Spinach Plant Resistant to Downy Mildew and Novel Resistance Gene

20230250445 · 2023-08-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a spinach plant that is resistant to downy mildew caused by Peronospora farinosa. The present invention further relates to a resistance gene that confers resistance to downy mildew in spinach plants, and methods for obtaining a spinach plant that is resistant to downy mildew, and use of one or more markers for providing a spinach plant that is resistant to downy mildew.

    Claims

    1. A spinach plant that is resistant to downy mildew caused by Peronospora farinosa (Pfs), wherein the spinach plant comprises in its genome a resistance gene comprising one or more mutations, wherein said resistance gene is associated with markers of SEQ ID No. 3 and SEQ ID No. 4 or SEQ ID No. 5 and SEQ ID No. 6.

    2. The spinach plant according to claim 1, wherein said resistance gene encodes for a protein having at least 85% sequence identity with SEQ ID No. 2.

    3. The spinach plant according to claim 1, wherein said resistance gene comprises a coding sequence having at least 90% sequence identity with SEQ ID No. 1.

    4. The spinach plant according to claim 1, wherein the plant is heterozygous or homozygous for the resistance gene comprising one or more mutations.

    5. The spinach plant according to claim 1, wherein said plant is at least resistant to Peronospora farinosa races Pfs3 to Pfs17.

    6. The spinach plant according to claim 1, wherein said resistance gene is obtainable from deposit number NCIMB 43624.

    7. The spinach plant according to claim 1, wherein the one or more mutations comprise deletions, insertions or substitutions in the coding sequence of SEQ ID No. 1.

    8. The spinach plant according to claim 1, wherein the resistance gene comprises at least one of the sequences of SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15.

    9. A see produced by a spinach plant according to claim 1.

    10. A resistance gene comprising one or more mutations that confer resistance to downy mildew in spinach plants, wherein the resistance gene encodes for a protein that has at least 85% sequence identity with SEQ ID No. 2.

    11. The resistance gene according to claim 10, wherein the coding sequence of said resistance gene having at least 90% sequence identity with SEQ ID No. 1.

    12. The resistance gene according to claim 10, wherein the resistance gene provides resistance to at least Peronospora farinosa races Pfs3 to Pfs17 in spinach.

    13. The resistance gene according to claim 10, wherein the resistance gene comprises at least one of the sequences of SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15.

    14. A method for providing a spinach plant that is resistant to downy mildew, wherein the method comprises the steps of introducing one or more mutations in a resistance gene in the genome of a susceptible spinach plant thereby providing the downy mildew resistant spinach plant, wherein the resistance gene encodes for a protein that has at least 85% sequence identity with SEQ ID No. 2.

    15. The method according to claim 14, wherein the coding sequence of said resistance gene having at least 90% sequence identity with SEQ ID No. 1.

    16. The method according to claim 14, wherein the one or more mutations of the resistance gene are achieved by genome editing techniques, CRISPR Cas, or mutagenesis techniques.

    17. The method according to claim 14, wherein the resistance gene comprises at least one of the sequences of SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15.

    18. The method according to claim 14, wherein the method comprises the steps of: a) providing a spinach plant comprising the resistance gene, b) crossing the spinach plant of step a) with a susceptible spinach plant, c) optionally, selfing the plant obtained in step b) for at least one time, d) selecting the plants that are resistant to downy mildew.

    19. The method according to claim 14, wherein the spinach plant is resistant to downy mildew caused by at least Peronospora farinosa races Pfs3 to Pfs17.

    20. The method according to claim 14, wherein the resistance gene is obtainable from deposit number NCIMB 43624.

    21. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWING

    [0037] The present invention will be further detailed in the following examples and figures wherein:

    [0038] FIG. 1: shows quantification of Pfs actin in spinach plants infected with Peronospora farinosa (Pfs12 or Pfs14), after VIGS gene silencing. Resistant spinach plants containing the L3 gene were transient transformed with a L3 VIGS silencing construct or a RFP VIGS silencing construct (negative control). As further controls a resistant spinach plant according to present invention was included that was not transformed with a VIGS construct (“R plant) and a Pfs susceptible spinach plant was included (“S control line OS56”). After VIGS, from these plants RNA was isolated to determine the expression levels of the Pfs actin house keeping gene by qPCR to determine Pfs infection. In case L3 gene expression levels were VIGS silenced in spinach infected with Pfs 12 or Pfs 14, expression levels of Pfs actin increased dramatically. Leaves of the plant that were susceptible to Pfs, showed high transcriptional levels of the Pfs actin house keeping gene, indicating the susceptibility corresponds with silenced L3 gene expression due to VIGS silencing.

    DESCRIPTION OF THE INVENTION

    Examples

    Genemapping of Novel Candidate Dominant Resistance Genes

    [0039] The identification of a novel candidate dominant resistance gene L3 was obtained by gene mapping of Peronospora farinosa (Pfs) resistance genes in Spinach (S. oleracea). In spinach these novel resistance genes were mapped on locus 3 on chromosome 1 in the spinach genome.

    [0040] The resistance gene was mapped using a Bulk Segregant Analysis (BSA) approach. The RNA of multiple BC3S1 resistant plants were pooled and compared to a pool of RNA of susceptible plants from the same family. Markers were developed in regions where an increase in number of SNPs was observed. The markers were validated on the BC3S1 population. Once a region of interest (ROI) could be identified and flanked by markers, a fine mapping approach was started.

    [0041] Flanking markers 2969156 and 3155721 or 1941240 and 460539 were used in an F2 population of ˜3000 samples to identify plants that contain a recombination between the two markers.

    TABLE-US-00001 Marker Sequence SEQ ID No. 3 2969156 AATTCCAGGCTGATGCCTCATCGTTCTCAACTGGTAAATG GTAACACCCCAAAGTCCAACTGCCAGCCCACCCAATAGA GTGAGCAACTTCTGTGATGTTTCTGAATTTTTGTGGCCAA TT SEQ ID No. 4 3155721 CATGATTATTGCATAAATTGGGGTTAGGGGTATGATTAA TTGCCCCAGTAACAACATATTTGGGAATGTTTTTGGTGTT ATTTTGAATGAATGAGGTAGTGGGGGTGGAGGGGGAGA AGGATGAGTAAGGTTTGGGAGTGGAGGAGAGAGAAAGA GGTGGGTGACGGCGGTGGTGAGGTTTAAGGTGAGACAGT GAAGCGG SEQ ID No. 5 1941240 TCACAGTTCATCCCCCTTTGTGTCAAGATGCATGCTATGT ATGTGTTCGACGAAATGCCTAAATGAGATGTCAACCGTT ATTTCAATTTTGATGCTTAGGTTAGAAGGTGAAATCAAA AGA SEQ ID No. 6 460539 GTGTACAAAATTTGGCAGGAAAGGAGCCGACTGAAAAT GGTACTGCTAAAAAAATGAGTCAATTTTTAAGCAAGGGG CCCATCGTTCTTAACTTTAGAGAATGTTCCCCAGAGGCAG ATGA

    [0042] Those recombinant plants were phenotyped with several Peronospora farinosa strains and genotyped by markers in the ROI. By combining the genotype and phenotype results, the region of interest could be reduced to a single gene.

    Construction of VIGS Construct and Transformation into Spinach (S. olercea)

    [0043] To confirm if the L3 gene is responsible for the observed resistance in spinach, VIGS silencing can be used to silence the in the resistant source S. oleracea. Therefore, a VIGS-construct was made for L3 and cloned in the K20 vector (See Table 1 for sequences). Another VIGS-construct was made that targets a different gene (RFP) and used as a negative control. The constructs were transformed into spinach using co-cultivation with agrobacterium (GV3101) to study the function of L3 in respect of resistance to Pfs.

    TABLE-US-00002 TABLE 1 VIGS-constructs Sequence L3 (SEQ ID No. 7) ATGGATGTGTCTGCAGGCCTTTCACTAGTACAAACTGTCCTCG AATTGTTGGGTTCTCCCATTTGGACACAGATTCAATCTTTGTTG GGTGTGGAGTACTCACAGCTTGACAAACTCAAGGCCACCATGT CCACTATTGAGGCTGTGCTCCTTGATGCTGAAGATCAAGAGCA GTTGCATCAATATCGTCGTAGCCATG RFP (SEQ ID No. 8) GAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACG GCCACAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTA CGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGG CCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCCAGT ACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGA CTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGC GTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAG GACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGC TGCGCGGCACCAACTTCTCCTCCGACGGCCCCGTAATGCAGAA GAAGACCATGGGCTG

    L3 Resistance Gene Silencing Experiment Using Virus Induced Gene Silencing (VIGS)

    [0044] To demonstrate that the L3 gene is related to Peronospora farinosa resistance, the putative resistance gene was been silenced by tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) to induce susceptibility to P. farinosa infection in resistant spinach lines containing the L3 resistance gene. TRV-derived VIGS vectors have been abundantly described to study gene function in Arabidopsis thaliana, Nicotiana benthamiana, Lycopersicon esculentum and other plants (see for example Huang C, Qian Y, Li Z, Zhou X.: Virus-induced gene silencing and its application in plant functional genomics. Sci China Life Sci. 2012; 55(2):99-108).

    [0045] VIGS gene silencing was used to obtain Peronospora-susceptibility in resistant spinach species (S. oleracea) comprising the L3 gene. Briefly, lines containing the L3 gene were silenced by VIGS. Resistant spinach plants were transient transformed with a L3 gene silencing construct and infected with Peronospora farinosa (Pfs 12 or Pfs 14) causing downy mildew in spinach. With VIGS it was demonstrated that the L3 gene was associated with downy mildew resistance, i.e. resistant spinach lines were made susceptible by removing the L3 gene via virus induced gene silencing thereby silencing the L3 resistance gene (see FIG. 1).

    Determine Peronospora farinosa Expression in Spinach Comprising the L3 Gene

    [0046] A qPCR experiment was conducted in spinach tissues obtained from the VIGS experiment as outlined above to determine Peronospora farinosa expression levels in these plants. To obtain more insight in the response of spinach to infection with Peronospora farinosa, leaves of resistant plants comprising the L3 allele, plus the control plants as indicated above, were harvested. cDNA was synthesized from RNA that had been isolated from infected leaves. Expression of Peronospora farinosa actin was analysed by qPCR using the primers as set out in Table 2. (SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, respectively).

    TABLE-US-00003 TABLE 2 Primer name Sequence P.farinosa actin 5′-CTCCCCTCAACCCTAAAGCAA-3′ Fwd (SEQ ID No. 9) P.farinosa actin 5′-GACAGGACAGCTTGGATGTTTAC-3′ Rv (SEQ ID No. 10) Elongation factor 5′-GCAGGGTCGTTCTTTGAGTC-3′ Fwd (SEQ ID No. 11) Elongation factor 5′-AGAGGCTCTTCCTGGTGACA-3′ Rv (SEQ ID No. 12)

    [0047] FIG. 1 shows the results of a qPCR of housekeeping gene P. farinosa actin in the plants after Pfs12 or Pfs 14 infection and VIGS silencing. Three technical replicates were performed, and relative Pfs actin expression was analysed by calculating the relative quantity (RQ=1/(2{circumflex over ( )}Cttarget)) and normalised expression (NE=RQtarget/RQref). The relative quantity of the target genes were normalised to Elongation factor of Spinacea oleracea, which is a house keeping gene in spinach. Values on the y-axis are relative Pfs actin expression. On the x-axis from left to right: sample leaves of a susceptible spinach plant OS56 in which no VIGS silencing construct has been used, sample leaves of a Pfs resistant plant according to present invention comprising the L3 gene in which no VIGS silencing construct has been used, sample leaves of a plant of present invention in which the L3 gene is silenced using the VIGS silencing construct, and sample leaves of a plant wherein the RFP VIGS construct (negative control) was used. In the samples showing a resistant phenotype, comprising the L3 gene, there is no Pfs present. In the sample with susceptible phenotypes where L3 gene was silenced by VIGS, high transcription levels of the Pfs housekeeping gene actin were measured.

    Disease Resistance Test (Leaf Disc Test) for Peronospora farinosa in Spinach L3

    [0048] Spinach plants of present invention containing the L3 gene are tested for resistance to Peronospora farinosa. The plants must be, at least in the second leaf stage and not yet flowering. Leaves of spinach plants that comprise the L3 gene, were put in trays with moistened paperboard. The infected seedlings are suspended in 20 mL water, filtered by cheesecloth and the flow-through is collected in a spray flask. One tray is spray-inoculated with this Peronospora farinosa suspension. Spray leafs with inoculum and make sure that all the discs are wet. The trays are covered with a glass plate and stored in a climate chamber at 15° C. (12 hours of light). Seven to fourteen days post inoculation infection leaves are phenotypically scored by eye on the presence of Peronospora farinosa (Pfs).

    [0049] Spinach plants that comprise the L3 gene were tested for resistance phenotype for Pfs. The leaves are scored based on symptoms of sporulation on upper or underside (abaxial side) of the leaf disc and scored according to the following scale: [0050] 9=No sporulation. [0051] 7-8=A small amount of sporulation (max 10 conidiophores). [0052] 5-6=Some sporulation on the edge of the disc. [0053] 3-4=Some sporulation in a small area of the punch or many sporulation on a piece of only 2-3 mm close to the edge. [0054] 2=Reasonable sporulation. [0055] 1=Strong sporulation.
    The infection was validated by inclusion of the susceptible and resistant controls (Viroflay, Boeing, wherein the susceptible control score a score of 1. A score of 9 showed to be fully resistant. Furthermore the degree of sporulation is qualified by the amount of sporulation and not the discoloration of the disc.

    TABLE-US-00004 TABLE 3 Peronospora farinosa (Pfs) resistance phenotype spinach plants. Pfs-physio Viroflay Boeing Plant L3 1 1 9 ND 2 1 9 ND 3 1 9 9 4 1 9 9 5 1 9 9 6 1 9 9 7 1 9 9 8 1 1 9 9 1 9 9 10 1 1 9 11 1 9 9 12 1 1 9 13 1 9 9 14 1 1 9 15 1 9 9 16 1 9 9 17 1 1 9

    [0056] Table 3 shows an overview of the disease test performed with the isolates of Peronospora farinosa Pfs1 to Pfs17 on Spinach varieties. Results show that spinach comprising the L3 resistance gene is resistant to at least Peronospora farinosa races Pfs3 to Pfs17. For Pfs physios 1 and 2 resistance was not determined, but it is expected that the spinach plant will also be resistant to Pfs 1 and 2. The control lines show to be susceptible to at least multiple downy mildew isolates. Only the plant of present invention is resistant to the recent physio Pfs 17.