ENGINEERED IMMUNE CELL FOR ALLOTRANSPLANTATION

Abstract

Provided is an engineered immune cell. The expressions of at least one MHC related gene and at least one NK activating receptor binding molecule are suppressed or silenced, so as to suppress the killing of the engineered immune cell by NK cells. Also provided are a pharmaceutical composition comprising the engineered immune cell and use of the engineered immune cell in preparation of drugs for treatment of cancer, infection, or autoimmune diseases.

Claims

1. An engineered immune cell, wherein expression of at least one MHC related gene and at least one NK activating receptor binding molecule is suppressed or silenced, so as to suppress killing of the engineered immune cell by NK cells.

2. The engineered immune cell according to claim 1, wherein the MHC related gene is selected from the group consisting of HLA-A, HLA-B, HLA-C, B2M, HLA-DPA, HLA-DQ, HLA-DRA, TAP1, TAP2, LMP2, LMP7, RFX5, RFXAP, RFXANK, CIITA and a combination thereof.

3. The engineered immune cell according to claim 2, wherein the MHC related gene is selected from the group consisting of HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA and a combination thereof.

4. The engineered immune cell according to claim 1, wherein the NK activating receptor binding molecule binds to an NK activating receptor selected from the group consisting of NKG2C, NKG2E, NKG2D, NKp30, NKp44, NKp46, NKp80, 2B4, DNAM-1, CD2 and LFA-1.

5. The engineered immune cell according to claim 1, wherein the NK activating receptor binding molecule is selected from the group consisting of MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1, H60, MULT1, B7-H6, BAG6, PfEMP1, HSPGS, AICL, CD112, CD155, CD48, CD58, CD59, ICAM1, ICAM2, ICAM3, STAT1, JAK1, IFNGR2, JAK2 and IFNGR1.

6. The engineered immune cell according to claim 5, wherein the NK activating receptor binding molecule is selected from the group consisting of CD112, CD155, CD48, MICA, MICB, CD58, B7-H6, ICAM1, ICAM2 and ICAM3.

7. The engineered immune cell according to claim 1, wherein the engineered immune cell further comprises suppressed or silenced expression of at least one TCR/CD3 gene selected from the group consisting of TRAC, TRBC, CD3 γ, CD3 δ, CD3 ε, CD3 ζ and a combination thereof.

8. The engineered immune cell according to claim 7, wherein expression of at least one TCR/CD3 gene, at least one MHC related gene, and at least one NK activating receptor binding molecule of the engineered immune cell is suppressed or silenced, wherein the TCR/CD3 gene is selected from the group consisting of TRAC, TRBC, CD3 γ, CD3 δ, CD3 ε, CD3 ζ and a combination thereof, the MHC related gene is selected from the group consisting of HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA and a combination thereof, and the NK activating receptor binding molecule is selected from the group consisting of CD112, CD155, CD48, MICA, MICB, CD58, B7-H6, ICAM1, ICAM2, ICAM3 and a combination thereof.

9. The engineered immune cell according to claim 1, wherein the engineered immune cell further comprises suppressed or silenced expression of one or more genes selected from the following: CD52, GR, dCK, PD1, LAG3, TIM3, CTLA4, PPP2CA, PPP2CB, PTPN6, PTPN22, PDCD1, HAVCR2, BTLA, CD160, TIGIT, CD96, CRTAM, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT, FOXP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2 and GUCY1B3.

10. The engineered immune cell according to claim 1, wherein the engineered cell further expresses an immune recognition receptor, which comprises a ligand binding domain, a transmembrane domain and an intracellular signaling domain.

11. The engineered immune cell according to claim 10, wherein the immune recognition receptor is a chimeric antigen receptor or a T cell receptor.

12. The engineered immune cell according to claim 11, wherein the immune recognition receptor is a chimeric antigen receptor, which comprises a ligand binding domain, a transmembrane domain, a costimulatory domain and an intracellular signaling domain.

13. The engineered immune cell according to claim 10, wherein the immune recognition receptor binds to a target selected from the group consisting of TSHR, CD19, CD123, CD22, BAFF-R, CD30, CD171, CS-1, CLL-1, CD33, EGFRvIII, GD2, GD3, BCMA, GPRC5D, Tn Ag, PSMA, ROR1, FLT3, FAP, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, mesothelin, IL-1 1Ra, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-0, SSEA-4, CD20, AFP, Folate receptor α, ERBB2 (Her2/neu), MUC1, EGFR, CS1, CD138, NCAM, Claudin18.2, Prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gp100, bcr-ab1, tyrosinase, EphA2, Fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, Folate receptor R, TEM1/CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD 179a, ALK, polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-1a, MAGE-A1, legumain, HPV E6/E7, MAGE A1, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostate specific protein, survivin and telomerase, PCTA-1/Galectin 8, MelanA/MART1, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2ETS fusion gene), NA17, PAX3, androgen receptor, Cyclin B1, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES 1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal tract carboxylesterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, PD1, PDL1, PDL2, TGFβ, APRIL, NKG2D and any combination thereof.

14. The engineered immune cell according to claim 1, wherein the immune cell is selected from the group consisting of a T cell, a macrophage, a dendritic cell, a monocyte, an NK cell or an NKT cell.

15. The engineered immune cell according to claim 1, wherein the immune cell is a T cell selected from the group consisting of CD4+/CD8+ T cell, CD4+ helper T cell, CD8+ T cell, tumor infiltrating cell, memory T cell, naive T cell, γδ-T cell, or αβ-T cell.

16. The engineered immune cell according to claim 1, wherein the immune cell is derived from adult stem cells, embryonic stem cells, umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells, totipotent stem cells or hematopoietic stem cells.

17. A pharmaceutical composition, comprising the engineered immune cell according to claim 1 and one or more pharmaceutically acceptable excipients.

18. (canceled)

19. A method of treating a cancer, infection or autoimmune disease in a subject, comprising administering a therapeutically effective amount of the engineered immune cell according to claim 1 to the subject.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0088] FIG. 1. Expression levels of NK activating receptor binding molecules on surface of T cells.

[0089] FIG. 2. Suppression effect of DKO-T cells of the present disclosure on killing effect of NK cells.

[0090] FIG. 3. Suppression effect of QKO-T cells of the present disclosure on the killing effect of NK cells.

[0091] FIG. 4. scFv expression levels of CAR-dKO and CAR-sKO T cells of the present disclosure.

[0092] FIG. 5. Killing effects of CAR-dKO and CAR-sKO T cells of the present disclosure on target cells.

[0093] FIG. 6: Cytokine release levels of CAR-dKO and CAR-sKO T cells of the present disclosure after co-culture with target cells.

DETAILED DESCRIPTION OF EMBODIMENTS

[0094] T cells used in all the examples of the present disclosure are primary human CD4+CD8+ T cells isolated from healthy donors by Ficoll-Paque™ PREMIUM (GE Healthcare, Lot No. 17-5442-02) using leukapheresis.

Example 1. Expression Levels of NK Activating Receptor Binding Molecules

[0095] T cells were activated with DynaBeads CD3/CD28 CTS™ (Gibco, Lot No. 40203D), and cultured at 37° C. and 5% CO.sub.2. T cells were collected at different culture time points, and expression levels of various NK activating receptor binding molecules were detected by flow cytometry, with results being shown in FIG. 1.

[0096] As can be seen from FIG. 1, the NK activating receptor binding molecules MICA/B, CD48, CD112, CD155, ICAM1, ICAM2, ICAM3, B7-H6 and CD58 show constitutive or inducible expression on T cells.

Example 2. Construction of DKO-T Cells with MHC Related Gene and NK Activating Receptor Binding Molecule Therein being Knocked Out

[0097] T cells were activated with DynaBeads CD3/CD28 CTS™ (Gibco, Lot No. 40203D), and continuously cultured for 3 days at 37° C. and 5% CO.sub.2. Then 10 μg of Cas9 protein, 5 μg of B2M sgRNA, and 5 μg of sgRNA targeting NK activating receptor binding molecule were electrically transfected into activated T cells at 400 V and 0.7 ms using a BTX Agile Pulse Max electroporator (Harvard Apparatus BTX) to obtain DKO-T cells with B2M and NK activating receptor binding molecules therein being both knocked out. T cells with only B2M being knocked out (KO-T) and wild-type T cells without knockout (NT) served as controls. The sgRNA sequences used in the present disclosure are shown in Table 1.

[0098] After DKO-T, B2M-KO-T and NT cells were cultured at 37° C. and 5% CO.sub.2 for 11 days, gene knockout efficiencies of B2M and various NK activating receptor binding molecules were examined by flow cytometry using corresponding antibodies (see Table 2), whose results are shown in Table 3.

TABLE-US-00001 TABLE 1 sgRNA Sequences Used in the Present Disclosure SEQ ID Gene name NO Sequence TRAC 1 agagucucucagcugguaca B2m 2 ggguagegcgagcacagcua RFX5 3 gggguugeggauccaccuau CD155 4 ggaaaggugaggaacucccu MICA/B 5 ggcugcccacugucccug CD48 6 ggacuugguacauaugaccg CD58 7 gggcauuacaacagccaucg B7H6 8 ggggcaugccguaccacacac ICAM1 9 gguaccucuauaaccgccag ICAM2 10 gguggucaucauagucacgg ICAM3 11 ggugagggugagcuaacacg

[0099] Note: in view of high homology of MICA and MICB genes, two MICA and MICB genes both can be simultaneously knocked out by the sgRNA designed in the present example.

TABLE-US-00002 TABLE 2 Information on Antibodies Used in Flow Cytometry Detection Antibody name Manufacturer Lot No. PE anti-human CD112 Antibody biolegend 337409 APC anti-human CD155 Antibody biolegend 337618 PE anti-human MICA/MICB Antibody biolegend 320906 PE anti-human CD48 Antibody biolegend 336708 PE anti-human CD58 Antibody sino 12409- biological MM05-P Alexa FlourR 647 anti-human B7-H6 BD 566733 APC anti-human CD54(ICAM-1)Antibody biolegend 353111 PE anti-human CD102(ICAM-2)Antibody biolegend 328505 APC anti-human CD50(ICAM-3)Antibody biolegend 330011

TABLE-US-00003 TABLE 3 Gene Knockout Efficiencies in DKO-T cells Gene Expression level Cell name knocked out NT after knockout B2M KO B2M 99.90% 13.10% B2M/MICAB B2M 99.90% 14.40% DKO MICA/B 69.6 22.5% B2M/CD48 B2M 99.90% 17.10% DKO CD48 99.20% 16.4% B2M/CD155 B2M 99.90% 14.80% DKO CD155   84% 37.8% B2M/CD58 B2M 99.90% 17.60% DKO CD58 99.60% 18.20% B2M/ICAM1 B2M 99.90% 17.60% DKO ICAM1 76.00% 8.20% B2M/ICAM2 B2M 99.90% 12.50% DKO ICAM2 99.00% 23.90% B2M/ICAM3 B2M 99.90% 14.10% DKO ICAM3 99.40% 19.60% B2M/B7H6 B2M 99.90% 19.90% DKO B7H6 46.60% 12.3%

Example 3. Suppression Effect of DKO-T Cells of the Present Disclosure on Killing Effect of NK Cells

[0100] The suppression effect of DKO-T cells prepared in the present disclosure on the killing effect of the NK cells was detected according to the following method: KO-T cells and DKO-T cells prepared in the present disclosure were labeled with Far-Red (invitrogen, Lot No. C34564). The labeled DKO-T cells and KO-T cells were then plated into a 96-well plate at a concentration of 1×10.sup.4 cells per well, and were co-cultured with addition of NK92 cells at an effector-target ratio of 2:1. After 16-18 hours, the ratio of T cells in the culture was detected by a flow cytometer, and the killing rate of the NK cells was calculated, with results being shown in FIG. 2.

[0101] It can be seen that in the case of knocking out only HLA (e.g., B2M), the killing rate of NK cells against T cells reaches 80%. Compared with this, further knocking out the NK activating receptor binding molecule (i.e., DKO-T cells of the present disclosure) can significantly suppress such killing effect.

Example 4. Construction of QKO-T Cells with TCR, MHC Related Gene and NK Activating Receptor Binding Molecule Therein being Knocked Out

[0102] T cells were activated with DynaBeads CD3/CD28 CTS™ (Gibco, Lot No. 40203D), and continuously cultured for 3 days at 37° C. and 5% C02. Then 10 μg of Cas9 protein, 2.5 μg of B2M sgRNA, 2.5 μg of TRAC sgRNA, 2.5 μg of RFX5 sgRNA, and 2.5 μg of CD155 sgRNA were electrically transfected into activated T cells at 400 V and 0.7 ms using a BTX Agile Pulse Max electroporator (Harvard Apparatus BTX) to obtain QKO-T cells with B2M, TCR, RFX5 and CD155 therein being knocked out. KO-T cells with only B2M therein being knocked out and DKO-T cells with B2M/CD155 therein being both knockout were obtained by the same method. Gene knockout efficiencies in these cells were detected by flow cytometry, with results being as shown in Table 4.

TABLE-US-00004 TABLE 4 Gene knockout efficiencies in QKO-T cells CD155 CD3 HLA-I HLA-II expression expression expression expression Cell name level level level level QKO-T 37.50% 5.60% 14.30% 20.60% DKO-T 33.20% 98.00% 12.7.00% 73.00% KO-T 88.00% 98.00% 12.00% 73.00% NT 89.00% 98.60% 99.00% 75.30%

[0103] It can be seen that corresponding genes in the QKO-T cells and the KO-T cells prepared in the present disclosure are effectively knocked out. Then, the suppression effect of the KO-T cells and the QKO-T cells prepared in the above on the killing effect of the NK cells was detected according to the method described in Example 3, with results being shown in FIG. 3.

[0104] It can be seen that the QKO-T cells with the NK activating receptor binding molecule, the TCR gene and multiple MHC related genes being simultaneously knocked out likewise can significantly suppress the killing effect of the NK cells.

Example 5. Construction of CAR-dKO T Cells and Verification of Functions Thereof

5.1 Construction of CAR-sKO T Cells and CAR-dKO T Cells

[0105] Sequences encoding the following proteins were synthesized, and cloned into the pLVX vector (Public Protein/Plasmid Library (PPL), Lot No.: PPL00157-4a): CD8a signal peptide (SEQ ID NO: 12), anti-CD19scFv (SEQ ID NO: 13), CD8a hinge region (SEQ ID NO: 14), CD8a transmembrane region (SEQ ID NO: 15), 4-1BB intracellular region (SEQ ID NO: 16), CD3ζ intracellular signaling domain (SEQ ID NO: 17), and correct insertion of target sequence was confirmed by sequencing.

[0106] After 3 ml of Opti-MEM (Gibco, Lot No. 31985-070) was added to a sterile tube to dilute the above plasmids, packaging vector psPAX2 (Addgene, Lot No. 12260) and envelope vector pMD2.G (Addgene, Lot No. 12259) were then added according to a ratio of plasmid:virus packaging vector:virus envelope vector=4:2:1. Then, 120 μl of X-treme GENE HP DNA transfection reagent (Roche, Lot No. 06366236001) was added, the mixture was well mixed immediately, and incubated at room temperature for 15 min, and then the plasmid/vector/transfection reagent mixture was added dropwise into a culture flask of 293T cells. Viruses were collected at 24 and 48 hours and combined, and then subjected to ultracentrifugation (25000 g, 4° C., 2.5 hours) to obtain concentrated lentiviruses.

[0107] Concentrated lentiviruses were transducted into sKO-T cells (only B2M being knocked out) and dKO-T cells (B2M/ICAM3 both being knocked out), to obtain CAR-sKO T cells and CAR-dKO T cells, respectively. Unmodified wild-type T cells served as negative control (NT).

[0108] After 11 days of culture at 37° C. and 5% CO.sub.2, expression levels of scFv on the CAR T cells were detected by flow cytometry using Biotin-SP (long spacer) AffiniPure Goat Anti-Mouse IgG, F(ab′)2 Fragment Specific (min X Hu, Bov, Hrs Sr Prot) (jackson immunoresearch, Lot No. 115-065-072) as a primary antibody and APC Streptavidin (BD Pharmingen, Lot No. 554067) or PE Streptavidin (BD Pharmingen, Lot No. 554061) as a secondary antibody, with results being shown in FIG. 4.

[0109] It can be seen that scFvs in the CAR T cells prepared in the present disclosure all can be effectively expressed.

5.2 Detecting Killing Effect of CAR-T Cells on Target Cells

[0110] Nalm6 target cells carrying a fluorescein gene were first plated into a 96-well plate at a concentration of 1×10.sup.4 cells per well, then NT cells, CAR-sKO T cells and CAR-dKO T cells were plated into the 96-well plate at an effector-target ratio of 2:1 (i.e., a ratio of effector T cells to target cells) for co-culture, and the fluorescence value was measured with a plate reader 16-18 hours later. According to calculation formula: (mean value of fluorescence of target cell−mean value of fluorescence of sample)/mean value of fluorescence of target cell×100%, the killing efficiency was calculated, with results being shown in FIG. 5.

[0111] It can be seen that the CAR-sKO T cells and the CAR-dKO T cells both have specific killing effects on the target cells, and further knocking out the NK activating receptor ICAM3 does not adversely affect the killing effect of the CAR-T cells.

5.3 Detecting the Cytokine Release Level of the CAR-T Cells

[0112] Target cells Nalm6 were plated in a 96-well plate at a concentration 1×10.sup.5 cells/well, then the NT cells, the CAR-sKO T cells and the CAR-dKO T cells of the present disclosure and the target cells were co-cultured at a ratio of 1:1. After 18-24 hours, cell co-culture supernatant was collected.

[0113] The 96-well plate was coated with capture antibody Purified anti-human IL2 Antibody (Biolegend, Lot No. 500302) or Purified anti-human IFN-γ Antibody (Biolegend, Lot No. 506502) and incubated overnight at 4° C., then the antibody solution was removed, 250 μL of PBST (IXPBS containing 0.1% Tween) solution containing 2% BSA (sigma, Lot No. V9009333-1 kg) was added, followed by incubation at 37° C. for 2 hours. The plate was then washed 3 times with 250 μL of PBST (1×PBS containing 0.1% Tween). 50 μL of the cell co-culture supernatant or a standard was added to each well, followed by incubation at 37° C. for 1 hour, then the plate was washed 3 times with 250 μL of PBST (1×PBS containing 0.1% Tween). Then 50 μL of detection antibody Anti-Interferon gamma antibody [MD-1] (Biotin) (abcam, Lot No. ab25017) was added to each well, and after 1 hour of incubation at 37° C., the plate was washed 3 times with 250 μL of PBST (1×PBS containing 0.1% Tween). HRP Streptavidin (Biolegend, Lot No. 405210) was then added, and after 30 minutes of incubation at 37° C., the supernatant was discarded, 250 μL of PBST (1×PBS containing 0.1% Tween) was added, and the plate was washed 5 times. 50 μL of TMB substrate solution was added to each well. The reaction was carried out in the dark at room temperature for 30 minutes, after which 50 μL of 1 mol/L H.sub.2SO.sub.4 was added to each well to quench the reaction. Within 30 minutes after quenching the reaction, absorbance at 450 nm was detected by a plate reader, and the content of cytokines was calculated according to a standard curve (plotted according to the measured value and concentration of the standard), with results being shown in FIG. 6.

[0114] It can be seen that both the CAR-sKO T cells and the CAR-dKO T cells can significantly improve the cytokine release level of the CAR T cells on the target cells, and further knocking out the NK activating receptor ICAM3 does not adversely affect the cytokine release level of the CAR-T cells.

[0115] It should be noted that the above-mentioned are merely for preferred examples of the present disclosure and not used to limit the present disclosure. For a person skilled in the art, various modifications and changes could be made to the present disclosure. A person skilled in the art should understand that any amendments, equivalent replacements, improvements, and so on, within the spirit and principle of the present disclosure, should be covered within the scope of protection of the present disclosure.