CRISPR nanocomplex for nonviral genome editing and method for preparing the same

Abstract

The present invention relates to a CRISPR nanocomplex for nonviral genome editing, a method for preparing the same, and the like. The CRISPR nanocomplex for nonviral genome editing of the present invention has a size of several nanometers to several microns, enables intracellular delivery without external physical stimulation, and can be utilized for genome editing through nonviral routes with respect to target genes of cells. As a result, when used for preparation of animal model, microbiological engineering, cell engineering for disease treatment, or formulations for biological administration, the CRISPR Nanocomplex shows high intracellular delivery and gene editing efficiency, and can minimize problems, such as nonspecific editing, gene mutation, and induction of cytotoxicity and biotoxicity.

Claims

1. A polymer carrier material-conjugated clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9), wherein the polymer carrier material is a branched polyethyleneimine (PEI), and wherein the branched PEI is conjugated to the Cas9 by a direct covalent bond.

2. A method for preparing a polymer carrier material-conjugated clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9), the method comprising: (a) reacting a functional group of a polymer carrier material with a bifunctional crosslinker to prepare an activated polymer carrier material; and (b) reacting a functional group of a Cas9 with the activated polymer carrier material to prepare a conjugated Cas9, wherein the polymer carrier material is a branched polyethyleneimine (PEI), and wherein the branched PEI is conjugated to the Cas9 by a direct covalent bond.

3. The method of claim 2, wherein the crosslinker in step (a) is selected from the group consisting of succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC), N-α-maleimidoacet-oxysuccinimide ester (AMAS), N-β-maleimidopropyl-oxysuccinimide ester (BMPS), N-γ-maleimidobutyryl-oxysuccinimide ester (GMBS), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), N-ε-malemidocaproyl-oxysuccinimide ester (EMCS), PEGylated SMCC (SM(PEG)), succinimidyl 3-(2-pyridyldithio)propionate (SPDP), PEGylated SPDP (PEG-SPDP), disuccinimidyl glutarate (DSG), dicyclohexylcarbodiimide (DCC), disuccinimidyl suberate (DSS), bissulfosuccinimidyl suberate (BS3), dithiobis(succinimidyl propionate) (DSP), ethylene glycol bis(succinimidyl succinate) (EGS), dimethyl pimelimidate (DMP), bismaleimidoethane (BMOE), 1,4-bismaleimidobutane (BMB), dithiobismaleimidoethane (DTME), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), N-Hydroxysuccinimide (NHS), propargyl-succinimidyl-ester, dibenzocyclooctyne-maleimide (DBCO-maleimide), dibenzocyclooctyne-PEG4-maleimide (DBCO-PEG-maleimide), dibenzocyclooctyne-S—S—N-hydroxysuccinimidyl ester (DBCO—S—S—NHS ester), dibenzocyclooctyne-N-hydroxysuccinimidyl ester (DBCO-NHS ester), acetylene-PEG-NHS ester, and alkyne-PEG-maleimide.

4. The method of claim 2, wherein the activation reaction of the polymer carrier material in step (a) is conducted in a solvent selected from the group consisting of dimethylsulfoxide (DMSO), dimethylformamide (DMF), ethanol, methanol, water, methylene chloride, and chloroform.

5. The method of claim 2, wherein the activation reaction of the polymer carrier material in step (a) is conducted at 4-60° C. for 0.5-24 h.

6. The method of claim 2, wherein the molar ratio of the polymer carrier material and the Cas9 in step (b) is 10.sup.−1:1 to 10.sup.5:1.

7. The method of claim 2, wherein the conjugation reaction of the functional group of the Cas9 and the activated polymer carrier material in step (b) is conducted at 4-60° C. for 1-48 h.

8. The method of claim 2, wherein the conjugation reaction of the functional group of the Cas9 and the activated polymer carrier material in step (b) is conducted in a water-soluble solvent with pH 4-10.

9. A CRISPR nanocomplex comprising the polymer carrier material-conjugated clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) of claim 1 and single guide RNA (sgRNA).

10. The CRISPR nanocomplex of claim 9, wherein the CRISPR nanocomplex has a particle size of 1-10,000 nm in an aqueous solution dispersion state.

11. The CRISPR nanocomplex of claim 9, wherein the CRISPR nanocomplex has a zeta potential of −100 to +100 mV.

12. A method for preparing the CRISPR nanocomplex of claim 9, the method comprising mixing the polymer carrier material-conjugated clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) and single guide RNA (sgRNA).

13. The method of claim 12, wherein the molar ratio of the polymer carrier material-conjugated Cas9 and the sgRNA is 1:10.sup.−6 to 1:10.sup.6.

14. A genome editing composition comprising a polymer carrier material-conjugated clustered regularly interspersed short palindromic repeats (CRISPR)-associated protein 9 (Cas9), wherein the polymer carrier material is a branched polyethyleneimine (PEI), wherein the branched PEI is conjugated to the Cas9 by a direct covalent bond, and an excipient.

15. The composition of claim 14, wherein the composition delivers the polymer carrier material-conjugated Cas9 into cells to induce genome editing.

16. The composition of claim 15, wherein the cells are eukaryotic cells or prokaryotic cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1a, 1b, 1c, 1d and 1e show the nucleotide sequence of recombinant Cas9 endonuclease (SpCas9) obtained from cloned Streptococcus pyogenes of the present invention. The combined sequence of FIGS. 1a-1e represents SEQ ID NO: 1. The sequence contains 6× His, FLAG, nuclear localization sequence (NLS), SpCas9, and green fluorescent protein (GFPuv) from the N- to C-terminus. The sequence in lower case shows the GFP region.

(2) FIG. 2 shows the SDS-PAGE results of the expressed and purified SpCas9 protein of the present invention. The size of SpCas9 was observed to be about 190 kDa.

(3) FIG. 3 shows the results of the fluorescence of GFP fused SpCas9 protein of the present invention observed under a UV illuminator.

(4) FIGS. 4a, 4b and 4c show single guide RNA (sgRNA) sequences (1 to 3) targeting the mecA gene (SEQ ID NO:12). Portions of sgRNA(1), sgRNA(2), and sgRNA(3) are shown as SEQ ID NOs: 13-15, respectively.

(5) FIGS. 5a and 5b show the nucleotide sequence of the mecA gene template for preparing the sgRNA sequences targeting the mecA gene. The combined sequence of FIGS. 5a and 5b represents SEQ ID NO:2.

(6) FIG. 6 shows primer sequences (SEQ ID NOs:3 and 4) for amplifying the mecA gene template.

(7) FIG. 7 shows the nucleotide sequences of templates (SEQ ID NOs: 5-7) for sgRNA synthesis.

(8) FIG. 8 shows the primer sequences (SEQ ID NOs: 8-11) for sgRNA template synthesis.

(9) FIG. 9 shows electrophoresis results of the synthesized sgRNAs.

(10) FIG. 10 shows the results of electrophoresis to confirm three kinds of sgRNAs synthesized in the present invention.

(11) FIG. 11 is a schematic diagram of a conjugation procedure between SpCas9 and bPEI of the present invention.

(12) FIG. 12 shows the gel retardation assay results to confirm the successful conjugation of bPEI onto SpCas9.

(13) FIG. 13 shows the SDS-PAGE analysis results to confirm the successful conjugation of bPEI onto SpCas9.

(14) FIG. 14 is a schematic diagram showing the preparation of a complex between SpCas9-bPEI and sgRNA of the present invention (Cr-Nanocomplex) and, as a control, a complex between the unmodified SpCas9 protein and sgRNA (native complex).

(15) FIG. 15 shows the comparison of the particle size between the Cr-Nanocomplex of the present invention and the native complex.

(16) FIG. 16 shows the gel electrophoresis results after adding the synthesized target DNA together with the Cr-Nanocomplex to induce cleavage.

(17) FIG. 17 shows the delivery results of the polymer-derivatized SpCas9 of the present invention into bacteria through observation by confocal microscopy.

(18) FIG. 18 shows the delivery efficiency of the polymer-derivatized SpCas9 of the present invention into bacteria, compared with a control group.

(19) FIGS. 19 and 20 and FIGS. 21a, 21b, and 21c show 3D images reconstructed from confocal image sections showing the presence of SpCas9 in bacterial cells from the overlapping of fluorescence signals from spCas9 and nuclear stain in order to examine the bacterial uptake of the polymer-derivatized SpCas9.

(20) FIG. 22 shows the overlapping of fluorescence signals from SpCas9 and nuclear stain in order to examine the bacterial uptake of SpCas9 polymer-derivatized with a polymer carrier having a different molecular weight (Mw 25,000).

(21) FIG. 23 shows the confocal microscopy observation and analysis results of the uptake efficiency of the Cr-Nanocomplex in A549 cells.

(22) FIG. 24 shows the confocal microscopy observation and analysis results of the uptake efficiency of the Cr-Nanocomplex in HaCat cells.

(23) FIG. 25 shows 3D images reconstructed from confocal image sections showing the presence of the complex in animal cells from the overlapping of fluorescence signals from Cr-Nanocomplex and nuclear stain in order to examine the uptake of the Cr-Nanocomplex into HaCat cells.

(24) FIG. 26 shows the confocal microscopy observation and analysis results of the uptake efficiency of the Cr-Nanocomplex in Raw 264.7 cells.

(25) FIG. 27 shows the confocal microscopy observation and analysis results of the uptake efficiency of the Cr-Nanocomplex in Jurkat cells.

(26) FIG. 28 shows the confocal microscopy observation and analysis results of the uptake efficiency of Cr-Nanocomplex in neural stem cells.

(27) FIG. 29 shows the confocal microscopy observation and analysis results of the uptake efficiency of Cr-Nanocomplex in induced pluripotent stem cells (iPSCs).

(28) FIG. 30 is a schematic diagram illustrating the experimental procedure for evaluating the genome editing efficiency of the Cr-Nanocomplex of the present invention.

(29) FIG. 31 shows growth rates from the measurement of OD.sub.600 values after suspension culture of the bacteria treated with the Cr-Nanocomplex of the present invention.

(30) FIGS. 32a and 32b show the results obtained by counting the number of CFUs in the presence or absence of oxacillin after bacteria were treated with the Cr-Nanocomplex or controls, in order to further assess the patterns of genome editing.

(31) FIG. 33 shows the relative growth (%) of the bacteria treated with the Cr-Nanocomplex of the present invention.

(32) FIG. 34 shows the genome editing efficiency of the Cr-Nanocomplex with different concentrations of the present invention.

(33) FIG. 35 shows the replica culture experiment results of the bacteria treated with the Cr-Nanocomplex of the present invention.

MODE FOR CARRYING OUT THE INVENTION

(34) Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

EXAMPLES

Example 1: Preparation of Carrier Material-Conjugated CRISPR Enzyme Protein

(35) 1-1. Expression and Purification of SpCas9 Protein

(36) The Cr-Nanocomplex (CRISPR nanocomplex) system for the efficient delivery of genome editing cargo into bacteria was developed using a complex of a polymer-derivatized Cas9 protein and sgRNA.

(37) First, for the expression of the SpCas9 protein, the SpCas9 gene obtained from lentiCRISPR (Addgene) was cloned into pET21a (Novagen). The primers 5′-GGGCATATGGGCAGCAGCCATCACCATCATCACCACGATTACAAAGACGATGACGATAAG ATGGCC-3′ (SEQ ID NO: 12) and 5′-CCCAAGCTTTTTCTTTTTTGCCTGGCCG GCCTTT-3′ (SEQ ID NO: 13) were used for SpCas9, and 5′-CCCAAGCTTATGAGTAAA GGAGAAGAAC-3′ (SEQ ID NO: 14) and 5′-CCCAAGCTTTTATTTGTAGAGCTCATCCA-3′ (SEQ ID NO: 15) were used for the green fluorescent protein (GFPuv).

(38) The SpCas9 contains 6× His, FLAG, nuclear localization sequence (NLS), SpCas9, and green fluorescent protein (GFPuv) from the N- to C-terminus. The cloned sequence was confirmed by DNA sequencing. After transforming the expression vector into BL21-(DE3) E. coli competent cells, the cells were inoculated in Luria-Bertani (LB) broth (containing 100 μg/ml ampicillin), grown at 30° C. overnight (OD.sub.600=0.4), and added with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) to induce SpCas9 expression. Cells were harvested after culture for 16 h followed by centrifugation at 5,000 rpm for 10 min, and treated with lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, 0.05% β-mercaptoethanol, pH 8.0) and with a procedure (41% duty, pulse of 2 s and rest of 5 s for a total of 30 min on ice).

(39) The cell lysate was then incubated with Ni-NTA agarose beads (Qiagen) to bind the His-tagged SpCas9, washed, and eluted with buffer containing 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 200 mM imidazole, 0.05% β-mercaptoethanol (pH 8.0).

(40) The eluent was then dialyzed against storage buffer (50 mM Tris HCl, pH 8.0, 200 mM KCl, 0.1 mM EDTA, 20% glycerol, 1 mM DTT, and 0.5 mM PMSF) for a total of 12 h with buffer change every 2 h, and stored at −70° C. Recombinant Cas9 endonuclease from Streptococcus pyogenes (SpCas9) was obtained by transformation of expression plasmid into E. coli competent cells, followed by purification through affinity chromatography. The sequence of cloned SpCas9 is shown in FIG. 1.

(41) The purified SpCas9 was analyzed by SDS-PAGE electrophoresis. The SDS-PAGE results of the purified SpCas9 protein of the present invention is shown in FIG. 2. The size of SpCas9 was observed to be about 190 kDa.

(42) The GFP fluorescence of the SpCas9 was also confirmed by observation under a UV illuminator (FIG. 3).

(43) 1-2. Design and Synthesis of Single Guide RNAs (sgRNAs)

(44) Design of sgRNAs

(45) Single guide RNAs (sgRNAs) targeting the mecA gene in MRSA was designed to induce double-strand breakage in the bacterial genome by SpCas9. Three different sgRNA sequences were determined according to various target sites within the mecA gene as protospacers (FIG. 4). The protospacer regions were all adjacent to a protospacer-adjacent motif (PAM) sequence (NGG), from which target cleavage would occur at the site three bases upstream.

(46) sgRNAs included a CrRNA for targeting mecA (CRISPR RNA), and a trans-activating RNA sequence (TracrRNA). A linker (GG) was also included in the 5′ end. Templates for the sgRNAs were prepared by repeating 30 cycles of annealing at 60° C. for 40 s and extension at 72° C. for 30 s using the HelixAmp Power-Pfu (NanoHelix) and oligonucleotide primers (Bioneer), followed by gel extraction (QIAquick, Qiagen). In vitro transcription was performed using the phage T7 RNA polymerase (Promega) at 37° C. for 120 m. Sequences of the amplicons and primers are shown in FIG. 4. The transcribed sgRNAs were purified by precipitation using 5 M ammonium acetate, followed by ethanol precipitation.

(47) For preparation of sgRNAs, DNA templates for respective sgRNA were first synthesized using the primers shown in FIG. 8 for in vitro transcription. The DNA template for each sgRNA included a T7 promoter region, a template region for CrRNA, and a template region for TracrRNA (FIG. 7). The synthesized DNA templates are shown in FIG. 9.

(48) In vitro transcription was then performed using the synthesized DNA templates and T7 polymerase to produce the respective sgRNAs. FIG. 10 shows that three different types of sgRNAs—sgRNA(1), sgRNA(2), and sgRNA(3), all targeting different regions of mecA, were successfully synthesized. All three synthesized sgRNAs were shown to have sizes of ˜100 nucleotides.

(49) Selection of sgRNA

(50) The functionality of the sgRNAs prepared above to guide double-strand cleavage was also examined. As the target DNA, a pure, cell free DNA solution was prepared by RT-PCR of the 1803 bp region within the mecA gene (FIG. 5) from the total RNA of cultured MRSA. sgRNA(1), sgRNA(2) and sgRNA(3) each were mixed with the purified native SpCas9 protein, and added with the PCR-amplified mecA target DNA, to induce endonuclease cleavage.

(51) The sgRNA(3) exhibited the highest cleavage efficiency, with both fragments (648 bp and 1155 bp) appearing in the gel electrophoresis results. The sgRNA(2) showed a clear fragment right below the uncleaved DNA which corresponds to the 1463 bp fragment, but the other cleaved product was difficult to observe. For the sgRNA(1), neither of the cleaved products were visible, showing that either the efficiency was too low for detection, or the sgRNA was non-functional in inducing specific double-strand breakage. Thus, the sgRNA(3) was used for the formation of nanocomplexes of the present invention and further examination for bacterial delivery.

(52) 1-3. Bacterial Strains and Culture

(53) MRSA strains CCARM 3798, 3803, 3877 were obtained from the Culture Collection of Antimicrobial Resistant Microbes (CCARM) and were used as target bacteria with drug resistance. MSSA strain KCTC 3881 was obtained from the Korean Collection for Type Cultures (KCTC), and used as the non-resistant strain. For culture, each bacterial strain was inoculated into tryptic soy broth (TSB, BD Biosciences) and cultured in suspension at 37° C. in a shaking incubator for 12-16 h. Bacterial growth and concentrations were determined by measuring the OD at 600 nm (0.4-0.6).

Example 2: Preparation of Polymer-Derivatized SpCas9

(54) 2-1. Preparation of SpCas9-bPEI

(55) For the conjugation of polyethyleneimine as an anionic carrier material to genome editing protein Cas9 endonuclease, the following experiment was conducted.

(56) Branched polyethyleneimine (bPEI, Mw 2,000 and 25,000) were activated by adding 16 mg of bPEI to 5 mg of sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC, Thermo Scientific) in ultra-pure water, followed by reaction at 25° C. for 3 h (molar ratio of bPEI:sulfo-SMCC=1:10). The reaction solutions were then dialyzed against deionized water (MWCO 500-1,000, Spectra/Por) for 48 h, and the polyethyleneimine polymer having an amine group substituted with maleimide was freeze-dried (FD8508, IlshinBioBase).

(57) In addition, for the production of Cas9 endonuclease using the genome editing protein as described above, the vector of Cas9 protein (SpCas9) derived from Streptococcus pyogens was expressed in E. coli, followed by purification using histidine.

(58) For the conjugation of polyethyleneimine to the genome editing protein (SpCas9), 2 mg of the purified SpCas9 protein was dissolved in 1.2 ml of phosphate buffer saline (PBS); the polyethyleneimine polymer activated by maleimide was reacted therein at a molar ration of 1:100 at pH 6.9 for 4 h at 4° C.; and then the final product (SpCas9-bPEI) was dialyzed against storage buffer (50 mM Tris HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 20% glycerol, 1 mM DTT, and 0.5 mM PMSF) for 24 h, and rapidly frozen in liquid nitrogen, and then stored at 80° C.

(59) A schematic diagram for the synthetic procedure of the SpCas9-bPEI is shown in FIG. 11.

(60) The conjugation of bPEI onto Cas9 was confirmed by gel retardation using 0.5% agarose gel and 5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(61) FIG. 12 shows the gel retardation assay results to confirm the successful conjugation of bPEI onto SpCas9. As shown in FIG. 12, SpCas9 conjugated with bPEI (SpCas9-bPEI) appeared to migrate slightly to the (−) direction, which was opposite to native SpCas9 that showed substantial migration to the (−) direction. The gel retardation assay results for SpCas9-bPEI may be due to the change in mobility and the clustering of protein molecules, due to modification with the polymer. Although a maximum of two bPEI molecules can be conjugated onto each protein molecule by increasing the molecular weight of the protein by only 4,000 Da, such a slight change (1-2%) may substantially affect the mobility of the protein during electrophoresis due to structural or dimensional changes. The theoretical charge of the GFP-fused SpCas9 protein was expected to be highly negative. Since bPEI is highly cationic due to an extremely high density of amine functional groups, the conjugation of bPEI onto SpCas9 may either affect the molecular charge of the protein or induce their clustering by electrostatic protein-polymer interactions.

(62) In addition, the SDS-PAGE results to confirm the successful conjugation of bPEI onto SpCas9 are shown in FIG. 13. As shown in FIG. 13, SpCas9-bPEI and native SpCas9 appeared at similar regions, showing that covalently crosslinked SpCas9 proteins were not present after the conjugation reaction (FIG. 13). Therefore, it was confirmed that the conjugation of SpCas9 and bPEI was successfully achieved, and no crosslinkage occurred between SpCas9 protein molecules.

Example 3: Preparation and Characterization of CRISPR Genome Editing Nanocomplex (Cr-Nanocomplex)

(63) 3-1. Preparation of Cr-Nanocomplex

(64) For the preparation of Cr-Nanocomplex of the present invention, SpCas9-bPEI (990 nM) and sgRNA(3) (1.8 μM) were mixed in deionized water (pH 6.5), and incubated at 25° C. for 15 min in static condition. As the control, native SpCas9 (990 nM) was mixed with sgRNA(3) (1.8 μM) in the same condition as above. As a result, a nano-sized complex in which Spcas9-bPEI and sgRNA (3) are self-assembled was manufactured (FIG. 14). As the sgRNA, a sequence targeting antibiotic-resistant gene mecA of methicillin-resistant Staphylococcus aureus (MRSA) was used. The pH during the complexation was ˜6.4, which was lower than the pKa (˜8.6) of bPEI (2 kDa), and would protonate their amine functional groups to induce electrostatic binding with the anionic sgRNA.

(65) Size Measurement and Zeta Potential Measurement of Complex

(66) For dynamic light scattering (DLS) and zeta potential measurement, the complexed solutions were diluted in PBS or deionized water to a final concentration of 168 nM SpCas9 and 300 nM sgRNA(3), respectively. The hydrodynamic sizes and zeta potentials of the Cr-Nanocomplexes or native complexes were measured with ELSZ-2000ZS (Otsuka).

(67) The dynamic light scattering measurement results showed that the particle size (Z average) was 163.3 nm for the Cr-Nanocomplex, which was greater than 82.6 nm, the size of the native complex of the unmodified Cas9 protein and sgRNA (FIG. 15). These results confirmed that small, nano-sized protein-polymer conjugate/RNA complexes were successfully formed by the charge interaction between the negatively charged sgRNA and positively charged polymer within SpCas9-bPEI. Each complex would include several molecules of SpCas9-bPEI and sgRNAs, forming larger complex structures, unlike unmodified SpCas9 which would mainly exist as a single protein bound to a single sgRNA molecule.

(68) The zeta potential values of the Cr-Nanocomplex and native complex both showed negative values, due to the presence of sgRNA bound to the surface of the protein, while the zeta potential of the Cr-Nanocomplex was relatively less anionic (−12.1 mV) compared to the native complex (−19.0 mV). In addition, the zeta potential of SpCas9-bPEI before complexation showed a positive value (+4.0 mV), which was a significant change from that of native SpCas9 (−17.2 mV), due to the introduction of the cationic polymer. The less anionic property of the Cr-Nanocomplex was expected to help improve the delivery into bacteria.

(69) 3-2. Cleavage Assay for Endonuclease Activity

(70) To investigate whether the Cas9 endonuclease after polymer derivatization and Cr-Nanocomplex formation retained the functional activity in inducing double-strand DNA cleavage, an in vitro cleavage assay was performed using PCR-amplified template DNA derived from cultured bacteria.

(71) First, MRSA and MSSA strains were cultured, and the total RNAs were extracted using the Trizol reagent (Invitrogen), and then reverse-transcribed using the amfiRivert cDNA Synthesis Platinum Master Mix (GenDEPOT) at 60° C. for 1 min (denaturation), 25° C. for 5 min (annealing), 55° C. for 60 min (extension), and 85° C. for 1 min (inactivation). cDNAs were then amplified with power pfu polymerase (Nanohelix) and specific primers for the mecA gene (Bioneer), using the following conditions: initiation at 95° C. for 2 min; 35 cycles of 95° C. for 20 s (denaturation), 59° C. for 40 s (annealing), 72° C. for 3 min 38 s (extension); and termination at 72° C. for 5 min.

(72) The amplified template DNAs were then treated with SpCas9-bPEI or native SpCas9 complexed with sgRNA(3) at a 10:10:1 molar ratio of SpCas9:sgRNA:target DNA, followed by incubation in Cas9 nuclease reaction buffer (20 mM HEPES, 100 mM NaCl, 5 mM MgCl.sub.2, 0.1 mM EDTA, pH 6.5) at 37° C. for 1 h. The final products were observed by agarose gel electrophoresis to confirm the presence and sizes of the DNA fragments.

(73) The results are shown FIG. 16.

(74) As shown in FIG. 16, it was confirmed that one larger DNA fragment and one smaller DNA fragment appeared, which correspond to the expected sizes of 1155 bp and 648 bp, showing that SpCas9, even after direct covalent modification with bPEI and complexation with sgRNA, is able to induce double-strand cleavage of the target DNA.

(75) 3-3. Bacterial Delivery of Polymer-Derivatized SpCas9 and Confocal Microscopy

(76) The polymer derivatization of Cas9 protein of the present invention was expected to increase the bacterial uptake compared with native Cas9. To demonstrate the delivery efficiency of polymer-derivatized SpCas9 into bacteria, SpCas9-bPEI was treated with in vitro cultured MRSA, followed by observation through confocal microscopy. MRSA strains 3798 and 3803 were cultured prior to treatment as mentioned above.

(77) SpCas9-bPEI (200 nM) or native SpCas9 (200 nM) in PBS were treated to 1×10.sup.7 of cultured MRSA. As the control, native SpCas9 simply mixed with bPEI was also used by first mixing concentrated SpCas9 with bPEI (Mw 2,000), incubating for 15 min at 25° C., and dilution (7×) in PBS for treatment (final concentration of SpCas9—200 nM, bPEI—3 μg/mL).

(78) After incubation at 37° C. for 2 h with gentle agitation using a shaking incubator, bacteria were repeatedly washed with PBS after centrifugation to remove the residual complexes. Bacteria were then fixed in 4% paraformaldehyde solution, mounted onto microscopic slides using Vectashield (Vector Laboratories), and observed using a laser scanning confocal microscope (LSM780, Carl Zeiss). For quantification of relative uptake, bacteria were treated with the mixtures above at 1.7×107/mL for 4 h. As another control, native SpCas9 was also mixed with Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's protocol (final concentration of SpCas9 at 400 nM). Low magnification images were obtained by confocal microscopy and the green fluorescence signals (SpCas9) were normalized to red fluorescence (PI stain) using ImageJ (NIH).

(79) The results are shown in FIGS. 17 and 18.

(80) As shown in FIG. 17, the Cas9 protein conjugated with polyethyleneimine of the present invention (SpCas9-bPEI) is an unmodified Cas9 protein (SpCas9), but SpCas9-bPEI was uptaken into bacteria at significantly high efficiency compared with a mixture of unreacted polyethyleneimine polymer and Cas9 protein (SpCas9+bPEI (mix)). In the case of SpCas9-bPEI of the present invention, bright green fluorescence from GFPuv was clearly observed adjacent to the nuclear stain, while native SpCas9 did not show any significant uptake. The native SpCas9 simply (noncovalently) mixed with bPEI (SpCas9+bPEI (mix)) as the control also did not show any sign of uptake.

(81) In addition, to further investigate the uptake of the polymer-derivatized SpCas9 into bacteria, confocal image sections were reconstructed into 3D images, showing the presence of SpCas9 within the bacterial cells from the overlap of fluorescence signals from the complex and nuclear stain (FIGS. 19 and 20).

(82) Histograms of the fluorescence signals were also obtained from different regions scanned within the confocal image, and as a result, signals from SpCas9 were present only at points where signals from the nuclear stain were also present (FIG. 21).

(83) As shown in FIG. 19, relative uptake values were shown to be 0.4273 for SpCas9-bPEI, and 0.0041, 0.0001, and 0.0083 for native SpCas9, native SpCas9 simply mixed with bPEI, and native SpCas9 mixed with lipofectamine, respectively. The greatly increased uptake of the Cas9 protein upon bPEI conjugation may be due to the highly cationic property of the polymer, or the resultant increase in polarity of the protein.

(84) Since the bPEI polymer is abundant in tertiary, secondary, and primary amine groups at high molecular densities, the interaction of SpCas9-bPEI to the negatively charged cell wall of gram-positive bacteria would substantially increase compared to native SpCas9. In addition, the presence of bPEI on the surface of SpCas9 allows the formation of clusters or condensation of the molecules. Overall, the enhanced binding of SpCas9 to the bacterial cell wall may be presumably by the penetration through the peptidoglycan and subsequently uptake through the cellular membrane, and thus would result in a higher chance of uptake. In addition, the strong cationic property of bPEI would electrostatically interact with the bacterial DNA, which was expected to allow the molecular attraction of SpCas9 towards the genomic target thereof.

(85) Meanwhile, using conventional lipofectamine as the carrier has been shown to have limitations due to the low loading efficiency of the drug and a difficult release thereof into the cell.

(86) The present inventors anticipated that these problems could be solved by covalent binding of the SpCas9 protein with a cationic polymer. So long as such a modification does not affect functional activity, the cationic polymer would be applied to each single molecule of protein while allowing the use of a minimal amount of carrier material. Another advantage is that an encapsulation process into the carrier material, which is required for a release step of the cargo for delivery, can be avoided.

(87) Further evidence could be confirmed in treatment experiments using SpCas9 modified with bPEI Mw 25,000. FIG. 22 shows that when modified with a larger bPEI polymer, the protein did not show any significant uptake when treated to bacteria. Since only modification with the smaller bPEI shows high delivery efficiency, it is evident that using a carrier material with a small molecular weight at an optimal amount is important to maximize delivery efficiency and minimize toxicity.

(88) 3-4. Animal Cell Delivery of Cr-Nanocomplex and Microscopy

(89) The polymer derivatization of Cas9 protein of the present invention was expected to increase the uptake into mammalian cells compared with native Cas9. To validate the delivery efficiency of Cr-Nanocomplex into mammalian cells, the in vitro cultured animal cells were treated with SpCas9-bPEI and sgRNA, and observed by confocal microscopy. A549, HaCat, and Raw264.7 animal cells were cultured in the 8-well chamber at 1×10.sup.4 cells 30 h before treatment. Jurkat animal cells were cultured in a 48-well cell culture plate.

(90) The cultured mammalian cells were treated with SpCas9-bPEI2000/sgRNA (168 nM), SpCas9-bPEI25000/sgRNA (168 nM), or native SpCas9/sgRNA (168 nM) in PBS. As another control, native SpCas9/sgRNA (168 nM) was mixed with Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer's protocol (final concentration of SpCas9/sgRNA at 168 nM each). Each experiment group was incubated using a cell incubator at 37° C., 5% CO.sub.2 for 1-1.6 h, and then repeatedly washed three times with PBS to remove remaining complexes. The cells were then fixed in 4% paraformaldehyde solution, mounted onto microscopic slides using Mounting Medium (Vector Laboratories), and observed using a laser scanning confocal microscope (LSM780, Carl Zeiss). As a result, low magnification images were obtained by confocal microscopy, and green fluorescence signals (SpCas9) and blue fluorescence (DAPI-nuclear stain) could be confirmed.

(91) As shown in FIG. 23, it can be confirmed that the Cas9 protein conjugate with polyethyleneimine (Mw: 2000) (SpCas9-bPEI)/sgRNA complex of the present invention showed successful uptake into A549 animal cells at significantly high efficiency compared with the unmodified Cas9 protein (SpCas9)/sgRNA complex, and also showed significantly high uptake even compared with a mixture with lipofectamine RNAiMAX. As another control, in the case of the treatment with SpCas9-bPEI25000/sgRNA (bPEI, Mw 25,000, 12.5-fold), clear intracellular uptake was not observed. In addition, also in cases where HaCat animal cells were treated, as shown in FIG. 24, it can be confirmed that Cas9 protein conjugate with polyethyleneimine (SpCas9-bPEI)/sgRNA complex of the present invention showed successful uptake into animal cells at significantly high efficiency compared with the unmodified Cas9 protein (SpCas9)/sgRNA complex and, as another control, the mixture with lipofectamine RNAiMAX. To further investigate the intracellular uptake of the Cr-Nanocomplex, confocal image sections were reconstructed into 3D images, showing the presence of the complexes within HaCat animal cells from the overlap of fluorescence signals from the complex (SpCas9/sgRNA: green fluorescence) and nuclear stain (DAPI: blue fluorescence) (FIG. 25). FIG. 25 confirmed that the Cas9 protein conjugated with polyethyleneimine (SpCas9-bPEI)/sgRNA complex of the present invention showed the most overlapping of green fluorescence signal (SpCas9) and blue fluorescence (DAPI-nuclear stain). The same results were also obtained for Raw 264.7 animal cells, and FIG. 26 confirmed that the GFPuv bright green fluorescence from Cas9 protein was clearly observed adjacent to the nuclear stain for the SpCas9-bPEI/sgRNA complex of the present invention, while native SpCas9 showed relatively weak fluorescence. As shown in FIG. 27, when immunocyte Jurkat animal cells were treated, the SpCas9-bPEI/sgRNA complex of the present invention, compared with the unmodified Cas9 protein (SpCas9)/sgRNA complex, showed greatly increased efficiency, and showed slightly increased intracellular uptake compared with a mixture with lipofectamine RNAiMAX. As shown in FIG. 28, it was observed that, also for human body-derived neural stem cells, the SpCas9-bPEI/sgRNA complex of the present invention showed a significantly high Cas9 fluorescence signal compared with the unmodified SpCas9/sgRNA complex, indicating a significantly high cell uptake effect. Also for human-derived induced pluripotent stem cells (iPSCs), the native SpCas9/sgRNA complex showed no cell uptake effect, but the SpCas9-bPEI/sgRNA complex of the present invention showed a significant cell uptake effect (FIG. 29). The delivery efficiency of SpCas9-bPEI/sgRNA or SpCas9/sgRNA complex can be confirmed by GFP signals of the SpCas9 recombinant protein, and for counterstain for all cells, the nucleus was stained with DAPI, and the cytoplasm was stained with rhodamine-phalloidin in FIGS. 28 and 29.

(92) 3-5. Evaluation of Genome Editing Efficiency by the Cr-Nanocomplex

(93) The present inventors investigated whether the Cr-Nanocomplex edits bacterial genome and targets antibiotic resistance. Cultured MRSA (strains 3798 and 3803) were in vitro treated with Cr-Nanocomplex formed of sgRNA targeting mercA and SpCas9-bPEI, and the bacterial growth was examined in subsequent culture in selective media. The cultured MRSA strains were verified to be resistant to both methicillin and oxacillin.

(94) As an experimental group, the Cr-Nanocomplexes of the present invention were prepared by mixing SpCas9-bPEI (990 nM) with sgRNA (3) (1.8 μM) and incubation for 15 min. As the control, native SpCas9 (990 nM) was mixed with sgRNA(3) (1.8 μM) in the same condition as above. A conventional lipid-based formulation as another control was also prepared by adding the native complex (50 μl) with Lipofectamine RNAiMAX (15.8 μL, Thermo Fisher Scientific), according to the manufacturer's protocol. As controls, ones containing protein only (without sgRNA), SpCas9-bPEI only, or native SpCas9 only were also prepared at 990 nM were also prepared.

(95) All samples were diluted 6× in tryptic soy broth (final concentration of SpCas9:sgRNA=165 nM:300 nM), followed by treatment with 5×10.sup.6 of MRSA at 37° C. for 4 h with gentle agitation. The treated bacteria were washed with PBS, diluted (100×) in TSB containing 6 μg/mL oxacillin, and incubated at 37° C. for 90 min in a shaking incubator. Bacterial growth was determined by measuring the OD value at 600 nm (Nanophotometer, Implen) after 90 min of incubation.

(96) The bacteria treated with the nanocomplex were also diluted (105×) in PBS, spread onto MRSA agar plates containing 6 μg/mL oxacillin, and incubated at 30° C. for 21 h, and the colony forming unit (CFU) was counted.

(97) In the case where bacteria treated with the Cr-Nanocomplex were cultured in suspension or on an agar medium containing oxacillin (6 μg/mL), the clones with broken double-stranded DNA could not grow and the unaffected clones would form bacterial colonies. A schematic diagram of the experimental procedure is shown in FIG. 28.

(98) The growth rates were determined from the measurement of OD.sub.600 values, after suspension culture of the bacteria treated with the Cr-Nanocomplex (FIG. 29). As shown in FIG. 29, it is shown that treatment with the Cr-Nanocomplex of the present invention results in significant inhibition of growth, that is, a 32% decrease compared with the treatment with SpCas9-bPEI without sgRNA as the control.

(99) In addition, in order to further assess genome editing patterns, bacteria were treated with the Cr-Nanocomplex or a control, and the number of CFUs was counted in the presence or absence of oxacillin (FIG. 30).

(100) As shown in FIG. 30, the treatment with the Cr-Nanocomplex of the present invention showed a significant decrease in growth under the presence of oxacillin (65×10.sup.6 CFU/ml) compared with the controls (335×10.sup.6 CFU/ml for SpCas9 only; 401×10.sup.6 CFU/ml for SpCas9-bPEI only), while the treatment with native SpCas9/sgRNA complex showed a smaller decrease in growth (121×10.sup.6 CFU/ml). In addition, the treatment with SpCas9-bPEI only, without sgRNA, did not show any significant decrease in bacterial growth, demonstrating that reduced bacterial growth when treated with the Cr-Nanocomplex did not result from toxicity by the presence of bPEI. Surprisingly, the lipofectamine formulation of native SpCas9/sgRNA complex showed no significant decrease in bacterial growth (361×10.sup.6 CFU/ml) compared with the treatment with SpCas9 only as the control. The use of lipofectamine for delivery of SpCas9/sgRNA complex showed substantial delivery efficiency in mammalian cells, but showed poor delivery in the case of bacterial cells. In addition, the fact that the culture of bacteria in the presence of bioactive molecules (e.g., proteins such as Cas9) can influence bacterial growth by acting as a food source or stimulant was considered.

(101) Therefore, the “relative growth” was calculated from (1) number of CFUs when treated with the complex including sgRNA, and normalized with (2) number of CFUs when treated with the complex excluding sgRNA (FIG. 31). As shown in FIG. 31, the treatment with the Cr-Nanocomplex of the present invention showed a relative growth of 16.3% compared with the treatment with SpCas9-bPEI only, while the treatment with SpCas9/sgRNA complex resulted in a relative growth of 35.9% compared with the treatment with SpCas9 only. The treatment with the native SpCas9/sgRNA complex in presence of lipofectamine resulted in a relative growth of 71.6%, compared with SpCas9 with lipofectamine without sgRNA (FIG. 31). These results demonstrate that, compared with the use of native SpCas9 complex regardless of the use of the conventional lipofectamine carrier, the Cr-Nanocomplex of the present invention allows sufficient delivery of the SpCas9 protein and sgRNA into bacteria, thereby enabling the double-strand cleavage of the target DNA at a much higher efficiency.

(102) In addition, the dose-dependent genome editing efficiency was determined by treating the bacteria with the Cr-Nanocomplex of various concentrations (FIGS. 32a and 32b). As shown in FIG. 32, when comparing the Cr-Nanocomplex with the native complex, the treatment at a lower concentration resulted in 18.7% inhibition in the relative growth, while the treatment at a higher concentration resulted in 57.7% inhibition in the relative growth. Although the treatment at a higher concentration resulted in a slightly higher mean value in inhibition compared to the treatment at an intermediate concentration, the values were shown to be statistically significant only for the case of intermediate treatment. The treatment with a lower concentration of Cr-Nanocomplex would not be sufficient to exert significant genome editing efficacy, while the treatment with a higher concentration of Cr-Nanocomplex may interfere with the process of genome editing by affecting bacterial function and uptake, or stimulating bacterial growth.

(103) Another critical finding was that the examination of bacterial growth in the absence of oxacillin showed similar results from the values in the presence of oxacillin, with 67×10.sup.6 CFU/ml for the Cr-Nanocomplex, 135×10.sup.6 CFU/ml for the native complex, and 414××10.sup.6 CFU/ml for SpCas9-bPEI only (FIG. 30).

(104) Replica plating of the bacterial colonies formed from Cr-Nanocomplex-treated bacteria was also performed. Here, primary plates not including oxacillin were replicated on secondary plates including oxacillin, and cultured at 30° C. for 12 h, and then the bacterial colonies were counted. Results showed that all clones which formed colonies in non-selective media also were able to grow in selective media (FIG. 33). These results show that genome editing by the Cr-Nanocomplex resulted in lethality of the bacteria, while the bacteria that tolerated the treatment continued to grow.

(105) Statistical Analysis

(106) All statistical data were calculated and shown as mean±standard deviation. Statistical significance was determined by obtaining the p value using the Student's t test.

SEQUENCE LISTING

(107) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted concurrently herewith as the sequence listing text file entitled “000141-US—NP_amended_sequence_listing.TXT”, file size 12 KiloBytes (KB), created on 28 Feb. 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).