APPLICATION OF METHIONINASE GENE THERAPY IN TREATMENT OF MALIGNANT TUMOR

Abstract

Disclosed is an application of methioninase gene therapy in the treatment of a malignant tumor. In the gene therapy, a virus is used as a vector to insert an exogenous methioninase gene to constitute a methioninase expression system inside a tumor, thus providing an endogenous mechanism for further consumption of methionine. In vitro cytology experiments indicate that the methioninase gene therapy significantly reduces the level of intracellular methionine, effectively inhibits the proliferation of tumor cells, and can be used in an application in preparing a drug for the targeted treatment of a malignant tumor.

Claims

1. A viral vector, wherein an exogenous MEGL gene is inserted therein.

2. The viral vector according to claim 1, wherein the exogenous MEGL gene is a methionine γ-lyase gene.

3. The viral vector according to claim 1, wherein the vector uses EF1A promoter.

4. The viral vector according to claim 1, the vector carries a mCherry fluorescent protein.

5. The viral vector according to claim 1, wherein the exogenous MEGL gene consists of a sequence of SEQ ID No.1.

6. The viral vector according to claim 1, wherein the vector is constructed by following steps of: subcloning the MEGL gene into a plasmid to obtain a MEGL expression plasmid; transfecting the MEGL expression plasmid and a helper plasmid into 293T cells; and collecting a supernatant, concentrating and purifying to obtain the viral vector.

7. The viral vector according to claim 6, wherein the MEGL expression plasmid and the helper plasmid are co-transfected into the 293T cells, and wherein the helper plasmid is a viral packaging helper plasmid.

8. The viral vector according to claim 6, wherein the MEGL expression plasmid carries a mCherry red fluorescent protein.

9. The viral vector according to claim 6, wherein the vector is constructed by following steps of: (a) constructing an entry vector using BP reaction, comprising: mixing a Gateway expression vector having a target gene attB1-MEGL-attB2 sequence with a donor vector having attP1-ccdB-attP2 sequence; adding a BP Clonase enzyme mixture containing Int and IHF, keeping at 25° C. for 1 h, and treating with a protease K at 37° C. for 10 min to generate an entry vector having target gene MEGL and an expression vector having a suicide gene; transforming the entry vector into Escherichia coli Stbl3, and identifying positive clones and performing sequencing validation; (b) constructing a destination vector having two recombination sites attR1 and attR2 downstream of an expression regulatory element thereof, each of the recombination sites being 125 bp in length; and having a ccdB suicide gene between the attR1 and attR2; and (c) constructing a final expression vector via LR reaction, comprising: mixing the entry vector and the destination vector, adding a LR Clonase enzyme mixture containing recombinant factors including Int, IHF and Xis, keeping at 25° C. overnight, performing transformation by treating with a proteinase K at 37° C. for 10 minutes to generate a fusion plasmid, the attL1 sequence and the attR1 sequence being recombined, the fusion plasmid being decomposed into two new plasmids, obtaining a final expression vector of destination vector having the target gene; transforming the final expression vector into Escherichia coli Stbl3, and identifying positive clone plasmid and performing sequencing validation.

10. The viral vector according to claim 1, the viral vector is a lentivirus vector.

11. A method for constructing the viral vector according to claim 1, comprising: subcloning the MEGL gene into a plasmid to obtain a MEGL expression plasmid, transfecting the MEGL expression plasmid and a helper plasmid into 293T cells; collecting the supernatant, concentrating and purifying to obtain the target virus.

12. The method according to claim 11, wherein the MEGL expression plasmid and the helper plasmid are co-transfected into the 293T cells, and wherein the helper plasmid is viral packaging helper plasmid.

13. The method according to claim 11, wherein the MEGL expression plasmid carries a mCherry red fluorescent protein.

14. The method according to claim 11, comprising (a) constructing an entry vector using BP reaction, comprising: mixing a Gateway expression vector having a target gene attB1-MEGL-attB2 sequence with a donor vector having attP1-ccdB-attP2 sequence; adding a BP Clonase enzyme mixture containing Int and IHF, keeping at 25° C. for 1 h, and treating with a protease K at 37° C. for 10 min to generate an entry vector having target gene MEGL and an expression vector having a suicide gene; transforming the entry vector into Escherichia coli Stbl3, and identifying positive clones and performing sequencing validation; (b) constructing a destination vector having two recombination sites attR1 and attR2 downstream of an expression regulatory element thereof, each of the recombination sites being 125 bp in length; and having a ccdB suicide gene between the attR1 and attR2; and (c) constructing a final expression vector via LR reaction, comprising: mixing the entry vector and the destination vector, adding a LR Clonase enzyme mixture containing recombinant factors including Int, IHF and Xis, keeping at 25° C. overnight, performing transformation by treating with a proteinase K at 37° C. for 10 minutes to generate a fusion plasmid, the attL1 sequence and the attR1 sequence being recombined, the fusion plasmid being decomposed into two new plasmids, obtaining a final expression vector of destination vector having the target gene; transforming the final expression vector into Escherichia coli Stbl3, and identifying positive clone plasmid and performing sequencing validation.

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. A method for treating malignant tumors, comprising administering the viral vector according to claim 1 to subjects in need.

20. The method according to claim 19, wherein the malignant tumor is glioma.

21. The method according to claim 19, wherein the viral vector directly kills tumor cells.

22. The method according to claim 19, the viral vector inhibits histone methyltransferase EZH2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. 1 shows the construction of MEGL overexpression viral vector.

[0031] FIG. 2 shows images of MEGL overexpression virus infected glioma cells captured with a fluorescence microscope.

[0032] FIG. 3 shows results of PCR and Western Blot identification of MEGL overexpression virus infected target tumor cells. The upper image shows al time PCR results, and the lower images show stern Blot results. Group V: no-load virus control group; Group M: MEGL overexpression virus group.

[0033] FIG. 4 shows LC-MS results showing a decrease in intracellular methionine level after infection with MEGL overexpression virus. Group V: no-load virus control group; Group M: MEGL overexpression virus group.

[0034] FIG. 5 shows inhibition of the proliferation of glioma cells by MEGL overexpression virus. Group V: no-load virus control group; Group M: MEGL overexpression virus group. All data are expressed as mean±standard deviation. (n=3), * P<0.05, ** P<0.01, *** P<0.001, all compared with group V.

[0035] FIG. 6 shows inhibition of the expression of tumor cells EZH2 by MEGL overexpression virus. The upper one shows the down-regulation of EZH2 gene expression detected by 1 time PCR, and the lower ones show the down-regulation of EZH2 protein expression detected by Southern Blot. Group V: no-load virus control group; Group M: MEGL overexpression virus group. All data are expressed as mean±standard deviation. (n=3), * P<0.05, ** P<0.01, *** P<0.001, all compared with group V.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0036] The present application will be further illustrated with reference to following embodiments. However, these embodiments are only for illustrating, rather than limitations to the present invention detailed in the claims.

Example 1: Construction of Expression Vector Having MEGL

[0037]

TABLE-US-00001 MEGL/3xFLAG of following sequence (SEQ ID NO.1) is used: 1 ATGCGC GACTCC CATAAC AACACC GGTTTT TCCACA CGGGCC ATTCAC CACGGC TACGAC 61 CCGCTT TCCCAC GGTGGT GCCTTG GTGCCA CCGGTG TACCAG ACCGCG ACCTAT GCCTTC 121 CCGACT GTCGAA TACGGC GCTGCG TGCTTC GCCGGG GAGGAG GCGGGG CACTTC TACAGC 181 CGCATC TCCAAC CCCACC CTGGCC TTGCTC GAGCAA CGCATG GCCTCG TTGGAG GGTGGT 241 GAGGCG GGATTG GCGCTG GCGTCG GGGATG GGAGCC ATTACT TCGACC CTCTGG ACCCTG 301 CTGCGG CCTGGT GATGAG CTGATC GTGGGG CGCACC TTGTAT GGCTGC ACCTTT GCGTTC 361 CTGCAC CATGGC ATTGGC GAGTTC GGGGTC AAGATC CACCAT GTCGAC CTTAAC GATGCC 421 AAGGCC CTGAAA GCGGCG ATCAAC AGCAAA ACGCGG ATGATC TACTTC GAAACA CCGGCC 481 AACCCC AACATG CAACTG GTGGAT ATAGCG GCGGTC GTCGAG GCAGTG CGGGGG AGTGAT 541 GTGCTT GTGGTG GTCGAC AACACC TACTGC ACGCCC TACCTG CAGCGG CCACTG GAACTG 601 GGGGCA GACCTG GTGGTG CATTCG GCAACC AAGTAC CTCAGT GGCCAT GGCGAC ATCACT 661 GCGGGC CTGGTG GTGGGG CGCAAG GCTTTG GTCGAC CGCATT CGGCTG GAAGGG CTGAAA 721 GACATG ACCGGG GCAGCC TTGTCA CCGCAT GACGCT GCGTTG TTGATG CGCGGC ATCAAG 781 ACCCTG GCGCTG CGCATG GACCGG CATTGC GCCAAC GCCCTG GAGGTC GCGCAG TTCCTG 841 GCCGGG CAGCCC CAGGTG GAGCTG ATCCAC TACCCG GGCTTG CCGTCG TTTGCC CAGTAC 901 GAACTG GCACAG CGGCAG ATGCGT TTGCCG GGCGGG ATGATT GCCTTT GAGCTC AAGGGC 961 GGTATC GAGGCC GGGCGC GGCTTC ATGAAT GCCCTG CAGCTT TTTGCC CGTGCG GTGAGC 1021 CTGGGG GATGCC GAGTCG CTGGCA CAGCAC CCGGCG AGCATG ACGCAC TCCAGT TACACG 1081 CCACAA GAGCGG GCGCAT CACGGG ATATCA GAGGGG CTGGTG AGGTTG TCAGTG GGGCTG 1141 GAGGAT GTGGAG GACCTG CTGGCA GATATC GAGTTG GCGTTG GAGGCG TGTGCA GACTAC 1201 AAAGAC CATGAC GGTGAT TATAAA GATCAT GATATC GATTAC AAGGAT GACGAT GACAAG 1261 TGA

[0038] The viral vector is purchased from Cyagen Biology. The expression vector is mainly constructed using Gateway cloning technology. Gateway technology comprises two reactions, BP reaction and LR reaction. The BP reaction uses a recombination reaction between an attB DNA segment or expression clone and an attP donor vector to create an entry clone. The LR reaction is a recombination reaction between an attL entry clone and an attR destination vector. The details are described as follows:

[0039] 1) Construction of the entry vector via BP reaction: Gateway expression vector having a target gene (attB1-MEGL-attB2 sequence) is mixed with a donor vector having attP1-ccdB (suicide gene)-attP2 sequence, and a BP Clonase enzyme mixture containing Int and IHF is added thereto. The resulted is kept at 25° C. for 1 h and then treated with a protease K at 37° C. for 10 min, so that recombination of attP and attB sequences occurs, generating an entry vector having target gene (MEGL) and an expression vector having suicide gene. The entry vector is transformed into Escherichia coli Stbl3, and positive clones are identified and sequencing validation is performed.

[0040] 2) The destination vector, for matching with the Gateway system, has two recombination sites attR1 and attR2 downstream of an expression regulatory element thereof. Each of the recombination sites is 125 bp in length; and there is a suicide gene ccdB between the attR1 and attR2.

[0041] 3) Construction of final expression vector via LR reaction: Two plasmids, i.e. the entry vector and the destination vector, are mixed, and a LR Clonase enzyme mixture containing recombinant factors including Int, IHF and Xis is added thereto. The resulted is kept at 25° C. overnight and then treated with a proteinase K at 37° C. for 10 minutes to perform transformation, so that the attR2 and attL2 sequences are recombined to generate a fusion plasmid. The attL1 sequence is recombined with the attR1 sequence, and the fusion plasmid is decomposed into two new plasmids, obtaining a final expression vector of destination vector having the target gene. The target product is transformed into Escherichia coli Stbl3, and positive clone plasmids are identified and sequencing validation is performed.

Example 2: Preparation of MEGL Overexpression Virus (Using Lentivirus as an Example)

[0042] 1) Virus packaging: The day before transfection, 293T cells are seeded in a culture dish. The number of seeded cells should be as such to allow cells growth to reach 90%-95% confluency on the day of transfection. On the day of transfection, culture medium is removed from 293T cells, and 10 mL (10 cm culture dish) of a culture medium for virus packaging is added thereto. Calcium phosphate-DNA precipitation is prepared as follows: A) Calcium-DNA mixture: CaCl.sub.2) is added into a 5 mL sterile EP tube, then an auxiliary plasmid and target gene plasmid are added thereto and mixed well. B) The centrifuge tube containing the calcium-DNA mixture is placed on a vortex oscillator to vortex the liquid, and then 2×HBS is added dropwise. After the dropping is completed, vortex for a few seconds and let stand for 5 minutes. The calcium phosphate-DNA suspension is poured into the culture medium of the above cells and mixed well gently, and placed in a 37° C., 5% CO2 saturated humidity incubator for culturing; After 4-6 hours of transfection, the culture medium is removed, and 10 mL of a culture medium for virus packaging is added. Then culture is continued in a 37° C., 5% CO2 saturated humidity incubator.

[0043] 2) Collecting and concentrating virus: 48 h after transfection, the culture medium containing virus is collected into a 50 mL centrifuge tube; The virus supernatant was centrifuged at low speed to remove cell fragments. The resulted supernatant is collected and filtered with a 0.45 μM small filter, and the filtrate is collected. PEG6000 and NaCl solution are added thereto in an amount corresponding to the volume of filtrate and mixed well, placed at 4° C. overnight for precipitation, and centrifuged the next day at 4° C., 1500×g for 30 minutes. The supernatant is removed; The virus precipitate is dissolved with HBSS, and fully pipetted up and down to prepare a single virus suspension which is then sub packaged into cryogenic vials.

[0044] 3) Identifying virus titer via Real time PCR: The day before the virus infection, 293T are seeded in a 6-well plate, five plates for each well, and 5×10.sup.5 cells/well; After 24 hours of the seeding, cells from two wells are counted with a hemocytometer to determine the actual number of cells at the time of infection, which is recorded as N. The medium in other culture plates are discarded and replaced with fresh culture medium to a final concentration of 5 μg/mL polybrene. The concentrated virus is diluted 200 times with medium, that is, 1 μL virus is added to 199 μL medium. 0.5 μL, 5 μL and 5 μL diluted virus are added to three culture wells, respectively; 20 hours after infection, culture supernatant is removed and replaced with 500 μL fresh culture medium having DNaseI. Digest at 37° C. for 15 minutes to remove the residual plasmid DNA. The cells are then cultured in 2 mL normal medium for 48 hours, digested with 0.5 mL 0.25% trypsin-EDTA solution, and collected by centrifugation. Extract genomic DNA according to the instructions of DNeasy kit and conduct real time fluorescent PCR amplification. Titer (integration units per mL, IU/mL) is calculated according to formula as follows:

IU/mL=(C×N×D×1000)/V

wherein: C=average copy number of virus integrated per genome; N=number of cells at the time of infection (approximately 1×10.sup.6) D=dilution ratio of viral vector; V=volume of diluted virus added.

Example 3: The Anti-Tumor Effect of MEGL Overexpressing Virus

[0045] 1. Glioma cells U87 and snb19 in logarithmic growth phase are inoculated into a 6-well plate. When the cells are grown to a density of about 30%-50%, a control no-load viral vector (hereinafter defined as Group V) and MEGL overexpression lentivirus (hereinafter defined as Group M) are added according to MOI=10, and Polyprene was added as an aid to a final concentration of 5 μg/mL. After 24 h, replace with normal medium and continue culture for 48 h. Screen with Puromycin having a final concentration of 2 μg/mL. Fluorescence intensity and proportion of cells are observed under a fluorescence microscope every 24 hours. The screen is successful when the number of red fluorescence cells exceeds 95%. Cell screening results are shown in FIG. 2.

[0046] 2. Real time PCR and Western Blot for identifying the expression of methioninase in cells infected with MEGL virus.

[0047] Total RNA is extracted from well-grown cells after virus infection using Trizol method. 1 μg of the total RNA template is reverse transcribed into cDNA in vitro. With cDNA as template, amplification is completed after 30 cycles of pre-denaturation (94° C., 2 min), denaturation (94° C., 30 s), annealing (55° C., 30 s), elongation (72° C., 1 min), and a final elongation (72° C., 10 min). The amplification products are analyzed by agarose gel electrophoresis, and images are captured using the gel imaging system.

[0048] Wherein, the MEGL primer sequence is as follows:

TABLE-US-00002 MEGL-F: CACTTCTACAGCCGCATCTCCAAC MEGL-R: GACCACCACAAGCACATCACTCC

[0049] The results are shown in FIG. 3A. The PCR results show that specific MEGL target gene segment (387 bp) is detected at 300-400 bp in group M, which indicates that the glioma is successfully infected by MEGL overexpression virus. 200 μL RIPA lysis and 2 μL PMSF are added to well-grown cells after virus infection. Cells are scraped off with a clean cell scraper and transferred into a new 1.5 ml EP tube. The cells are lysed on ice for 10 min, broken up by sonication for 3 s with 3 s interval for a total of 30 s, and then centrifuged at 12000 rpm at 4° C. for 15 min. The supernatant is collected into another clean EP tube, and stored at −20° C. The total protein concentration is detected by BCA method. MEGL is detected by Western Blot, using Tubulin as an internal control. As shown in FIG. 3B, specific bands are detected in group M at about 43 KD (* represents methioninase protein band), further indicating successful infection with MEGL overexpression virus.

3. Identifying the Methioninase Activity of Cells Infected with MEGL Overexpression Virus. Intracellular Methionine Levels in Malignant Tumor Cells Infected by MEGL Overexpression Virus are Determined with Liquid Chromatography Mass Spectrometry (LC-MS).

[0050] Virus infected glioma cells U87-V, U87-M, snb19-V and snb19-M in the logarithmic growth phase are prepared into single-cell suspensions respectively at a concentration of 1.5×10.sup.6/ml. 1 ml single-cell suspension is cultured in a 150 mm culture dish for 3 days and digested with trypsin. The treated cells are harvested and washed twice with pre-cooling PBS. 2 mL of pre-cooling 60% methanol aqueous solution is added to carry out extraction. Cells are broken up by sonication 5 times for 3 s, with 3 s interval between each sonication, operated on an ice bath. Centrifugation is carried out, the supernatant is collected into a sample vial, and the precipitate is extracted with 1 ml of 60% methanol. The supernatants are combined, freeze-dried, and left overnight. The resulted is re-dissolved in 300 ul pre-cooling 60% methanol aqueous solution, vortex sonicated, filtered with a 0.22 μm membrane, and detected. The results are shown in FIG. 4: In snb19 cells, the intracellular methionine level in group M is decreased 19.9 times compared with group V. However, in U87 cells, the group M is decreased 3.15 times compared with the group V. These results indicate that MEGL overexpression virus has successfully infected the cells and reduced the intracellular methionine content.

4. Detection of Effects of MEGL Overexpression Virus on the Proliferation Inhibition of Glioma Cells by CCK8 Method

[0051] Single-cell suspensions are prepared with virus infected glioma cells U87-V, U87-M, snb19-V and snb19-M in the logarithmic growth phase, and seeded in a 96-well plate, with 100 μL cell suspension (containing 1.5×10.sup.3 cells) per well, 5 duplicates for each group; The proliferation of cells is detected on the 1st, 3rd, 4th, 5th and 7th days respectively as follows: 10 ul CCK-8 solution is added to each well without generating bubbles; The cells are incubated in an incubator at 37° C. with 5% CO2 for 1 h, then the culture plate is taken out, and the absorbance of the cells at 450 nm is measured with a microplate reader. Results shown in FIG. 5 indicate MEGL overexpression virus has significantly inhibited the proliferation of glioma cells.

5. Real Time PCR Detection of Decrease in EZH2 Gene Expression in Tumor Cells by MEGL Overexpression Virus

[0052] Total RNA is extracted from well-grown cells after virus infection by using Trizol method. 1 μg RNA template is reverse transcribed into cDNA in vitro. Using cDNA as template, real time PCR is carried out at following reaction condition: 50° C. for 2 min; 95° C. for 10 min; 95° C. for 15 sec, 60° C. for 1 min; 72° C. for 1 min (40 cycles in total), and finally a product dissolution curve is measured, and calculation is carried out using 2 AAct method. Results shown in FIG. 6A show MEGL overexpression virus has reduced the expression of EZH2 gene in cells. As shown in FIG. 6B, Western Blot results further confirms that MEGL overexpression virus has reduced the expression of EZH2 protein in cells.

[0053] The above in vitro experiments further show that the virus mediated methioninase system in present invention can inhibit the proliferation of tumors by inhibiting EZH2, and has good anti-tumor effects.