, a second nucleic acid detection composition, a third nucleic acid detection composition, and a fourth nucleic acid detection composition to a reaction system with a target nucleic acid to achieve the multiplex detection of the target nucleic acid.

Claims

1. A method for detecting a target nucleic acid in a sample, comprising: contacting the sample with a nucleic acid detection composition, wherein the nucleic acid detection composition comprises a clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) protein, a guide RNA (gRNA), and a single-stranded nucleic acid reporter, and the gRNA comprises a region to bind to the Cas protein and a guide sequence to hybridize with a target sequence on the target nucleic acid; and detecting a detectable signal generated due to a cleavage of the Cas protein on the single-stranded nucleic acid reporter to detect the target nucleic acid; wherein the nucleic acid detection composition comprises any one, any two, any three, or four from the group consisting of a first nucleic acid detection composition, a second nucleic acid detection composition, a third nucleic acid detection composition, and a fourth nucleic acid detection composition; the first nucleic acid detection composition comprises Cas12i, a first gRNA binding to the Cas12i and hybridizing with a first target sequence on the target nucleic acid, and a first single-stranded nucleic acid reporter; the second nucleic acid detection composition comprises Cas12b, a second gRNA binding to the Cas12b and hybridizing with a second target sequence on the target nucleic acid, and a second single-stranded nucleic acid reporter; the third nucleic acid detection composition comprises Cas12a, a third gRNA binding to the Cas12a and hybridizing with a third target sequence on the target nucleic acid, and a third single-stranded nucleic acid reporter; the fourth nucleic acid detection composition comprises Cas12j, a fourth gRNA binding to the Cas12j and hybridizing with a fourth target sequence on the target nucleic acid, and a fourth single-stranded nucleic acid reporter; the first single-stranded nucleic acid reporter comprises at least two consecutive nucleotides, and the at least two consecutive nucleotides are one or more from the group consisting of ribonucleotides, deoxyribonucleotides, and nucleic acid analogues; the second single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a first abasic spacer, and the single-stranded nucleic acid reporter with the first abasic spacer comprises at least one optional nucleotide and at least one first abasic spacer; or, a nucleic acid structure of the second single-stranded nucleic acid reporter is a first nucleic acid analogue, and the first nucleic acid analogue is a locked nucleic acid (LNA); the third single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a second abasic spacer, and the single-stranded nucleic acid reporter with the second abasic spacer comprises at least one optional nucleotide and at least one second abasic spacer; and the fourth single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a third abasic spacer, and the single-stranded nucleic acid reporter with the third abasic spacer comprises at least one optional nucleotide and at least one third abasic spacer; or, a nucleic acid structure of the fourth single-stranded nucleic acid reporter is a second nucleic acid analogue, and the second nucleic acid analogue is 2′-O-methyl RNA.

2. The method according to claim 1, wherein the nucleic acid detection composition comprises any two, any three, or four from the group consisting of the first nucleic acid detection composition, the second nucleic acid detection composition, the third nucleic acid detection composition, and the fourth nucleic acid detection composition.

3. The method according to claim 1, wherein the detectable signal is detected in the following ways: a visual-based detection, a sensor-based detection, a color detection, a gold nanoparticle-based detection, a fluorescence polarization, a colloidal phase transition/dispersion, an electrochemical detection, and a semiconductor-based detection.

4. The method according to claim 1, wherein the target nucleic acid comprises ribonucleotides or deoxyribonucleotides; and the target nucleic acid comprises a single-stranded nucleic acid and a double-stranded nucleic acid, such as single-stranded DNA, double-stranded DNA, and single-stranded RNA.

5. The method according to claim 1, wherein a 5′ terminus and a 3′ terminus of the single-stranded nucleic acid reporter are provided with different reporter groups, respectively; or, the 5′ terminus and the 3′ terminus of the single-stranded nucleic acid reporter are provided with different labeling molecules, respectively.

6. The method according to claim 1, wherein the target nucleic acid is derived from a sample such as a virus, a bacterium, a microorganism, soil, a water source, a human body, an animal, and a plant; the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a disease-related specific nucleic acid, or a specific nucleic acid different from a control, and the disease-related specific nucleic acid is a specific mutation site or a single nucleotide polymorphism (SNP) site; the virus is a plant virus or an animal virus, such as a papilloma virus, a liver DNA virus, a herpes virus, an adenovirus, a poxvirus, a parvovirus, and a coronavirus; and the coronavirus comprises SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, and Mers-Cov.

7. The method according to claim 1, wherein the method further comprises: extracting the target nucleic acid from the sample.

8. A system or composition or kit for detecting a target nucleic acid in a sample, comprising a nucleic acid detection composition, wherein the nucleic acid detection composition comprises a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA comprises a region to bind to the Cas protein and a guide sequence to hybridize with a target sequence on the target nucleic acid; and the nucleic acid detection composition comprises any one, any two, any three, or four from the group consisting of a first nucleic acid detection composition, a second nucleic acid detection composition, a third nucleic acid detection composition, and a fourth nucleic acid detection composition, the first nucleic acid detection composition comprises Cas12i, a first gRNA binding to the Cas12i and hybridizing with a first target sequence on the target nucleic acid, and a first single-stranded nucleic acid reporter; the second nucleic acid detection composition comprises Cas12b, a second gRNA binding to the Cas12b and hybridizing with a second target sequence on the target nucleic acid, and a second single-stranded nucleic acid reporter; the third nucleic acid detection composition comprises Cas12a, a third gRNA binding to the Cas12a and hybridizing with a third target sequence on the target nucleic acid, and a third single-stranded nucleic acid reporter; the fourth nucleic acid detection composition comprises Cas12j, a fourth gRNA binding to the Cas12j and hybridizing with a fourth target sequence on the target nucleic acid, and a fourth single-stranded nucleic acid reporter; the first single-stranded nucleic acid reporter comprises at least two consecutive nucleotides, and the at least two consecutive nucleotides are one or more from the group consisting of ribonucleotides, deoxyribonucleotides, and nucleic acid analogues; the second single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a first abasic spacer, and the single-stranded nucleic acid reporter with the first abasic spacer comprises at least one optional nucleotide and at least one first abasic spacer; or, a nucleic acid structure of the second single-stranded nucleic acid reporter is a first nucleic acid analogue, and the first nucleic acid analogue is a locked nucleic acid (LNA); the third single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a second abasic spacer, and the single-stranded nucleic acid reporter with the second abasic spacer comprises at least one optional nucleotide and at least one second abasic spacer; and the fourth single-stranded nucleic acid reporter is a single-stranded nucleic acid reporter with a third abasic spacer, and the single-stranded nucleic acid reporter with the third abasic spacer comprises at least one optional nucleotide and at least one third abasic spacer; or, a nucleic acid structure of the fourth single-stranded nucleic acid reporter is a second nucleic acid analogue, and the second nucleic acid analogue is 2′-O-methyl RNA.

9. The system or composition or kit according to claim 8, wherein the nucleic acid detection composition comprises any two, any three, or four from the group consisting of the first nucleic acid detection composition, the second nucleic acid detection composition, the third nucleic acid detection composition, and the fourth nucleic acid detection composition.

10. The system or composition or kit according to claim 8, wherein the system or composition or kit is configured for detecting the target nucleic acid in the sample.

11. The method according to claim 2, wherein the detectable signal is detected in the following ways: a visual-based detection, a sensor-based detection, a color detection, a gold nanoparticle-based detection, a fluorescence polarization, a colloidal phase transition/dispersion, an electrochemical detection, and a semiconductor-based detection.

12. The method according to claim 2, wherein a 5′ terminus and a 3′ terminus of the single-stranded nucleic acid reporter are provided with different reporter groups, respectively; or, the 5′ terminus and the 3′ terminus of the single-stranded nucleic acid reporter are provided with different labeling molecules, respectively.

13. The method according to claim 3, wherein a 5′ terminus and a 3′ terminus of the single-stranded nucleic acid reporter are provided with different reporter groups, respectively; or, the 5′ terminus and the 3′ terminus of the single-stranded nucleic acid reporter are provided with different labeling molecules, respectively.

14. The method according to claim 4, wherein a 5′ terminus and a 3′ terminus of the single-stranded nucleic acid reporter are provided with different reporter groups, respectively; or, the 5′ terminus and the 3′ terminus of the single-stranded nucleic acid reporter are provided with different labeling molecules, respectively.

15. The method according to claim 2, wherein the method further comprises: extracting the target nucleic acid from the sample.

16. The method according to claim 3, wherein the method further comprises: extracting the target nucleic acid from the sample.

17. The method according to claim 4, wherein the method further comprises: extracting the target nucleic acid from the sample.

18. The method according to claim 5, wherein the method further comprises: extracting the target nucleic acid from the sample.

19. The method according to claim 6, wherein the method further comprises: extracting the target nucleic acid from the sample.

20. The system or composition or kit according to claim 9, wherein the system or composition or kit is configured for detecting the target nucleic acid in the sample.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0134] FIG. 1 shows that, when a sequence of the single-stranded nucleic acid reporter is 5′-6-FAM//T//T//3′-BHQ1, Cas12i can specifically cleave the single-stranded nucleic acid reporter and leads to a better detectable signal than other proteins.

[0135] FIG. 2 shows that, when the single-stranded nucleic acid reporter is a nucleic acid analogue (LNA, sequence: 5′-6-FAM//LNA_T//LNA_T//LNA_T//LNA_T//LNA_T//3′-BHQ1, Cas12b can specifically cleave the single-stranded nucleic acid reporter and leads to a better detectable signal than other proteins.

[0136] FIG. 3 shows that, when a sequence of the single-stranded nucleic acid reporter is 5′-6-FAM/S//S//C//S//S//3′-BHQ1, Cas12a can specifically cleave the single-stranded nucleic acid reporter and leads to a better detectable signal than other proteins.

[0137] FIG. 4 shows that, when a sequence of the single-stranded nucleic acid reporter is 5′-6-FAM/S//S//A//S//S//3′-BHQ1, Cas12a and Cas12b can specifically cleave the single-stranded nucleic acid reporter and leads to better detectable signals than other proteins, where a detectable signal of Cas12a is stronger than that of Cas12b.

[0138] FIG. 5 shows that, when a sequence of the single-stranded nucleic acid reporter is 5′-6-FAM/S//S//T//S//S//3′-BHQ1, Cas12a and Cas12j can specifically cleave the single-stranded nucleic acid reporter and leads to better detectable signals than other proteins.

[0139] FIG. 6 shows that, when a sequence of the single-stranded nucleic acid reporter is 5′-6-FAM/S//S//G//S//S//3′-BHQ1, Cas12a and Cas12b can specifically cleave the single-stranded nucleic acid reporter and leads to better detectable signals than other proteins, where a detectable signal of Cas12b is stronger than that of Cas12a.

[0140] FIG. 7 shows that, when the single-stranded nucleic acid reporter is a nucleic acid analogue (2′-O-methyl RNA), Cas12j can specifically cleave the single-stranded nucleic acid reporter and leads to a better detectable signal than other proteins.

[0141] FIG. 8 shows the doublet detection of genes N and S of the virus COVID-19 with Cas12i and Cas12j, where cas12i targets the gene S, with a reporter of FAM-CT-BHQ1; cas12j targets the gene N, with a reporter of Cy3-SSTSS-BHQ2; when both genes S and N are present in a sample, two fluorescent signals can be detected; when only the gene N is present in a sample, only the FAM fluorescent signal corresponding to Cas12i can be detected; when only the gene S is present in a sample, only the Cy3 fluorescent signal corresponding to Cas12j can be detected; and when both the gene S and the gene N are not present in a sample, neither of the two signals can be detected.

[0142] FIG. 9 shows the triplet detection of different target nucleic acids with Cas12a, Cas12b, and Cas12i.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0143] The present disclosure will be further explained below in conjunction with examples. The following examples are only preferred examples of the present disclosure, and are not intended to limit the present disclosure in other forms. Any technical personnel familiar with the profession may use the technical content disclosed above to derive equivalent examples through equivalent changes. Any simple modification or equivalent change made to the following examples according to the technical essence of the present disclosure without departing from the content of the solutions of the present disclosure shall fall within the protection scope of the present disclosure.

[0144] The technical solutions of the present disclosure are based on the following principle: a nucleic acid is extracted from a sample to be tested, for example, a target nucleic acid can be obtained through amplification; a gRNA that can be paired with the target nucleic acid is used to guide a Cas protein to recognize and bind to the target nucleic acid; then the Cas protein stimulates the cleavage activity of the single-stranded nucleic acid reporter to cleave the single-stranded nucleic acid reporter in the system; two terminals of the single-stranded nucleic acid reporter are provided with a fluorophore and a quencher respectively, and if the single-stranded nucleic acid reporter is cleaved, fluorescence will be excited; and in other embodiments, the two terminals of the single-stranded nucleic acid reporter can also be provided with a labeling molecule that can be detected by colloidal gold.

Example 1: Nucleic Acid Detection Using Cas12i, Cas12j, Cas12a, and Cas12b

[0145] In this example, different single-stranded nucleic acid reporters were designed, and Cas12i, Cas12j, Cas12a, and Cas12b were used for detection. The different single-stranded nucleic acid reporters were single-stranded nucleic acid reporter-TT, single-stranded nucleic acid reporter-TT-F, single-stranded nucleic acid reporter-LNA, single-stranded nucleic acid reporter-SSCSS, single-stranded nucleic acid reporter-SSASS, single-stranded nucleic acid reporter-SSTSS, single-stranded nucleic acid reporter-SSGSS, and single-stranded nucleic acid reporter-OCH.sub.3.

[0146] A structure of the single-stranded nucleic acid reporter-TT was 5′-6-FAM//T//T//3′-BHQ1; a structure of the single-stranded nucleic acid reporter-TT-F was 5′-6-FAM//T-F//T-F//3′-BHQ1 (where T-F was 2′-fluoro-modified T); a structure of the single-stranded nucleic acid reporter-LNA was 5′-6-FAM//LNA_T//LNA_T//LNA_T//LNA_T//LNA_T//3′-BHQ1; a structure of the single-stranded nucleic acid reporter-SSCSS was 5′-6-FAM//S//S//C//S//S//3′-BHQ1 (where S was dSpacer); a structure of the single-stranded nucleic acid reporter-SSASS was 5′-6-FAM//S//S//A//S//S//3′-BHQ1 (where S was dSpacer); a structure of the single-stranded nucleic acid reporter-SSTSS was 5′-6-FAM//S//S//T//S//S//3′-BHQ1 (where S was dSpacer); a structure of the single-stranded nucleic acid reporter-SSGSS was 5′-6-FAM//S//S//G//S//S//3′-BHQ1 (where S was dSpacer); and a structure of the single-stranded nucleic acid reporter-OCH.sub.3 was 5′-6-FAM//T-OCH.sub.3//T-OCH.sub.3//T-OCH.sub.3//T-OCH.sub.3//T-OCH.sub.3//3′-BHQ1 (where T-OCH.sub.3 was 2′-O-methyl-modified T).

[0147] The applicants verified the detection effects of Cas12a (SEQ ID NO: 1), Cas12b (SEQ ID NO: 2), Cas12i (SEQ ID NO: 3), and Cas12j (SEQ ID NO: 4) when the above-mentioned nucleic acid reporters with an abasic spacer were used, and an experimental design was as follows:

TABLE-US-00001 Cas protein Target nucleic acid gRNA Reporter (final concentration: (final concentration: (final concentration: (final concentration: 50 nM) 25 nM) 50 nM) 400 nM) Cas12a Cas12i3-g2-ssDNA0 LbCas12a-TGW6-g1 Single-stranded nucleic acid Cas12b Cas12i3-g2-ssDNA0 AaCas12b-TGW6-g1 reporter-TT Cas12i Cas12i3-g2-ssDNA0 DRi3-gOsTGW6-2 Single-stranded nucleic acid Cas12j Cas12j19-g3-ssDNA0 DR12j19gOsTGW6-3 reporter-TT-F Single-stranded nucleic acid reporter-LNA Single-stranded nucleic acid reporter-SSCSS Single-stranded nucleic acid reporter-SSASS Single-stranded nucleic acid reporter-SSTSS Single-stranded nucleic acid reporter-SSGSS Or single-stranded nucleic acid reporter-OCH3

[0148] A sequence of the Cas12i3-g2-ssDNA0 was shown in SEQ ID NO 5;

[0149] a sequence of the Cas12j119-g3-ssDNA0 was shown in SEQ TD NO: 6;

[0150] a sequence of the LbCas12a-TGW6-g1 was shown in SEQ ID NO: 7;

[0151] a sequence of the AaCas12b-TGW6-g1 was shown in SEQ ID NO: 8;

[0152] a sequence of the Cas12i3-TGW6-g2 was shown in SEQ ID NO: 9; and

[0153] a sequence of the Cas12j19-TGW6-g3 was shown in SEQ ID NO: 10.

[0154] A content of each component in the 20 μl system was as follows:

TABLE-US-00002 Component 20 μl system consumption Final concentration Buffer 2 ul 1× 100 mM DTT 2 ul 10 mM 2 μM Cas12 0.5 ul 50 nM 1 μM gRNA 1 ul 50 nM 100 nM ssDNA 1 ul 5 nM 10 μM single-stranded 0.4 ul 200 nM nucleic acid reporter H.sub.2O Up to 20 ul

[0155] The detection effects of each component is shown in FIGS. 1-7

[0156] When the probe sequence was TT, Cas12i could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other proteins.

[0157] When the probe sequence was 5′-6-FAM//T-F//T-F//3′-BHQ1, Cas12i could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other proteins.

[0158] In addition, when the probe sequence was CT (5′-6-FAM//C//T//3′-BHQ1), Cas12i also could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other Cas proteins.

[0159] When the probe was a nucleic acid analogue (LNA), Cas12b could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other proteins.

[0160] When the probe sequence was 5′-6-FAM/S//S//C//S//S//3′-BHQ1, Cas12a could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other proteins.

[0161] When the probe sequence was 5′-6-FAM/S//S//A//S//S//3′-BHQ1, Cas12a and Cas12b could specifically cleave the single-stranded nucleic acid reporter, and resulted in better detectable signals than other proteins.

[0162] When the probe sequence was 5′-6-FAM/S//S//T//S//S//3′-BHQ1, Cas12a and Cas12j could specifically cleave the single-stranded nucleic acid reporter, and resulted in better detectable signals than other proteins.

[0163] When the probe sequence was 5′-6-FAM/S//S//G//S//S//3′-BHQ1, Cas12a and Cas12b could specifically cleave the single-stranded nucleic acid reporter, and resulted in better detectable signals than other proteins, where a detectable signal of Cas12b was stronger than that of Cas12a.

[0164] When the probe was a nucleic acid analogue (2′-O-methyl RNA), Cas12j could specifically cleave the single-stranded nucleic acid reporter, and resulted in a better detectable signal than other proteins.

Example 2: Doublet Detection of Virus COVID-19 Using Cas12i and Cas12j

[0165] Cas12i and Cas12j were used to achieve the doublet detection of genes N and S of virus COVID-19: Cas12i targeted the gene S, with a reporter of 5′-6-FAM//C//T//3′-BHQ1, and the gRNA sequence was AGAGAAUGUGUGCAUAGUCACACUCAGGAUGUUAACUGCACAG, as shown in SEQ ID NO: 11; and Cas12j targeted the gene N, with a reporter of 5′-Cy3//S//S//T//S//S//3′-BHQ2, and the gRNA sequence was GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCACCGCGACAUUCCGAAGAACG C, as shown in SEQ ID NO: 12.

[0166] As shown in FIG. 8, the results showed that, when both genes S and N were present in a sample, two fluorescent signals could be detected; when only the gene N was present in a sample, only the FAM fluorescent signal corresponding to Cas12i could be detected; when only the gene S was present in a sample, only the Cy3 fluorescent signal corresponding to Cas12j could be detected; and when both the gene S and the gene N were not present in a sample, neither of the two signals could be detected.

Example 3: Triplet Detection of Different Target Nucleic Acids Using Cas12a, Cas12b, and Cas12i

[0167] Cas12a, Cas12b, and Cas12i were used to achieve the triplet detection of different target nucleic acids.

TABLE-US-00003 Cas Target protein gene name Reporter sequence Fluorophore cas12a EV71 VP1 5′6-FAM//A//S//S//T//3′BHQ1 FAM cas12b OsTGW6 5′TAMRA//LNA-T//LNA-T//LNA- TAMRA T//LNA-T//LNA-T//3′BHQ2 cas12i COVID-19 5′HEX//C//T//3′BHQ1 HEX orf1ab

[0168] cas12a targeted the target nucleic acid EV71 VP1 with a sequence of GTGCACGCAACAAAAGTGAACTCTGCATCAAAGCGCATGT (SEQ ID NO: 13), the single-stranded nucleic acid reporter was 5′-6-FAM//A//dS//dS//T//3′-BHQ1 (where dSpacer was an abasic spacer), and the gRNA was LbCas12a-g71-1 with a sequence of UAAUUUCUACUAAGUGUAGAUAUGCAGAGUUCACUUUUGUUGCG (SEQ ID NO: 14, where the bolded part was a position for the gRNA to bind to the protein, and the underlined part was a position matching the target nucleic acid sequence).

[0169] Cas12b targeted the target nucleic acid OsTGW6 with a sequence of GATCGTTGGTAGTTCATGCTGCTGTCGGTGAAATAAACATCTCCGGTAAC (SEQ ID NO: 15), the single-stranded nucleic acid reporter was 5′-TTAMRA//LNA-T//LNA-T//LNA-T//LNA-T//LNA-T//3′-BHQ2 (where LNA-T refers to an LNA with a base of T), the tracrRNA sequence was GUCUAAAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGC AAAGCCCGUUGAACUUCUCAAAAAGAACGCUCGCUCAGUGUUCUGAC (SEQ ID NO: 16), and the crRNA sequence was GUCGGAUCACUGAGCGAGCGAUCUGAGAAGUGGCACuuucaccgacagcagcauga (SEQ ID NO: 17, where the underlined part was a position matching the target nucleic acid sequence).

[0170] Cas12i targeted the target nucleic acid COVID-19 orf1ab with a sequence of Ggcaccaaattccaaaggtttaccttggtaatcatcttcagtaccatactcatattgag (SEQ ID NO: 18), the single-stranded nucleic acid reporter was 5′-HEX//C//T//3′-BHQ1, and the gRNA was CV19-Lamb-i3g5g with a sequence of AGAGAAUGUGUGCAUAGUCACACccaaggUaaaccUUUggaaUUUgg (SEQ ID NO: 19, where the bolded part was a position for the gRNA to bind to the protein, and the underlined part was a position matching the target nucleic acid sequence).

[0171] As shown in FIG. 9, the left side of the figure shows a target nucleic acid added to the system, which is expressed in an abbreviation of a corresponding enzyme (for example, “ABI” refers to the target nucleic acid EV71 VP1 detected by the Cas12a (A) protein added to the system, the target nucleic acid OsTGW6 detected by the Cas12a (B) protein, and the target nucleic acid COVID-19 orf1ab detected by the Cas12i (I) protein; and the upper side of the figure shows a fluorescent signal generated after the Cas protein in this system recognizes a target nucleic acid, then activates the bypass cleavage activity, and specifically cleaves the single-stranded nucleic acid reporter (for example, “Cas12-FAM” refers to an FAM fluorescence intensity generated after the Cas12 protein in this system recognizes the target nucleic acid EV71 VP1, then activates the bypass cleavage activity, and specifically cleaves the single-stranded nucleic acid reporter 5′-6-FAM//A//S//S//T//3′-BHQ1). The darker the color, the stronger the signal.

[0172] Specifically, for example, in the first row, when the target nucleic acid EV71 VP1 detected by the Cas12a (A) protein, the target nucleic acid OsTGW6 detected by the Cas12b (B) protein, and the target nucleic acid COVID-19 orf1ab detected by the Cas12i (I) protein are added to the system, FAM fluorescence corresponding to Cas12a, TAMRA fluorescence corresponding to Cas12b, and HEX fluorescence corresponding to Cas12i can be detected.

[0173] The test results prove that Cas12a, Cas12b, and Cas12i show different preferences for single-stranded nucleic acid reporters and thus can be used for triplet nucleic acid detection.

[0174] All documents mentioned in the present disclosure are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present disclosure, those skilled in the art can make various changes or modifications to the present disclosure, and these equivalents shall also fall within the scope defined by the appended claims of the present application.