Cell-permeable (CP)-Cas9 recombinant protein and uses thereof
11319546 · 2022-05-03
Assignee
Inventors
Cpc classification
C07K19/00
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C07K2319/10
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to providing cell-permeable (CP)-Cas9 recombinant protein and uses thereof. Preferably, the CP-Cas9 recombinant protein may be used as Cas9 nuclease for CRISPR/Cas9 system by utilizing the platform technology for macromolecule intracellular transduction.
Claims
1. A Cell-Permeable (CP)-Cas9 recombinant protein, which comprises a Cas9 protein and at least one advanced macromolecule transduction domain (aMTD)(s) consisting of 9 to 13 amino acid residues and having improved cell and/or tissue permeability compared to a reference CPP of SEQ ID NO: 799, wherein the aMTD is fused to one end or both ends of the Cas9 protein and has the following features of: (a) being composed of 3 or more amino acids sequences selected from the group consisting of Ala, Val, Ile, Leu, and Pro; (b) having Proline as amino acid sequences corresponding to any one or more of positions 5 to 8, and the last of its amino acid sequence; and (c) having an instability index of 40 to 60; an aliphatic index of 180 to 220; and a grand average of hydropathy (GRAVY) of 2.1 to 2.6.
2. The CP-Cas9 recombinant protein according to claim 1, wherein the Cas9 protein comprises the amino acid sequence of SEQ ID NO: 1221.
3. The CP-Cas9 recombinant protein according to claim 2, wherein the Cas9 protein is encoded by the polynucleotide sequence of SEQ ID NO: 1222.
4. The CP-Cas9 recombinant protein according to claim 1, wherein the aMTD(s) consists of 12 amino acid sequences and represented by the following general formula: ##STR00001## wherein X(s) independently refer to Alanine (A), Valine (V), Leucine (L), or Isoleucine (I); Proline (P) is positioned in one of the U(s) and the remaining U(s) independently composed of A, V, L, or I; and P at the 12′ position is Proline (P).
5. The CP-Cas9 recombinant protein according to claim 1, wherein the at least one aMTD(s) comprises an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 1 to 240.
6. The CP-Cas9 recombinant protein according to claim 5, wherein the at least one aMTD(s) is encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 241 to 480.
7. The CP-Cas9 recombinant protein according to claim 1, wherein the CP-Cas9 recombinant protein further comprises one or more solubilization domain (SD)(s), and the aMTD(s), the Cas9 protein and the SD(s) are randomly fused to one another.
8. The CP-Cas9 recombinant protein according to claim 7, wherein the one or more SD(s) comprises an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 1203 to 1209.
9. The CP-Cas9 recombinant protein of claim 8, wherein the one or more SD(s) is encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 1210 to 1216.
10. The CP-Cas9 recombinant protein according to claim 7, wherein the CP-Cas9 recombinant protein is represented by any one of the following structural formulae: A-B-C, A-C-B, B-A-C, B-C-A, C-A-B, C-B-A and A-C-B-C wherein A is the aMTD(s) having improved cell and/or tissue permeability, B is the Cas9 protein, and C is the SD(s), and if the CP-Cas9 recombinant protein comprises two SDs, the two SDs can be same or different.
11. The CP-Cas9 recombinant protein according to claim 1, wherein the CP-Cas9 recombinant protein comprises a histidine-tag affinity domain additionally fused to one end thereof.
12. The CP-Cas9 recombinant protein according to claim 11, wherein the histidine-tag affinity domain comprises the amino acid sequence of SEQ ID NO: 1217.
13. The CP-Cas9 recombinant protein of claim 12, wherein the histidine-tag affinity domain is encoded by the polynucleotide sequence of SEQ ID NO: 1218.
14. The CP-Cas9 recombinant protein according to claim 1, wherein the recombinant protein comprises a chemical bond linkage.
15. The CP-Cas9 recombinant protein according to claim 1, wherein the CP-Cas9 recombinant protein is used for deletion, insertion or replacement of a target sequence or gene.
16. A polynucleotide sequence encoding the CP-Cas9 recombinant protein of claim 1.
17. A recombinant expression vector comprising the polynucleotide sequence of claim 16.
18. A transformant transformed with the recombinant expression vector of claim 17.
19. A method for preparing a CP-Cas9 recombinant protein comprising: preparing the recombinant expression vector of claim 17; preparing a transformant using the recombinant expression vector; culturing the transformant; and recovering the recombinant protein expressed by the culturing.
20. A method of editing a target gene in a subject comprising: administering to the subject an effective amount of the CP-Cas9 recombinant protein of claim 1, and a gRNA, wherein the gRNA is capable of complementarily binding to a nucleic acid sequence in the target gene.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
MODE FOR INVENTION
(32) 1. Analysis of Reference Hydrophobic CPPs to Identify ‘Critical Factors’ for Development of Advanced MTDs
(33) Previously reported MTDs were selected from a screen of more than 1,500 signal peptide sequences. Although the MTDs that have been developed did not have a common sequence or sequence motif, they were all derived from the hydrophobic (H) regions of signal sequences (HRSSs) that also lack common sequences or motifs except their hydrophobicity and the tendency to adopt alpha-helical conformations. The wide variation in H-region sequences may reflect prior evolution for proteins with membrane translocating activity and subsequent adaptation to the SRP/Sec61 machinery, which utilizes a methionine-rich signal peptide binding pocket in SRP to accommodate a wide-variety of signal peptide sequences.
(34) Previously described hydrophobic CPPs (e.g. MTS/MTM and MTD) were derived from the hydrophobic regions present in the signal peptides of secreted and cell surface proteins. The prior art consists first, of ad hoc use of H-region sequences (MTS/MTM), and second, of H-region sequences (with and without modification) with highest CPP activity selected from a screen of 1,500 signal sequences (MTM). Second prior art, the modified H-region derived hydrophobic CPP sequences had advanced in diversity with multiple number of available sequences apart from MTS/MTM derived from fibroblast growth factor (FGF) 4. However, the number of MTDs that could be modified from naturally occurring secreted proteins are somewhat limited. Because there is no set of rules in determining their cell-permeability, no prediction for the cell-permeability of modified MTD sequences can be made before testing them.
(35) The hydrophobic CPPs, like the signal peptides from which they originated, did not conform to a consensus sequence, and they had adverse effects on protein solubility when incorporated into protein cargo. We therefore set out to identify optimal sequence and structural determinants, namely critical factors (CFs), to design new hydrophobic CPPs with enhanced ability to deliver macromolecule cargoes including proteins into the cells and tissues while maintaining protein solubility. These newly developed CPPs, advanced macromolecule transduction domains (aMTDs) allowed almost infinite number of possible designs that could be designed and developed based on the critical factors. Also, their cell-permeability could be predicted by their character analysis before conducting any in vitro and/or in vivo experiments. These critical factors below have been developed by analyzing all published reference hydrophobic CPPs.
(36) 1-1. Analysis of Hydrophobic CPPs
(37) Seventeen different hydrophobic CPPs (Table 1) published from 1995 to 2014 (Table 2) were selected. After physiological and chemical properties of selected hydrophobic CPPs were analyzed, 11 different characteristics that may be associated with cell-permeability have been chosen for further analysis. These 11 characteristics are as follows: sequence, amino acid length, molecular weight, pI value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition and secondary structure of the sequences (Tables 3 and 4).
(38) Table 1 shows the summary of published hydrophobic Cell-Penetrating Peptides which were chosen.
(39) TABLE-US-00001 TABLE 1 # Pepides Origin Protein 1 MTM Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 2 MTS Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 3 MTD10 Streptomyces coelicolor NP_625021 Glycosyl hydrolase 4 MTD13 Streptomyces coelicolor NP_639877 Putative secreted protein 5 MTD47 Streptomyces coelicolor NP_627512 Secreted protein 6 MTD56 Homo sapiens P23274 Peptidyl-prolyl cis-trans isomerase B precursor 7 MTD73 Drosophila melanogaster AAA17887 Spatzle (spz) protein 8 MTD77 Homo sapiens NP_003231 Kaposi fibroblast growth factor (K-FGF) 9 MTD84 Phytophthora cactorum AAK63068 Phytotoxic protein PcF precusor 10 MTD85 Streptomyces coelicolor NP_629842 Peptide transport system peptide binding protein 11 MTD86 Streptomyces coelicolor NP_629842 Peptide transport system secreted peptide binding protein 12 MTD103 Homo sapiens TMBV19 domain Family member B 13 MTD132 Streptomyces coelicolor NP_628377 P60-family secreted protein 14 MTD151 Streptomyces coelicolor NP_630126 Secreted chitinase 15 MTD173 Streptomyces coelicolor NP_624384 Secreted protein 16 MTD174 Streptomyces coelicolor NP_733505 Large, multifunctional secreted protein 17 MTD181 Neisseria meningitidis Z2491 CAB84257.1 Putative secreted protein
(40) Tables 2 and 3 show characteristics of published hydrophobic Cell-Penetrating Peptides (A) which were analyzed (SEQ ID NOs: 798 to 814).
(41) TABLE-US-00002 TABLE 2 Structural Rigidity/Flexibility Feature Molecular Bending (Instability (Aliphatic Hydropathy # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) (GRAVY) 1 MTM AAVALLP 16 1,515.90 5.6 Bending 45.5 220 2.4 AVLLALL AP (SEQ ID NO: 798) 2 MTS AAVLLPVL 12 1,147.40 5.6 Bending 57.3 211.7 2.3 LAAP (SEQ ID NO: 799) 3 MTD LGGAVVA 16 1,333.50 5.5 Bending 47.9 140.6 1.8 10 APVAAAV AP (SEQ ID NO: 800) 4 MTD LAAAALA 11 1,022.30 5.5 Bending 26.6 213.6 2.4 13 VLPL (SEQ ID NO: 801) 5 MTD AAAVPVL 10 881 5.6 Bending 47.5 176 2.4 47 VAA (SEQ ID NO: 802) 6 MTD VLLAAALIA 9 854.1 5.5 No-Bending 8.9 250 3 56 (SEQ ID NO: 803) 7 MTD PVLLLLA 7 737.9 6 No-Bending 36.1 278.6 2.8 73 (SEQ ID NO: 804) 8 MTD AVALLILAV 9 882.1 5.6 No-Bending 30.3 271.1 3.3 77 (SEQ ID NO: 805) 9 MTD AVALVAV 11 982.2 5.6 No-Bending 9.1 212.7 3.1 84 VAVA (SEQ ID NO: 806) 10 MTD LLAAAAA 11 1,010.20 5.5 No-Bending 9.1 231.8 2.7 85 LLLA (SEQ ID NO: 807) 11 MTD LALPVLLLA 11 1,010.20 5.5 No-Bending 9.1 231.8 2.7 86 (SEQ ID NO: 808) 12 MTD LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 2.8 103 (SEQ ID NO: 809) 13 MTD AVVVPAIV 12 1,119.40 5.6 Bending 50.3 195 2.4 132 LAAP (SEQ ID NO: 810) 14 MTD AAAPVAA 9 1,031.40 5.5 Bending 73.1 120 1.6 151 VP (SEQ ID NO: 811) 15 MTD AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 2.4 173 (SEQ ID NO: 812) 16 MTD LILLLPAV 12 1,011.80 5.5 Bending 79.1 257.3 2.6 174 ALP (SEQ ID NO: 813) 17 MTD AVLLLPAAA 9 838 5.6 Bending 51.7 206.7 2.4 181 (SEQ ID NO: 814) AVE 10.8 ± 1011 ± 5.6 ± Proline 40.1 ± 217.9 ± 43.6 2.5 ± 0.4 2.4 189.6 0.1 Presence 21.9
(42) TABLE-US-00003 TABLE 3 SEQ Residue A/a Composition Secondary ID # Peptides Structure A V L I P G Structure Cargo Ref. No 1 MTM Aliphatic 6 2 6 0 2 0 Helix p50 1 798 Ring 2 MTS Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 799 Ring 3 MTD10 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 800 Ring 4 MTD13 Aliphatic 5 1 4 0 1 0 No-Helix RUNX3 3 801 Ring 5 MTD47 Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 802 Ring 6 MTD56 Aliphatic 4 1 3 1 0 0 Helix ES 5 803 Ring 7 MTD73 Aliphatic 1 1 4 0 1 0 Helix ES 5 804 Ring 8 MTD77 Aliphatic 3 2 3 1 0 0 Helix NM23 6 805 Ring 9 MTD84 Aliphatic 5 5 1 0 0 0 Helix OCT4 4 806 Ring 10 MTD85 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 7 807 Ring 11 MTD86 Aliphatic 6 0 5 0 0 0 No-Helix SOX2 7 808 Ring 12 MTD103 Aliphatic 2 1 5 0 1 0 Helix p18 8 809 Ring 13 MTD132 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 810 Ring 14 MTD151 Aliphatic No-Helix Parkin 8 811 Ring 15 MTD173 Aliphatic 2 2 1 2 2 0 Helix KLF4 4 812 Ring 16 MTD174 Aliphatic Helix Parkin 8 813 Ring 17 MTD181 Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 814 Ring
(43) Two peptide/protein analysis programs were used (ExPasy: SoSui: harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes and structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.
(44) 1-2. Characteristics of Analyzed Peptides: Length, Molecular Weight and pl Value
(45) Average length, molecular weight and pl value of the peptides analyzed were 10.8±2.4, 1,011±189.6 and 5.6±0.1, respectively (Table 5)
(46) Table 4 summarizes Critical Factors (CFs) of published hydrophobic Cell-Penetrating Peptides (A) which were analyzed.
(47) TABLE-US-00004 TABLE 4 Length: 10.8 ± 2.4 Molecular Weight: 1,011 ± 189.6 pl: 5.6 ± 0.1 Bending Potential (BP): Praline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 40.1 ± 21.9 Residue Structure & 217.9 ± 43.6 Aliphatic Index (AI): Hydropathy (GRAVY): 2.5 ± 0.4 Aliphatic Ring: Non polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: α-Helix is favored but not required.
(48) 1-3. Characteristics of Analyzed Peptides: Bending Potential—Proline Position (PP)
(49) Bending potential (bending or no-bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain.
(50) Eleven out of 17 were determined as ‘Bending’ peptide which means that proline is present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a “bent” configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.
(51) 1-4. Characteristics of Analyzed Peptides: Rigidity/Flexibility—Instability Index (II)
(52) Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9 to 79.1), but average value was 40.1±21.9 which suggested that the peptide should be somehow flexible, but not too much rigid or flexible (Tables 3 and 4).
(53) 1-5. Characteristics of Analyzed Peptides: Structural Features—Structural Feature (Aliphatic Index: AI) and Hydropathy (Grand Average of Hydropathy: GRAVY)
(54) Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic—that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 (MTD10—Tables 2 and 3) and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.5±0.4 and 217.9±43.6, respectively. Their amino acid composition is also indicated in the Tables 2 and 3.
(55) 1-6. Characteristics of Analyzed Peptides: Secondary Structure (Helicity)
(56) As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a “bent” configuration with hydrophobic sequences having α-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial for membrane penetration. Therefore, structural analysis of the peptides was conducted to determine whether the sequences were to form helix or not. Nine peptides were helix and eight were not (Tables 2 and 3). It seems to suggest that helix structure may not be required.
(57) 1-7. Determination of Critical Factors (CFs)
(58) In the 11 characteristics analyzed, the following 6 are selected namely “Critical Factors” for the development of new hydrophobic CPPs—advanced MTDs: amino acid length, bending potential (proline presence and location), rigidity/flexibility (instability index: II), structural feature (aliphatic index: AI), hydropathy (GRAVY) and amino acid composition/residue structure (hydrophobic and aliphatic A/a) (Tables 2 to 4).
(59) 2. Analysis of Selected Hydrophobic CPPs to Optimize ‘Critical Factors’
(60) Since the analyzed data of the 17 different hydrophobic CPPs (analysis A, Tables 2 to 4) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, analysis B (Tables 5 to 7) and C (Tables 8 to 10) were also conducted to optimize the critical factors for better design of improved CPPs—aMTDs. Therefore, 17 hydrophobic CPPs have been grouped into two groups and analyzed the groups for their characteristics in relation to the cell permeable property. The critical factors have been optimized by comparing and contrasting the analytical data of the groups and determining the common homologous features that may be critical for the cell permeable property.
(61) 2-1. Selective Analysis (B) of Peptides Used to Biologically Active Cargo Protein for in Vivo
(62) In analysis B, eight CPPs were used with each biologically active cargo in vivo. Length was 11±3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility (instability index: II) was 41±15, but removing one [MTD85: rigid, with minimal II (9.1)] of the peptides increased the overall instability index to 45.6±9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy (Tables 5 to 7)
(63) Tables 5 and 6 show characteristics of published hydrophobic Cell-Penetrating Peptides (B): selected CPPs that were used to each cargo in vivo.
(64) TABLE-US-00005 TABLE 5 Rigidity/ Structural Flexibility Feature Molecular Bending (Instability (Aliphatic Hydropathy # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) (GRAVY) 1 MTM AAVALLPAVLLALLAP 16 1,515.9 5.6 Bending 45.5 220.0 2.4 (SEQ ID NO: 798) 2 MTS AAVLLPVLLAAP 12 1,147.4 5.6 Bending 57.3 211.7 2.3 (SEQ ID NO: 799) 3 MTD10 LGGAVVAAPVAAAVAP 16 1,333.5 5.5 Bending 47.9 140.6 1.8 (SEQ ID NO: 800) 4 MTD73 PVLLLLA 7 737.9 6.0 No- 36.1 278.6 2.8 (SEQ ID NO: 804) Bending 5 MTD77 AVALLILAV 9 882.1 5.6 No- 30.3 271.1 3.3 (SEQ ID NO: 805) Bending 6 MTD85 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1* 231.8 2.7 (SEQ ID NO: 807) Bending 7 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 2.8 (SEQ ID NO: 809) 8 MTD132 AVVVPAIVLAAP 12 1,119.4 5.6 Bending 50.3 195.0 2.4 (SEQ ID NO: 810) AVE 11 ± 3.2 1,083 ± 252 5.6 ± 0.1 Proline 41 ± 15 227 ± 47 2.5 ± 0.4 Presence *Removing the MTD85 increases II to 45.6 ± 9.3
(65) TABLE-US-00006 TABLE 6 Residue A/a Composition Secondary # Peptides Structure A V L I P G Structure Cargo Ref. 1 MTM Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 2 MTS Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 3 MTD10 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 4 MTD73 Aliphatic 1 1 4 0 1 0 Helix ES 6 Ring 5 MTD77 Aliphatic 3 2 3 1 0 0 Helix NM23 3 Ring 6 MTD85 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 5 Ring 7 MTD103 Aliphatic 2 1 5 0 1 0 Helix p18 4 Ring 8 MTD132 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 7 Ring
(66) Table 7 shows summarized Critical Factors of published hydrophobic Cell-Penetrating Peptides (B).
(67) TABLE-US-00007 TABLE 7 Length: 11 ± 3.2 Molecular Weight: 1,083 ± 252 pl: 5.6 ± 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 41.0 ± 15 (.sup.a Removing the MTD85 increases II to 45.6 ± 9.3) Residue Structure & 227 ± 47 Aliphatic Index (Al): Hydropathy (GRAVY): 2.5 ± 0.4 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: α-Helix is favored but not required.
(68) 2-2. Selective Analysis (C) of Peptides that Provided Bending Potential and Higher Flexibility
(69) To optimize the ‘Common Range and/or Consensus Feature of Critical Factor’ for the practical design of aMTDs and the random peptides (rPs or rPeptides), which were to prove that the ‘Critical Factors’ determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs—protein aggregation, low solubility/yield, and poor cell-/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.
(70) Hydrophobic CPPs which did not have a bending potential, rigid or too much flexible sequences (too much low or too much high Instability Index), or too low or too high hydrophobic CPPs were unselected, but secondary structure was not considered because helix structure of sequence was not required.
(71) In analysis C, eight selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed (Tables 8 to 10). Common amino acid length is 12 (11.6±3.0). Proline is presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1±3.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7±37.5 and 2.4±0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs-aMTDs.
(72) Tables 8 and 9 show characteristics of published hydrophobic Cell-Penetrating Peptides (C): selected CPPs that provided bending potential and higher flexibility.
(73) TABLE-US-00008 TABLE 8 Rigidity/ Flexibility Structural Feature Molecular Bending (Instability (Aliphatic Hydropathy # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) (GRAVY) 1 MTM AAVALLPAVLLALLAP 16 1515.9 5.6 Bending 45.5 220.0 2.4 (SEQ ID NO: 798) 2 MTS AAVLLPVLLAAP 12 1147.4 5.6 Bending 57.3 211.7 2.3 (SEQ ID NO: 799) 3 MTD10 LGGAVVAAPVAAAVAP 16 1333.5 5.5 Bending 47.9 140.6 1.8 (SEQ ID NO: 800) 4 MTD47 AAAVPVLVAA 10 881.0 5.6 Bending 47.5 176.0 2.4 (SEQ ID NO: 802) 5 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 2.8 (SEQ ID NO: 809) 6 MTD132 AVVVPAIVLAAP 12 1119.4 5.6 Bending 50.3 195.0 2.4 (SEQ ID NO: 810) 7 MTD173 AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 2.4 (SEQ ID NO: 812) 8 MTD181 AVLLLPAAA 9 838.0 5.6 Bending 51.7 206.7 2.4 (SEQ ID NO: 814) AVE 11.6 ± 1081.2 ± 5.6 ± Proline 50.1 ± 3.6 204.7 ± 37.5 2.4 ± 0.3 3.0 244.6 0.1 Presence
(74) TABLE-US-00009 TABLE 9 A/a Residue Composition Secondary # Peptides Sequence Structure A V L I P G Structure Cargo Ref. 1 MTM AAVALLPAVLLALLAP Aliphatic 6 2 6 0 2 0 Helix p50 1 (SEQ ID NO: 798) Ring 2 MTS AAVLLPVLLAAP Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 (SEQ ID NO: 799) Ring 3 MTD10 LGGAVVAAPVAAAVAP Aliphatic 7 4 1 0 2 2 Helix Parkin 8 (SEQ ID NO: 800) Ring 4 MTD47 AAAVPVLVAA Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 (SEQ ID NO: 802) Ring 5 MTD103 LALPVLLLA Aliphatic 2 1 5 0 1 0 Helix p18 8 (SEQ ID NO: 809) Ring 6 MTD132 AVVVPAIVLAAP Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 (SEQ ID NO: 810) Ring 7 MTD173 AVIPILAVP Aliphatic 2 2 1 2 2 0 Helix KLF4 4 (SEQ ID NO: 812) Ring 8 MTD181 AVLLLPAAA Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 (SEQ ID NO: 814) Ring
(75) Table 10 shows summarized critical factors of published hydrophobic Cell-Penetrating Peptides (C).
(76) TABLE-US-00010 TABLE 10 Length: 11.6 ± 3.0 Molecular Weight: 1,081.2 ± 224.6 pl: 5.6 ± 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides. Instability Index (II): 50.1 ± 3.6 Residue Structure & 204.7 ± 37.5 Aliphatic Index (AI): Hydropathy (GRAVY): 2.4 ± 0.3 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: α-Helix is favored but not required.
3. New Design of Improved Hydrophobic CPPs-aMTDs Based on the Optimized Critical Factors
(77) 3-1. Determination of Common Sequence and/or Common Homologous Structure
(78) As mentioned above, H-regions of signal sequence (HRSS)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, sequence motif, and/or common-structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence- and structural-motif which satisfy newly determined ‘Critical Factors’ to have ‘Common Function,’ namely, to facilitate protein translocation across the membrane with similar mechanism to the analyzed reference CPPs. Based on the analysis A, B and C, the common homologous features have been analyzed to determine the critical factors that influence the cell-permeability. The range value of each critical factor has been determined to include the analyzed index of each critical factor from analysis A, B and C to design novel aMTDs (Table 11). These features have been confirmed experimentally with newly designed aMTDs in their cell-permeability.
(79) Table 11 shows comparison the range/feature of each Critical Factor between the value of analyzed CPPs and the value determined for new design of novel aMTDs sequences
(80) TABLE-US-00011 TABLE 11 Summarized critical Factors of aMTD Selected CPPs Newly Designed CPPs Critical Factor Range Range Bending Potential Proline presences in Proline presences (Proline Position: PP) the middle and/or at in the middle the end of peptides (5’, 6’, 7’ or 8’) and at the end of peptides Rigidity/Flexibility 45.5-57.3 40-60 (Instability Index: II) (50.1 ± 3.6) Structural Feature 140.6-220.0 180-220 (Aliphatic Index: AI) (204.7 ± 37.5) Hydropathy 1.8-2.8 2.1-2.6 (Grand Average of (2.4 ± 0.3) Hydropathy GRAVY) Length 11.6 ± 3.0 9-13 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
(81) In Table 11, universal common features and sequence/structural motif are provided. Length is 9-13 amino acids, and bending potential is provided with the presence of proline in the middle of sequence (at 5′, 6′, 7′ or 8′ amino acid) for peptide bending and at the end of peptide for recombinant protein bending and Rigidity/Flexibility of aMTDs is II>40 are described in Table 11.
(82) 3-2. Critical Factors for Development of Advanced MTDs
(83) Recombinant cell-permeable proteins fused to the hydrophobic CPPs to deliver therapeutically active cargo molecules including proteins into live cells had previously been reported, but the fusion proteins expressed in bacteria system were hard to be purified as a soluble form due to their low solubility and yield. To address the crucial weakness for further clinical development of the cell-permeable proteins as protein-based biotherapeutics, greatly improved form of the hydrophobic CPP, named as advanced MTD (aMTD) has newly been developed through critical factors-based peptide analysis. The critical factors used for the current invention of the aMTDs are herein (Table 11).
(84) 1. Amino Acid Length: 9 to 13
(85) 2. Bending Potential (Proline Position: PP): Proline presences in the middle (from 5′ to 8′ amino acid) and at the end of sequence
(86) 3. Rigidity/Flexibility (Instability Index: II): 40 to 60
(87) 4. Structural Feature (Aliphatic Index: AI): 180 to 220
(88) 5. Hydropathy (GRAVY): 2.1 to 2.6
(89) 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids—A, V, L, I and P
(90) 3-3. Design of Potentially Best aMTDs that all Critical Factors are Considered and Satisfied
(91) After careful consideration of six critical factors derived from analysis of unique features of hydrophobic CPPs, advanced macromolecule transduction domains (aMTDs) have been designed and developed based on the common 12 amino acid platform which satisfies the critical factors including amino acid length (9 to 13) determined from the analysis. The advanced macromolecule transduction domains (aMTDs) according to the embodiments are represented by the General Formula of
(92) Unlike previously published hydrophobic CPPs that require numerous experiments to determine their cell-permeability, newly developed aMTD sequences could be designed by performing just few steps as follows using above mentioned platform to follow the determined range value/feature of each critical factor.
(93) First, prepare the 12 amino acid sequence platform for aMTD. Second, place proline (P) in the end (12′) of sequence and determine where to place proline in one of four U(s) in 5′, 6′, 7′, and 8. Third, alanine (A), valine (V), leucine (L) or isoleucine (I) is placed in either X(s) and/or U(s), where proline is not placed. Lastly, determine whether the amino acid sequences designed based on the platform, satisfy the value or feature of six critical factors to assure the cell permeable property of aMTD sequences. Through these processes, numerous novel aMTD sequences have been constructed. The expression vectors for preparing non-functional cargo recombinant proteins fused to each aMTD, expression vectors have been constructed and forcedly expressed in bacterial cells. These aMTD-fused recombinant proteins have been purified in soluble form and determined their cell-permeability quantitatively. aMTD sequences have been newly designed, numbered from 1 to 240, as shown in Tables 13 to 18. In Tables 13 to 18, sequence ID Number (SEQ ID NO) is a sequence listings for reference, and aMTD numbers refer to amino acid listing numbers that actually have been used at the experiments. For further experiments, aMTD numbers have been used. In addition, polynucleotide sequences shown in the sequence lists have been numbered from SEQ ID NO: 241 to 480.
(94) Tables 12 to 17 shows 240 new hydrophobic aMTD sequences that were developed to satisfy all critical factors.
(95) TABLE-US-00012 TABLE 12 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 1 1 AAALAPVVLALP 12 57.3 187.5 2.1 Aliphatic 2 2 AAAVPLLAVVVP 12 41.3 195.0 2.4 Aliphatic 3 3 AALLVPAAVLAP 12 57.3 187.5 2.1 Aliphatic 4 4 ALALLPVAALAP 12 57.3 195.8 2.1 Aliphatic 5 5 AAALLPVALVAP 12 57.3 187.5 2.1 Aliphatic 6 11 VVALAPALAALP 12 57.3 187.5 2.1 Aliphatic 7 12 LLAAVPAVLLAP 12 57.3 211.7 2.3 Aliphatic 8 13 AAALVPVVALLP 12 57.3 203.3 2.3 Aliphatic 9 21 AVALLPALLAVP 12 57.3 211.7 2.3 Aliphatic 10 22 AVVLVPVLAAAP 12 57.3 195.0 2.4 Aliphatic 11 23 VVLVLPAAAAVP 12 57.3 195.0 2.4 Aliphatic 12 24 IALAAPALIVAP 12 50.2 195.8 2.2 Aliphatic 13 25 IVAVAPALVALP 12 50.2 203.3 2.4 Aliphatic 14 42 VAALPVVAVVAP 12 57.3 186.7 2.4 Aliphatic 15 43 LLAAPLVVAAVP 12 41.3 187.5 2.1 Aliphatic 16 44 ALAVPVALLVAP 12 57.3 203.3 2.3 Aliphatic 17 61 VAALPVLLAALP 12 57.3 211.7 2.3 Aliphatic 18 62 VALLAPVALAVP 12 57.3 203.3 2.3 Aliphatic 19 63 AALLVPALVAVP 12 57.3 203.3 2.3 Aliphatic
(96) TABLE-US-00013 TABLE 13 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 20 64 AIVALPVAVLAP 12 50.2 203.3 2.4 Aliphatic 21 65 IAIVAPVVALAP 12 50.2 203.3 2.4 Aliphatic 22 81 AALLPALAALLP 12 57.3 204.2 2.1 Aliphatic 23 82 AVVLAPVAAVLP 12 57.3 195.0 2.4 Aliphatic 24 83 LAVAAPILALALP 12 41.3 195.8 2.1 Aliphatic 25 84 AAVAAPLLLALP 12 41.3 195.8 2.1 Aliphatic 26 85 LLVLPAAALAAP 12 57.3 195.8 2.1 Aliphatic 27 101 LVALAPVAAVLP 12 57.3 203.3 2.3 Aliphatic 28 102 LALAPAALALLP 12 57.3 204.2 2.1 Aliphatic 29 103 ALIAAPILALAP 12 57.3 204.2 2.2 Aliphatic 30 104 AVVAAPLVLALP 12 41.3 203.3 2.3 Aliphatic 31 105 LLALAPAALLAP 12 57.3 204.1 2.1 Aliphatic 32 121 AIVALPALALAP 12 50.2 195.8 2.2 Aliphatic 33 123 AAIIVPAALLAP 12 50.2 195.8 2.2 Aliphatic 34 124 IAVALPALIAAP 12 50.3 195.8 2.2 Aliphatic 35 141 AVIVLPALAVAP 12 50.2 203.3 2.4 Aliphatic 36 143 AVLAVPAVLVAP 12 57.3 195.0 2.4 Aliphatic 37 144 VLAIVPAVALAP 12 50.2 203.3 2.4 Aliphatic 38 145 LLAVVPAVALAP 12 57.3 203.3 2.3 Aliphatic 39 161 AVIALPALIAAP 12 57.3 195.8 2.2 Aliphatic 40 162 AVVALPAALIVP 12 50.2 203.3 2.4 Aliphatic 41 163 LALVLPAALAAP 12 57.3 195.8 2.1 Aliphatic 42 164 LAAVLPALLAAP 12 57.3 195.8 2.1 Aliphatic 43 165 ALAVPVALAIVP 12 50.2 203.3 2.4 Aliphatic 44 182 ALIAPVVALVAP 12 57.3 203.3 2.4 Aliphatic 45 183 LLAAPVVIALAP 12 57.3 211.6 2.4 Aliphatic 46 184 LAAIVPAIIAVP 12 50.2 211.6 2.4 Aliphatic 47 185 AALVLPLIIAAP 12 41.3 220.0 2.4 Aliphatic 48 201 LALAVPALAALP 12 57.3 195.8 2.1 Aliphatic 49 204 LIAALPAVAALP 12 57.3 195.8 2.2 Aliphatic 50 205 ALALVPAIAALP 12 57.3 195.8 2.2 Aliphatic 51 221 AAILAPIVALAP 12 50.2 195.8 2.2 Aliphatic 52 222 ALLIAPAAVIAP 12 57.3 195.8 2.2 Aliphatic 53 223 AILAVPIAVVAP 12 57.3 203.3 2.4 Aliphatic 54 224 ILAAVPIALAAP 12 57.3 195.8 2.2 Aliphatic 55 225 VAALLPAAAVLP 12 57.3 187.5 2.1 Aliphatic 56 241 AAAVVPVLLVAP 12 57.3 195.0 2.4 Aliphatic 57 242 AALLVPALVAAP 12 57.3 187.5 2.1 Aliphatic 58 243 AAVLLPVALAAP 12 57.3 187.5 2.1 Aliphatic 59 245 AAALAPVLALVP 12 57.3 187.5 2.1 Aliphatic 60 261 LVLVPLLAAAAP 12 41.3 211.6 2.3 Aliphatic 61 262 ALIAVPAIIVAP 12 50.2 211.6 2.4 Aliphatic 62 263 ALAVIPAAAILP 12 54.9 195.8 2.2 Aliphatic 63 264 LAAAPVVIVIAP 12 50.2 203.3 2.4 Aliphatic 64 265 VLAIAPLLAAVP 12 41.3 211.6 2.3 Aliphatic 65 281 ALIVLPAAVAVP 12 50.2 2032 24 Aliphatic 66 282 VLAVAPALIVAP 12 50.2 203.3 2.4 Aliphatic 67 283 AALLAPALIVAP 12 50.2 195.8 2.2 Aliphatic 68 284 ALIAPAVALIVP 12 50.2 211.7 2.4 Aliphatic 69 285 AIVLLPAAVVAP 12 50.2 203.3 2.4 Aliphatic
(97) TABLE-US-00014 TABLE 14 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 70 301 VIAAPVLAVLAP 12 57.3 203.3 2.4 Aliphatic 71 302 LALAPALALLAP 12 57.3 204.2 2.1 Aliphatic 72 304 AIILAPIAAIAP 12 57.3 204.2 2.3 Aliphatic 73 305 IALAAPILLAAP 12 57.3 204.2 2.2 Aliphatic 74 321 IVAVALPALAVP 12 50.2 203.3 2.3 Aliphatic 75 322 VVAIVLPALAAP 12 50.2 203.3 2.3 Aliphatic 76 323 IVAVALPVALAP 12 50.2 203.3 2.3 Aliphatic 77 324 IVAVALPAALVP 12 50.2 203.3 2.3 Aliphatic 78 325 IVAVALPAVALP 12 50.2 203.3 2.3 Aliphatic 79 341 IVAVALPAVLAP 12 50.2 203.3 2.3 Aliphatic 80 342 VIVALAPAVLAP 12 50.2 203.3 2.3 Aliphatic 81 343 IVAVALPALVAP 12 50.2 203.3 2.3 Aliphatic 82 345 ALLIVAPVAVAP 12 50.2 203.3 2.3 Aliphatic 83 361 AVVIVAPAVIAP 12 50.2 195.0 2.4 Aliphatic 84 363 AVLAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 85 364 LVAAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 86 365 AVIVVAPALLAP 12 50.2 203.3 2.3 Aliphatic 87 381 VVAIVLPAVAAP 12 50.2 195.0 2.4 Aliphatic 88 382 AAALVIPAILAP 12 54.9 195.8 2.2 Aliphatic 89 383 VIVALAPALLAP 12 50.2 211.6 2.3 Aliphatic 90 384 VIVAIAPALLAP 12 50.2 211.6 2.4 Aliphatic 91 385 IVAIAVPALVAP 12 50.2 203.3 2.4 Aliphatic 92 401 AALAVIPAAILP 12 54.9 195.8 2.4 Aliphatic 93 402 ALAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 94 403 AAALVIPAAILP 12 54.9 195.8 2.2 Aliphatic 95 404 LAAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 96 405 LAAAVIPVAILP 12 54.9 211.7 2.4 Aliphatic 97 421 AAILAAPLIAVP 12 57.3 195.8 2.2 Aliphatic 98 422 VVAILAPLLAAP 12 57.3 211.7 2.4 Aliphatic 99 424 AVVVAAPVLALP 12 57.3 195.0 2.4 Aliphatic 100 425 AVVAIAPVLALP 12 57.3 203.3 2.4 Aliphatic 101 442 ALAALVPAVLVP 12 57.3 203.3 2.3 Aliphatic 102 443 ALAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 103 444 LAAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 104 445 ALAALVPALVVP 12 57.3 203.3 2.3 Aliphatic 105 461 IAAVIVPAVALP 12 50.2 203.3 2.4 Aliphatic 106 462 IAAVLVPAVALP 12 57.3 203.3 2.4 Aliphatic 107 463 AVAILVPLLAAP 12 57.3 211.7 2.4 Aliphatic 108 464 AVVILVPLAAAP 12 57.3 203.3 2.4 Aliphatic 109 465 IAAVIVPVAALP 12 50.2 203.3 2.4 Aliphatic 110 481 AIAIAIVPVALP 12 50.2 211.6 2.4 Aliphatic 111 482 ILAVAAIPVAVP 12 54.9 203.3 2.4 Aliphatic 112 483 ILAAAIIPAALP 12 54.9 204.1 2.2 Aliphatic 113 484 LAVVLAAPAIVP 12 50.2 203.3 2.4 Aliphatic 114 485 AILAAIVPLPVP 12 50.2 211.6 2.4 Aliphatic 115 601 VIVALAVPALAP 12 50.2 203.3 2.4 Aliphatic 116 502 AIVALAVPVLAP 12 50.2 203.3 2.4 Aliphatic 117 503 AAIIIVLPAALP 12 50.2 220.0 2.4 Aliphatic 118 604 LIVALAVPALAP 12 50.2 211.7 2.4 Aliphatic 119 505 AIIIVIAPAAAP 12 50.2 195.8 2.3 Aliphatic
(98) TABLE-US-00015 TABLE 15 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 120 521 LAALIVVPAVAP 12 50.2 203.3 2.4 Aliphatic 121 522 ALLVIAVPAVAP 12 57.3 203.3 2.4 Aliphatic 122 524 AVALIVVPALAP 12 50.2 203.3 2.4 Aliphatic 123 525 ALAIVVAPVAVP 12 50.2 195.0 2.4 Aliphatic 124 541 LLALIIAPAAAP 12 57.3 204.1 2.1 Aliphatic 125 542 ALALIIVPAVAP 12 50.2 211.6 2.4 Aliphatic 126 543 LLAALIAPAALP 12 57.3 204.1 2.1 Aliphatic 127 544 IVALIVAPAAVP 12 43.1 203.3 2.4 Aliphatic 128 545 VVLVLAAPAAVP 12 57.3 195.0 2.3 Aliphatic 129 561 AAVAIVLPAVVP 12 50.2 195.0 2.4 Aliphatic 130 562 ALIAAIVPALVP 12 50.2 211.7 2.4 Aliphatic 131 563 ALAVIVVPALAP 12 50.2 203.3 2.4 Aliphatic 132 564 VAIALIVPALAP 12 50.2 211.7 2.4 Aliphatic 133 565 VAIVLVAPAVAP 12 50.2 195.0 2.4 Aliphatic 134 582 VAVALIVPALAP 12 50.2 203.3 2.4 Aliphatic 135 583 AVILALAPIVAP 12 50.2 211.6 2.4 Aliphatic 136 585 ALIVAIAPALVP 12 50.2 211.6 2.4 Aliphatic 137 601 AAILIAVPIAAP 12 57.3 195.8 2.3 Aliphatic 138 602 VIVALAAPVLAP 12 50.2 203.3 2.4 Aliphatic 139 603 VLVALAAPVIAP 12 57.3 203.3 2.4 Aliphatic 140 604 VALIAVAPAVVP 12 57.3 195.0 2.4 Aliphatic 141 605 VIAAVLAPVAVP 12 57.3 195.0 2.4 Aliphatic 142 622 ALIVLAAPVAVP 12 50.2 203.3 2.4 Aliphatic 143 623 VAAAIALPAIVP 12 50.2 187.5 2.3 Aliphatic 144 625 ILAAAAAPLIVP 12 50.2 195.8 2.2 Aliphatic 145 643 LALVLAAPAIVP 12 50.2 211.6 2.4 Aliphatic 146 645 ALAVVALPAIVP 12 50.2 203.3 2.4 Aliphatic 147 661 AAILAPIVAALP 12 50.2 195.8 2.2 Aliphatic 148 664 ILIAIAIPAAAP 12 54.9 204.1 2.3 Aliphatic 149 665 LAIVLAAPVAVP 12 50.2 203.3 2.3 Aliphatic 150 666 AAIAIIAPAIVP 12 50.2 195.8 2.3 Aliphatic 151 667 LAVAIVAPALVP 12 50.2 203.3 2.3 Aliphatic 152 683 LAIVLAAPAVLP 12 50.2 211.7 2.4 Aliphatic 153 684 AAIVLALPAVLP 12 50.2 211.7 2.4 Aliphatic 154 685 ALLVAVLPAALP 12 57.3 211.7 2.3 Aliphatic 155 686 AALVAVLPVALP 12 57.3 203.3 2.3 Aliphatic 156 687 AILAVALPLLAP 12 57.3 220.0 2.3 Aliphatic 157 703 IVAVALVPALAP 12 50.2 203.3 2.4 Aliphatic 158 705 IVAVALLPALAP 12 50.2 211.7 2.4 Aliphatic 159 706 IVAVALLPAVAP 12 50.2 203.3 2.4 Aliphatic 160 707 IVALAVLPAVAP 12 50.2 203.3 2.4 Aliphatic 161 724 VAVLAVLPALAP 12 57.3 203.3 2.3 Aliphatic 162 725 IAVLAVAPAVLP 12 57.3 203.3 2.3 Aliphatic 163 726 LAVAIIAPAVAP 12 57.3 187.5 2.2 Aliphatic 164 727 VALAIALPAVLP 12 57.3 211.6 2.3 Aliphatic 165 743 AIAIALVPVALP 12 57.3 211.6 2.4 Aliphatic 166 744 AAVVIVAPVALP 12 50.2 195.0 2.4 Aliphatic 167 746 VAIIVVAPALAP 12 50.2 203.3 2.4 Aliphatic 168 747 VALLAIAPALAP 12 57.3 195.8 2.2 Aliphatic 169 763 VAVLIAVPALAP 12 57.3 203.3 2.3 Aliphatic
(99) TABLE-US-00016 TABLE 16 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 170 764 AVALAVLPAVVP 12 57.3 195.0 2.3 Aliphatic 171 765 AVALAVVPAVLP 12 57.3 195.0 2.3 Aliphatic 172 766 IVVIAVAPAVAP 12 50.2 195.0 2.4 Aliphatic 173 767 IVVAAVVPALAP 12 50.2 195.0 2.4 Aliphatic 174 783 IVALVPAVAIAP 12 50.2 203.3 2.5 Aliphatic 175 784 VAALPAVALVVP 12 57.3 195.0 2.4 Aliphatic 176 786 LVAIAPLAVLAP 12 41.3 211.7 2.4 Aliphatic 177 787 AVALVPVIVAAP 12 502 195.0 2.4 Aliphatic 178 788 AIAVAIAPVALP 12 57.3 187.5 2.3 Aliphatic 179 803 AIALAVPVLALP 12 57.3 211.7 2.4 Aliphatic 180 805 LVLIAAAPIALP 12 41.3 220.0 2.4 Aliphatic 181 806 LVALAVPAAVLP 12 57.3 203.3 2.3 Aliphatic 182 807 AVALAVPALVLP 12 57.3 203.3 2.3 Aliphatic 183 808 LVVLAAAPLAVP 12 41.3 203.3 2.3 Aliphatic 184 809 LIVLAAPALAAP 12 50.2 195.8 2.2 Aliphatic 185 810 VIVLAAPALAAP 12 50.2 187.5 2.2 Aliphatic 186 811 AVVLAVPALAVP 12 57.3 195.0 2.3 Aliphatic 187 824 LIIVAAAPAVAP 12 50.2 187.5 2.3 Aliphatic 188 825 IVAVIVAPAVAP 12 43.2 195.0 2.5 Aliphatic 189 826 LVALAAPIIAVP 12 41.3 211.7 2.4 Aliphatic 190 827 IAAVLAAPALVP 12 57.3 187.5 2.2 Aliphatic 191 828 IALLAAPIIAVP 12 41.3 220.0 2.4 Aliphatic 192 829 AALALVAPVIVP 12 50.2 203.3 2.4 Aliphatic 193 830 IALVAAPVALVP 12 57.3 203.3 2.4 Aliphatic 194 831 IIVAVAPAAIVP 12 43.2 203.3 2.5 Aliphatic 195 832 AVAAIVPVIVAP 12 43.2 195.0 2.5 Aliphatic 196 843 AVLVLVAPAAAP 12 41.3 219.2 2.5 Aliphatic 197 844 VVALLAPLIAAP 12 41.3 211.8 2.4 Aliphatic 198 845 AAVVIAPLLAVP 12 41.2 203.3 2.4 Aliphatic 199 846 IAVAVAAPLLVP 12 41.3 203.3 2.4 Aliphatic 200 847 LVAIVVLPAVAP 12 50.2 219.2 2.6 Aliphatic 201 848 AVAIVVLPAVAP 12 50.2 195.0 2.4 Aliphatic 202 849 AVILLAPLIAAP 12 57.3 220.0 2.4 Aliphatic 203 850 LVIALAAVALP 12 57.3 211.7 2.4 Aliphatic 204 851 VLAVVLPAVALP 12 57.3 219.2 2.5 Aliphatic 205 852 VLAVAAPAVLLP 12 57.3 203.3 2.3 Aliphatic 206 863 AAVVLLPIIAAP 12 41.3 211.7 2.4 Aliphatic 207 864 ALLVIAPAIAVP 12 57.3 211.7 2.4 Aliphatic 208 865 AVLVIAVPAIAP 12 57.3 203.3 2.5 Aliphatic 209 867 ALLVVIAPLAAP 12 41.3 211.7 2.4 Aliphatic 210 868 VLVAAILPAAIP 12 54.9 211.7 2.4 Aliphatic 211 870 VLVAAVLPIAAP 12 41.3 203.3 2.4 Aliphatic 212 872 VLAAAVLPLVVP 12 41.3 219.2 2.5 Aliphatic 213 875 AIAIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 214 877 VAIIAVPAVVAP 12 572 195.0 2.4 Aliphatic 215 878 IVALVAPAAVVP 12 50.2 195.0 2.4 Aliphatic 216 879 AAIVILLPAVVVP 12 50.2 219.1 2.5 Aliphatic 217 881 AALIVVPAVAVP 12 50.2 1950 2.4 Aliphatic 218 882 AIALVVPAVAVP 12 57.3 195.0 2.4 Aliphatic 219 883 LAIVPAAIAALP 12 50.2 195.8 2.2 Aliphatic
(100) TABLE-US-00017 TABLE 17 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 220 885 LVAIAPAVAVLP 12 57.3 203.3 2.4 Aliphatic 221 887 VLAVAPAVAVLP 12 57.3 195.0 2.4 Aliphatic 222 888 ILAVVAIPAAAP 12 54.9 187.5 2.3 Aliphatic 223 889 ILVAAAPIAALP 12 57.3 195.8 2.2 Aliphatic 224 891 ILAVAAIPAALP 12 54.9 195.8 2.2 Aliphatic 225 893 VIAIPAILAAAP 12 54.9 195.8 2.3 Aliphatic 226 895 AIIIVVPAIAAP 12 50.2 211.7 2.5 Aliphatic 227 896 AILIVVAPIAAP 12 50.2 211.7 2.5 Aliphatic 228 897 AVIVPVAIIAAP 12 50.2 203.3 2.5 Aliphatic 229 899 AVVIALPAVVAP 12 57.3 195.0 2.4 Aliphatic 230 900 ALVAVIAPVVAP 12 57.3 195.0 2.4 Aliphatic 231 901 ALVAVLPAVAVP 12 57.3 195.0 2.4 Aliphatic 232 902 ALVAPLLAVAVP 12 41.3 203.3 2.3 Aliphatic 233 904 AVLAVVAPVVAP 12 57.3 186.7 2.4 Aliphatic 234 905 AVIAVAPLVVAP 12 41.3 195.0 2.4 Aliphatic 235 906 AVIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 236 907 VAIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 237 908 VALALAPVVVAP 12 57.3 195.0 2.3 Aliphatic 238 910 VAALLPAVVVAP 12 57.3 195.0 2.3 Aliphatic 239 911 VALALPAVVVAP 12 57.3 195.0 2.3 Aliphatic 240 912 VALLAPAVVVAP 12 57.3 195.0 2.3 Aliphatic 52.6 ± 5.1 201.7 ± 7.8 2.3 ± 0.1
(101) 3-4. Design of the Peptides that Did not Satisfy at Least One Critical Factor
(102) To demonstrate that this invention of new hydrophobic CPPs-aMTDs, which satisfy all critical factors described above, are correct and rationally designed, the peptides which do not satisfy at least one critical factor have also been designed. Total of 31 rPeptides (rPs) are designed, developed and categorized as follows: no bending peptides, either no proline in the middle as well at the end and/or no central proline; rigid peptides (II<40); too much flexible peptides; aromatic peptides (aromatic ring presences); hydrophobic, with non-aromatic peptides but have amino acids other than A, V, L, I, P or additional proline residues; hydrophilic, but non-aliphatic peptides.
(103) 3-4-1. Peptides that do not Satisfy the Bending Potential
(104) Table 18 shows the peptides that do not have any proline in the middle (at 5′, 6′, 7′ or 8′) and at the end of the sequences (SEQ ID NOs: 815 to 824). In addition, Table 19 describes the peptides that do not have proline in the middle of the sequences. All these peptides are supposed to have no-bending potential.
(105) TABLE-US-00018 TABLE 18 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) No-Bending 815 931 AVLIAPAILAAA 12 6 57.3 204.2 2.5 Peptides 816 936 ALLILAAAVAAP 12 12 41.3 204.2 2.4 (No Proline 817 152 LAAAVAAVAALL 12 None 9.2 204.2 2.7 at 5 or 6 818 27 LAIVAAAAALVA 12 None 2.1 204.2 2.8 and/or 12) 819 935 ALLILPAAAVAA 12 6 57.3 204.2 2.4 and 820 670 ALLILAAAVAAL 12 None 25.2 236.6 2.8 (No Central 821 934 LILAPAAVVAAA 12 5 57.3 195.8 2.5 Proline) 822 37 TTCSQQQYCTNG 12 None 53.1 0 −1.1 823 16 NNSCTTYTNGSQ 12 None 47.4 0 −1.4 824 113 PVAVALLIAVPP 12 1, 11, 12 57.3 195 2.1
(106) 3-4-2. Peptides that do not Satisfy the Rigidity/Flexibility
(107) To prove that rigidity/flexibility of the sequence is a crucial critical factor, rigid (Avg. II: 21.8±6.6) and too high flexible sequences (Avg. II: 82.3±21.0) were also designed. Rigid peptides that instability index is much lower than that of new aMTDs (II: 41.3 to 57.3, Avg. II: 53.3±5.7) are shown in Table 19 (SEQ ID NOs: 825 to 839). Bending, but too high flexible peptides that II is much higher than that of new aMTDs are also provided in Table 20 (SEQ ID NOs: 840 to 858).
(108) TABLE-US-00019 TABLE 19 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) Rigid 825 226 ALVAAIPALAIP 12 6 20.4 195.8 2.2 Peptides 826 6 VIAMIPAAFWVA 12 6 15.7 146.7 2.2 (II <50) 827 750 LAIAAIAPLAIP 12 8, 12 22.8 204.2 2.2 828 26 AAIALAAPLAIV 12 8 18.1 204.2 2.5 829 527 LVLAAVAPIAIP 12 8, 12 22.8 211.7 2.4 830 466 IIAAAAPLAIIP 12 7, 12 22.8 204.2 2.3 831 167 VAIAIPAALAIP 12 6, 12 20.4 195.8 2.3 832 246 VVAVPLLVAFAA 12 5 25.2 195 2.7 833 426 AAALAIPLAIIP 12 7, 12 4.37 204.2 2.2 834 606 AAAIAAIPIIIP 12 8, 12 4.4 204.2 2.4 835 66 AGVLGGPIMGVP 12 7, 12 35.5 121.7 1.3 836 248 VAAIVPIAALVP 12 6, 12 34.2 203.3 2.5 837 227 LAAIVPIAAAVP 12 6, 12 34.2 187.5 2.2 838 17 GGCSAPQTTCSN 12 6 51.6 8.3 −0.5 839 67 LDAEVPLADDVP 12 6, 12 34.2 130 0.3
(109) TABLE-US-00020 TABLE 20 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) Bending 840 692 PAPLPPVVILAV 12 1, 3, 5, 6 105.5 186.7 1.8 Peptides, 841 69 PVAVLPPAALVP 12 1, 6, 7, 12 89.4 162.5 1.6 but Too 842 390 VPLLVPVVPVVP 12 2, 6, 9, 12 105.4 210 2.2 High 843 350 VPILVPVVPVVP 12 2, 6, 9, 12 121.5 210 2.2 Flexibility 844 331 VPVLVPLVPVVP 12 2, 6, 9, 12 105.4 210 2.2 845 9 VALVPAALILPP 12 5, 11, 12 89.4 203.3 2.1 846 68 VAPVLPAAPLVP 12 3, 6, 9, 12 105.5 162.5 1.6 847 349 VPVLVPVVPVVP 12 2, 6, 9, 12 121.5 201.6 2.2 848 937 VPVLVPLPVPVV 12 2, 6, 8, 10 121.5 210 2.2 849 938 VPVLLPVVVPVP 12 2, 6, 10, 12 121.5 210 2.2 850 329 LPVLVPVVPVVP 12 2, 6, 9, 12 121.5 210 2.2 851 49 VVPAAPAVPVVP 12 3, 6, 9, 12 121.5 145.8 1.7 852 772 LPVAPVIPIIVP 12 2, 5, 8, 12 79.9 210.8 2.1 853 210 ALIALPALPALP 12 6, 9, 12 89.4 195.8 1.8 854 28 AVPLLPLVPAVP 12 3, 6, 9, 12 89.4 186.8 1.8 855 693 AAPVLPVAVPIV 12 3, 6, 10 82.3 186.7 2.1 856 169 VALVAPALILAP 12 6, 12 73.4 211.7 2.4 857 29 VLPPLPVLPVLP 12 3, 4, 6, 9, 12 121.5 202.5 1.7 858 190 AAILAPAVIAPP 12 6, 11, 12 89.4 163.3 1.8
(110) 3-4-3. Peptides that do not Satisfy the Structural Features
(111) New hydrophobic CPPs-aMTDs are consisted with only hydrophobic and aliphatic amino acids (A, V, L, I and P) with average ranges of the indexes—AI: 180 to 220 and GRAVY: 2.1 to 2.6 (Table 21). Based on the structural indexes, the peptides which contain an aromatic residue (W, F or Y) are shown in Table 22 (SEQ ID NOs: 859 to 864) and the peptides which are hydrophobic with non-aromatic sequences but have amino acids residue other than A, V, L, I, P or additional proline residues are designed (Table 23) (SEQ ID NOs: 865 to 872). Finally, hydrophilic and/or bending peptides which are consisted with non-aliphatic amino acids are shown in Table 23 (SEQ ID NOs: 873 to 885).
(112) TABLE-US-00021 TABLE 21 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) Aromatic 859 30 AMALLPAAVAVA 12 6 51.6 163.3 2.3 Peptides 860 33 AAAILAPAFLAV 12 7 57.3 171.7 2.4 (Aromatic 861 131 WIIAPVWLAWIA 12 5 51.6 179.2 1.9 Ring 862 922 WYVIFVLPLVVP 12 8, 12 41.3 194.2 2.2 Presences) 863 71 FMWMWFPFMWYP 12 7, 12 71.3 0 0.6 864 921 IWWFVVLPLVVP 12 8, 12 41.3 194.2 2.2
(113) TABLE-US-00022 TABLE 22 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) Hydrophobic, 865 436 VVMLVVPAVMLP 12 7, 12 57.3 194.2 2.6 but Non 866 138 PPAALLAILAVA 12 1, 2 57.3 195.8 2.2 Aromatic 867 77 PVALVLVALVAP 12 1, 12 41.3 219.2 2.5 Peptides 868 577 MLMIALVPMIAV 12 8 18.9 195 2.7 869 97 ALLAAPPALLAL 12 6, 7 57.3 204.2 2.1 870 214 ALIVAPALMALP 12 6, 12 60.5 187.5 2.2 871 59 AVLAAPVVAALA 12 6 41.3 187.5 2.5 872 54 LAVAAPPVVALL 12 6, 7 57.3 203.3 2.3
(114) TABLE-US-00023 TABLE 23 SEQ Proline Rigidity/ Sturctural ID rPeptide Position Flexibility Feature Hydropathy Group NO ID Sequences Length (PP) (II) (AI) (GRAVY) Hydrophilic 873 949 SGNSCQQCGNSS 12 None 41.7 0 −1.1 Peptides, 874 39 CYNTSPCTGCCY 12 6 52.5 0 0 but Non 875 19 YVSCCTYTNGSQ 12 None 47.7 0 −1 Aliphatic 876 947 CYYNQQSNNNNQ 12 None 59.6 0 −2.4 877 139 TGSTNSPTCTST 12 7 53.4 0 −0.7 878 18 NYCCTPTTNGQS 12 6 47.9 0 −0.9 879 20 NYCNTCPTYGQS 12 7 47.4 0 −0.9 880 635 GSTGGSQQNNQY 12 None 31.9 0 −1.9 881 40 TYNTSCTPGTCY 12 8 49.4 0.0 −0.6 882 57 QNNCNTSSQGGG 12 None 52.4 0 −1.6 883 159 CYSGSTSQNQPP 12 11, 12 51 0 −1.3 884 700 GTSNTCQSNQNS 12 None 19.1 0 −1.6 885 38 YYNQSTCGGQCY 12 None 53.8 0 −1
(115) 3-5. Summary of Newly Designed Peptides
(116) Total of 457 sequences have been designed based on the critical factors. Designed potentially best aMTDs (hydrophobic, flexible, bending, aliphatic and 12-A/a length peptides) that do satisfy all range/feature of critical factors are 316. Designed rPeptides that do not satisfy at least one of the critical factors are 141 that no bending peptide sequences are 26; rigid peptide (II<40) sequences are 23; too much flexible peptides are 24; aromatic peptides (aromatic ring presences) are 27; hydrophobic, but non-aromatic peptides are 23; and hydrophilic, but non-aliphatic peptides are 18.
(117) 4. Preparation of Recombinant Report Proteins Fused to aMTDs and rPeptides
(118) Recombinant proteins fused to aMTDs and others [rPeptides, reference hydrophobic CPP sequences (MTM and MTD)] were expressed in a bacterial system, purified with single-step affinity chromatography and prepared as soluble proteins in physiological condition. These recombinant proteins have been tested for the ability of their cell-permeability by utilizing flow cytometry and laser scanning confocal microscopy.
(119) 4-1. Selection of Cargo Protein for Recombinant Proteins Fused to Peptide Sequences
(120) For clinical/non-clinical application, aMTD-fused cargo materials would be biologically active molecules that could be one of the following: enzymes, transcription factors, toxic, antigenic peptides, antibodies and antibody fragments. Furthermore, biologically active molecules could be one of these following macromolecules: enzymes, hormones, carriers, immunoglobulin, membrane-bound proteins, transmembrane proteins, internal proteins, external proteins, secreted proteins, virus proteins, native proteins, glycoproteins, fragmented proteins, disulfide bonded proteins, recombinant proteins, chemically modified proteins and prions. In addition, these biologically active molecules could be one of the following: nucleic acid, coding nucleic acid sequence, mRNAs, antisense RNA molecule, carbohydrate, lipid and glycolipid.
(121) According to these pre-required conditions, a non-functional cargo to evaluate aMTD-mediated protein uptake has been selected and called as Cargo A (CRA) that should be soluble and non-functional. The domain (A/a 289 to 840; 184 A/a length) is derived from protein S (Genbank ID: CP000113.1).
(122) 4-2. Construction of Expression Vector and Preparation of Recombinant Proteins
(123) Coding sequences for recombinant proteins fused to each aMTD are cloned Ndel (5′) and SalI (3′) in pET-28a(+) (Novagen, Darmstadt, Germany) from PCR-amplified DNA segments. PCR primers for the recombinant proteins fused to aMTD and rPeptides are SEQ ID NOs: 481 to 797 and 886 to 1202. Structure of the recombinant proteins is displayed in
(124) The recombinant proteins were forcedly expressed in E. coli BL21 (DE3) cells grown to an OD.sub.600 of 0.6 and induced for 2 hours with 0.7 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni.sup.2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany) in natural condition. After the purification, purified proteins were dissolved in a physiological buffer such as DMEM medium.
(125) TABLE-US-00024 TABLE 24 Potentially Best aMTDs 240 (Hydrophobic, Flexible, Bending, Aliphatic & Helical): Random Peptides: 31 No Bending Peptides (No 02 Proline at 5 or 6 and/or 12): No Bending Peptides 01 (No Central Proline): Rigid Peptides (II < 50): 09 Too Much Flexible Peptides: 09 Aromatic Peptides (Aromatic 01 Ring Presences): Hydrophobic, But Non-Aromatic 02 Peptides: Hydrophilic, But Non-Aliphatic 07 Peptides:
(126) 4-3. Expression of aMTD- or Random Peptide (rP)-Fused Recombinant Proteins
(127) Using the standardized six critical factors, 316 aMTD sequences have been designed. In addition, 141 rPeptides are also developed that lack one of these critical factors: no bending peptides: i) absence of proline both in the middle and at the end of sequence or ii) absence of proline either in the middle or at the end of sequence, rigid peptides, too much flexible peptides, aromatic peptides (aromatic ring presence), hydrophobic but non-aromatic peptides, and hydrophilic but non-aliphatic peptides (Table 24).
(128) These rPeptides are devised to be compared and contrasted with aMTDs in order to analyze structure/sequence activity relationship (SAR) of each critical factor with regard to the peptides' intracellular delivery potential. All peptide (aMTD or rPeptide)-containing recombinant proteins have been fused to the CRA to enhance the solubility of the recombinant proteins to be expressed, purified, prepared and analyzed.
(129) These designed 316 aMTDs and 141 rPeptides fused to CRA were all cloned (
(130) To prepare the proteins fused to rPeptides, 60 proteins were expressed that were 10 out of 26 rPeptides in the category of no bending peptides (Table 18); 15 out of 23 in the category of rigid peptides [instability index (II)<40] (Table 19); 19 out of 24 in the category of too much flexible peptides (Table 20); 6 out of 27 in the category of aromatic peptides (Table 21); 8 out of 23 in the category of hydrophobic but non-aromatic peptides (Table 22); and 12 out of 18 in the category of hydrophilic but non-aliphatic peptides (Table 23).
(131) 4-4. Quantitative Cell-Permeability of aMTD-Fused Recombinant Proteins
(132) The aMTDs and rPeptides were fluorescently labeled and compared based on the critical factors for cell-permeability by using flow cytometry and confocal laser scanning microscopy (
(133) Table 25 shows comparison analysis of cell-permeability of aMTDs with a negative control (A: rP38).
(134) TABLE-US-00025 TABLE 25 Negative Control rP38 aMTD 19.6 ± 1.6* The Average of (Best: 164.2) 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to rP38)
(135) Relative cell-permeability (relative fold) of aMTDs to the reference CPPs [B: MTM12 (AAVLLPVLLAAP) (SEQ ID NO: 1250), C: MTD85 (AVALLILAV) (SEQ ID NO: 1251)] was also analyzed.
(136) Table 26 shows comparison analysis of cell-permeability of aMTDs with a reference CPP (B: MTM12).
(137) TABLE-US-00026 TABLE 26 MTM12 aMTD 13.1 ± 1.1* The Average of (Best: 109.9) 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to MTM12)
(138) Table 27 shows comparison analysis of cell-permeability of aMTDs with a reference CPP (C: MTD85).
(139) TABLE-US-00027 TABLE 27 MTD85 aMTD 6.6 ± 0.5* The Average of (Best: 55.5) 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to MTD85)
(140) Geometric means of negative control (histidine-tagged rP38-fused CRA recombinant protein) subtracted by that of naked protein (histidine-tagged CRA protein) lacking any peptide (rP38 or aMTD) was standardized as relative fold of 1. Relative cell-permeability of 240 aMTDs to the negative control (A type) was significantly increased by up to 164 fold, with average increase of 19.6±1.6 (Table 28 to 33).
(141) TABLE-US-00028 TABLE 28 SEQ Proline Rigidity/ Sturctural Relative ID Position Flexibility Feature Hydropathy Ratio (Fold) NO aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 229 899 AVVIALPAVVAP 12 7 57.3 195.0 2.4 164.2 109.9 55.5 237 908 VALALAPVVVAP 12 7 57.3 195.0 2.3 150.6 100.8 50.9 238 910 VAALLPAVVVAP 12 6 57.3 195.0 2.3 148.5 99.4 50.2 185 810 VIVLAAPALAAP 12 7 50.2 187.5 2.2 120.0 80.3 40.6 233 904 AVLAVVAPVVAP 12 8 57.3 186.7 2.4 105.7 70.8 35.8 74 321 IVAVALPALAVP 12 7 50.2 203.3 2.3 97.8 65.2 32.9 204 851 VLAVVLPAVALP 12 7 57.3 219.2 2.5 96.6 64.7 32.7 239 911 VALALPAVVVAP 12 6 57.3 195.0 2.3 84.8 56.8 28.7 205 852 VLAVAAPAVLLP 12 7 57.3 203.3 2.3 84.6 56.6 28.6 179 803 AIALAVPVLALP 12 7 57.3 211.7 2.4 74.7 50.0 25.3 222 888 ILAVVAIPAAAP 12 8 54.9 187.5 2.3 71.0 47.5 24.0 188 825 IVAVIVAPAVAP 12 8 43.2 195.0 2.5 69.7 46.6 23.6 226 895 AIIIVVPAIAAP 12 7 50.2 211.7 2.5 60.8 40.7 20.6 227 896 AILIVVAPIAAP 12 8 50.2 211.7 2.5 57.5 38.5 19.4 164 727 VALAIALPAVLP 12 8 57.3 211.6 2.3 54.7 36.7 18.5 139 603 VLVALAAPVIAP 12 8 57.3 203.3 2.4 54.1 36.1 18.2 200 847 LVAIVVLPAVAP 12 8 50.2 219.2 2.6 50.2 33.4 16.9 189 826 LVALAAPIIAVP 12 7 41.3 211.7 2.4 49.2 32.9 16.6 161 724 VAVLAVLPALAP 12 8 57.3 203.3 2.3 47.5 31.8 16.1 131 563 ALAVIVVPALAP 12 8 50.2 203.3 2.4 47.1 31.4 15.9 186 811 AVVLAVPALAVP 12 7 57.3 195.0 2.3 46.5 31.1 15.7 194 831 IIVAVAPAAIVP 12 7 43.2 203.3 2.5 46.3 31.0 15.7 192 829 AALALVAPVIVP 12 8 50.2 203.3 2.4 44.8 30.0 15.2 224 891 ILAVAAIPAALP 12 8 54.9 195.8 2.2 44.7 29.9 15.1 234 905 AVIAVAPLVVAP 12 7 41.3 195.0 2.4 44.0 29.5 14.9 132 564 VAIALIVPALAP 12 8 50.2 211.7 2.4 43.6 29.1 14.7 34 124 IAVALPALIAAP 12 6 50.3 195.8 2.2 43.6 29.0 14.7 190 827 IAAVLAAPALVP 12 8 57.3 187.5 2.2 43.0 28.8 14.6 2 2 AAAVPLLAVVVP 12 5 41.3 195.0 2.4 40.9 27.2 13.8 91 385 IVAIAVPALVAP 12 7 50.2 203.3 2.4 38.8 25.9 13.1 191 828 IALLAAPIIAVP 12 7 41.3 220.0 2.4 36.8 24.6 12.4 181 806 LVALAVPAAVLP 12 7 57.3 203.3 2.3 36.7 24.6 12.4 198 845 AAVVIAPLLAVP 12 7 41.3 203.3 2.4 35.8 24.0 12.1 218 882 AIALVVPAVAVP 12 7 57.3 195.0 2.4 35.0 23.4 11.8 128 545 VVLVLAAPAAVP 12 8 57.3 195.0 2.3 34.6 23.1 11.7 39 161 AVIALPALIAAP 12 6 57.3 195.8 2.2 34.5 23.0 11.6 110 481 AIAIAIVPVALP 12 8 50.2 211.6 2.4 34.3 23.0 11.6 230 900 ALVAVIAPVVAP 12 8 57.3 195.0 2.4 34.3 22.9 11.6 53 223 AILAVPIAVVAP 12 6 57.3 203.3 2.4 33.0 22.1 11.2 187 824 LIIVAAAPAVAP 12 8 50.2 187.5 2.3 32.8 21.9 11.1 130 562 ALIAAIVPALVP 12 8 50.2 211.7 2.4 32.7 21.8 11.0 52 222 ALLIAPAAVIAP 12 6 57.3 195.8 2.2 32.6 21.7 11.0 17 61 VAALPVLLAALP 12 5 57.3 211.7 2.3 31.2 20.8 10.5 134 582 VAVALIVPALAP 12 8 50.2 203.3 2.4 30.6 20.4 10.3 223 889 ILVAAAPIAALP 12 7 57.3 195.8 2.2 30.3 20.3 10.3 177 787 AVALVPVIVAAP 12 6 50.2 195.0 2.4 29.3 19.6 9.9 157 703 IVAVALVPALAP 12 8 50.2 203.3 2.4 29.2 19.5 9.9 158 705 IVAVALLPALAP 12 8 50.2 211.7 2.4 28.6 19.1 9.7 220 885 LVAIAPAVAVLP 12 6 57.3 203.3 2.4 28.3 19.0 9.6 3 3 AALLVPAAVLAP 12 6 57.3 187.5 2.1 27.0 18.0 9.1 137 601 AAILIAVPIAAP 12 8 57.3 195.8 2.3 26.8 17.9 9.0 196 843 AVLVLVAPAAAP 12 8 41.3 219.2 2.5 26.4 17.7 8.9 94 403 AAALVIPAAILP 12 7 54.9 195.8 2.2 25.2 16.8 8.5 127 544 IVALIVAPAAVP 12 8 43.1 203.3 2.4 23.4 15.6 7.9 121 522 ALLVIAVPAVAP 12 8 57.3 203.3 2.4 22.7 15.2 7.7
(142) TABLE-US-00029 TABLE 29 Relative SEQ Proline Rigidity/ Sturctural Ratio ID Position Flexibility Feature Hydropathy (Fold) NO aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 180 805 LVLIAAAPIALP 12 8 41.3 220.0 2.4 22.3 14.9 7.6 108 464 AVVILVPLAAAP 12 7 57.3 203.3 2.4 22.3 14.9 7.5 96 405 LAAAVIPVAILP 12 7 54.9 211.7 2.4 22.2 14.8 7.5 168 747 VALLAIAPALAP 12 8 57.3 195.8 2.2 22.0 14.8 7.5 115 501 VIVALAVPALAP 12 8 50.2 203.3 2.4 21.5 14.4 7.3 147 661 AAILAPIVAALP 12 6 50.2 195.8 2.2 21.4 14.3 7.2 176 786 LVAIAPLAVLAP 12 6 41.3 211.7 2.4 21.2 14.2 7.2 144 625 ILAAAAAPLIVP 12 8 50.2 195.8 2.2 20.9 13.9 7.0 101 442 ALAALVPAVLVP 12 7 57.3 203.3 2.3 20.4 13.6 6.9 240 912 VALLAPAVVVAP 12 6 57.3 195.0 2.3 19.9 13.3 6.7 43 165 ALAVPVALAIVP 12 5 50.2 203.3 2.4 19.8 13.2 6.7 98 422 VVAILAPLLAAP 12 7 57.3 211.7 2.4 19.6 13.1 6.6 155 686 AALVAVLPVALP 12 8 57.3 203.3 2.3 19.5 13.1 6.6 81 343 IVAVALPALVAP 12 7 50.2 203.3 2.3 19.4 12.9 6.5 76 323 IVAVALPVALAP 12 7 50.2 203.3 2.3 19.1 12.8 6.4 105 461 IAAVIVPAVALP 12 7 50.2 203.3 2.4 19.0 12.7 6.4 9 21 AVALLPALLAVP 12 6 57.3 211.7 2.3 18.9 12.6 6.4 95 404 LAAAVIPAAILP 12 7 54.9 195.8 2.2 18.9 12.6 6.4 60 261 LVLVPLLAAAAP 12 5 41.3 211.6 2.3 18.5 12.3 6.2 122 524 AVALIVVPALAP 12 8 50.2 203.3 2.4 18.3 12.2 6.2 55 225 VAALLPAAAVLP 12 6 57.3 187.5 2.1 18.3 12.2 6.2 63 264 LAAAPVVIVIAP 12 5 50.2 203.3 2.4 18.2 12.1 6.1 1 1 AAALAPVVLALP 12 6 57.3 187.5 2.1 17.7 11.8 6.0 88 382 AAALVIPAILAP 12 7 54.9 195.8 2.2 17.7 11.8 6.0 107 463 AVAILVPLLAAP 12 7 57.3 211.7 2.4 17.6 11.7 5.9 75 322 VVAIVLPALAAP 12 7 50.2 203.3 2.3 17.6 11.7 5.9 117 503 AAIIIVLPAALP 12 8 50.2 220.0 2.4 17.6 11.8 5.9 211 870 VLVAAVLPIAAP 12 8 41.3 203.3 2.4 16.6 11.1 5.6 56 241 AAAVVPVLLVAP 12 6 57.3 195.0 2.4 16.6 11.0 5.6 163 726 LAVAIIAPAVAP 12 8 57.3 187.5 2.2 16.5 11.0 5.6 79 341 IVAVALPAVLAP 12 7 50.2 203.3 2.3 16.4 10.9 5.5 125 542 ALALIIVPAVAP 12 8 50.2 211.6 2.4 16.2 10.8 5.5 83 361 AVVIVAPAVIAP 12 7 50.2 195.0 2.4 16.0 10.7 5.4 54 224 ILAAVPIALAAP 12 6 57.3 195.8 2.2 15.8 10.6 5.3 20 64 AIVALPVAVLAP 12 6 50.2 203.3 2.4 15.8 10.6 5.3 111 482 ILAVAAIPVAVP 12 8 54.9 203.3 2.4 15.8 10.6 5.3 113 484 LAVVLAAPAIVP 12 8 50.2 203.3 2.4 15.6 10.4 5.3 210 868 VLVAAILPAAIP 12 8 54.9 211.7 2.4 14.9 10.0 5.0 124 541 LLALIIAPAAAP 12 8 57.3 204.1 2.1 14.8 9.9 5.0 150 666 AAIAIIAPAIVP 12 8 50.2 195.8 2.3 14.7 9.9 5.0 149 665 LAIVLAAPVAVP 12 8 50.2 203.3 2.3 14.7 9.9 5.0 84 363 AVLAVAPALIVP 12 7 50.2 203.3 2.3 14.7 9.8 4.9 57 242 AALLVPALVAAP 12 6 57.3 187.5 2.1 14.6 9.7 4.9 90 384 VIVAIAPALLAP 12 7 50.2 211.6 2.4 14.0 9.4 4.7 214 877 VAIIAVPAVVAP 12 7 57.3 195.0 2.4 14.0 9.4 4.7 206 863 AAVVLLPIIAAP 12 7 41.3 211.7 2.4 13.8 9.3 4.7 123 525 ALAIVVAPVAVP 12 8 50.2 195.0 2.4 13.8 9.2 4.7 213 875 AIAIVVPAVAVP 12 7 50.2 195.0 2.4 13.8 9.2 4.7 69 285 AIVLLPAAVVAP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 65 281 ALIVLPAAVAVP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 209 867 ALLVVIAPLAAP 12 8 41.3 211.7 2.4 13.2 8.8 4.4 172 766 IVVIAVAPAVAP 12 8 50.2 195.0 2.4 12.9 8.6 4.4 80 342 VIVALAPAVLAP 12 7 50.2 203.3 2.3 12.7 8.5 4.3 217 881 AALIVVPAVAVP 12 7 50.2 195.0 2.4 12.7 8.5 4.3 119 505 AIIIVIAPAAAP 12 8 50.2 195.8 2.3 12.4 8.3 4.2
(143) TABLE-US-00030 TABLE 30 Relative SEQ Proline Rigidity/ Sturctural Ratio ID Position Flexibility Feature Hydropathy (Fold) NO aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 169 763 VAVLIAVPALAP 12 8 57.3 203.3 2.3 12.3 7.2 4.2 156 687 AILAVALPLLAP 12 8 57.3 220.0 2.3 12.0 7.0 4.1 159 706 IVAVALLPAVAP 12 8 50.2 203.3 2.4 12.0 7.0 4.1 145 643 LALVLAAPAIVP 12 8 50.2 211.6 2.4 11.8 7.9 4.0 66 282 VLAVAPALIVAP 12 6 50.2 203.3 2.4 11.8 7.9 4.0 126 543 LLAALIAPAALP 12 8 57.3 204.1 2.1 11.7 7.8 4.0 78 325 IVAVALPAVALP 12 7 50.2 203.3 2.3 11.7 7.8 4.0 199 846 IAVAVAAPLLVP 12 8 41.3 203.3 2.4 11.7 6.8 4.0 89 383 VIVALAPALLAP 12 7 50.2 211.6 2.3 11.6 7.7 3.9 87 381 VVAIVLPAVAAP 12 7 50.2 195.0 2.4 11.5 7.7 3.9 183 808 LVVLAAAPLAVP 12 8 41.3 203.3 2.3 11.5 7.6 3.9 208 865 AVLVIAVPAIAP 12 8 57.3 203.3 2.5 11.3 7.5 3.8 162 725 IAVLAVAPAVLP 12 8 57.3 203.3 2.3 11.2 7.5 3.8 197 844 VVALLAPLIAAP 12 7 41.3 211.8 2.4 11.2 7.5 3.8 228 897 AVIVPVAIIAAP 12 5 50.2 203.3 2.5 11.2 7.5 3.8 141 605 VIAAVLAPVAVP 12 8 57.3 195.0 2.4 11.0 7.4 3.7 166 744 AAVVIVAPVALP 12 8 50.2 195.0 2.4 11.0 7.3 3.7 51 221 AAILAPIVALAP 12 6 50.2 195.8 2.2 10.9 7.3 3.7 142 622 ALIVLAAPVAVP 12 8 50.2 203.3 2.4 10.6 7.1 3.6 92 401 AALAVIPAAILP 12 7 54.9 195.8 2.2 10.6 7.1 3.6 77 324 IVAVALPAALVP 12 7 50.2 203.3 2.3 10.3 6.9 3.5 215 878 IVALVAPAAVVP 12 7 50.2 195.0 2.4 10.3 6.9 3.5 71 302 LALAPALALLAP 12 5 57.3 204.2 2.1 10.2 6.8 3.4 154 685 ALLVAVLPAALP 12 8 57.3 211.7 2.3 10.2 5.9 3.4 201 848 AVAIVVLPAVAP 12 8 50.2 195.0 2.4 10.0 6.7 3.4 138 602 VIVALAAPVLAP 12 8 50.2 203.3 2.4 9.9 5.8 3.4 178 788 AIAVAIAPVALP 12 8 57.3 187.5 2.3 9.8 6.6 3.3 38 145 LLAVVPAVALAP 12 6 57.3 203.3 2.3 9.5 6.3 3.2 6 11 VVALAPALAALP 12 6 57.3 187.5 2.1 9.5 6.3 3.2 35 141 AVIVLPALAVAP 12 6 50.2 203.3 2.4 9.4 6.3 3.2 120 521 LAALIVVPAVAP 12 8 50.2 203.3 2.4 9.4 6.3 3.2 100 425 AVVAIAPVLALP 12 7 57.3 203.3 2.4 9.4 6.3 3.2 86 365 AVIVVAPALLAP 12 7 50.2 203.3 2.3 9.3 6.2 3.1 62 263 ALAVIPAAAILP 12 6 54.9 195.8 2.2 9.0 6.0 3.0 82 345 ALLIVAPVAVAP 12 7 50.2 203.3 2.3 8.9 5.9 3.0 203 850 LVIALAAPVALP 12 8 57.3 211.7 2.4 8.8 5.9 3.0 37 144 VLAIVPAVALAP 12 6 50.2 203.3 2.4 8.8 5.9 3.0 173 767 IVVAAVVPALAP 12 8 50.2 195.0 2.4 8.5 5.0 2.9 47 185 AALVLPLIIAAP 12 6 41.3 220.0 2.4 8.5 5.7 2.9 202 849 AVILLAPLIAAP 12 7 57.3 220.0 2.4 8.3 4.8 2.8 40 162 AVVALPAALIVP 12 6 50.2 203.3 2.4 8.2 5.5 2.8 207 864 ALLVIAPAIAVP 12 7 57.3 211.7 2.4 8.2 4.8 2.8 42 164 LAAVLPALLAAP 12 6 57.3 195.8 2.1 8.2 5.5 2.8 236 907 VAIALAPVVVAP 12 7 57.3 195.0 2.4 8.1 5.4 2.8 103 444 LAAALVPVALVP 12 7 57.3 203.3 2.3 8.1 5.4 2.7 102 443 ALAALVPVALVP 12 7 57.3 203.3 2.3 8.0 5.3 2.7 221 887 VLAVAPAVAVLP 12 6 57.3 195.0 2.4 7.7 5.1 2.6 231 901 ALVAVLPAVAVP 12 7 57.3 195.0 2.4 7.7 5.1 2.6 167 746 VAIIVVAPALAP 12 8 50.2 203.3 2.4 7.6 4.4 2.6 232 902 ALVAPLLAVAVP 12 5 41.3 203.3 2.3 7.6 5.1 2.6 133 565 VAIVLVAPAVAP 12 8 50.2 195.0 2.4 7.5 5.0 2.5 59 245 AAALAPVLALVP 12 6 57.3 187.5 2.1 7.5 5.0 2.5 165 743 AIAIALVPVALP 12 8 57.3 211.6 2.4 7.4 4.9 2.5 109 465 AVVILVPLAAAP 12 7 57.3 203.3 2.4 7.4 4.9 2.5 30 104 AVVAAPLVLALP 12 6 41.3 203.3 2.3 7.3 4.9 2.5
(144) TABLE-US-00031 TABLE 31 Relative SEQ Proline Rigidity/ Sturctural Ratio ID Position Flexibility Feature Hydropathy (Fold) NO aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 160 707 IVALAVLPAVAP 12 8 50.2 203.3 2.4 7.3 4.9 2.5 212 872 VLAAAVLPLVVP 12 8 41.3 219.2 2.5 7.3 4.9 2.5 135 583 AVILALAPIVAP 12 8 50.2 211.6 2.4 7.3 4.8 2.4 216 879 AAIVLLPAVVVP 12 7 50.2 219.1 2.5 7.2 4.8 2.4 175 784 VAALPAVALVVP 12 5 57.3 195.0 2.4 7.1 4.7 2.4 225 893 VIAIPAILAAAP 12 5 54.9 195.8 2.3 7.0 4.7 2.4 8 13 AAALVPVVALLP 12 6 57.3 203.3 2.3 7.0 4.7 2.4 184 809 LIVLAAPALAAP 12 7 50.2 195.8 2.2 7.0 4.7 2.4 104 445 ALAALVPALVVP 12 7 57.3 203.3 2.3 6.9 4.6 2.3 22 81 AALLPALAALLP 12 5 57.3 204.2 2.1 6.9 4.6 2.3 151 667 LAVAIVAPALVP 12 8 50.2 203.3 2.3 6.9 4.6 2.3 235 906 AVIALAPVVVAP 12 7 57.3 195.0 2.4 6.8 4.6 2.3 112 483 ILAAAIIPAALP 12 8 54.9 204.1 2.2 6.8 4.5 2.3 114 485 AILAAIVPLAVP 12 8 50.2 211.6 2.4 6.8 4.5 2.3 97 421 AAILAAPLIAVP 12 7 57.3 195.8 2.2 6.7 4.5 2.3 136 585 ALIVAIAPALVP 12 8 50.2 211.6 2.4 6.6 4.4 2.2 99 424 AVVVAAPVLALP 12 7 57.3 195.0 2.4 6.6 4.4 2.2 85 364 LVAAVAPALIVP 12 7 50.2 203.3 2.3 6.5 4.3 2.2 93 402 ALAAVIPAAILP 12 7 54.9 195.8 2.2 6.4 4.3 2.2 106 462 IAAVLVPAVALP 12 7 57.3 203.3 2.4 6.3 4.2 2.1 64 265 VLAIAPLLAAVP 12 6 41.3 211.6 2.3 6.0 4.0 2.0 70 301 VIAAPVLAVLAP 12 6 57.3 203.3 2.4 6.0 4.0 2.0 45 183 LLAAPVVIALAP 12 6 57.3 211.6 2.4 6.0 4.0 2.0 58 243 AAVLLPVALAAP 12 6 57.3 187.5 2.1 5.9 3.9 2.0 148 664 ILIAIAIPAAAP 12 8 54.9 204.1 2.3 5.7 3.8 1.9 174 783 IVALVPAVAIAP 12 6 50.2 203.3 2.5 5.7 3.8 1.9 116 502 AIVALAVPVLAP 12 8 50.2 203.3 2.4 5.6 3.7 1.9 61 262 ALIAVPAIIVAP 12 6 50.2 211.6 2.4 5.5 3.7 1.9 152 683 LAIVLAAPAVLP 12 8 50.2 211.7 2.4 5.5 3.2 1.9 193 830 IALVAAPVALVP 12 7 57.3 203.3 2.4 5.3 3.5 1.8 170 764 AVALAVLPAVVP 12 8 57.3 195.0 2.3 5.0 3.4 1.7 182 807 AVALAVPALVLP 12 7 57.3 203.3 2.3 5.0 3.3 1.7 46 184 LAAIVPAIIAVP 12 6 50.2 211.6 2.4 4.8 3.2 1.6 73 305 IALAAPILLAAP 12 6 57.3 204.2 2.2 4.8 3.2 1.6 27 101 LVALAPVAAVLP 12 6 57.3 203.3 2.3 4.5 3.0 1.5 72 304 AIILAPIAAIAP 12 6 57.3 204.2 2.3 4.4 3.0 1.5 140 604 VALIAVAPAVVP 12 8 57.3 195.0 2.4 4.3 2.5 1.5 146 645 ALAVVALPAIVP 12 8 50.2 203.3 2.4 4.3 2.9 1.5 48 201 LALAVPALAALP 12 6 57.3 195.8 2.1 4.2 2.8 1.4 41 163 LALVLPAALAAP 12 6 57.3 195.8 2.1 4.1 2.4 1.4 195 832 AVAAIVPVIVAP 12 7 43.2 195.0 2.5 4.1 2.7 1.4 44 182 ALIAPVVALVAP 12 6 57.3 203.3 2.4 4.0 2.7 1.4 11 23 VVLVLPAAAAVP 12 6 57.3 195.0 2.4 4.0 2.6 1.3 31 105 LLALAPAALLAP 12 6 57.3 204.1 2.1 4.0 2.6 1.3 129 561 AAVAIVLPAVVP 12 8 50.2 195.0 2.4 3.9 2.6 1.3 171 765 AVALAVVPAVLP 12 8 57.3 195.0 2.3 3.8 2.2 1.3 153 684 AAIVLALPAVLP 12 8 50.2 211.7 2.4 3.5 2.1 1.2 36 143 AVLAVPAVLVAP 12 6 57.3 195.0 2.4 3.3 2.2 1.1 118 504 LIVALAVPALAP 12 8 50.2 211.7 2.4 3.3 2.2 1.1 10 22 AVVLVPVLAAAP 12 6 57.3 195.0 2.4 3.1 2.1 1.1 5 5 AAALLPVALVAP 12 6 57.3 187.5 2.1 3.1 2.1 1.0 67 283 AALLAPALIVAP 12 6 50.2 195.8 2.2 3.1 2.0 1.0 21 65 IAIVAPVVALAP 12 6 50.2 203.3 2.4 3.0 2.0 1.0 219 883 LAIVPAAIAALP 12 6 50.2 195.8 2.2 3.0 2.0 1.0 33 123 AAIIVPAALLAP 12 6 50.2 195.8 2.2 2.9 2.0 1.0
(145) TABLE-US-00032 TABLE 32 Relative SEQ Proline Rigidity/ Sturctural Ratio ID Position Flexibility Feature Hydropathy (Fold) NO aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 68 284 ALIAPAVALIVP 12 5 50.2 211.7 2.4 2.8 1.8 0.9 50 205 ALALVPAIAALP 12 6 57.3 195.8 2.2 2.6 1.7 0.9 14 42 VAALPVVAVVAP 12 5 57.3 186.7 2.4 2.5 1.7 0.8 32 121 AIVALPALALAP 12 6 50.2 195.8 2.2 2.5 1.7 0.8 13 25 IVAVAPALVALP 12 6 50.2 203.3 2.4 2.4 1.6 0.8 12 24 IALAAPALIVAP 12 6 50.2 195.8 2.2 2.3 1.6 0.8 49 204 LIAALPAVAALP 12 6 57.3 195.8 2.2 2.2 1.5 0.8 7 12 LLAAVPAVLLAP 12 6 57.3 211.7 2.3 2.2 1.5 0.7 15 43 LLAAPLVVAAVP 12 5 41.3 187.5 2.1 2.1 1.4 0.7 29 103 ALIAAPILALAP 12 6 57.3 204.2 2.2 2.1 1.4 0.7 23 82 AVVLAPVAAVLP 12 6 57.3 195.0 2.4 2.1 1.4 0.7 4 4 ALALLPVAALAP 12 6 57.3 195.8 2.1 2.0 1.3 0.7 26 85 LLVLPAAALAAP 12 5 57.3 195.8 2.1 1.9 1.3 0.7 19 63 AALLVPALVAVP 12 6 57.3 203.3 2.3 1.9 1.3 0.7 16 44 ALAVPVALLVAP 12 5 57.3 203.3 2.3 1.6 1.1 0.5 25 84 AAVAAPLLLALP 12 6 41.3 195.8 2.1 1.5 1.0 0.5 18 62 VALLAPVALAVP 12 6 57.3 203.3 2.3 1.4 0.9 0.5 24 83 LAVAAPLALALP 12 6 41.3 195.8 2.1 1.4 0.9 0.5 28 102 LALAPAALALLP 12 5 57.3 204.2 2.1 1.4 0.9 0.5 143 623 VAAAIALPAIVP 12 8 50.2 187.5 2.3 0.8 0.6 0.3 19.6 ± 1.6 13.1 ± 1.1 6.6 ± 0.5
(146) Moreover, compared to reference CPPs (B type: MTM12 and C type: MTD85), novel 240 aMTDs averaged of 13±1.1 (maximum 109.9) and 6.6±0.5 (maximum 55.5) fold higher cell-permeability, respectively (Tables 28 to 32).
(147) TABLE-US-00033 TABLE 33 Negative control rP38 MTM12 MTD85 aMTD 19.6 ± 1.6* 13.1 ± 1.1* 6.6 ± 0.5* The Average of (Best: 164.2) (Best: 109.9) (Best: 55.5) 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to rP38, MTM12, MTD85)
(148) In addition, cell-permeability of 31 rPeptides has been compared with that of 240 aMTDs (0.3±0.04; Tables 34 and 35).
(149) TABLE-US-00034 TABLE 34 Relative Proline Rigidity/ Sturctural Ratio to Position Flexibility Feature Hydropathy aMTD Number rPeptide Sequences Length (PP) (II) (AI) (GRAVY) AVE 1 692 PAPLPPVVILAV 12 1, 3, 5, 6 105.5 186.7 1.8 0.74 (SEQ ID NO: 840) 2 26 AAIALAAPLAIV 12 8 18.1 204.2 2.5 0.65 (SEQ ID NO: 828) 3 113 PVAVALLIAVPP 12 1, 11, 12 57.3 195 2.1 0.61 (SEQ ID NO: 824) 4 466 IIAAAAPLAIIP 12 7, 12 22.8 204.2 2.3 0.52 (SEQ ID NO: 830) 5 167 VAIAIPAALAIP 12 6, 12 20.4 195.8 2.3 0.50 (SEQ ID NO: 831) 6 97 ALLAAPPALLAL 12 6, 7 57.3 204.2 2.1 0.41 (SEQ ID NO: 869) 7 390 VPLLVPVVPVVP 12 2, 6, 9, 12 105.4 210 2.2 0.41 (SEQ ID NO: 842) 8 426 AAALAIPLAIIP 12 7, 12 4.37 204.2 2.2 0.40 (SEQ ID NO: 833) 9 214 ALIVAPALMALP 12 6, 12 60.5 187.5 2.2 0.33 (SEQ ID NO: 870) 10 68 VAPVLPAAPLVP 12 3, 6, 9, 12 105.5 162.5 1.6 0.32 (SEQ ID NO: 846) 11 39 CYNTSPCTGCCY 12 6 52.5 0.0 0.0 0.29 (SEQ ID NO: 874) 12 934 LILAPAAVVAAA 12 5 57.3 195.8 2.5 0.28 (SEQ ID NO: 821) 13 938 VPVLLPVVVPVP 12 2, 6, 10, 12 121.5 210 2.2 0.28 (SEQ ID NO: 849) 14 329 LPVLVPVVPVVP 12 2, 6, 9, 12 121.5 210 2.2 0.23 (SEQ ID NO: 850) 15 606 AAAIAAIPIIIP 12 8, 12 4.4 204.2 2.4 0.20 (SEQ ID NO: 834) 16 49 VVPAAPAVPVVP 12 3, 6, 9, 12 121.5 145.8 1.7 0.18 (SEQ ID NO: 851) 17 139 TGSTNSPTCTST 12 7 53.4 0.0 −0.7 0.17 (SEQ ID NO: 877) 18 772 LPVAPVIPIIVP 12 2, 5, 8, 12 79.9 210.8 2.1 0.16 (SEQ ID NO: 852) 19 921 IWWFVVLPLVVP 12 8, 12 41.3 194.2 2.2 0.14 (SEQ ID NO: 864) 20 66 AGVLGGPIMGVP 12 7, 12 35.5 121.7 1.3 0.13 (SEQ ID NO: 835) 21 693 AAPVLPVAVPIV 12 3, 6, 10 82.3 186.7 2.1 0.13 (SEQ ID NO: 855) 22 18 NYCCTPTTNGQS 12 6 47.9 0.0 −0.9 0.10 (SEQ ID NO: 878) 23 16 NNSCTTYTNGSQ 12 None 47.4 0.0 −1.4 0.08 (SEQ ID NO: 823) 24 227 LAAIVPIAAAVP 12 6, 12 34.2 187.5 2.2 0.08 (SEQ ID NO: 837) 25 17 GGCSAPQTTCSN 12 6 51.6 8.3 −0.5 0.08 (SEQ ID NO: 838) 26 67 LDAEVPLADDVP 12 6, 12 34.2 130 0.3 0.08 (SEQ ID NO: 839) 27 635 GSTGGSQQNNQY 12 None 31.9 0.0 −1.9 0.07 (SEQ ID NO: 880) 28 29 VLPPLPVLPVLP 12 3, 4, 6, 9, 12 121.5 202.5 1.7 0.07 (SEQ ID NO: 857) 29 57 QNNCNTSSQGGG 12 None 52.4 0.0 −1.6 0.06 (SEQ ID NO: 882) 30 700 GTSNTCQSNQNS 12 None 19.1 0.0 −1.6 0.05 (SEQ ID NO: 884) 31 38 YYNQSTCGGQCY 12 None 53.8 0.0 −1.0 0.05 (SEQ ID NO: 885) AVE 0.3 ± 0.04
(150) TABLE-US-00035 TABLE 35 Relative Ratio to aMTD AVE* rPeptide 0.3 ± 0.04 The Average of 31 aMTDs *Out of 240 aMTDs, average relative fold of aMTD had been 19.6 fold compared to type A (rP38).
(151) In summary, relative cell-permeability of aMTDs has shown maximum of 164.0, 109.9 and 55.5 fold higher to rP38, MTM12 and MTD85, respectively. In average of total 240 aMTD sequences, 19.6±1.6, 13.1±1.1 and 6.6±0.5 fold higher cell-permeability are shown to the rP38, MTM12 and MTD85, respectively (Tables 28 to 32). Relative cell-permeability of negative control (rP38) to the 240 aMTDs is only 0.3±0.04 fold.
(152) 4-5. Intracellular Delivery and Localization of aMTD-Fused Recombinant Proteins
(153) Recombinant proteins fused to the aMTDs were tested to determine their intracellular delivery and localization by laser scanning confocal microscopy with a negative control (rP38) and previous published CPPs (MTM12 and MTD85) as the positive control references. NIH3T3 cells were exposed to 10 μM of FITC-labeled protein for 1 hour at 37, and nuclei were counterstained with DAPI. Then, cells were examined by confocal laser scanning microscopy (FIG. 7). Recombinant proteins fused to aMTDs clearly display intracellular delivery and cytoplasmic localization (
(154) 4-6. Summary of Quantitative and Visual Cell-Permeability of Newly Developed aMTDs
(155) Histidine-tagged aMTD-fused cargo recombinant proteins have been greatly enhanced in their solubility and yield. Thus, FITC-conjugated recombinant proteins have also been tested to quantitate and visualize intracellular localization of the proteins and demonstrated higher cell-permeability compared to the reference CPPs.
(156) In the previous studies using the hydrophobic signal-sequence-derived CPPs—MTS/MTM or MTDs, 17 published sequences have been identified and analyzed in various characteristics such as length, molecular weight, pI value, bending potential, rigidity, flexibility, structural feature, hydropathy, amino acid residue and composition, and secondary structure of the peptides. Based on these analytical data of the sequences, novel artificial and non-natural peptide sequences designated as advanced MTDs (aMTDs) have been invented and determined their functional activity in intracellular delivery potential with aMTD-fused recombinant proteins.
(157) aMTD-fused recombinant proteins have promoted the ability of protein transduction into the cells compared to the recombinant proteins containing rPeptides and/or reference hydrophobic CPPs (MTM12 and MTD85). According to the results, it has been demonstrated that critical factors of cell-penetrating peptide sequences play a major role to determine peptide-mediated intracellular delivery by penetrating plasma membrane. In addition, cell-permeability can considerably be improved by following the rational that all satisfy the critical factors.
(158) 5. Structure/Sequence Activity Relationship (SAR) of aMTDs on Delivery Potential
(159) After determining the cell-permeability of novel aMTDs, structure/sequence activity relationship (SAR) has been analyzed for each critical factor in selected some of and all of novel aMTDs (
(160) TABLE-US-00036 TABLE 36 Rank of Rigidity/ Sturctural Relative Amino Acid Delivery Flexibility Feature Hydropathy Ratio (Fold) Composition Potential (II) (AI) (GRAVY) A B C A V I L 1~10 55.9 199.2 2.3 112.7 75.5 38.1 4.0 3.5 0.4 2.1 11~20 51.2 205.8 2.4 56.2 37.6 19.0 4.0 2.7 1.7 1.6 21~30 49.1 199.2 2.3 43.6 28.9 14.6 4.3 2.7 1.4 1.6 31~40 52.7 201.0 2.4 34.8 23.3 11.8 4.2 2.7 1.5 1.6 41~50 53.8 201.9 2.3 30.0 20.0 10.1 4.3 2.3 1.1 2.3 51~60 51.5 205.2 2.4 23.5 15.7 7.9 4.4 2.1 1.5 2.0 222~231 52.2 197.2 2.3 2.2 1.5 0.8 4.5 2.1 1.0 2.4 232~241 54.1 199.7 2.2 1.7 1.2 0.6 4.6 1.7 0.2 3.5
(161) 5-1. Proline Position:
(162) In regards to the bending potential (proline position: PP), aMTDs with its proline at 7′ or 8′ amino acid in their sequences have much higher cell-permeability compared to the sequences in which their proline position is at 5′ or 6′ (
(163) 5-2. Hydropathy:
(164) In addition, when the aMTDs have GRAVY (Grand Average of Hydropathy) ranging in 2.1-2.2, these sequences display relatively lower cell-permeability, while the aMTDs with 2.3-2.6 GRAVY are shown significantly higher one (
(165) 5-3. rPeptide SAR:
(166) To the SAR of aMTDs, rPeptides have shown similar SAR correlations in the cell-permeability, pertaining to their proline position (PP) and hydropathy (GRAVY). These results confirms that rPeptides with high GRAVY (2.4 to 2.6) have better cell-permeability (
(167) 5-4. Analysis of Amino Acid Composition:
(168) In addition to proline position and hydropathy, the difference of amino acid composition is also analyzed. Since aMTDs are designed based on critical factors, each aMTD-fused recombinant protein has equally two proline sequences in the composition. Other hydrophobic and aliphatic amino acids—alanine, isoleucine, leucine and valine—are combined to form the rest of aMTD peptide sequences.
(169) Alanine: In the composition of amino acids, the result does not show a significant difference by the number of alanine in terms of the aMTD's delivery potential because all of the aMTDs have three to five alanines. In the sequences, however, four alanine compositions show the most effective delivery potential (geometric mean) (
(170) Leucine and Isoleucine: Also, the compositions of isoleucine and leucine in the aMTD sequences show inverse relationship between the number of amino acid (I and L) and delivery potential of aMTDs. Lower number of isoleucine and leucine in the sequences tends to have higher delivery potential (geometric mean) (
(171) Valine: Conversely, the composition of valine of aMTD sequences shows positive correlation with their cell-permeability. When the number of valine in the sequence is low, the delivery potential of aMTD is also relatively low (
(172) Ten aMTDs having the highest cell-permeability are selected (average geometric mean: 2584±126). Their average number of valine in the sequences is 3.5; 10 aMTDs having relatively low cell-permeability (average geometric mean: 80±4) had average of 1.9 valine amino acids. The average number of valine in the sequences is lowered as their cell-permeability is also lowered as shown in
(173) 5-5. Conclusion of SAR Analysis:
(174) As seen in
(175) 6. Experimental Confirmation of Index Range/Feature of Critical Factors
(176) The range and feature of five out of six critical factors have been empirically and experimentally determined that are also included in the index range and feature of the critical factors initially proposed before conducting the experiments and SAR analysis. In terms of index range and feature of critical factors of newly developed 240 aMTDs, the bending potential (proline position: PP), rigidity/flexibility (Instability Index: II), structural feature (Aliphatic Index: AI), hydropathy (GRAVY), amino acid length and composition are all within the characteristics of the critical factors derived from analysis of reference hydrophobic CPPs.
(177) Therefore, our hypothesis to design and develop new hydrophobic CPP sequences as advanced MTDs is empirically and experimentally proved and demonstrated that critical factor-based new aMTD rational design is correct.
(178) TABLE-US-00037 TABLE 37 Summarized Critical Factors of aMTD Newly Analysis of Designed CPPs Experimental Results Critical Factor Range Range Bending Potential Proline presences Proline presences (Proline Position: PP) in the middle in the middle (5’, 6’, 7’ or 8’) (5’, 6’, 7’ or 8’) and at the and at the end of peptides end of peptides Rigidity/Flexibility 40-60 41.3-57.3 (Instability Index: II) Structural Feature 180-220 187.5-220.0 (Aliphatic Index: AI) Hydropathy 2.1-2.6 2.2-2.6 (Grand Average of Hydropathy GRAVY) Length 9-13 12 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
7. Discovery and Development of Protein-Based New Biotherapeutics with MITT Enabled by aMTDs for Protein Therapy
(179) Total of 240 aMTD sequences have been designed and developed based on the critical factors. Quantitative and visual cell-permeability of 240 aMTDs (hydrophobic, flexible, bending, aliphatic and 12 a/a-length peptides) are all practically determined.
(180) To measure the cell-permeability of aMTDs, rPeptides have also been designed and tested. As seen in
(181) These examined critical factors are within the range that we have set for our critical factors; therefore, we are able to confirm that the aMTDs that satisfy these critical factors have relatively high cell-permeability and much higher intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.
(182) It has been widely evident that many human diseases are caused by proteins with deficiency or over-expression that causes mutations such as gain-of-function or loss-of-function. If biologically active proteins could be delivered for replacing abnormal proteins within a short time frame, possibly within an hour or two, in a quantitative manner, the dosage may be regulated depending on when and how proteins may be needed. By significantly improving the solubility and yield of novel aMTD in this invention (Table 33), one could expect its practical potential as an agent to effectively deliver therapeutic macromolecules such as proteins, peptides, nucleic acids, and other chemical compounds into live cells as well as live mammals including human. Therefore, newly developed MITT utilizing the pool (240) of novel aMTDs can be used as a platform technology for discovery and development of protein-based biotherapeutics to apprehend intracellular protein therapy after determining the optimal cargo-aMTD relationship.
(183) The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.
Example 1. Development of Novel Advanced Macromolecule Transduction Domain (aMTD)
(184) H-regions of signal sequences (HRSP)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined ‘critical factors’ to have a ‘common function,’ to facilitate protein translocation across the plasma membrane with similar mechanism to the analyzed CPPs.
(185) The structural motif is represented by General Formula of
(186) In Table 12, universal common sequence/structural motif is provided as follows. The amino acid length of the peptides in this invention ranges from 9 to 13 amino acids, mostly 12 amino acids, and their bending potentials are dependent with the presence and location of proline in the middle of sequence (at 5′, 6′, 7′ or 8′ amino acid) and at the end of peptide (at 12′) for recombinant protein bending. Instability index (II) for rigidity/flexibility of aMTDs is II<40, grand average of hydropathy (GRAVY) for hydropathy is around 2.2, and aliphatic index (AI) for structural features is around 200 (Table 11). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and summarized in Tables 12 to 17.
Example 2. Construction of Expression Vectors for Recombinant Proteins Fused to aMTDs
(187) Our newly developed technology has enabled us to expand the method for making cell-permeable recombinant proteins. The expression vectors were designed for histidine-tagged CRA proteins fused with aMTDs or rPeptides. To construct expression vectors for recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify each designed aMTD or rPeptide fused to CRA.
(188) The PCR reactions (100 ng of genomic DNA, 10 pmol of each primer, each 0.2 mM dNTP mixture, 1× reaction buffer and 2.5 U of Pfu(+) DNA polymerase (Doctor protein, Korea) was digested on the restriction enzyme site between Nde I (5′) and Sal I (3′) involving 35 cycles of denaturation (95° C.), annealing (62° C.), and extension (72° C.) for 30 seconds each. For the last extension cycle, the PCR reactions remained for 5 minutes at 72° C. Then, they were cloned into the site of pET-28a(+) vectors (Novagen, Darmstadt, Germany). DNA ligation was performed using T4 DNA ligase at 4° C. overnight. These plasmids were mixed with competent cells of E. coli DH5-alpha strain on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat shocked in the water bath at 42° C. for 90 seconds. Then, the mixture added with LB broth media was recovered in 37° C. shaking incubator for 1 hour. Transformant was plated on LB broth agar plate with kanamycin (50 μg/mL) (Biopure, Johnson City, Tenn., USA) before incubating at 37° C. overnight. From a single colony, plasmid DNA was extracted, and after the digestion of Nde I and Sal I restriction enzymes, digested DNA was confirmed at 645 bp by using 1.2% agarose gels electrophoresis (
Example 3. Inducible Expression, Purification and Preparation of Recombinant Proteins Fused to aMTDs and rPeptides
(189) To express recombinant proteins, pET-28a(+) vectors for the expression of CRA proteins fused to a negative control [rPeptide 38 (rP38)], reference hydrophobic CPPs (MTM.sub.12 and MTD.sub.85) and aMTDs were transformed in E. coli BL21 (DE3) strains. Cells were grown at 37° C. in LB medium containing kanamycin (50 μg/ml) with a vigorous shaking and induced at OD.sub.600=0.6 by adding 0.7 mM IPTG (Biopure) for 2 hours at 37° C. Induced recombinant proteins were loaded on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (InstantBlue, Expedeon, Novexin, UK) (
(190) The E. coli cultures were harvested by centrifugation at 5,000×rpm for 10 minutes, and the supernatant was discarded. The pellet was re-suspended in the lysis buffer (50 mM NaH.sub.2PO.sub.4, 10 mM Imidazol, 300 mM NaCl, pH 8.0). The cell lysates were sonicated on ice using a sonicator (Sonics and Materials, Inc., Newtown, Conn., USA) equipped with a probe. After centrifuging the cell lysates at 5,000×rpm for 10 minutes to pellet the cellular debris, the supernatant was incubated with lysis buffer-equilibrated Ni-NTA resin (Qiagen, Hilden, Germany) gently by open-column system (Bio-rad, Hercules, Calif., USA). After washing protein-bound resin with 200 ml wash buffer (50 mM NaH.sub.2PO.sub.4, 20 mM Imidazol, 300 mM NaCl, pH 8.0), the bounded proteins were eluted with elution buffer (50 mM NaH.sub.2PO.sub.4, 250 mM Imidazol, 300 mM NaCl, pH 8.0).
(191) Recombinant proteins purified under natural condition were analyzed on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (
Example 4. Determination of Quantitative Cell-Permeability of Recombinant Proteins
(192) For quantitative cell-permeability, the aMTD- or rPeptide-fused recombinant proteins were conjugated to fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo., USA). RAW 264.7 cells were treated with 10 μM FITC-labeled recombinant proteins for 1 hour at 37° C., washed three times with cold PBS, treated with 0.25% tripsin/EDTA (Sigma-Aldrich, St. Louis, Mo.) for 20 minutes at 37° C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins were analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software (
Example 5. Determination of Cell-Permeability and Intracellular Localization of Recombinant Proteins
(193) For a visual reference of cell-permeability, NIH3T3 cells were cultured for 24 hours on coverslip in 24-wells chamber slides, treated with 10 μM FITC-conjugated recombinant proteins for 1 hour at 37° C., and washed three times with cold PBS. Treated cells were fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 10 minutes at room temperature, washed three times with PBS, and mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif., USA), and counter stained with DAPI (4′,6-diamidino-2-phenylindole). The intracellular localization of the fluorescent signal was determined by confocal laser scanning microscopy (LSM700, Zeiss, Germany;
Example 6. Expression of Cas9 Recombinant Proteins
(194) 6-1. Construction of Expression Vectors for Recombinant Proteins
(195) Our newly developed technology, aMTD-based MITT, has enabled us to improve the method for developing cell-permeable recombinant proteins. The expression vectors were designed for Cas9 recombinant proteins fused with aMTD/SDs (HNM.sub.563C9, HNM.sub.563C9SB, HNM.sub.563C9SBSB, HNSBC9M.sub.563, HNSBSBC9M.sub.563) and control proteins without aMTD (HC9). To acquire expression vectors for Cas9 recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify these recombinant proteins.
(196) The PCR reactions (100 ng of genomic DNA, 10 pmol of each primer, each 0.2 mM dNTP mixture, 1× reaction buffer and 2.5 U of Pfu(+) DNA polymerase (Doctor Protein, Korea)) was digested on the different restriction enzyme site involving 40 cycles of denaturation (95° C.) for 45 seconds, annealing (58° C.) for 45 seconds, and extension (72° C.) for 120 seconds. For the last extension cycle, the PCR reactions remained for 10 minutes at 72° C.
(197) Histidine-tagged Cas9 recombinant proteins are constructed by amplifying the Cas9 cDNA (1368 amino acids) from nt (nucleotide) 1 to 4104, using the primers (Table 39), for aMTD/SD-fused to Cas9 cargo. NLS/aMTD-Cas9 and SDB are prepared by amplifying its templates using the primers. The PCR products of NLS/aMTD-Cas9 and SDB are cleaved with NdeI/BamHI and BamHI/SalI, respectively. The amplified and cohesive-ended SDB are ligated to the BamHI site of the C-terminus of Cas9, then finally ligated into 6×His expression vector, pET-28a(+) (Novagen, Madison, Wis., USA). In addition, Cas9 and NLS/aMTD-Cas9 are amplified its template using the primers (Tables 38 and 39). The PCR products of Cas9 and NLS/aMTD-Cas9 are cleaved with NdeI/BamHI. The amplified and cohesive-ended Cas9 and NLS/aMTD-Cas9 were ligated to the NdeI/BamHI site of the pET-28a(+) vector. DNA ligation was performed using T4 DNA ligase (NEB, USA) at 4° C. overnight. These plasmids were mixed with competent cells of E. coli BL21(DE3) CodonPlus-RIL strain (ATCC, USA) on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat-shocked in the water bath at 42° C. for 90 seconds. Then, the mixture added with LB broth media (ELPIS, Korea) was recovered in 37° C. shaking incubator for 1 hour. Then, transformant was plated on LB broth agar plate with kanamycin (25 ug/mL) (Biopure, Johnson City, Tenn.) before incubating overnight at 37° C. From a single colony, plasmid DNA was extracted; and after the double digestion of NdeI and SalI restriction enzymes, digested DNA was confirmed by using 1.2% agarose gels electrophoresis (
(198) The amino acid and polynucleotide sequences of histidine tag are indicated in SEQ ID NOs: 1217 and 1218; and amino acid and polynucleotide sequences of aMTDs are indicated in SEQ ID NOs: 131 and 371, respectively. The amino acid and polynucleotide sequences of NLS are indicated in SEQ ID NOs: 1219 and 1220, The amino acid and polynucleotide sequences of Cas9 are indicated in SEQ ID NOs: 1221 and 1222 respectively.
(199) As shown in
(200) PCR primers for the His-tagged Cas9 recombinant proteins fused to aMTD and SD were summarized in Tables 38 and 39 (SEQ ID NOs: 1223 to 1229).
(201) TABLE-US-00038 TABLE 38 SEQ Cargo SD Recombinant 5′ Primer (5′ > 3′) ID NO Cas9 — HC9 CCCAAGCTTATCAACGGTATTCGTGACAAACAAAGC 1223 — HNM.sub.563C9 GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGC 1224 — HNM.sub.563C9SB TGGCGGTGATTGTGGTGCCGGCGCTGGCGCCGATGGAC AAAAAGTATAGCATTGGCCTG SDB HNM.sub.563C9SB CCCGGATCCATGGCAGAACAAAGCGACAAGGATGTGAAG 1225
(202) TABLE-US-00039 TABLE 39 SEQ Cargo SD Recombinant 3′ primer (5′ >3′) ID NO Cas9 — HC9 CCCAAGCTTACGGCTCAGACGGCCCCAACCGGTGTA 1226 — HNM.sub.563C9 CGCGGATTCATCGCCGCCCAGTTGGCTCAGGTCAAT 1227 — HNM.sub.563C9SB CGCGGATTCTTAATCGCCGCCCAGTTGGCTCAGGTCAAT 1228 SDB HNM.sub.563C9SB CGCGTCGACTTAAAGGGTTTCCGAAGGCTTGGCTATCTT 1229
(203) 6-2. Expression and Purification of Histidine-Tagged Cas9 Recombinant Proteins
(204) The transformant was cultured in TB medium containing 25 ug/ml of kanamycin, and the transformant was inoculated in 7 ml of TB medium at 37° C. overnight. The incubated transformant was inoculated in 700 ml of TB medium at 37° C. until OD.sub.600 reached 0.4. The medium was added with 0.3 mM isopropyl-β-D-thiogalactoside (IPTG) as a protein expression inducer, and further incubated at 18° C. for 16 hours. The medium was centrifuged at 4° C. and 8,000×g for 5 minutes, and a supernatant was discarded to recover a cell pellet. The pellet was loaded on SDS-PAGE to analyze expression levels. The pellet was suspended in a lysis buffer (20 mM Tris-HCl, pH 7.4, 300 mM KCl, 10% glycerol, 1% sucrose), and then this suspension was disrupted with sonication to the cells. The disrupted cells were centrifuged at 4° C. and 15,000×g for 30 minutes to obtain a soluble fraction and an insoluble fraction. After, the soluble fraction was used for protein purification. Recombinant proteins are supposed to be purified by Ni.sup.2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany) in the natural condition. After purification, they will be changed to a physiological buffer, 20 mM Tris, pH 7.4, 300 mM KCl, 20% glycerol, 1% sucrose.
(205) 6-3. Determination of Solubility/Yield of Cas9 Recombinant Proteins
(206) The aMTD-fused Cas9 recombinant proteins containing SDB are cloned, expressed, purified, and prepared in a soluble form under the native condition. Each recombinant protein; HNM.sub.563C9SB and HNM.sub.563C9SBSB were determined for their size (number of amino acids), yield (mg/L) and solubility on 8% SDS-PAGE gel and stained with Coomassie Brilliant Blue.
(207) Solubility will be scored on a 5-point scale ranging from highly soluble proteins with little tendency to precipitate (+++++) to largely insoluble proteins (+) by measuring their turbidity (A450). Yield (mg/L) in physiological buffer condition of each recombinant protein will also be determined.
(208) As shown in
(209) Then, HNM.sub.563C9SB was used as a structure of CP-Cas9 recombinant protein in the next examples.
(210) 6-4. Determinaclation of Optimal aMTD for CP-Cas9 Recombinant Proteins
(211) To improve solubility/yield, cell/tissue-permeability and biological activity of the CP-Cas 9 recombinant protein, CP-Cas9 recombinant proteins fused with different aMTDs were prepared (
(212) TABLE-US-00040 TABLE 41 Bending Potential aMTD Amino Acid Proline Position Felxibility Feature Hydropathy ID Sequence Length 5′ 6′ 7′ 8′ 12′ Number (II) (AI) (GRAVITY) 161 ALAVIVVPALAP 12 0 0 0 1 1 12 57.3 195.8 2.2 (SEQ ID NO: 39) 165 ALAVPVALAIVP 12 1 0 0 0 1 12 50.2 203.3 2.4 (SEQ ID NO: 43) 264 LAAAPVVIVIAP 12 1 0 0 0 1 12 50.2 203.3 2.4 (SEQ ID NO: 63) 442 ALAALVPAVLVP 12 0 0 1 0 1 12 57.3 203.3 2.3 (SEQ ID NO: 101) 522 ALLVIAVPAVAP 12 0 0 0 1 1 12 57.3 203.3 2.4 (SEQ ID NO: 121) 563 ALAVIVVPALAP 12 0 0 0 1 1 12 50.2 203.3 2.4 (SEQ ID NO: 131) 661 AAILAPIVAALP 12 0 1 0 0 1 12 50.2 195.8 2.2 (SEQ ID NO: 147) 889 ILVAAAPIAALP 12 0 0 1 0 1 12 57.3 195.8 2.2 (SEQ ID NO: 223) 899 AVVIALPAVVAP 12 0 0 1 0 1 12 57.3 195.0 2.4 (SEQ ID NO: 229)
(213) TABLE-US-00041 TABLE 41 aMTD ID Amino Acid Sequence cDNA Sequence 161 ALAVIVVPALAP GCGCTGGCGGTGATTGTGGTGCCGGCGCTGGCGCCG (SEQ ID NO: 39) (SEQ ID NO: 279) 165 ALAVPVALAIVP GCGCTGGCGGTGCCGGTGGCGCTGGCGATTGTGCCG (SEQ ID NO: 43) (SEQ ID NO: 283) 264 LAAAPVVIVIAP CTGGCGGCGGCGCCGGTGGTGATTGTGATTGCGCCG (SEQ ID NO: 63) (SEQ ID NO: 303) 442 ALAALVPAVLVP GCGCTGGCGGCGCTGGTTCCGGCGGTTCTGGTTCCG (SEQ ID NO: 101) (SEQ ID NO: 341) 522 ALLVIAVPAVAP GCGCTGCTGGTGATTGCGGTTCCGGCGGTGGCGCCG (SEQ ID NO: 121) (SEQ ID NO: 361) 563 ALAVIVVPALAP CGGCGCCAGCGCCGGCACCACAATCACCGCCAGCGC (SEQ ID NO: 131) (SEQ ID NO: 371) 661 AAILAPIVAALP GCGGCGATTCTGGCGCCGATTGTGGCGGCGCTGCCG (SEQ ID NO: 147) (SEQ ID NO: 387) 889 ILVAAAPIAALP ATTCTGGTGGCGGCGGCGCCGATTGCGGCGCTGCCG (SEQ ID NO: 223) (SEQ ID NO: 463) 899 AVVIALPAVVAP GCGGTGGTGATTGCGCTGCCGGCGGTGGTGGCGCCG (SEQ ID NO: 229) (SEQ ID NO: 469)
(214) TABLE-US-00042 TABLE 42 SEQ Recombinant ID Cargo Protein 5′ Primer (5′->3′) NO Cas9 HNM.sub.161C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGCTGGCGGTGATT 1234 GTGGTGCCGGCGCTGGCGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.165C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGCTGGCGGTGCCG 1235 GTGGCGCTGGCGATTGTGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.264C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGCTGGCGGCGGCGCCG 1236 GTGGTGATTGTGATTGCGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.442C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGCTGGCGGCGCTG 1237 GTTCCGGCGGTTCTGGTTCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.552C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGCTGCTGGTGATTG 1238 CGGTTCCGGCGGTGGCGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.563C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGCTGGCGGTGATT 1239 GTGGTGCCGGCGCTGGCGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.661C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGGCGATTCTGGCG 1240 CCGATTGTGGCGGCGCTGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.889C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGATTCTGGTGGCGGCG 1241 GCGCCGATTGCGGCGCTGCCGATGGACAAAAAGTATAGCATTGGCCTG HNM.sub.899C9SB GGAATTCCATATGCCCAAGAAGAAGAGGAAGGTGGCGGTGGTGATTGCG 1242 CTGCCGGCGGTGGTGGCGCCGATGGACAAAAAGTATAGCATTGGCCTG
(215) TABLE-US-00043 TABLE 43 SEQ ID 3′ Primer (5′->3′ NO Cas9 CGCGGATTCTTAATCGCCGCCCAGTTGGCTCAG 1243 Recombinant GTCAAT Protein
(216) All of the CP-Cas9 recombinant proteins fused with various aMTDs have excellent yield and solubility.
Example 7. Determination of Cell Permeability of CP-Cas9 Recombinant Proteins
(217) To examine cell permeability of CP-Cas9 recombinant protein, CP-Cas9 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (KCLB, Seoul, South Korea) or HeLa cells (KCLB, Seoul, South Korea) were treated with 5 μM FITC-labeled CP-Cas9 recombinant proteins and cultivated at 37° C.
(218) First, RAW 264.7 cells were cultured in a DMEM medium containing 10% fetal bovine serum (FBS, Hyclone, USA) and 1% penicillin/streptomycin (Hyclone, USA). After cultivation, the cells were washed three times with ice-cold PBS (Phosphate-buffered saline, Hyclone, USA) and treated with proteinase K (10 μg/mL, SIGMA, USA) to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FlowJo cytometric analysis software, Guava, Millipore, Darmstadt, Germany). As a control, untreated cells (vehicle) and equimolar concentration of unconjugated FITC-treated cells (FITC) were used.
(219) Next, HeLa cells was incubated for 3 hour at 37° C. with 5 μM FITC-labeled CP-Cas9 recombinant protein. For nuclear staining, a mixture of VECTASHIELD™ Mounting Medium (Vector laboratories, Burlingame, Calif.) and DAPI (4′,6-diamidino-2-phenylindole) was added to HeLa cells, and visualized using a confocal laser microscope (LSM700, Zeiss, Germany).
(220) As shown in
Example 8. Determination of Biological Activity of CP-Cas9 Recombinant Proteins
(221) To investigate the biological activity of CP-Cas9 recombinant protein, in vitro plasmid cleavage assay was performed and nuclease activity was measured.
(222) 8-1. Nuclease Activity
(223) The mixture was mixed with 250 ng of CP-Cas9 recombinant protein and 50 ng of gRNA (5′-AGGCAAAATGCCGCAAAAAA-3′ (SEQ ID NO:1244)), and incubated with 300 ng of pUC19 plasmid for 1 hour at 37° C. in 10 μl of reaction buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl.sub.2 and 100 μg/ml of BSA pH 7.9).
(224) gRNA was synthesized using a GENEART™ Precision gRNA Synthesis kit (Thermo Fisher Scientific, CA, USA) and recognized part or all of the ampicillin sequence of the plasmid as a target sequence. The target sequence has a nucleotide sequence selected from the group consisting of 5′-TGCCGCAAAAAAGGGAATAA-3′ (SEQ ID NO: 1245), 5′-ATGCCGCAAAAAAGGGAATA-3′ (SEQ ID NO: 1246), 5′-AGGCAAAATGCCGCAAAAAA-3′ (SEQ ID NO: 1244). Preferably, the target sequence has 5′-AGGCAAAATGCCGCAAAAAA-3′ (SEQ ID NO: 1244).
(225) When the CP-Cas9 recombinant protein and gRNA are treated in pUC19 plasmid, the plasmid is cleaved by the CP-Cas9 recombinant protein and linearized plasmid is detected. The pUC19 plasmid (Circular) and its linear cleavage product (linear) were separated by 1% agarose gel electrophoresis.
(226) As shown in
(227) 8-2. Nuclease Activity in a Dose Dependent Manner of gRNA
(228) To investigate the gRNA dose dependent nuclease activity of CP-Cas9 recombinant protein, the nuclease activity were measured in the same manner as in Example 8-1.
(229) The mixture was mixed with 200 ng of CP-Cas9 recombinant proteins and 6, 12.5, 25, 50 or 100 ng of gRNA, and incubated with 300 ng of pUC19 plasmid for 1 hour at 37° C. in 10 μl of reaction buffer.
(230) As a positive control, the pUC19 plasmid was treated with 3.1 buffer.
(231) As shown in
(232) 8-3. Nuclease Activity in a Dose Dependent Manner of CP-Cas9 Recombinant Protein
(233) To investigate the dose dependent nuclease activity of CP-Cas9 recombinant protein, the nuclease activity were measured in the same manner as in Example 8-1.
(234) The mixture was mixed with 12.5, 25, 50, 100 or 200 ng of CP-Cas9 recombinant proteins and 50 ng of gRNA, and incubated with 300 ng of pUC19 plasmid for 1 hour at 37° C. in 10 μl of reaction buffer.
(235) As a positive control, the pUC19 plasmid was treated with restriction enzyme, NdeI.
(236) As shown in
(237) 8-4. Nuclease Activity: Targeted Digestion
(238) For the in vitro plasmid cleavage assay, SureGuide Cas9 Nuclease kit (Agilent, Calif., USA) was used. As a control, commercial Cas9 protein (Toolgen, Korea) was used.
(239) 250 ng of Cas9 proteins (Toolgen, Korea) or CP-Cas9 recombinant proteins were incubated with 100 ng of target DNA (Control DNA) and 50 ng of gRNA for 30 min at 30° C. in 20 μl of reaction buffer. The mixture was incubated at 65° C. for 15 minutes for inactivation. DNA cleavage products were separated by 1% agarose gel electrophoresis. When the target DNA was cleaved by Cas9, fragments of the target DNA were detected such as positive control.
(240) As shown in
Example 9. Determination of Biological Activity of CP-Cas9 Recombinant Proteins in the in Reporter Cells
(241) To investigate the biological activity of CP-Cas9 recombinant proteins at a cell level, HeLa cells transfected with the RFP plasmid were used as color reporter cells (
(242) As a control, commercial Cas9 protein (Toolgen, Korea) was used.
(243) gRNA was synthesized using a GENEART™ Precision gRNA Synthesis kit (Thermo Fisher Scientific, CA, USA). The gRNA was recognized part or all of the mRFP sequence of the plasmid as a target sequence. The target sequence has a nucleotide sequence selected from the group consisting of 5′-CTCCTCCGAGGACGTCATCA-3′ (SEQ ID NO: 1247), 5′-CAAGGAGTTCATGCGCTTCA-3′ (SEQ ID NO: 1248), 5′-CGCTTCAAGGTGCGCATGGA-3′. (SEQ ID NO: 1249) Preferably, the target sequence has 5′-CGCTTCAAGGTGCGCATGGA-3′ (SEQ ID NO: 1249).
(244) The color reporter cells were treated with Cas9 protein or CP-Cas9 recombinant protein and gRNA according to 3 protocols, the protocols are as follows.
(245) 9-1. Determination of Biological Activity of CP-Cas9 Recombinant Proteins in the in Reporter Cells: Protocol 1
(246) HeLa cells transfected with the RFP plasmid were seeded in a 24-well plate (1×10.sup.5/well). After a day, 120 ng of gRNA (5′-CGCTTCAAGGTGCGCATGGA-3′(SEQ ID NO:1249)) and 500 ng of CP-Cas9 recombinant protein were mixed within OPTI-MEM™ (Thermo Fisher), and the mixture incubated at 37° C. for 15 minutes. The mixture were mixed with LIPOFECTAMIN™ 3000 (Thermo Fisher Scientific, CA, USA) and incubated at RT for 15 minutes. Then, the cells were treated with the mixture for 48 hours. The cells were observed red fluorescence protein (RFP) by fluorescence microscopy.
(247) As shown in
(248) 9-2. Determination of Biological Activity of CP-Cas9 Recombinant Proteins in the in Reporter Cells: Protocol 2
(249) HeLa cells transfected with the RFP plasmid were seeded in a 6-well plate (0.7×10.sup.5/well). After a day, 1 ug of gRNA (5′-CGCTTCAAGGTGCGCATGGA-3′(SEQ ID NO: 1249)) and 5 ul of LIPOFECTAMIN™ 3000 were mixed in OPTI-MEM™ (Thermo Fisher), and the mixture incubated at RT for 15 minutes. The mixture were mixed within Serum free DMEM. Then, the cells were treated with the mixture. After 4 hours, the cells were washed twice with PBS, changed to DMEM with 10% FBS and incubated at 37° C.
(250) Next day, CP-Cas9 recombinant proteins were mixed within serum free DMEM, and the cells were treated with the CP-Cas9 recombinant proteins. After 8 hours, the cells were washed twice with PBS, changed to DMEM with 10% FBS and incubated at 37° C. for 24 hours. The cells were observed red fluorescence protein (RFP) by fluorescence microscopy.
(251) As shown in
(252) 9-3. Determination of Biological Activity of CP-Cas9 Recombinant Proteins in the in Reporter Cells: Protocol 3
(253) HeLa cells transfected with the RFP plasmid were seeded in a 24-well plate (1×10.sup.5/well). After a day, 120 ng of gRNA (5′-CGCTTCAAGGTGCGCATGGA-3′ (SEQ ID NO: 1249)) and 500 ng of CP-Cas9 recombinant protein were mixed within OPTI-MEM™ (Thermo Fisher), and the mixture incubated at 37° C. for 15 minutes. The mixture were mixed within serum free DMEM. Then, the cells were treated with the mixture. The cells were observed red fluorescence protein (RFP) by fluorescence microscopy.
(254) As shown in
(255) These results suggest that the CP-Cas9 recombinant protein fused aMTD is enhanced its tissue-permeability and therefore, aMTD is critical for systemic delivery of the protein in vitro.