Cold- and water-inducible promoter from rice

11319548 · 2022-05-03

Assignee

Inventors

Cpc classification

International classification

Abstract

This present invention relates to isolation and derivation of nucleic acid sequences from monocot plants, preferably rice that are capable of driving and/or regulating a stress induced expression of an operably linked nucleic acid. The present invention also is directed to the use of the isolated nucleic acid to drive and/or regulate a stress-induced expression of an operably linked nucleic acid. The isolated nucleic acid sequence of the present invention as set forth in SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or the complement thereof can be an inducible promoter. The promoters of the invention can be induced by abiotic stress such as water, cold, heat and/or salinity or a biotic stress such as by a virus, bacteria, or fungi.

Claims

1. A genetic construct comprising an inducible promotor having the nucleotide sequence set forth in SEQ ID NO:7 and a heterologous polynucleotide sequence encoding a protein operably linked to said inducible promoter.

2. The genetic construct of claim 1, wherein the heterologous polynucleotide sequence encodes a beta-glucuronidase (GUS).

3. A vector comprising the genetic construct of claim 2.

4. A plant cell comprising the genetic construct of claim 2.

5. A plant cell comprising the genetic construct of claim 2 stably incorporated into its genome.

6. A transgenic plant comprising the genetic construct of claim 1 stably incorporated into its genome.

7. The transgenic plant of claim 6, wherein the transgenic plant is a monocot plant or a dicot plant.

8. The transgenic plant of claim 7, wherein the monocot plant is a rice plant.

9. Transgenic seed produced by the transgenic plant of claim 6 and comprising the genetic construct.

10. A method for regulating gene expression in a plant, the method comprising: a) subjecting a transgenic plant comprising the genetic construct of claim 1 to a water, cold, or salt stress condition; and b) investigating the expression of said protein in the plant.

11. The method of claim 10, wherein subjecting the plant to water stress is by withholding water to the plant for 1-14 days.

12. The method of claim 10, wherein subjecting the plant to salt stress is by irrigating the plant with a solution containing 100-200 mM NaCl for 2 to 12 hours.

13. The method of claim 10, wherein subjecting the plant to cold stress is by keeping the plant at a temperature of 4-8° C. for 2-8 hours.

Description

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWING

(1) FIGS. 1A-1B: FIG. 1A is a graphical representation of gateway entry vector pENTR-D-TOPO and destination vector pMDC164 useful for expression in plants of a beta-glucurodinase (GUS) gene under control of any one of the promoters according to the invention. FIG. 1B is a map of the vector RP 2H promoter cloned in pMDC 164.

(2) FIGS. 2A-2E: is a digital image exhibiting expression pattern of RP2H (SEQ ID NO 1). GUS staining is visible in FIG. 2A root tissue, FIG. 2B leaf tissue, FIG. 2C panicles, FIG. 2D lemma and palea and FIG. 2E anthers.

(3) FIGS. 3A-3B is a digital image exhibiting expression pattern of RP8 (SEQ ID NO 6) under water stress. Slight GUS expression was observed in the leaf tissue before stress as can be seen in FIG. 3A and there is a visible increase in GUS expression pattern seen after water stress in FIG. 3B.

(4) FIG. 4A-4B is a digital image exhibiting expression pattern of RP10 (SEQ ID NO 7) under water stress. No visible GUS expression was observed in the leaf tissue before stress as can be seen in FIG. 4A and there is a visible increase in GUS expression pattern seen after water stress in FIG. 4B.

(5) FIGS. 5A-5B is a digital image exhibiting expression pattern of RP4 (SEQ ID NO 4) under water stress. No visible GUS expression was observed in the leaf tissue before stress as can be seen in FIG. 5A and there is a visible increase in GUS expression pattern seen after water stress in FIG. 5B.

(6) FIGS. 6A-6B is a digital image exhibiting expression pattern of RP7 (SEQ ID NO 5) under water stress. No visible GUS expression was observed in the leaf tissue before stress as can be seen in FIG. 6A and there is a visible increase in GUS expression pattern seen after water stress in FIG. 6B.

(7) FIGS. 7A-7B is a digital image exhibiting expression pattern of RP10H (SEQ ID NO 3). GUS staining is visible in FIG. 7A leaf tissue and FIG. 7B inflorescence.

(8) FIG. 8 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoters viz RP2H, RP3H, RP8H, RP9H, RP10H, RP4, RP7, RP10, RP11 after salt stress assay along with control.

(9) FIG. 9 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoters viz RP8 along with control after salt stress assay.

(10) FIG. 10 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoter viz RP2H, RP9H, RP4, RP7, RP8, RP10, RP11 after heat stress assay along with control.

(11) FIG. 11 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoter viz RP2H and RP11 after heat stress assay along with control.

(12) FIG. 12 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoter viz RP3H, RP9H, RP10H, RP4, RP7, RP11 after cold stress assay along with control.

(13) FIG. 13 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoter viz RP2H, RP8, RP10 after cold stress assay along with control.

(14) FIG. 14 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoters viz RP10, RP8, RP4, RP10H and RP11 along with control plants when exposed to water stress condition.

(15) FIG. 15 is a graph of Fluorometric analysis of Gus expression in leaf tissues of different promoters viz RP2H and RP7 along with control plants after water stress assay.

DETAILED DESCRIPTION

Definitions

(16) The term “promoter” as used herein is taken in a broad context and refers to regulatory nucleic acid sequences capable of effecting (driving and/or regulating) expression of the sequences to which they are operably linked. A “promoter” encompasses transcriptional regulatory sequences derived from a classical genomic gene. Usually a promoter comprises a TATA box, which is capable of directing the transcription initiation complex to the appropriate transcription initiation start site. However, some promoters do not have a TATA box (TATA-less promoters), but are still fully functional for driving and/or regulating expression. A promoter may additionally comprise a CCAAT box sequence and additional regulatory elements (i.e. upstream activating sequences or cis-elements such as enhancers and silencers). A “promoter” may also include the transcriptional regulatory sequences of a classical prokaryotic gene, in which case it may include a −35 box sequence and/or a −10 box transcriptional regulatory sequences. Preferably, the promoter is free of sequences (such as protein encoding sequences or other sequences at the 3′ end) that naturally flank the promoter in the genomic DNA of the organism from which the promoter is derived. Further preferably, the promoter is also free of sequences that naturally flank it at the 5′ end. The promoter may comprise less than about 2 kb, 1.6 kb, 1.2 kb, 1 kb, 0.8 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally occur with the promoter in genomic DNA from the organism of which the promoter is derived. The invention encompasses an isolated nucleic acid as mentioned above, capable of regulating transcription of an operably linked nucleic acid in a plant or in one or more particular cells, tissues or organs of a plant.

(17) “Driving expression” as used herein means promoting the transcription of a nucleic acid.

(18) “Regulating expression” as used herein means influencing the level, time or place of transcription of a nucleic acid. The promoters of the present invention may thus be used to increase, decrease or change in time and/or place transcription of a nucleic acid. For example, they may be used to limit the transcription to certain cell types, tissues or organs, or during a certain period of time, or in response to certain environmental conditions.

(19) The term “plant expressible” means being capable of regulating expression in a plant, plant cell, plant tissue and/or plant organ.

(20) A “fragment” as used herein means a portion of a nucleic acid sequence. Suitable fragments useful in the methods of the present invention are functional fragments, which retain at least one of the functional parts of the promoter and hence are still capable of driving and/or regulating expression. Examples of functional fragments of a promoter include the minimal promoter, the upstream regulatory elements, or any combination thereof.

(21) “Inducible promoters” are responsive to environmental stimuli and provide precise regulation of transgene expression through external control. Inducible promoters are useful for the regulation of potentially stress-related genes that are activated as a result of biotic and abiotic stresses. The differential expression during environmental stimuli helps in meaningful resource utilization.

(22) The term “stress inducible” shall be taken to indicate that expression is predominantly in a stress such as water, heat or salinity. Expression may be driven and/or regulated in the seed, embryo, scutellum, aleurone, endosperm, leaves, flower, calli, meristem, shoot meristem, discriminating centre, shoot, shoot meristem and root.

(23) The term “constitutive” means having no or very few spatial or temporal regulations. The term “constitutive expression” as used herein refers to a substantially continuously expression in substantially all tissues of the organism. The skilled craftsman will understand that a “constitutive promoter” is a promoter that is active during most, but not necessarily all, phases of growth and development of the organism and throughout most, but not necessarily all, parts of an organism.

(24) The term “genetic construct” as used herein means a nucleic acid made by genetic engineering.

(25) The term “operably linked” to a promoter as used herein means that the transcription is driven and/or regulated by that promoter. A person skilled in the art will understand that being operably linked to a promoter preferably means that the promoter is postponed upstream (i.e. at the 5-end) of the operably linked nucleic add. The distance to the operably linked nucleic acid may be variable, as long as the promoter of the present invention is capable of driving and/or regulating the transcription of the operably linked nucleic acid. For example, between the promoter and the operably linked nucleic acid, there might be a cloning site, an adaptor, a transcription or translation enhancer.

(26) The operably linked nucleic acid may be any coding or non-coding nucleic acid. The operably linked nucleic acid may be in the sense or in the anti-sense direction. Typically in the case of genetic engineering of host cells, the operably linked nucleic acid is to be introduced into the host cell and is intended to change the phenotype of the host cell. Alternatively, the operably linked nucleic acid is an endogenous nucleic acid from the host cell.

(27) The term “transcription terminator” as used in herein refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3-non-translated DNA sequences usually containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3-end of a primary transcript. Terminators active in and/or isolated from viruses, yeasts, molds, bacteria, insects, birds, mammals and plants are known and have been described in literature. Examples of terminators suitable for use in the genetic constructs of the present invention include the Agrobacterium tumefaciens nopaline synthase (NOS) gene terminator, the Agrobacterium tumefaciens octopine synthase (OCS) gene terminator sequence, the Cauliflower mosaic virus (CaMV) 35S gene terminator sequence, the Oryza sativa ADP-glucose pyrophosphorylase terminator sequence (t3 Bt2), the Zea mays zein gene terminator sequence, the rbcs-1A gene terminator, and the rbcs-3A gene terminator sequences, amongst others.

(28) An “expression cassette” as meant herein refers to a minimal genetic construct necessary for expression of a nucleic acid. A typical expression cassette comprises a promoter-gene-terminator combination. An expression cassette may additionally comprise cloning sites, for example Gateway recombination sites or restriction enzyme recognition sites, to allow easy cloning of the operably linked nucleic acid or to allow the easy transfer of the expression cassette into a vector. An expression cassette may further comprise 5′ untranslated regions, 3′ untranslated regions, a selectable marker, transcription enhancers or translation enhancers.

(29) The “transformation vector” is a genetic construct, which may be introduced in an organism by transformation and may be stably maintained in said organism. Some vectors may be maintained in for example Escherichia coli, A. tumefaciens, Saccharomyces cerevisiae or Schizosaccharomyces pombe, while others such as phagemids and cosmid vectors, may be maintained in bacteria and/or viruses. Transformation vectors may be multiplied in their host cell and may be isolated again therefrom to be transformed into another host cell. Vector sequences generally comprise a set of unique sites recognized by restriction enzymes, the multiple cloning sites (MCS), wherein one or more non-vector sequence(s) can be inserted. Vector sequences may further comprise an origin of replication which is required for maintenance and/or replication in a specific host cell. Examples of origins of replication include, but are not limited to, the f1-ori and colE1.

(30) “Expression vector” form a subset of transformation vectors, which, by virtue of having the appropriate regulatory sequences, enable expression of the inserted non-vector sequence(s). Expression vectors have been described which are suitable for expression in bacteria for example E. coli; fungi for example S. cerevisiae, S. pombe, Pichia pastoris or the like; insect cells for example baculoviral expression vectors; animal cells for example COS or CHO cells and plant cells. One suitable expression vector according to the present invention is a plant expression vector, useful for the transformation of plant cells, the stable integration in the plant genome, the maintenance in the plant cell and the expression of the non-vector sequences in the plant cell.

(31) The term “selectable marker” includes any gene, which confers a phenotype to a cell in which it is expressed, to facilitate the identification and/or selection of cells that are transfected or transformed. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance. Cells containing the genetic construct will thus survive antibiotics or herbicide concentrations that kill untransformed cells. Examples of selectable marker genes include genes conferring resistance to antibiotics for example nptll encoding neomycin phosphotransferase capable of phosphorylating neomycin and kanamycin, or hpt encoding hygromycin phosphotransferase capable of phosphorylating hygromycin; or herbicides for example bar which provides resistance to Basta; aroA or gox providing resistance against glyphosate; or genes that provide a metabolic trait for example manA that allows plants to use mannose as sole carbon source. Visual marker genes result in the formation of colour for example beta-glucurodinase, (GUS); luminescence for example luciferase or fluorescence for example Green Fluorescent Protein (GFP) and derivatives thereof. Further examples of suitable selectable marker genes include the ampicillin resistance (Ampr), tetracycline resistance gene (Tcr), bacterial kanamycin resistance gene (Kanr), phosphinothricin resistance gene, and the chloramphenicol acetyltransferase (CAT) gene, amongst others.

(32) The term “transformation” as used herein encompasses the transfer of an exogenous nucleic acid into a host cell, irrespective of the method used for transfer. In particular for plants, tissues capable of clonal propagation, whether by organogenesis or embryogenesis, are suitable to be transformed with a genetic construct of the present invention and a whole plant may be regenerated therefrom. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular plant species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (for example apical meristem, axillary buds, or root meristems), and induced meristem tissue (for example cotyledon meristem and hypocotyl meristem). The nucleic acid may be transiently or stably introduced into a plant cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the plant genome.

(33) The term “plant” or “plants” as used herein encompasses whole plants, ancestors and progeny of plants and plant parts, including seeds, shoots, stems, roots (including tubers), and plant cells, tissues and organs. The term “plant” therefore also encompasses suspension cultures, embryos, meristematic regions, callus tissue, gametophytes, sporophytes, pollen, and microspores.

(34) The present invention provides nucleic acid sequences useful for driving and/or regulating expression of an operably linked nucleic acid in plants. The present invention provides isolating and deriving these nucleic acid sequences from monocot plants for example rice, as well as employing them in driving and/or regulating expression of an operably linked nucleic acid. The present invention therefore concerns promoters, genetic constructs, expression cassettes, transformation vectors, expression vectors, host cells and transgenic plants having the nucleic acids according to the present invention. The present invention also concerns methods for driving and/or regulating expression of a nucleic acid and methods for the production of transgenic plants.

(35) The isolated nucleic acid sequences having nucleic acids as presented in SEQ ID NO 1 to 10, preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 were isolated from Oryza sativa and have been found to be capable of driving and regulating expression of an operably linked nucleic acid; their expression patterns have also been characterized. Therefore, the present invention offers a collection of hitherto unknown isolated nucleic acids, which isolated nucleic acids are useful as promoters.

(36) Accordingly, the present invention provides isolated nucleic acid sequences capable of driving and/or regulating expression, having:

(37) (a) a nucleic acid having sequence as set forth in any one of SEQ ID NO 1 to 10 or the complement of any one of SEQ ID NO 1 to 10; preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or the complement thereof; or

(38) (b) a nucleic acid having at least 90% sequence identity in a continuous stretch with any of the nucleic acid sequence as set forth in any one of SEQ ID NO 1 to 10; preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or the complement thereof, or

(39) (c) a nucleic acid sequence which hybridizes with any of the nucleic acid sequence as set forth in any one of SEQ ID NO 1 to 10; preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or the complement thereof. The hybridization can be carried out under stringent conditions such as at annealing temperatures of about 60° C. to about 68° C.

(40) The present invention is not limited to the nucleic acids as presented by SEQ ID NO 1 to 10. A person skilled in the art will recognize that variants or fragments of a nucleic add may occur, whilst maintaining the same functionality. These variants or fragments may be manmade (e.g. by genetic engineering) or may even occur in nature. Therefore, the present invention extends to variant nucleic acids and fragments of any of SEQ ID NO 1 to 10, which variants or fragments are useful in the methods of the present invention. Such variants and fragments include:

(41) (a) a nucleic acid as given in any one of SEQ ID NO 1 to 10 or the complement of any one of SEQ ID NO 1 to 10; or

(42) (b) a nucleic acid having at least 90% sequence identity in a continuous stretch with any of the DNA sequences as given in any one of SEQ ID NO 1 to 10; or

(43) (c) a nucleic acid specifically hybridizing with any of the DNA sequences as given in any one of SEQ ID NO 1 to 10; or

(44) (d) a fragment of any of the nucleic acids as defined in (a) to (c), which fragment is capable of driving and/or regulating expression.

(45) Suitable variants of any one of SEQ ID NO 1 to 10 encompass homologues which have in increasing order of preference at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with any one of the nucleic acids as represented in SEQ ID NO 1 to 10.

(46) The percentage of identity may be calculated using an alignment program. Preferable, a pair-wise global alignment program may be used. This algorithm maximizes the number of matches and minimizes the number of gaps.

(47) Search and identification of homologous nucleic acids, would be well within the realm of a person skilled in the art. Such methods involve screening sequence databases with the sequence provided by the present invention, for example any one of SEQ ID NO 1 to 10. Useful sequence databases include but are not limited to Genbank the European Molecular Biology Laboratory Nucleic acid Database (EMBL) or versions thereof, or the MIPS database. Different search algorithms and software for the alignment and comparison of sequences are well known in the art. Such software includes, for example GAP, BSETFIT, BLAST, FASTA and TFASTA. Preferably BLAST software is used, which calculates percent sequence identity and performs a statistical analysis of the similarity between the sequences. The suite of programs referred to as BLAST programs has 5 different implementations: three designed for nucleotide sequence queries (BLASTN, BLASTX and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN). The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information.

(48) The sequences of the genome of Arabidopsis thaliana and the genome of Oryza sativa are now available in public databases such as Genbank. Other genomes are currently being sequenced. Therefore, it is expected that as more sequences of the genomes of other plants become available, homologous promoters may be identifiable by sequence alignment with any one of SEQ ID NO 1 to SEQ ID NO 8. The skilled person will readily be able to find homologous promoters from other plant species, for example from other crop plants, such as maize. Homologous promoters from other crop plants are especially useful for practicing the methods of the present invention in crop plants.

(49) One example of homologues having at least 90% sequence identity in a continuous stretch with any one of SEQ ID NO 1 to 10 are allelic variants of any one of SEQ ID NO 1 to 10. Allelic variants are variants of the same gene occurring in two different individuals of the same species and usually allelic variants differ by slight sequence changes. Allelic variants may encompass Single Nucleotide Polymorphisms (SNPs) as well as Small Insertion/Deletion Polymorphisms (INDELs). The size of INDELs is usually less than 100 bp. SNPs and INDELs form the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.

(50) Homologues suitable for use in the methods according to the invention may readily be isolated from their source organism via the technique of PCR or hybridization. Their capability of driving and/or regulating expression may readily be determined, for example, by following the methods described in the examples section by simply substituting the sequence used in the actual example with the homologue.

(51) Also encompassed within the present invention are promoters, having a fragment of any of the nucleic acids as presented by any one of SEQ ID NO 1 to 10 or variants or compliments thereof as described hereinabove.

(52) Suitable fragments may range from at least about 20 base pairs or about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 base pairs, up to about the full length sequence of the invention. These base pairs are typically immediately upstream of the transcription initiation start, but alternatively may be from anywhere in the promoter sequence.

(53) Suitable fragments useful in the methods of the present invention may be tested for their capability of driving and/or regulating expression by standard techniques well known to the skilled person or by the following method described in the Example section.

(54) The promoters as disclosed in any one of SEQ ID NO 1 to 10, preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or the complement thereof are isolated as nucleic acids of approximately 2 kb from the upstream region of particular rice coding sequences (CDS). Generally, a promoter may comprises from coding sequence to the upstream direction: (i) an 5 UTR of pre-messenger RNA, (ii) a minimal promoter having the transcription initiation element (Inr) and more upstream a TATA box, and (iii) may contain regulatory elements that determine the specific expression pattern of the promoter.

(55) The promoter is preferably a plant-expressible promoter.

(56) The expression pattern of the promoters according to the present invention was studied in detail and it was found that many of them were stress inducible. The stress can be induced by abiotic stress factors or biotic stress. Typically, abiotic stress can be induced by environmental factors such as water, temperature variation such as heat stress or cold stress, salinity and the like. Biotic stress can be induced by an infection of a bacterium, virus or fungi such as Fusarium species known to a person skilled in the art. The invention also provides for abiotic stress induced by a biotic stress i.e. an infection caused by an organism.

(57) The inventors surprisingly found that the nucleic acid SEQ ID NO 1 can be expressed under heat and cold stress. SEQ ID NO2, SEQ ID NO 4, and/or SEQ ID NO 8 can be expressed under salt, water, heat and cold stress. SEQ ID NO 5 and/or SEQ ID NO 6 can be expressed under water, heat and cold stress. SEQ ID NO 3 and/or SEQ ID NO 9 can be expressed under water and salt stress and SEQ ID NO 7 can be expressed under water and cold stress. The nucleic acid SEQ ID NO 6 expressed under salt, water, heat and cold stress; SEQ ID NO 3 and/or SEQ ID NO 9 expressed under water and salt stress; and SEQ ID NO 7 expressed under salt, water and cold stress is preferred. Accordingly, the present invention provides “stress inducible” promoters.

(58) Alternatively and/or additionally, some promoters of the present invention display a constitutive expression pattern. For example, SEQ ID NO 1 showed strong expression in leaf tissue as well as weak expression in roots, flowers and young spikelet. Further, SEQ ID NO 1 showed expression after heat and cold stress. Accordingly, the present invention provides a promoter as described hereinabove, which can be a constitutive promoter.

(59) The “expression pattern” of a promoter is not only influenced by the spatial and temporal aspects, but also by the level of expression. The level of expression is determined by the so-called “strength” of a promoter. Depending on the resulting expression level, a distinction is made herein between “weak” or “strong” promoters.

(60) The present invention also provides an expression cassette, a vector which may be a transformation vector or a plant expression vector having a genetic construct as described above.

(61) Typically, a plant expression vector according to the present invention comprises a nucleic acid of any one of SEQ ID NO 1 to 10, preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or a variant thereof as described hereinabove, optionally operably linked to a second nucleic acid. Typically, a plant expressible vector according to the present invention further comprises T-DNA regions for stable integration into the plant genome (for example the left border and the right border regions of the Ti plasmid). FIG. 1A shows a map of the vector having the promoter of the present invention cloned in pMDC 164.

(62) The genetic constructs of the invention may further comprise a “selectable marker”. Furthermore, the present invention encompasses a host cell having a promoter, or a genetic construct, or an expression cassette, or a transformation vector or an expression vector according to the invention as described hereinabove. In particular embodiments of the invention, the host cell is selected from bacteria, algae, fungi, yeast, plants host cells.

(63) In one particular embodiment, the invention provides a transgenic plant cell having a promoter according to the invention, or a nucleic acid, or a genetic construct, or an expression cassette, or a transformation vector or an expression vector according to the invention as described hereinabove. Preferably said plant cell is a dicot plant cell or a monocot plant cell more preferably a cell of any of the plants as mentioned herein. The dicot plant cell according to the present invention can be cotton, chilli, cauliflower, tomato, or brinjal. The monocot plant cell according to the present invention can be rice, wheat, corn, sorghum, or pearl millet. Preferably, in the transgenic plant cell according to the invention, the promoter or the genetic construct of the invention is stably integrated into the genome of the plant cell.

(64) The invention also provides a method for the production of a transgenic plant, having

(65) (a) introducing into a plant cell a promoter, for example any one of SEQ ID NO 1 to SEQ ID NO 10, preferably SEQ ID NO 3 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 9 or variant or fragment thereof, or a genetic construct, or an expression cassette, or a transformation vector or an expression vector according to the present invention and as described hereinabove, and

(66) (b) optionally cultivating said plant cell under conditions promoting plant growth.

(67) Introducing the promoter (isolated nucleic acid sequence) of the present invention, or genetic construct or expression cassette, or transformation vector or expression vector, into a host cell (e.g. plant cell) is preferably achieved by transformation.

(68) Transformation of a plant species is now a fairly routine technique. Advantageously, any of several transformation methods may be used to introduce the nucleic acid of the invention into a suitable ancestor cell. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, and transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts; electroporation of protoplasts; microinjection into plant material; DNA or RNA-coated particle bombardment infection with (non-integrative) viruses and the like. A preferred transformation method for the production of transgenic plant cells according to the present invention is an Agrobacterium mediated transformation method.

(69) In some embodiments provided are transgenic rice plants having any one of the promoters of the present invention preferably produced via Agrobacterium mediated transformation using any of the well-known methods for rice transformation.

(70) Generally after transformation, plant cells or cell groupings are selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest (which could be under the control of any of the promoters of the present invention), following which the transformed material may be cultivated under conditions promoting plant growth.

(71) The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art. Accordingly, the method for the production of a transgenic plant as described hereinabove, may further comprise regenerating a plant from the plant cell in which the promoter or fragments thereof is introduced.

(72) The present invention further provides a plant having a plant cell as described hereinabove. The plants may also be able to grow, or even reach maturity including for example fruit production, seed formation, seed ripening and seed setting.

(73) Furthermore, progeny may be produced from these seeds, which progeny may be fertile. Alternatively or additionally, the transformed and regenerated plants may also produce progeny by non-sexual propagation such as cloning, grafting. The generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1) transformed plant may be selfed to give homozygous second generation (or T2) transformants, and the T2 plants further propagated through classical breeding techniques.

(74) The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (for example all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (for example in plants, a transformed rootstock grafted to an untransformed scion).

(75) Following DNA transfer and growth of the transformed cells, putatively transformed plant cells or plants may be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organization. Alternatively or additionally, expression levels or expression patterns of the newly introduced DNA may be undertaken using northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.

(76) The present invention clearly extends to plants obtainable by any of the methods according to the present invention, which plants comprise any of the isolated promoters or the constructs of the present invention. The present invention clearly extends to any plant parts and propagules of such plant. The present invention extends further to encompass the progeny of a primary transformed cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced in the parent by the methods according to the invention. The invention also extends to harvestable parts of a plant, such as but not limited to seeds, leaves, fruits, flowers, stem cultures, stem, rhizomes, roots, tubers, bulbs and cotton fibers.

(77) The present invention provides a method for regulating stress in plants including transforming a plant cell with a nucleic acid sequence of interest operably linked to a promoter of the present invention, or transforming the plant or plant cell with an expression cassette or a transformation vector or an expression vector having the genetic construct of the invention and contacting the plant or plant cell with a substance or organism that induces the expression of the promoter.

(78) The invention further provides a method for driving and/or regulating expression of a nucleic acid in a plant or plant cell, having: a) subjecting a transgenic plant having the genetic construct having nucleic acid sequence of isolated nucleic acid of the present invention operably linked to a GUS gene to a stress condition such as water stress, heat stress, cold stress and/or salinity stress; and b) investigating the expression of said nucleic acid sequences patterns in the plants by observing the GUS stained plant tissues; and c) selecting the plants displaying GUS staining;
where the nucleic acid SEQ ID NO 1 can be expressed under heat and cold stress; SEQ ID NO2, SEQ ID NO 4, and/or SEQ ID NO 8 can be expressed under salt, water, heat and cold stress; SEQ ID NO 5 and/or SEQ ID NO 6 can be expressed under water, heat and cold stress; SEQ ID NO 3 and/or SEQ ID NO 9 can be expressed under water and salt stress and SEQ ID NO 7 can be expressed under water and cold stress. According to an embodiment of the invention, the nucleic acid SEQ ID NO 6 expressed under salt, water, heat and cold stress; SEQ ID NO 3 and/or SEQ ID NO 9 expressed under water and salt stress; and SEQ ID NO 7 expressed under salt, water and cold stress is preferred.

(79) The present invention provides that the stress can be induced by various ways. In one embodiment, according to the present invention, plants can be subjected to water stress by withholding water to the plants for about 1 to 14 days, preferably 5 to 9 days. The stress can be induced by varying the temperature, for example, the plants can be subjected to heat stress by keeping the plants in an incubator at a temperature of about 35° C. to 42° C. for 2 to 8 hours each day for about 2 to 6 days according to an embodiment of the present invention. Preferably, the plants can be subjected to the heat stress by keeping the plants in the incubator at a temperature of about 42° C. for about 8 hours each day for about 2 to 6 days. Similarly, subjecting the plants to cold stress can be by keeping them in an incubator at a temperature to 4° C. to 8° C. for 2-8 hours. Preferably, the plants can be subjected to cold stress by keeping them in an incubator at a temperature of about 4° C. for about 8 hours each day for about 2 to 6 days. The plants can be subjected to salt stress by irrigating the plants with a solution containing about 100 to 200 Mm NaCl for about 2 to 12 hours in an embodiment of the present invention. Preferably, the plants can be subjected to salt stress by irrigating the plants with a solution containing about 150 mM NaCl for about 3 to 12 hours. The present invention also includes abiotic stress induced by a biotic factor such as an infection by organisms such as bacteria, virus, fungi such as Fusarium.

(80) The observation of the expression patterns of the isolated nucleic acid sequences, i.e. the promoters of the present invention can be made by visual inspection of the GUS stained tissues such as roots tissues, leaves, or flower parts (such as anthers). Preferably, sampling can be done once before the start of subjecting the plants to a stress and once after the stress test. A person skilled in the art would understand that the expression of some promoters may be weak in certain tissues and may only be visible with very sensitive detection methods. GUS staining and GUS quantification protocols are known to a person skilled in the art.

(81) Accordingly, the present invention provides a method as described above, wherein the expression can be a constitutive expression or a stress-inducible expression. For these embodiments, reference is made to the example section where the specific expression patterns of the promoters according to the invention are described and where different types of tissue-specific expression are detailed.

(82) The present invention further encompasses the use of an isolated nucleic acid as defined hereinabove to drive and/or regulate expression of an operably linked nucleic acid.

(83) The person skilled in the art will recognize that provision of sequences SEQ ID NO 1 to 10, readily makes available the tools to isolate related promoters, which may have substantial sequence identity to any of SEQ ID NO 1 to 10.

Example 1

(84) Probe Sets for Highly Upregulated Genes Under Various Stress Condition and Arriving at Promoters

(85) A unified gene expression resource like PLEXdb (Plant Expression Database) was used to identify highly up regulated probe sets by comparing different abiotic treatments viz drought, salinity etc. from the selected experiments. By considering each and every combination of every experiment, 8 fold probeset data generated and redundant probesets were deleted. The probesets having higher frequency of occurrence were considered for this study. Predicted mRNA sequence and putative promoter sequences were retrieved from RiceXPro (The Rice Expression Profile Database). The gene IDs and designated promoter name are listed in Table 1.

(86) TABLE-US-00001 TABLE 1 Designated promoter name and Gene ID Seq. ID. Promoter No. designation Gene ID 1 RP2H Os08t0442900-01 2 RP9H Os11t0181200-01 3 RP10H Os08t0286500-01 4 RP4 Os05t0542500-01 5 RP7 Os06t0324400-01 6 RP8 Os05t0550600-02 7 RP10 Os03t0245800-02 8 RP11 Os03t0330200-00 9 RP3H Os11t0533400-01 10 RP8H Os03t0133100-01
Identification and Isolation of the Promoter Regions of Rice Genes

(87) The promoter regions of these genes were isolated as the DNA region spanning about 2 kb upstream of the translation initiation codon (i.e. first ATG), which codon was excluded. The promoter regions were isolated from genomic DNA of Oryza sativa Indica rice line IR-58025 B developed by International Rice Research Institute (IRRI), Philippines via PCR using specific primers and high fidelity DNA polymerase.

(88) These specific primers comprise CACC site for site directed ligation. These specific primers are herein represented as SEQ ID NO 11 to 30 and are listed in Table 2. Conditions for PCR were as follows: 1 cycle of 3 min at 95° C., 35 cycles of 30 sec at 95° C., 30 sec at 50-60° C. and 2 min at 72° C., and 1 cycle of 7 min at 72° C. [annealing temperature varied for each promoter]. The length of the expected PCR fragment and the annealing temperatures are indicated in Table 3. The corresponding PCR fragment was purified from the PCR reaction mix via gel electrophoresis and subsequent purification with HiYield Gel/PCR DNA Mini kit (Real Genomics).

(89) TABLE-US-00002 TABLE 2 Primers of respective promoters Seq. ID. No. Oligo Name 5′<--------------SEQUENCE-------------->3′ Length 11 RP2H Forward Primer CACCGCGGCCGCTCTCTGTGGCTGTTGTGTC 31 12 RP2H Reverse Primer CTGCAGTGCTCCTCTGCTGTACTG 24 13 RP9H Forward Primer CACCGCGGCCGCCCATTGCTATCTTCTACCG 31 14 RP8H Reverse Primer CCATGGCGCTCTCTCTTGCAGTTAAT 26 15 RP10H Forward Primer CACCGTCGACACTAACTAAGAATCAAATGC 30 16 RP10H Reverse Primer CCATGGCACGATGATTTCTCCCCTC 25 17 RP4 Forward Primer CACCGCGGCCGCGGGTTAATGTAGTTCTTGG 31 18 RP4 Reverse Primer CTGCAGGAATGTTAGAACTCTGATGG 26 19 RP7 Forward Primer CACCGCGGCCGCGCGATTTGGTCAGCTTCT 30 20 RP7 Reverse Primer ATTCCATGGCTCTCCCAAGTCCCAACTA 28 21 RP8 Forward Primer CACCGCGGCCGCGTTTTAGAGTTGGACACAG 31 22 RP8 Reverse Primer ATTGTCGACCTGAAATTAAGCTGCGAGA 28 23 RP10 Forward Primer CACCGTCGACTAGTGACTACCAATGCTC 28 24 RP10 Reverse Primer CCATGGACAGAGTAGAGAGGAAATC 25 25 RP11 Forward Primer CACCGCGGCCGCTGGATTCATTGGATTGGGC 31 26 RP11 Reverse Primer ATTGTCGACTTGTTCCTCTTCTCTGGTG 28 27 RP3H Forward Primer CACCGCGGCCGCGATCACGAATATCAACGCC 31 28 RP3H Reverse Primer CTGCAGTTTGGAGCGGAGAGAGTT 24 29 RP8H Forward Primer CACCGCGGCCGCGGTTGCATTACACTGACAG 31 30 RP8H Reverse Primer CTGCAGTGAGCTGAGTTGAGTGAGT 25

(90) TABLE-US-00003 TABLE 3 Annealing temperature and Length of the PCR fragment Sr. Promoter Annealing Length of the No. designation temperature PCR fragment 1 RP2H 63 1988 2 RP9H 60 2133 3 RP10H 63 2463 4 RP4 61 2035 5 RP7 67 1949 6 RP8 67 1881 7 RP10 65 2119 8 RP11 67 1977 9 RP3H 60 2047 10 RP8H 60 2051

Example 2

(91) Cloning of Promoter-Gus Reporter Vectors for Plant Transformation

(92) The purified PCR fragments of Example 1 corresponding to the promoter regions of the present invention, were cloned into the pENTR™/D-TOPO entry plasmid of the Gateway system (Life Technologies) using the site specific ligation. The identity and base pair composition of the cloned insert was confirmed by sequencing and additionally, the resulting plasmid was tested via restriction digests. In order to clone each of the promoters of the present invention in front of a reporter gene, each entry clone of Example 1 was subsequently used in an “LR recombination reaction” (Gateway) with the destination vector pMDC 164. This destination vector was designed to operably link each promoter of the present invention to the Escherichia coli beta-glucuronidase (GUS) gene via the substitution of the Gateway recombination cassette in front of the GUS A gene. Furthermore this destination vector is suitable for transformation of plants and comprises within the T-DNA left and right borders the resulting promoter-GUS cassette and selectable marker and screenable marker cassettes (see FIGS. 1A-1B). The resulting reporter vectors, having a promoter of the present invention operably linked to GUS, are subsequently transformed into Agrobacterium strain EHA 105 and subsequently into plants of rice line IR-58025 B developed by International Rice Research Institute (IRRI), Philippines using transformation techniques as mentioned below.

(93) Rice Transformation Protocol

(94) Agrobacterium—transformation of rice was performed by method as described in Hiei et al., 2006 with some modification.

(95) Transformation Protocol:

(96) Freshly isolated rice immature embryos from plants grown in a greenhouse (Dawalwadi, Mahyco), after 10-12 days' post anthesis were inoculated with A. tumefaciens EHA105 carrying pMDC164 promoter construct.

(97) Three days before infection, Agrobacterium strain EHA 105 carrying pMDC164 promoters: GUS were streaked on LB agar with antibiotic selection (Chloramphenicol 10 mg/L and Kanamycin 50 mg/L). and incubated at 28° C.

(98) Just before infection, grown Agrobacterium culture scrapped from plate and suspended in (AA) infection medium and ˜1.0 OD at 600 nm (stationary phage) used for infection.

(99) Seed sterilization: seeds were de-husked by hand and sterilized in 70% ethanol for 30 seconds and in 1.5% sodium hypochlorite solution for 5 minutes. The immature seeds were rinsed several times in sterile water, and immature embryos of 1.5 mm in length were collected under a stereoscopic dissection microscope.

(100) 5 μl of suspended Agrobacterium-culture dropped on scutellum of freshly isolated immature embryo incubated for 15 minutes then co-cultivated on (NBA)s medium for 4-6 days in dark at 25° C.

(101) Resting step: After the co-cultivation, elongated shoots were removed from the immature embryos by a scalpel and the immature embryos were cultured on (NBM) medium that contained cefotaxime (250 mg/L) and carbenicillin (100 mg/L) with the scutellum-side up for 5 days

(102) Selection step: After resting step immature embryos were transferred on selection medium NBM with cefotaxime (250 mg/L) and hygromycin (50 mg 1/L) for 2 weeks followed by second selection of two weeks on the fresh NBM medium with cefotaxime (250 mg/L) and hygromycin (50 mg 1/L).

(103) Pre-regeneration step: Calluses clearly resistant to hygromycin derived from the scutella were transferred to a pre-regeneration medium (NBPR) that contained hygromycin (40 mg/L) and cefotaxime (250 mg/L) and cultured for 10 days.

(104) Regeneration step: Proliferating calluses with green spots were cultured on an (RNM) regeneration medium that contained hygromycin (30 mg/L) and cefotaxime (250 mg/L).

(105) Rooting: regenerated plantlets were cultured on an (MSN)1.5 rooting medium that contained hygromycin (30 mg/L).

(106) In all of the following steps, cultures were incubated at 28° C. under 16 hrs. light and 8 hrs. dark.

(107) The plants were hardened to soil in pots and grown to maturity in a greenhouse.

(108) Media Composition:

(109) 1] AA-infection: AA salts and amino acids (Toriyama and Hinata, 1985), B5 vitamins, vitamin assay casamino acids (0.5 g/L), sucrose (20 g/L), D-glucose (10 g/L), acetosyringone (0.1 mM), pH 5.2

(110) 2] NBM: N6 major salts, B5 minor salts and vitamins, vitamin assay casamino acids (0.5 g/l), L-proline (0.5 g/L), L-glutamine (0.3 g/L), D-maltose (20 g/L), D-mannitol (36 g/L), 2,4-D (2 mg/L), NAA (1 mg/L), BA (0.2 mg/L), Gelrite (5 g/L), pH 5.8

(111) 3] NBPR: N6 major salts, B5 minor salts and vitamins, vitamin assay casamino acids (0.5 g/L), L-proline (0.5 g/L), L-glutamine (0.3 g/L), D-maltose (30 g/L), 2,4-D (2 mg/L), 1 NAA (1 mg/L), BA (1 mg/L), Gelrite (7 g/L), pH 5.8

(112) 4] RNM: N6 major salts, B5 minor salts and vitamins, vitamin assay casamino acids (0.3 g/L), L-proline (0.3 g/L), L-glutamine (0.3 g/L), D-maltose (30 g/L), NAA (1 mg/L), BA (3 mg/L), agarose Type I (4 g/L), pH 5.8

(113) 5] MSN1.5: Full strength of MS major salts, MS minor salts, MS vitamins and myo-inositol (100 mg/L), MS Cacl2, MS iron, (Murashige and Skoog, 1962), sucrose (30 g/L), NAA (1.5 mg/L), phytagel (3 g/L), pH 5.8

Example 3

(114) Expression Patterns of the Promoter-Gus Reporter Cassette in Plants Growth and Harvest of Transgenic Plants or Plant Parts at Various Stages

(115) For each promoter-GUS reporter construct T0 transgenic rice plants were generated from transformed cells. Plant growth was performed under normal conditions.

(116) The GUS staining analyses were performed on T0 plants originating from the transformed tissues. The stability of promoter activity in the next generations or progeny plants of the original T0 plant the so-called T1 and T2 plants was evaluated as follows. The T0 plant transformed with the reporter constructs as mentioned in the above paragraphs of Example 2, were grown until maturity of which the seeds (T1 seeds) were harvested and sown to generate progeny T1 plants. These plants were analyzed and the T1 plants were allowed to reach maturity and to set T2 seeds.

(117) The expression pattern of the promoters of the present invention was studied in T0 plants, T1 seeds, T1 plants.

(118) Expression Patterns of the Promoters of the Present Invention Under Different Stress Conditions

(119) Rice T1 seeds sown in sandy soil were kept in a culture room with light intensity maintained at 12,000 to 14,000 lux and with a 16-h light/8-h dark cycle at 28° C. After germination, one month old plants were subjected to stress conditions.

(120) Water stress: Water was withheld from transgenic and control plants for 6 days (until almost all the leaves in the pot became completely rolled). Plants were then recovered by providing water for 5 to 9 days. Sampling was done once before the start of water withholding experiment and when the leaves start to roll.

(121) Heat stress: Plants were subjected to heat stress by keeping them in a BOD incubator and adjusting the temperature to 42° C. for 8 hrs. each day for 6 days (until almost all the leaves in the pot became completely rolled).

(122) Salt stress: plants were irrigated with a solution containing 150 mM NaCl for 3 to 12 hrs. for salt stress.

(123) Cold stress: Plants were subjected to cold stress by keeping them in a BOD incubator and adjusting the temperature to 4° C. for 8 hrs. each day for 6 days (until almost all the leaves in the pot became completely rolled).

(124) Sampling was done once before the start of the stress assay and designated as E0 (Initial) and after exposing to stress when the leaves starts to roll and designated as Ef (final).

(125) The following paragraphs describe the observed expression patterns of the promoters of the present invention in more detail. The observations are based on the visual inspection of the GUS stained tissues as described above. It is to be understood that for some promoters expression may be weak and that expression in certain tissues may only be visible with very sensitive detection methods.

(126) Promoter 1

(127) RP2H construct (SEQ ID NO. 1) was investigated. 10 plants of three independent events in T1 generation were analyzed. Strong expression in leaf tissue was observed as well as weak expression in roots, expression was observed in flowers, more particularly in lemma of young spikelet. It was concluded that the promoter is suitable for expression in young tissue, more preferably in young, developing or expanding tissue, more preferably in green tissue. The expression level slightly decreased after water stress and salt stress. There was a slight increase after heat and cold stress. So it was concluded that RP2H behaves like a constitutive promoter which also shows inducibility to temperature variations.

(128) Promoter 2

(129) RP9H construct (SEQ ID NO. 2) was investigated. It was observed that RP9H drives expression of Gus gene, and there was no expression or expression level was very low, therefore not invisible to the naked eye when not exposed to any stress. It was also observed that the promoter can drive expression under various stress conditions. There was significant increase in expression level after water stress. There was 4 fold increase in the expression under salt stress, 28 fold increase under heat stress and cold stress showed 55 fold increase. It is concluded that RP9H is a stress inducible promoter which can increase the expression level of a gene under various stress condition.

(130) Promoter 3

(131) RP10H construct (SEQ ID NO. 3) was investigated. No visible expression was observed in the leaves when the promoter drives Gus gene under no stress condition. RP10H was capable of driving expression in flowers, more particularly in lemma of young spikelet. The expression level increased after exposing to water stress and salt stress. There was a 6 fold increase after water stress in the expression level of Gus gene. After salt stress expression increased to 4 fold after 2 hours and 16 fold after 5 hours. No expression after heat and cold stress was observed. It is concluded that RP10H is water and salt stress inducible promoter.

(132) Promoter 4

(133) RP4 construct (SEQ ID NO. 4) was investigated. Weak expression was observed in the leaves initially. The expression level increased to 16 fold after exposing the plants to water stress, 3 fold increase to salt stress, 0.4 fold increase to heat and 3 fold increase to cold stress after 5 hrs of stress).

(134) Promoter 5

(135) RP7 construct (SEQ ID NO. 5) was investigated. Weak expression was observed in the leaves initially. The expression level increased significantly after exposing the plants to heat stress (2 fold increase). There was a slight increase in the expression under water and cold stress when Gus gene was driven by RP7. Under salt stress the expression increased initially, however decreased after 5 hour of stress.

(136) Promoter 6

(137) RP8 construct (SEQ ID NO. 6) was investigated. Weak expression was observed in the leaves initially. The expression level increased after exposing the plants to water stress (1.4 fold increase). Inducibility to heat (1 fold increase) and cold stress (2 fold increase) was also observed. There was a decrease in expression level after 5 hours of salt stress. It was concluded that RP8 was water stress inducible promoter showing significant inducibility to heat and cold stress as well.

(138) Promoter 7

(139) RP10 construct (SEQ ID NO. 7) was investigated. Weak expression was observed in the leaves initially. The expression level increased to 2.5 fold after exposing the plants to water stress. Inducibility to cold stress was observed with 8 fold increase). There was a very little increase after heat stress and even though there was 1 fold increase after 2 hours of salt stress the inducibility decreased gradually. It was concluded that RP10 was a water and cold stress inducible promoter.

(140) Promoter 8

(141) RP11 construct (SEQ ID NO. 8) was investigated. Weak expression was observed in the leaves initially. The expression level increased to 4.2 fold after exposing the plants to water stress. A steady increase up to 2.8-fold was observed after salt stress after 5 hours). The promoter also showed inducibility to heat and cold stress. After 2 hrs of heat stress there was a 4 fold increase in expression level of Gus which increased to 32 fold after 5 hours. Also a 2 fold increased after 5 hours of cold stress. It was concluded that RP11 was a stress inducible promoter which can increase the expression level of a gene under various stress condition.

(142) Promoter 9

(143) RP3H construct (SEQ ID NO. 9) was investigated. Weak expression was observed in the leaves initially. The expression level significantly increased after exposing the plants to water stress (38 fold increase). There was 4 fold increase in expression level when exposed to 150 mM salt stress for 5 hrs. No significant increase after heat and cold stress was. It was concluded that RP3H is a water and salt stress inducible promoter.

(144) Promoter 10

(145) RP8H construct (SEQ ID NO. 10) was investigated. When RP8H drove the expression of Gus gene, it was observed that there was wither no expression or expression level was very low, therefore not invisible to the naked eye when not exposed to any stress. Also no significant increase in Gus expression was seen when exposed to heat, cold, salt and water stress.

(146) GUS Staining Protocol

(147) The plant material was covered by a Gus solution and incubated up to 16 hours at 37° C. Gus Buffer [phosphate buffer (50 ml), Triton X (0.1% 10 ml), 50 mM Potassium ferricyanate (2 ml), 50 mM Potassium ferrocyanide (2 ml), methanol (20 ml) in distilled water (15 ml) and X-Gluc stock (1 ml of X-Gluc (50 mg) in DMF (1 ml)]. Chlorophyll was extracted by washing with 70% ethanol (for 8 hours).

(148) Gus expression in leaf tissue of T1 plants are shown in FIGS. 2-7, there was slight or no visible GUS expression observed in the tissues of plants before they were exposed to stress as can be seen in (A) images, however there was marked visible increase in GUS expression in tissues of plants after they were exposed to water stress as can be seen in (B) images.

Example 4

(149) GUS Quantification

(150) Quantification of GUS activity was performed by flurometric assay described in Jefferson et al., 1987 (Jefferson et al., (1987), EMBOJ., 6, 3901-3907) and Gallagher 1992 (Gallagher, S. R. (1992) Academic Press, Inc., New York, pp. 47-59).

(151) Plant extract: 100 mg leaf tissues were ground in 200 μl of extraction buffer [50 mM NaPO4 pH 7.0, 10 mM EDTA, 0.1% Triton X-100, 0.1% sodium lauryl sarcosine, 10 mM β-mercaptoethanol]. The leaf tissue was then centrifuged at 12000 rpm for 15 minutes at 4° C. to remove cell debris. Supernatant was transferred to a fresh tube.

(152) MUG assay: 20 μl homogenates (approximately 5 μg of protein) were mixed with 80 μl of GUS assay buffer [8.8 mg MUG was dissolved in 10 ml (2 mM) extraction buffer. The buffer was freshly prepared just before use]. The mixture was vortexed and incubated at 37° C. for 30 minute and 60 minute in a water bath. Each reaction mixture (2 μl of) and of each MU standard were mixed with stop buffer (475 μl [200 mM Na2CO3 (21.2 gm/L) pH 11.2]). 200 μl of above reaction mixture from above step were loaded by duplicated manner in a micro-titer plate and florescence were determined, excitation at 365 nm and emission at 444 nm.

(153) picoMole MU / .Math.g of protein / minute = picoMole Mu / well amount of protein in 10 .Math. l × minute of assay

(154) Concentrated MU calibration stock solution: Mix 9.9 mg in 50 ml D/W to prepare 1 mM MU stock. Make 1:10 dilution to get 100 μM MU stock and 1:50 dilution to get 20 μM stock solution. For standard curve used 0, 4, 8, 12, 20, 40, 100, 250, 500 pmol MU.

(155) Gus quantification data is presented in Table 4 and 5.

(156) TABLE-US-00004 TABLE 4 Gus Quantification data Salt stress (150 mM) pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control 18.06 20.62 5.58 RP2H 212.30 116.90 116.90 RP3H 21.70 122.30 125.30 RP8H 0 0 0 RP9H 1.10 6.47 90.80 RP10H 4.74 26.29 83.40 RP4 45.23 54.82 195.00 RP7 229.41 254.31 193.02 RP10 118.06 263.41 47.23 RP11 45.05 89.15 171.79

(157) TABLE-US-00005 TABLE 5 Gus Quantification data Salt stress (150 mM) pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control   18.05958754   20.61898005    5.582652 RP8 1987.289516 1672.672257 2792.164

(158) TABLE-US-00006 TABLE 6 Gus Quantification data-Table 6 represents significant increase in the Gus 5 expression pattern of RP9H, RP4, RP7, RP8, RP2H and RP11 after heat stress Heat stress pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control  4.07  3.46  3.77 RP9H  5.98  0.00 176.26 RP4 105.28 34.95 152.48 RP7  35.83 52.18 107.73 RP8  16.28 32.28  34.58 RP10  8.62 11.83  10.62

(159) TABLE-US-00007 TABLE 7 Gus Quantification data-Table 7 represents significant increase in the Gus expression pattern of RP9H, RP4, RP7, RP8, RP2H and RP11 after heat stress Heat stress pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control  4.07  3.46   3.77 RP2H 818.23 671.34 1334.39 RP11  8.98  48.97  296.38

(160) TABLE-US-00008 TABLE 8 Gus Quantification data-Table 8 represents the Gus expression pattern of RP2H, RP3H, RP8H, RP9H, RP1OH, RP4, RP7, RP8, RP10 and RP11 to 2 hours and 5 hours of cold stress. Cold stress pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control 0 0 0 RP3H 40.48 30.40 0.00 RP9H 0 1.63 55.03 RP10H 1.243524255 2.096052367 2.429907 RP4 55.84 170.33 278.07 RP7 173.54 182.46 231.65 RP11 9.27 15.18 27.94

(161) TABLE-US-00009 TABLE 9 Gus Quantification data-Table 9 represents the Gus expression pattern of RP2H, RP3H, RP8H, RP9H, RP10H, RP4, RP7, RP8, RP10 and RP11 to 2 hours and 5 hours of cold stress. Cold stress pmole MU/mg protein/min Sample 0 hr 2 hr 5 hr Control 0 0 0 RP2H 1138.486529 1223.994169 2295.215 RP8 310.3441585 290.9299799 981.2915 RP10 46.52182127 94.33485234 436.2004

(162) TABLE-US-00010 TABLE 10 Gus Quantification data-Table 10 represents the significant increase in the Gus expression pattern of RP10, RP8, RP4, RP10H, RP11 after water stress. Water Stress pmole MU/mg protein/min Before After Sample Stress Stress 25B (ve) 1.886 12.995 10-1A 60.663 212.883 8-2B 333.293 801.69 4-1A 101.512 1787.8 10H-4B 31.26 242.7 11-8A 37.726 199.423

(163) TABLE-US-00011 TABLE 11 Gus Quantification data-Table 11 represents the significant increase in the Gus expression pattern of RP2H, RP3H, RP9H, RP10H, RP7 after water stress. Water Stress pmole MU/mg protein/min Before After Sample Stress Stress Control 1.886 12.995 RP2H 1241.50 935.49 RP3H 3.40 134.55 RP9H 0 438.37 RP10H 31.26 242.7 RP7 1457.35 2644.40
Observations/Inferences of the Above Tables

(164) Gus expression analysis of individual promoters was quantified by flurometric assay before and after water, salt, heat and cold stresses. FIGS. 8 and 9 depicts the values (i.e. pmole MU/mg protein/min) of the Gus quantification after exposing the plants OF promoter RP2H, RP3H, RP8H, RP9H, RP10H, RP4, RP7, RP8, RP10 and RP11 to 2 hours and 5 hours of salt stress. RP3H, RP9H, RP10H, RP4, RP8, and RP11 showed significant increase in the Gus expression pattern after exposing it to salt stress, whereas no significant increase in the Gus expression pattern was observed in RP2H, RP8H, RP7 and RP10 (represented by the values of table 4 and 5).

(165) Table 6 and 7 represents significant increase in the Gus expression pattern of RP9H, RP4, RP7, RP8, RP2H and RP11 after heat stress. RP 10 showed no significant increase.

(166) Table 8 and 9 represents the Gus expression pattern of RP2H, RP3H, RP8H, RP9H, RP10H, RP4, RP7, RP8, RP10 and RP11 to 2 hours and 5 hours of cold stress.

(167) Table 10 represents the significant increase in the Gus expression pattern of RP10, RP8, RP4, RP10H, RP11 after water stress.

(168) Table 11 represents the significant increase in the Gus expression pattern of RP2H, RP3H, RP9H, RP10H, RP7 after water stress.

(169) From these tables it was concluded that RP2H behaved like a constitutive promoter which also showed inducibility to temperature variations i.e. heat and cold stress. RP9H was a stress inducible promoter which increased the expression level of a gene under salt, water, heat and cold stress condition. RP10H was water and salt stress inducible promoter. RP4 was a stress inducible promoter which increased the expression level of a gene under salt, water, heat and cold stress condition. RP7 was water, heat and cold stress inducible promoter. RP8 was water stress inducible promoter showing significant inducibility to heat and cold stress as well. RP10 is water and cold stress inducible promoter. RP11 was a stress inducible promoter which increased the expression level of a gene under various stress condition. RP3H was a water and salt stress inducible promoter. RP8H did not significantly drive Gus expression under salt, water, heat and cold stress condition.