COMPOSITION FOR SEQUENTIAL POLYMERASE CHAIN REACTION, AND GENE AMPLIFICATION METHOD USING SAME
20230250471 · 2023-08-10
Assignee
Inventors
Cpc classification
International classification
Abstract
The present invention relates to a composition for a sequential polymerase chain reaction and a gene amplification method using the same. The composition for a sequential polymerase chain reaction comprises a template gene, a DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer so that a sequential polymerase chain reaction can be induced in one container. Unlike conventional nested PCR, a reactant-adding step is omitted in the sequential polymerase chain reaction according to the present invention, and thus the inflow of contaminants from the outside is low, the yield of polymerase chain reaction (PCR) of genes can be increased, and highly-reproducible polymerase chain reaction results can be obtained even if the presence of genes is very low.
Claims
1. A method for performing a sequential polymerase chain reaction, comprising preparing a composition comprising a template gene, DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer in one container; a first polymerase chain reaction step; and a second polymerase chain reaction step, wherein the first polymerase chain reaction step comprises: a) a first denaturation step of unwinding the double helix of the template gene; b) a first annealing step of binding the first forward primer and the first reverse primer to the template gene according to step a); and c) synthesizing a first product by replicating the template gene by the first forward primer and the second reverse primer bound in step b), and wherein the second polymerase chain reaction step comprises: d) a second denaturation step of unwinding the double helix of the first product; e) a second annealing step of binding the first forward primer and the first reverse primer to the first product according to step d); f) synthesizing a second product by replicating the first product by the first forward primer and the second reverse primer bound in step e); and g) synthesizing a final product by binding the first forward primer to the second product to synthesize a third product, and binding the third reverse primer to the third product.
2. The method of claim 1, wherein step e) is performed at a higher temperature than step b), and wherein the second reverse primer is designed to be activated at a higher temperature than the first reverse primer.
3. The method of claim 1, wherein step e) is performed at a temperature which is 5° C. to 30° C. higher than step b).
4. The method of claim 1, wherein the first polymerase chain reaction and the second polymerase chain reaction are controlled according to temperature.
5. The method of claim 1, wherein the second reverse primer further comprises an arbitrary gene sequence in addition to a sequence complementary to the template gene.
6. The method of claim 5, wherein the arbitrary gene sequence and the complementary gene sequence are included in the second product, and wherein the third reverse primer binds to the arbitrary gene sequence and the complementary gene sequence included in the second product to synthesize a final product.
7. The method of claim 1, wherein the composition further comprises a probe binding to the third product, and wherein a gene sequence of the third product to which the probe binds is a gene sequence complementary to an arbitrary gene sequence included in the second reverse primer.
8. The method of claim 7, wherein the probe is degraded according to gene synthesis by the third reverse primer to emit light.
9. A composition for a sequential polymerase chain reaction, comprising the template gene, DNA polymerase, dNTP, the first forward primer, the first reverse primer, the second reverse primer and the third reverse primer according to claim 1.
10. A kit for a sequential polymerase chain reaction, comprising the template gene, DNA polymerase, dNTP, the first forward primer, the first reverse primer, the second reverse primer and the third reverse primer according to claim 1.
Description
DESCRIPTION OF DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
MODES OF THE INVENTION
[0034] Hereinafter, preferred exemplary embodiments of the present invention will be described in detail. The advantages and features of the present invention will be apparent with reference to the exemplary embodiments described below for achieving the same. However, the present invention is not limited to the exemplary embodiments to be disclosed below, but may be implemented in a variety of different forms. However, these exemplary embodiments are provided to make the disclosure of the present invention complete, and to fully inform the scope of the invention to those skilled in the art to which the present invention pertains, and the present invention is defined by the scope of the claims. The same reference numerals refer to the same constitutional elements throughout the specification.
[0035] Unless otherwise defined, all terms (including technical and scientific terms) used in the present specification may be used as meanings that can be commonly understood by those of ordinary skill in the art to which the present invention pertains. In addition, terms that are defined in a commonly used dictionary are not interpreted ideally or excessively unless explicitly defined specifically. The terms used in the present specification are for describing the exemplary embodiments and are not intended to limit the present invention. In the present specification, the singular form also includes the plural form unless specifically stated in the phrase.
[0036] As used herein, the term ‘ polymerase chain reaction (PCR)’ is a method of amplifying a specific template gene to be detected and as modifications of the polymerase chain reaction, it includes reverse transcriptase polymerase chain reaction (RT-PCR) in which complementary DNA is synthesized by using reverse transcriptase for RNA and performs a polymerase chain reaction by using the same as a template, real-time polymerase chain reaction that simultaneously detects an amplified product while amplifying DNA using fluorescent materials and the like.
[0037] Unless otherwise specified herein, the sequential polymerase chain reaction of the present invention includes a process carried out by a method commonly used in the art.
[0038] For example, the enzymes used in the sequential polymerase chain reaction of the present invention may include DNA Taq-polymerase having exonuclease activity, which may be used in the same manner in a first polymerase chain reaction and a second polymerase chain reaction.
[0039] As used herein, the term ‘primer’ is a nucleic acid sequence having a short free 3′ hydroxyl group to be replicated and may form base pairs with a complementary template, and it refers to a short nucleic acid sequence that functions as a starting point for copying the template gene. The length and sequence of a primer should allow the synthesis of an extension product to begin. The specific length and sequence of a primer will depend on the complexity of a DNA or RNA target required as well as the conditions of use of the primer, such as temperature and ionic strength.
[0040] As used herein, the term ‘template gene’ may include double-stranded DNA, single-stranded RNA, cDNA or miRNA, and most preferably, the template gene is in the form of DNA.
[0041] As used herein, the term ‘product’ refers to a gene synthesized according to a polymerase chain reaction.
[0042] As used herein, the term ‘degradation’ of a probe or primer may mean that the structure of a probe or primer is physically or chemically modified or destroyed.
[0043] As with the commonly known polymerase chain reaction (PCR) technique, one PCR step consists of three steps. After passing through a thermal denaturation process (denaturation step) that separates genes using heat, the temperature is lowered to allow the primer to bind to the end of a sequence to be amplified (annealing step), and the heat is slightly raised to perform a polymerization reaction (polymerization or extension, gene synthesis step) that synthesizes the gene, The thermal denaturation step, the annealing step and the gene synthesis step are sequentially performed, and it is noted that one cycle is performed when each step is performed once. For example, in the case of the first polymerase chain reaction of the present invention, when a denaturation step is performed at 95° C. for 15 seconds, an annealing step is performed at 65° C. for 30 seconds, and a gene synthesis step is performed at 72° C. for 30 seconds, it is noted that in this case, the first polymerase chain reaction is performed for 1 cycle (times).
[0044] As used herein, the term ‘sequential polymerase chain reaction’ may include preparing a composition including a template gene, DNA polymerase, dNTP, a first forward primer, a first reverse primer, a second reverse primer and a third reverse primer in one container; a first polymerase chain reaction step; and a second polymerase chain reaction step.
[0045] The first polymerase chain reaction step of the present invention may include a) a first denaturation step of unwinding the double helix of the template gene; b) a first annealing step of binding the first forward primer and the first reverse primer to the template gene according to step a); and c) synthesizing a first product by replicating the template gene by the first forward primer and the second reverse primer bound in step b). The second polymerase chain reaction step may include d) a second denaturation step of unwinding the double helix of the first product; e) a second annealing step of binding the first forward primer and the first reverse primer to the first product according to step d); f) synthesizing a second product by replicating the first product by the first forward primer and the second reverse primer bound in step e); and g) synthesizing a final product by binding the first forward primer to the second product to synthesize a third product, and binding the third reverse primer to the third product.
[0046] As used herein, the term ‘container’ includes all types of experimental tools capable of causing a polymerase chain reaction. The present invention is characterized in that different polymerase chain reactions are continuously and independently performed in one container.
[0047] As used herein, the term ‘sequential polymerase chain reaction (hereinafter, referred to as ‘switching PCR’)’ means a reaction in which a first polymerase chain reaction for amplifying a template gene and a second polymerase chain reaction for amplifying the product of the first polymerase chain reaction occur continuously and sequentially, and the initiation of each polymerase chain reaction may be controlled by temperature. The sequential polymerase chain reaction according to the present invention may further proceed to a third or fourth polymerase chain reaction or subsequent steps.
[0048] In the sequential polymerase chain reaction of the present invention, a separate reactant-adding step is excluded between the first polymerase chain reaction and the second polymerase chain reaction, and the first polymerase chain reaction and the second polymerase chain reaction may be performed continuously or independently in one container. Unlike the conventional nested PCR reaction, in the ‘sequential polymerase chain reaction’ according to the present invention, the intermediate step of adding reactants is omitted, thereby shortening the gene amplification time and preventing contamination from foreign substances.
[0049] The first polymerase chain reaction or the second polymerase chain reaction may be performed in several cycles, and the nested PCR technique may be used as a part of the sequential polymerase chain reaction of the present invention. The present invention may amplify the gene in a short period of time even if the template gene (template) is present at a low concentration by passing through multiple PCR steps.
[0050] Similar to the conventional polymerase chain reaction (PCR), the main purpose of the present invention is to amplify the amount of a template gene, and the first polymerase chain reaction and the second polymerase chain reaction of the ‘sequential polymerase chain reaction’ according to the present invention may be performed several times to synthesize a large amount of the final gene (final product). As described above, the genes synthesized in each step of the present invention are used or remain in the subsequent reaction.
[0051] As used herein, the term ‘forward’ or ‘reverse’ indicating the direction of initiation of the synthesis of primers means that the synthesis direction between each primer is different or identical, and it does not specify the gene synthesis direction of 5′->3′ or 3′->5′ according to the replication target gene (e.g., template gene). That is, although the gene synthesis direction of the primers according to the replication target gene may be different, the synthesis direction between the reverse primers is the same and is opposite to that of the forward primer.
[0052] For example, when the template gene is double-stranded, the first forward primer and the first reverse primer may each replicate complementary template gene strands (first polymerase chain reaction). Thereafter, the first forward primer may bind to a second product synthesized by the first reverse primer, and the second reverse primer may bind to the second product synthesized by the first forward primer to replicate the gene strand (second polymerase chain reaction). The first forward primer may bind to the second product synthesized by the second reverse primer to initiate the synthesis of a third product, and in this case, when an arbitrary gene sequence is further included in the second reverse primer, a gene sequence complementary to the arbitrary gene sequence may be further synthesized in the third product. The third reverse primer may bind to the third product synthesized by the first forward primer to initiate the synthesis of a final product. In this case, if a probe and the third reverse primer bind to the ‘sequence complementary to the arbitrary gene sequence’ included in the third product, the probe separates from the third product and emits light according to the initiation of gene synthesis of the third reverse primer. In this case, since the light emission by the probe is confirmed only when the third product is synthesized, it can be seen that the second polymerase chain reaction has been performed.
[0053] As can be seen from the foregoing, the first product or the second product of the present invention may be composed of double strands, and each primer of the present invention binds to a gene sequence complementary to each gene, and the subsequent reaction proceeds.
[0054] As used herein, the terms ‘first forward primer’ and ‘first reverse primer’ refer to primers that bind to a template gene and initiate the replication of a template gene. A first product is synthesized according to the initiation of template gene replication of the first forward primer and the first reverse primer. In the present invention, the ‘first reverse primer’ is designed to bind only to the template gene, but the ‘first forward primer’ binds not only to the template gene but also binds to the first product, the second product or the third product to initiate replication.
[0055] As used herein, the term ‘second reverse primer’ refers to a primer that binds to the first product, and the second reverse primer may also bind to the template strand, but is designed such that it does not participate in the first polymerase chain reaction by controlling the activation temperature and the temperature of the first annealing step. When the template gene is DNA, since the first product is also double-stranded, the first forward primer binds to the complementary strand of the first product gene strand, to which the second reverse primer binds, to initiate the replication of the first product gene. In this case, the second reverse primer may further include an arbitrary gene (adapter gene) sequence which is not included in the first product or template gene, and the arbitrary gene may be located at the 5′ end of the second reverse primer. Accordingly, the second product synthesized by the second reverse primer may include the arbitrary gene sequence which is not included in the template gene.
[0056] The first forward primer may bind to the second product synthesized by the second reverse primer to initiate the synthesis of the third product.
[0057] As used herein, the term ‘third reverse primer’ refers to a primer that binds to the third product. The third reverse primer may bind to ‘a gene sequence complementary to the arbitrary gene sequence’ present in the ‘third product.’ According to the present invention, the third reverse primer is not involved in the first polymerase chain reaction, because it binds to the ‘gene sequence complementary to the arbitrary gene sequence.’
[0058] When the polymerase chain reaction (PCR) is performed, it is common to reduce the concentration of primers used in order to detect a point mutation of a template gene, but in this case, there is a problem in that the amount (yield) of the final product is reduced. In order to solve this problem, the present invention uses a second reverse primer including an arbitrary gene and a third reverse primer. In the present invention, the second reverse primer (preferably at the 5′ end) may include an arbitrary gene (adapter gene) and initiates the second polymerase chain reaction by using the first product as a template. According to the present invention, the first forward primer may bind to the second product synthesized by the second reverse primer, whereby the third product including the ‘gene complementary to the arbitrary gene (adapter gene)’ is synthesized. The third reverse primer binds to ‘a gene complementary to an arbitrary gene (adapter gene)’ included in the third product to initiate the synthesis of a final product, and since a high concentration may be used for the concentration of the third reverse primer regardless of a point mutation, more products may be produced. That is, in order to solve the yield (PCR YIELD) problem in a conventional polymerase chain reaction for detecting a point mutation (in general, when conducting PCR to detect a point mutation, there is a problem in that the PCR YIELD is reduced by using a low concentration of primers and performing an annealing step at a temperature slightly higher than the temperature of a general annealing step), the concentration of the second reverse primer used may be lowered, but the concentration of the third reverse primer may be increased, and thus, a larger amount of product may be synthesized in a short period of time.
[0059] As used herein, the term ‘design’ of a primer means preparing a primer such that the primer can be activated or blocked under specific conditions (e.g., temperature), and the primer design method commonly used in the art may be used. The design method includes a method of controlling the length (mer) or sequence of a primer, but is not limited thereto.
[0060] As used herein, the term ‘blocking’ may mean that the primer is not annealed to the target gene (gene (template) to be replicated in the corresponding PCR).
[0061]
[0062] In the present invention, each annealing step of the first polymerase chain reaction and the second polymerase chain reaction may have different temperatures, and preferably, the annealing step temperature of the second polymerase chain reaction is higher than the annealing temperature of the first polymerase chain reaction. For example, the annealing step of the second polymerase chain reaction may be performed at a temperature 5° C. to 30° C. higher than the annealing step of the first polymerase chain reaction. According to the present invention, the temperature at which each primer is activated may be different from each other. In this case, the activation temperature of the first forward primer is preferably designed in the widest range, and the activation temperatures of the second reverse primer and the third reverse primer are preferably designed to be higher than the activation temperature of the first reverse primer. For example, the activation temperature of the second reverse primer or the third reverse primer may be designed to be 5° C. to 30° C. higher than the activation temperature of the first reverse primer.
[0063] The annealing step of the first polymerase chain reaction according to the present invention may be performed at a temperature 5° C. to 30° C. lower than the annealing step of the second polymerase chain reaction, and exonuclease is activated by the initiation of gene synthesis of the first reverse primer. That is, in the first polymerase chain reaction, only the first product by the first forward primer and the first reverse primer may be synthesized. The annealing step of the second polymerase chain reaction may be performed at a temperature which is 5° C. to 30° C. higher than the annealing step of the first polymerase chain reaction, and due to the relatively high temperature, the reaction by the first reverse primer does not proceed. On the other hand, the second reverse primer may bind to the first product such that only the second polymerase chain reaction proceeds.
[0064] Specifically,
[0065] Referring to
[0066] Referring to
[0067] According to an exemplary embodiment of the present invention, the first forward primer, the first reverse primer, the second reverse primer, the third reverse primer and the probe may consist of sequences as shown in Table 1 below.
TABLE-US-00001 TABLE 1 Sequence Information (5′.fwdarw.3′) First forward GGGAGCCAATATTGTCTTTGTGTTC primer First reverse GTGCCGCCTGCTG primer Second reverse CTCCACCGTGCAGCTCATCA primer (Example 1) Second reverse TAGGCGGAATCGGTAGTAATCAA CAT primer (Example 2) CAGTCTGATAAGCTATCGG TAC CTCCACCGTGCAGCTCATCAC Third reverse TAGGCGGAATCGGTAGTAATCAA primer Probe /56-FAM/CAG TCT GAT/ZEN/AAG CTA TCG G/3IABKFQ/
[0068] Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.
Example 1
[0069] <1-1> Switching PCR Reaction Using Template of Standard Concentration
[0070] 10 μL of qPCR Master mix was added to a PCR tube. Then, 1 μL of Template DNA (T790M) was added, and 1 μL of each of the first forward primer and the first reverse primer at a concentration of 10 μM, 1 μL of the second reverse primer at a concentration of 10 μM, 1 μL of the third reverse primer and 0.5 μL of the probe were added. After adding 7 μL of distilled water to the tube, pipetting was performed (in this case, the prepared kit is referred to as Experimental Group 1). Thereafter, the tube was placed into the well of a PCR machine (Bio-Rad CFX96™), and the temperature was adjusted as shown in Table 2 below to perform the first polymerase chain reaction 20 times and the second polymerase chain reaction for 40 times.
TABLE-US-00002 TABLE 2 Temperature Conditions Time Number of Cycles 95° C. 15 minutes 95° C. 15 seconds First polymerase chain reaction 65° C. 30 seconds 20 times 72° C. 30 seconds 95° C. 15 seconds Second polymerase chain reaction 71° C. 30 seconds 40 times 72° C. 30 seconds
[0071] <1-2> Switching PCR Reaction Using Diluted Template
[0072] Experimental groups were prepared by setting the concentration of Template DNA (T790M) to ½ μL (Experimental Group 2), ¼ μL (Experimental Group 3), ⅙ μL (Experimental Group 4), ⅛ μL (Experimental Group 5) and 1/10 μL (Experimental Group 6), and experiments were performed under the same rest of conditions as in Experimental Example 1-1.
[0073] Result values according to Examples 1-1 and 1-2 are shown in Tables 3 and 4 below.
TABLE-US-00003 TABLE 3 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1% M 19.69 19.69 0.38 (T790M (3COPY) 20.23 Mutant standard) 19.12 19.73 1/2% M 21.22 21.43 0.64 21.05 20.47 21.47 21.51 21.78 21.13 20.92 20.21 21.06 21.99 20.45 22.59 21.60 22.17 21.75 21.87 22.15 21.79
TABLE-US-00004 TABLE 4 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/4% M 23.42 23.15 1.07 (T790M 22.16 Mutant standard) 22.26 23.01 21.07 23.51 22.88 23.68 21.97 23.68 21.97 23.27 24.07 23.05 23.31 25.39 23.10 22.09 23.41 24.34 25.18
[0074] <1-3> Standard PCR Reaction Using Template of Reference Concentration
[0075] 10 μL of qPCR Master mix was added to a PCR tube. Thereafter, 1 μL of Template DNA (T790M) was added, and 0.5 μL of each of the first forward primer and the first reverse primer at a concentration of 10 uM was added. After adding 7 μL of distilled water to the tube, pipetting was performed (in this case, the prepared kit is referred to as Control Group 1). Thereafter, the tube was placed into the well of a PCR machine (Bio-Rad CFX96™), and the temperature was controlled as shown in Table 5 below to perform PCR for 60 times.
TABLE-US-00005 TABLE 5 Temperature Number of Conditions Times Cycles 95° C. 15 minutes 95° C. 15 seconds PCR 71° C. 30 seconds 60 times 72° C. 30 seconds
[0076] <1-4> Standard PCR Reaction Using Diluted Template
[0077] Experimental groups were prepared by setting the concentration of Template DNA (T790M) to ½ μL (Experimental Group 2), ¼ μL (Experimental Group 3), ⅙ μL (Experimental Group 4), ⅛ μL (Experimental Group 5) and 1/10 μL (Experimental Group 6), and experiments were performed under the same rest of conditions as in Experimental Example 2-1.
[0078] Result values according to Examples 1-3 and 1-4 are shown in Tables 6 and 7 below.
TABLE-US-00006 TABLE 6 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1% M 46.36 46.13 0.54 (T790M (3COPY) 45.60 Mutant standard) 45.75 46.79 1/2% M 51.06 49.58 1.87 48.25 50.83 49.34 49.53 49.94 46.98 49.78 49.96 48.02 46.97 50.99 50.57 51.28 46.23 53.65 48.14 51.00
TABLE-US-00007 TABLE 7 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/4% M 52.59 51.51 1.32 (T790M 51.53 Mutant standard) 51.16 51.66 51.22 51.81 51.35 52.10 48.10 50.26 50.99 50.31 50.58 53.42 50.96 52.23 53.52 53.35
[0079] Referring to
Example 2
[0080] <2-1> Switching PCR Reaction Using Template at Reference Concentration
[0081] PCR was performed under the same conditions as in Example 1-1.
[0082] <2-2> Switching PCR Reaction Using Diluted Template
[0083] PCR was performed under the same conditions as in Example 1-2.
[0084] Result values according to Examples 2-1 and 2-2 are shown in Tables 8 and 9 below.
TABLE-US-00008 TABLE 8 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/4% M 17.59 19.99 1.67 (T790M 19.95 Mutant standard) 21.56 20.85 1/6% M 19.10 20.66 1.40 20.02 19.34 19.52 19.93 21.31 23.11 19.53 19.66 21.86 22.47 23.18 20.26 19.74 18.55 22.15 19.88 21.97 21.42 20.17
TABLE-US-00009 TABLE 9 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/8% M 23.17 22.97 0.69 (T790M 22.22 Mutant standard) 21.52 22.69 23.26 23.34 23.30 23.48 23.89 23.48 23.97 22.46 22.37 23.91 23.87 23.13 23.45 22.49 23.51 24.14
[0085] <2-3> Standard PCR Reaction Using Template at Reference Concentration
[0086] PCR was performed under the same conditions as in Example 1-3.
[0087] <2-4> Standard PCR Reaction Using Diluted Template
[0088] PCR was performed under the same conditions as in Examples 1-4.
[0089] Result values according to Examples 2-3 and 2-4 are shown in Tables 10 and 11 below.
TABLE-US-00010 TABLE 10 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/4% M 51.16 51.04 1.31 (T790M 52.26 Mutant standard) 49.19 51.53 1/6% M 54.55 50.22 2.08 52.15 55.60 48.52 48.80 50.73 49.31 50.34 48.27 49.07 49.55 50.57 50.70 48.60 48.13 47.81 51.44 51.51 48.52 50.30
TABLE-US-00011 TABLE 11 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/8% M 55.68 53.09 3.05 (T790M 50.66 Mutant standard) 53.22 49.04 54.04 50.89 50.25 49.38 50.72 49.55 52.74 51.72 54.54 58.93 53.63 56.08 58.00 56.60
[0090] Referring to
Example 3
[0091] <3-1> Switching PCR Reaction Using Template at Reference Concentration
[0092] PCR was performed under the same conditions as in Example 1-1.
[0093] <3-2> Switching PCR Reaction Using Diluted Template
[0094] PCR was performed under the same conditions as in Example 1-2.
[0095] Result values according to Examples 3-1 and 3-2 are shown in Table 12 below.
TABLE-US-00012 TABLE 12 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/2% M 17.87 17.93 0.08 (T790M 17.99 Mutant standard) 1/4% M 18.12 18.76 0.90 19.39 1/6% M 22.22 21.69 0.75 21.16 1/8% M 23.73 25.11 2.01 28.07 24.01 24.65 1/10% M 26.65 25.89 1.31 23.84 27.14 25.49 23.44 26.05 27.03 26.11 25.94 27.18
[0096] <3-3> Standard PCR Reaction Using Template at Reference Concentration
[0097] PCR was performed under the same conditions as in Example 1-3.
[0098] <3-4> Standard PCR Reaction Using Diluted Template
[0099] PCR was performed under the same conditions as in Examples 1-4.
[0100] Result values according to Examples 3-3 and 3-4 are shown in Table 13 below.
TABLE-US-00013 TABLE 13 Cq (Number Cq Cq Standard Gene Type Concentration of Cycles) Average Deviation PC 1/2% M 55.95 54.20 2.48 (T790M 52.44 Mutant standard) 1/4% M 52.11 52.26 0.20 52.40 1/6% M 54.60 54.09 0.71 53.59 1/8% M — 56.84 1.72 58.19 54.90 57.43 1/10% M 53.89 56.35 1.72 56.70 57.61 — 54.18 55.64 56.17 58.49 — 58.11
[0101] Referring to
[0102] In addition, the sequential polymerase chain reaction (switching PCR) in Example 3-2 of the present invention showed a 100% detection rate at both concentrations of ⅛% (Experimental Group 5) and 1/10% (Experimental Group 6), and in the case of the standard PCR of Example 3-4, it showed a detection rate of 75% at a concentration of ⅛% and a detection rate of 80% at a concentration of 1/10%, and thus, it can be seen that detection rates of below 95% were showed at both concentrations. That is, in the sequential polymerase chain reaction (Switching PCR) according to the present invention, amplification occurs easily even when the concentration of the template gene is low, and thus, it can be seen that the sequential polymerase chain reaction (switching PCR) using the kit according to the present invention has a higher sensitivity.
Example 4
[0103] <4-1> Standard PCR Reaction Using Template at Reference Concentration
[0104] 10 μL of qPCR Master mix was added to a PCR tube. Thereafter, 100 fg/μL of Template DNA (T790M) was added, and 0.5 μL of each of the first forward primer and the first reverse primer at a concentration of 10 μM, 1 μL of the second reverse primer at a concentration of 10 μM, 1 μL of the third reverse primer at a concentration of 10 μM and 0.5 μL of a probe were added. After adding 7 μL of distilled water to the tube, pipetting was performed. Thereafter, the tube was placed into the well of a PCR machine (Bio-Rad CFX96™), and the temperature was controlled as shown in Table 14 below to perform 40 cycles of PCR.
TABLE-US-00014 TABLE 14 Temperature Number of Conditions Time Cycles 95° C. 15 minutes 95° C. 15 seconds PCR 63° C. 30 seconds 40 times (cycle) 72° C. 30 seconds
[0105] <4-2> Standard PCR Reaction Using Template at Reference Concentration
[0106] The temperature was controlled as shown in Table 15, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
TABLE-US-00015 TABLE 15 Temperature Number of Conditions Time Cycles 95° C. 15 minutes 95° C. 15 seconds PCR 71° C. 30 seconds 40 times (cycle) 72° C. 30 seconds
[0107] <4-3> Standard PCR Reaction Using Template at Reference Concentration
[0108] The first polymerase chain reaction and the second polymerase chain reaction were performed at the temperatures as shown in Table 16, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
TABLE-US-00016 TABLE 16 Temperature Number of Conditions Time Cycles 95° C. 15 minutes 95° C. 15 seconds First polymerase chain reaction 65° C. 30 seconds 10 times 72° C. 30 seconds 95° C. 15 seconds Second polymerase chain reaction 71° C. 30 seconds 30 times 72° C. 30 seconds
[0109] <4-4> Standard PCR Reaction Using Template of Standard Concentration
[0110] The concentration of Template DNA (T790M) was set to 0, and PCR was performed under the same conditions as in Example 4-1 for other experimental conditions.
[0111]
[0112] In {circle around (1)} of
EXPLANATION OF REFERENCE NUMERALS
[0113] 10: Template gene [0114] 20: First forward primer [0115] 21: First product [0116] 30: First reverse primer [0117] 40: Second reverse primer [0118] 50: Third reverse primer [0119] 60: Probe
[0120] Although the exemplary embodiments of the present invention have been described above, those of ordinary skill in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without changing the technical spirit or essential features thereof. Therefore, it should be understood that the exemplary embodiments described above are illustrative in all respects and not restrictive.