TREATMENT OF CANCER USING RECALL ANTIGENS DELIVERED BY ATTENUATED BACTERIA

Abstract

Methods, pharmaceutical compositions and vaccines comprising an attenuated bacteria that expresses a recall antigen are disclosed for treatment of cancer.

Claims

1. A method of treating a tumor in a subject, and/or reducing or preventing metastasis of a tumor in a subject, comprising administering to the subject an attenuated bacteria that expresses a recall antigen in an amount effective to treat the tumor, and/or to reduce or prevent metastasis of the tumor.

2. The method of claim 1, wherein the bacteria is one or more of Listeria monocytogenes, Salmonella thyphimurium, Vibrio cholera, Clostridium, and Bifidobacterium breve.

3. The method of claim 1, wherein the bacteria is Listeria monocytogenes.

4. The method of claim 1, wherein the recall antigen is an epitope of one or more of tetanus toxoid, measle virus, and polio virus.

5. The method of claim 1, wherein the recall antigen is an epitope of tetanus toxoid.

6. The method of claim 1, wherein the tumor is a tumor of one or more of the pancreas, ovary, uterus, neck, head, breast, prostate, liver, lung, kidney, neurones, glia, colon, testicle, or bladder.

7. The method of claim 1, wherein the tumor is an inoperable tumor.

8. The method of claim 1, wherein prior to administration to the subject, the bacteria are cultured in yeast medium.

9. The method of claim 1, which further comprises administering CpG to the subject.

10. The method of claim 1, wherein prior to administration of bacteria to the subject, the subject is screened for their major histocompatibility complex (WIC) 1 haplotype and administered an antigen for which the subject shows a CD8 T cell recall response.

11. The method of claim 1, wherein prior to administration of bacteria to the subject, an epitope of the antigen is administered to the subject to generate memory T cells to the antigen.

12. The method of claim 1, wherein bacteria are administered systemically to the subject.

13. The method of claim 1, wherein bacteria are administered by direct injection to a tumor site in the subject.

14. The method of claim 1, wherein bacteria are administered in myeloid-derived suppressor cells (MDSCs).

15. The method of claim 1, further comprising administering to the subject a chemotherapeutic agent that reduces the number of myeloid-derived suppressor cells (MDSCs).

16. The method of claim 15, wherein the chemotherapeutic agent is gemcitabine.

17. The method of claim 1, wherein the subject is a human.

18. The method of claim 1, wherein the subject is a mammal.

19. The method of claim 1, wherein the method is effective to reduce tumor growth and/or size.

20. The method of claim 1, wherein the method is effective to reduce metastases.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0008] FIG. 1. Schematic view of the Listeria-recall antigen model.

[0009] FIG. 2A. Development of the Listeria.sup.at-TT.sub.856-1313 vaccine. A non-toxic fragment of the C-terminus of tetanus toxoid (TT) cDNA (amino acid positions 856-1313) was cloned as a fusion protein with a truncated non-cytolytic ListeriolysinO (LLO) in the Listeria.sup.at plasmid pGG34, under the control of the LLO promoter (P)(A). A myc tag has been included for the detection of TT protein.

[0010] FIG. 2B Development of the Listeria.sup.at-TT.sub.856-1313 vaccine and testing TT expression of infected 4T1 tumor cells. Secretion of LLO-TT.sub.856-1313 protein by LM-LLO-TT (Listeria.sup.at-TT) was confirmed by western blotting using anti-myc antibodies. Lane 1: neg control (medium); Lane 2: supernatant of Listeria.sup.at-TT culture; Lane 3: pellet of Listeria.sup.at-TT culture.

[0011] FIG. 2C. Development of the Listeria.sup.at-TT.sub.856-1313 vaccine and testing TT expression of infected 4T1 tumor cells. Infection with Listeria.sup.at-TT resulted in the expression of TT antigens in the 4T1 tumor cells as shown here with anti-myc antibodies. Lane 1: 4T1 tumor cells; Lane 2: 4T1 tumor cells infected with Listeria.sup.at; Lane 3: 4T1 tumor cells infected with Listeria.sup.at-TT.

[0012] FIG. 3. Generation of CD8 T cell responses to immunodominant epitope within TT.sub.856-1313 protein. BALB/cByJ mice received three immunizations with 5 μg of purified TT.sub.856-1313 protein and 10 μg of CpG at 1-week time intervals, and white blood cells of treated and control mice were re-stimulated with the immunodominant CD8 TT peptide (GYNAPGIPL) (SEQ ID NO:1) for 72 h, and then they were analyzed by flow cytometry. Representative of 2 experiments. n=5 mice per group.

[0013] FIG. 4. Listeria.sup.at-TT.sub.856-1313 is highly effective against metastases in breast cancer model 4T1. BALB/cByJ mice were immunized with TT.sub.856-1313 protein and CpG as described for FIG. 3. One week later, 4T1 tumor cells (0.5×10.sup.5) were injected into the mammary fat pad and immunizations with Listeria.sup.at-TT were administered (every other day) after the tumor had reached 5 mm in diameter. This was continued for two weeks. Two days after the last immunization, all mice were euthanized and analyzed for the number of metastases. Average of two experiments with 5 mice per group. Mann-Withney test *p<0.05 is significant.

[0014] FIG. 5. Effect of Listeria-TT and gemcitabine (Gem) on metastases (left panel) and tumors (right panel) in a preclinical model pancreatic cancer (Panc-02). C57B16 mice were injected with 2×10.sup.6 Panc-02 tumor cells in the mammary fat pad. Three days after tumor cell injection mice were treated with gemcitabine ip (1.2 mg/300 μl) every 3 days (6 treatments in total) throughout the whole study. 10.sup.7 CFU of Listeria-TT was injected every day ip, for 4 days, followed by a rest period of 3 days followed by 3 more injections with 10.sup.7 CFU of Listeria-TT every day. All mice were euthanized on day 21 and analyzed for the number of metastases and tumor weight. N=3 mice per group.

[0015] FIG. 6A-6B. GEM and Listeria-TT strongly eliminates advanced pancreatic cancer in Panc-02 and KPC mice. (A) Panc-02 model. C57Bl/6 mice were immunized 3 times with the human TT vaccine using 1-week time intervals starting day 0 to generate the memory T cells to TT. Subsequently, Panc-02 tumor cells (10.sup.5/100 μl) were injected in mammary fat pad (day 21). When tumors were 10 mm (day 31), one high dose of Listeria-TT (10.sup.7 CFU) was injected ip, followed (day 36) by daily low doses of Listeria-TT (10.sup.4 CFU) for 2 weeks (14 doses in total). GEM (1.2 mg/mouse) was administered every three days (5 doses in total) starting on day 34. All mice were euthanized on day 52, and analyzed for the number of metastases (untreated mice have metastases predominantly in the liver and pancreas, and less in mesenchemal lymph nodes and diaphragm). n=5 mice per group. Average of two experiments. Mann-Whitney *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. The error bars represent SEM. (B) KPC model. KPC mice of 3.5 months old received the same treatments as the Panc-02 mice. Mice were euthanized when 4.5 months old.

[0016] FIG. 7A-7B. (A) GEM reduces the MDSC population in blood of Panc-02 mice. C57B16 mice were challenged with Panc-02 tumor cells and treated with Listeria-TT+GEM as described in FIG. 7A. Two days after the last treatment the percentage of MDSC (CD11b+Gr1+) was determined in blood by flow cytometry. N=5 mice per group. Representative of two experiments. (B) GEM reduces the TAM population in metastases of Panc-02 mice. C57B16 mice were challenged with Panc-02 tumor cells and treated with Listeria-TT+GEM as described in FIG. 7A. Two days after the last treatment the percentage of TAM (CD11b+F4/80+) was determined in the primary tumors by flow cytometry. N=5 mice per group. Representative of two experiments. The error bars represent SEM.

[0017] FIG. 8. Synergistic effects of Listeria-TT and GEM on pancreatic cancer. Listeria delivers TT into tumor cells through infection, resulting in highly immunogenic tumor cells, and reactivates memory T cells to TT through infection of DC (not shown). Simultaneously, Listeria induces high levels of ROS in tumor cells and macrophages, which improves GEM sensitivity through reduction of CDA. GEM reduces the MDSC and TAM population, resulting in improved T cell responses. These synergistic effects will lead to tumor cell kill by TT-specific T cells, GEM, and by Listeria-induced ROS.

[0018] FIG. 9. Listeria reduces CDA. Hela cells (human cervical cancer cell line) or PANC-1 (human pancreatic cancer cell line) were cultured for 2 hrs with various numbers of CFU of Listeria (LM) (10.sup.8, 10.sup.6, and 10.sup.4 CFU/ml), and then cultured overnight with Gentamicin to kill all extracellular bacteria. CDA expression was analyzed by western blotting using rabbit anti-human CDA antibodies.

[0019] FIG. 10. Schematic view of immunization protocol of Listeria-recall antigen and Gemcitabine in mice.

DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention provides a method of treating a tumor in a subject, and/or reducing the incidence or likelihood of metastasis of a tumor in a subject, comprising administering to the subject an attenuated bacteria that expresses a recall antigen in an amount effective to treat the tumor, and/or to reduce the incidence or likelihood of metastasis of the tumor.

[0021] The bacteria can be, for example, one or more of Listeria monocytogenes, Salmonella thyphimurium, Vibrio cholera, Clostridium, and Bifidobacterium breve. In a preferred embodiment, the bacteria are Listeria monocytogenes. The bacteria are attenuated to reduce or eliminate virulence. As used here, attenuated Listeria, for example, is denoted as Listeria.sup.at.

[0022] As used herein, a recall antigen is an antigen to which a subject has previously been exposed earlier in life. Recall antigens can include, for example, antigens used for childhood vaccinations, such as tetanus toxoid, measle virus, and poliovirus antigens. Most individuals have been vaccinated and boosted with these antigens during childhood, resulting in memory T cells that circulate in their blood stream for life. These memory T cells can be reactivated at any age, even in a tumor microenvironment.

[0023] Examples of recall antigens that can be used include, but are not limited to, an epitope or an fragment containing one or more immunodominant epitopes of one or more of tetanus toxoid, measle virus, and polio virus. In a preferred embodiment, the antigen is a tetanus toxoid fragment containing one or more immunodominant epitopes.

[0024] This principle is not only applicable to childhood antigens, but to almost any immunogenic antigen that patients have seen earlier in life. For example, up to 70% of all women acquire a Candida albicans infection earlier or later in life (1), which expresses highly immunogenic proteins including heat-shock protein (Hsp)70(2). On the other hand, flu virus is less suitable because of their continuous antigenic drift. Basically, the number of immunogenic antigens to be used for this approach is unlimited.

[0025] As an example, shown below are the Tetanus toxoid (TT) (aa position 856-1313) amino acid (upper case) (SEQ ID NO:5) and DNA (lower case) (SEQ ID NO:6) sequence cloned into Listeria (see Experimental Details). The underlined and bold portions of the DNA sequence represent primer sequences used for cloning TT into Listeria. The underlined and bold portions of the amino acid sequence represent CD8 epitopes in TT immunodominant in the Panc-02 model (C57B16 mice). The portion of the amino acid sequence in italics and bold font represents the CD8 epitope in TT immunodominant in the 4T1 model (BALB/c mice).

TABLE-US-00001 5′ tcaacaccaattccattttcttattctaaaaatctggattgttgggttgataatgaagaa  S  T  P  I  P  F   S  Y  S  K  N  L  D  C  W  V  D  N  E  E gatatagatgttatattaaaaaagagtacaattttaaatttagatattaataatgatatt  D  I  D  V  I  L  K  K  S  T  I  L  N  L  D  I  N  N  D  I atatcagatatatctgggtttaattcatctgtaataacatatccagatgctcaattggtg  I  S  D  I  S  G  F  N  S  S  V  I  T  Y  P  D  A  Q  L  V cccggaataaatggcaaagcaatacatttagtaaacaatgaatcttctgaagttatagtg  P  G  I  N  G  K  A  I  H  L  V  N  N  E  S  S  E  V  I  V cataaagctatggatattgaatataatgatatgtttaataattttaccgttagcttttgg  H  K  A  M  D  I  E  Y  N  D  M  F  N  N  F  T  V  S  F W ttgagggttcctaaagtatctgctagtcatttagaacaatatggcacaaatgagtattca  L  R  V  P  K  V  S  A  S  H  L  E  Q  Y  G  T  N  E  Y  S ataattagctctatgaaaaaacatagtctatcaataggatctggttggagtgtatcactt  I  I  S  S  M  K  K  H  S  L  S  I  G  S  G  W  S  V  S  L aaaggtaataacttaatatggactttaaaagattccgcgggagaagttagacaaataact  K  G  N  N  L  I  W  T  L  K  D  S  A  G  E  V  R  Q  I  T tttagggatttacctgataaatttaatgcttatttagcaaataaatgggtttttataact  F  R  D  L  P  D  K  F  N  A  Y  L  A  N  K  W  V  F  I  T attactaatgatagattatcttctgctaatttgtatataaatggagtacttatgggaagt  I  T  N  D  R  L  S  S  A  N  L  Y  I  N  G  V  L  M  G  S gcagaaattactggtttaggagctattagagaggataataatataacattaaaactagat  A  E  I  T  G  L  G  A  I  R  E  D  N  N  I  T  L  K  L  D agatgtaataataataatcaatacgtttctattgataaatttaggatattttgcaaagca  R  C  N  N  N  N  Q  Y  V  S  I  D  K  F  R  I  F  C  K  A ttaaatccaaaagagattgaaaaattatacacaagttatttatctataacctttttaaga  L  N  P  K  E  I  E  K  L  Y  T  S  Y  L  S  I  T  F  L  R gacttctggggaaaccctttacgatatgatacagaatattatttaataccagtagcttct  D  F  W  G  N  P  L  R  Y  D  T  E  Y  Y  L  I  P  V  A  S agttctaaagatgttcaattgaaaaatataacagattatatgtatttgacaaatgcgcca  S  S  K  D  V  Q  L  K  N  I  T  D  Y  M  Y  L  T  N  A  P tcgtatactaacggaaaattgaatatatattatagaaggttatataatggactaaaattt  S  Y  T  N  G  K  L  N  I  Y  Y  R  R  L  Y  N  G  L  K  F attataaaaagatatacacctaataatgaaatagattcttttgttaaatcaggtgatttt  I  I  K  R  Y  T  P  N  N  E  I  D  S  F  V  K  S  G  D  F attaaattatatgtatcatataacaataatgagcacattgtaggttatccgaaagatgga  I  K  L  Y  V  S  Y  N  N  N  E  H  I  V  G  Y  P  K  D  G aatgcctttaataatcttgatagaattctaagagtaggttataatgccccaggtatccct  N  A  F  N  N  L  D  R  I  L  R  V  ctttataaaaaaatggaagcagtaaaattgcgtgatttaaaaacctattctgtacaactt     Y  K  K  M  E  A  V  K  L  R  D  L  K  T  Y  S  V  Q  L aaattatatgatgataaaaatgcatctttaggactagtaggtacccataatggtcaaata  K  L  Y  D  D  K  N  A  S  L  G  L  V  G  T  H  N  G  Q  I ggcaacgatccaaatagggatatattaattgcaagcaactggtactttaatcatttaaaa  G  N  D  P  N  R  D  I  L  I  A  S  N  W  Y  F  N  H  L  K gataaaattttaggatgtgattggtactttgtacctacagatgaaggatggaca 3′  D  K  I  L  G  C  D  W  Y  F  V  P  T  D  E  G  W  T.

[0026] Also as an example, shown below are the poliovirus (PV) (aa position: 49-273 in VP1) amino acid (SEQ ID NO:7) and DNA (SEQ ID NO:8) sequence cloned into Listeria. The underlined and bold portions of the DNA sequence represent primer sequences used for cloning PV VP1 into Listeria. The portions of the amino acid sequence in italics and bold font represent CD8 epitopes in PV VP1 immunodominant in the 4T1 model (BALB/c mice/H2-d haplotype).

TABLE-US-00002 5′ aggtcaaggtcagagtctagcatagagtctttcttcgcgcggggtgcatgcgtg        R  S  R  S  E  S  S  I  E  S  F  F  A  R  G  A  C  V accattatgaccgtggataacccagcttccaccacgaataaggataagctatttgcagtg  T  I  M  T  V  D  N  P  A  S  T  T  N  K  D  K  L  F  A  V tggaagatcacttataaagatactgtccagttacggaggaaattggagttcttcacctat  W  K                K  L  E  F  F  T  Y tctagatttgatatggaacttacctttgtggttactgcaaatttcactgagactaacaat  S  R  F  D  M  E  L  T  F  V  V  T  A  N  F  T  E  T  N  N gggcatgccttaaatcaagtgtaccaaattatgtacgtaccaccaggcgctccagtgccc  G  H  A  L  N  Q  V  Y  Q  I  M  Y  V  P  P  G  A  P  V  P gagaaatgggacgactacacatggcaaacctcatcaaatccatcaatcttttacacctac  E  K  W  D  D  Y  T  W  Q  T  S  S  N  P  S  I  F  Y  T  Y ggaacagctccagcccggatctcggtaccgtatgttggtatttcgaacgcctattcacac  G  T  A  P  A  R  I  S  V  P  Y  V  G  I   ttttacgacggtttttccaaagtaccactgaaggaccagtcggcagcactaggtgactcc                   A  A  L  G  D  S ctttatggtgcagcatctctaaatgacttcggtattttggctgttagagtagtcaatgat  L  Y  G  A  A  S  L  N  D  F  G  I  L  A  V  R  V  V  N  D cacaacccgaccaaggtcacctccaaaatcagagtgtatctaaaacccaaacacatcaga  H  N  P  T  K  V  T  S  K  I  R  V  Y  L  K  P  K  H  I  R gtctggtgcccgcgtccaccgagggcagtggcgtactacggccctggagtggattacaag  V  W  C  P  R  P  P  R  A  V  A  Y  Y  G  P  G  V  D  Y  K gatggtacgcttacaccc 3′  D  G  T  L  T  P.

[0027] As a further example, shown below are the measlevirus (MV) amino acids (Nucleocapsid aa position: 38-351) amino acid (SEQ ID NO:9) and DNA (SEQ ID NO:10) sequence cloned into Listeria. The underlined and bold portions of the DNA sequence represent primer sequences used for cloning of the MV sequence into Listeria. The portions of the amino acid sequence in italics and bold font represent CD8 epitopes in MV immunodominant in the 4T1 model (AKR mice/H2-k haplotype).

TABLE-US-00003 5′                                           ccaatccctggagat                                               P  I  P  G  D tcctcaattaccactcgatccagacttctggaccggttggtcaggttaattggaaacccg  S  S  I  T  T  R  S  R  L              N  P gatgtgagcgggcccaaactaacaggggcactaataggtatattatccttatttgtggag  D  V  S  G  P  K  L  T  G  A  L  I  G  I  L  S  L  F   tctccaggtcaattgattcagaggatcaccgatgaccctgacgttagcataaggctgtta          Q  R  I  T  D  D  P  D  V  S  I  R  L  L gaggttgtccagagtgaccagtcacaatctggccttaccttcgcatcaagaggtaccaac  E  V  V  Q  S  D  Q  S  Q  S  G  L  T  F  A  S  R  G  T  N atggaggatgaggcgaaccaatacttttcacatgatgatccaattagtagtgatcaatcc  M  E  D  E  A  N  Q  Y  F  S  H  D  D  P  I  S  S  D  Q  S aggttcggatggttcgagaacaaggaaatctcagatattgaagtgcaagaccctgaggga  R  F  G  W  F  E  N  K  E  I  S  D  I  E  V  Q  D  P  E  G ttcaacatgattctgggtaccatcctagcccaaatttgggccttgctcgcaaaggcggtt  F  N  M  I  L  G  T  I  L  A  Q  I  W  A  L  L  A  K  A  V acggccccagacacggcagctgattcggagctaaga 3′  T  A  P  D  T  A  A  D  S  E  L  R.

[0028] The tumor can be, for example, a tumor of one or more of the pancreas, ovary, uterus, neck, head, breast, prostate, liver, lung, kidney, neurones, glia, colon, testicle, or bladder. The tumor can be an inoperable tumor.

[0029] Preferably, prior to administration to the subject, the bacteria are cultured in yeast medium.

[0030] The method can further comprise administering Cytosine-phosphate-Guanine (CpG) to the subject as an adjuvant.

[0031] In one embodiment, prior to administration of bacteria to the subject, the subject is screened for their major histocompatibility complex (MHC) 1 haplotype and administered an antigen for which the subject shows a CD8 T cell recall response.

[0032] In one embodiment, prior to administration of bacteria to the subject, an epitope of the antigen is administered to the subject to generate memory T cells to the antigen. This method will be less effective in older subjects who have fewer naïve T cells than younger subjects.

[0033] Bacteria can be administered by different routes to the subject. For example, bacteria can be administered systemically to the subject, such as for example, by intravenous administration. Bacteria can be administered by direct injection to a tumor site in the subject. Myeloid-derived suppressor cells (MDSCs) can be used to deliver attenuated bacteria to the microenvironment of both primary and metastatic neoplastic lesions, where the attenuated bacteria spread from MDSCs into tumor cells (see, e.g., 10). The infected tumor cells then become a target for activated immune cells.

[0034] Preferably, the subject receives repeated administrations of attenuated bacteria that expresses the recall antigen. For example, the administration may be daily or every other day, for a period of several days until a satisfactory therapeutic outcome is achieved.

[0035] As used herein, “treating” a tumor means that one or more symptoms of the disease, such as the tumor itself, metastasis thereof, vascularization of the tumor, or other parameters by which the disease is characterized, are reduced, ameliorated, placed in a state of remission, or maintained in a state of remission. “Treating” a tumor also means that one or more hallmarks of the tumor may be eliminated or reduced by the treatment. Non-limiting examples of such hallmarks include uncontrolled degradation of the basement membrane and proximal extracellular matrix, migration, division, and organization of the endothelial cells into new functioning capillaries, and the persistence of such functioning capillaries. Preferably, the method is effective to reduce tumor growth and/or size.

[0036] As used herein, reducing or preventing metastasis of a tumor means that any of the symptoms of the disease, such as the metastases, the extent of spread thereof, the vascularization of the metastases or other parameters by which the disease is characterized are reduced, ameliorated, prevented, placed in a state of remission, maintained in a state of remission, or eliminated. Preferably, the method is effective to reduce metastases. The method can reduce the incidence or likelihood of metastasis of a tumor.

[0037] The method can further comprise administering to the subject a chemotherapeutic agent that reduces the number of myeloid-derived suppressor cells (MDSCs). Such chemotherapeutic agents include, for example, gemcitabine, Vitamin A derivates, Amiloride, CpG oligodeoxynucleotide (CpG ODN), Docetaxel, 5-Fluorouracil, GW2580, Sildenafi and Sinitinib (3, 4).

[0038] The subject can be a mammal. In different embodiments, the mammal is a mouse, rat, cat, dog, horse, donkey, mule, sheep, goat, cow, steer, bull, livestock, primate, monkey, or preferably a human. The human can be of different ages, such as for example, a person 60 years of age or older.

[0039] Also provided is a pharmaceutical composition comprising a pharmaceutically acceptable carrier and attenuated bacteria that expresses a recall antigen. The bacteria can be, for example, one or more of Listeria monocytogenes, Salmonella thyphimurium, Vibrio cholera, Clostridium, and Bifidobacterium breve. The recall antigen can be, for example, an epitope of one or more of tetanus toxoid, measle virus, and polio virus.

[0040] Examples of acceptable pharmaceutical carriers include, but are not limited to, additive solution-3 (AS-3), saline, phosphate buffered saline, Ringer's solution, lactated Ringer's solution, Locke-Ringer's solution, Krebs Ringer's solution, Hartmann's balanced saline solution, and heparinized sodium citrate acid dextrose solution. The pharmaceutically acceptable carrier used can depend on the route of administration. The pharmaceutical composition can be formulated for administration by any method known in the art, including but not limited to, oral administration, parenteral administration, intravenous administration, transdermal administration, intramuscular administration, intranasal administration, direct injection into a tumor site, and administration through an osmotic mini-pump.

[0041] Also provided is a cancer vaccine comprising attenuated bacteria that expresses a recall antigen. The bacteria can be, for example, one or more of Listeria monocytogenes, Salmonella thyphimurium, Vibrio cholera, Clostridium, and Bifidobacterium breve. The recall antigen can be, for example, an epitope of one or more of tetanus toxoid, measle virus, and polio virus.

[0042] This invention will be better understood from the Experimental Details, which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims that follow thereafter.

EXPERIMENTAL DETAILS

Introduction

[0043] Listeria constructs were developed that express antigens with immunodominant epitopes of childhood recall antigens tetanus toxoid (TT), measle virus (MV), and poliovirus (PV). Repeated immunizations with Listeria-TT in mice with memory T cells to the TT nearly completely eliminates metastases in mice with metastatic breast cancer cancer without side effects. Listeria-TT combined with gemcitabine in mice with pancreatic cancer was even more effective that Listeria-TT alone, most likely because gemcitabine reduces immune suppression through the elimination of myeloid-derived suppressor cells (MDSCs).

Schematic View of the Listeria-Recall Antigen Model

[0044] FIG. 1 provides a schematic view of the Listeria-recall antigen model. Memory T cells to recall antigens such as TT can be generated with the human TT vaccine in BALB/cByJ mice. The TT proteins can be taken up by antigen-presenting cells (APC) and presented to naïve T cells. Upon repeated exposure, the naïve T cells will differentiate into memory T cells, which circulate in the blood stream for life. Subsequently, 4T1 tumor cells can be injected into the mammary fat pad (this can be done at young or old age), followed by frequent immunizations with low dose Listeria-TT once the tumor is palpable. This will recall the activation of the memory T cells to TT earlier in life. Simultaneously, TT will be delivered into the tumor cells through infection with Listeria-TT, resulting in the presentation of TT antigens. Finally, the TT-specific memory T cells will migrate to the tumor cells, and kill the 4T1 tumor cells now presenting TT epitopes.

Methods and Results

[0045] Development of the Listeria.sup.at-TT.sub.856-1313 vaccine. The Listeria-TT vaccine was developed as described below. The TT.sub.856-1313 (62 kDa) was cloned as a fusion-protein with a truncated Listeriolysin O (LLO)(48 kDa) in the Listeria.sup.at vector (pGG34) under the control of the LLO promoter (P), and a myc sequence for detection of the TT protein (FIG. 2A). Secretion of LLO-TT.sub.856-1313 protein by the Listeria.sup.at-based vaccine was detected by western blotting using anti-myc antibodies (FIG. 2B). Infection of 4T1 tumor cells with Listeria.sup.at-TT.sub.856-1313 resulted in the expression of TT protein in the tumor cells (FIG. 2C). Also fragments of MV and PV have been cloned into the Listeria.sup.at. Epitopes of the recall antigens that are immunodominant in mice are shown in Table 1.

[0046] Generation of CD8 T cell responses to immunodominant epitope in TT.sub.856-1313 protein. It was tested whether the TT.sub.856-1313 protein induced CD8 T cell responses to the immunodominant epitope of TT.sub.856-1313. For this purpose, BALB/cByJ mice were immunized three times with TT.sub.856-1313 protein and CpG. Two days after the last immunization, mice were euthanized and white blood cells were restimulated with an immunodominant peptide GYNAPGIPL.sub.1228-1236 (SEQ ID NO:1) within the TT.sub.856-1313 protein (7). CD8 T cells were activated against the immunodominant T1228-1236 epitope in blood of BALB/cByJ mice (FIG. 3).

[0047] Vaccination with Listeria.sup.at-TT.sub.856-1313 is highly effective against metastases in breast cancer model 4T1. The efficacy of the Listeria-TT.sub.856-1313 vaccine was tested against metastatic breast cancer in the 4T1 model. First, memory T cells to the immunodominant CD8 T cell epitope were generated with TT.sub.856-1313 protein and CpG. Then, 4T1 tumor and metastases were generated by injection of the 4T1 cell line into the mammary fat pad, and Listeria.sup.at-TT vaccinations were administered every other day for two weeks after the tumor size had reached 5 mm. Listeria.sup.at-TT.sub.856-1313 was highly effective against the metastases (FIG. 4) but not against the primary tumors (not shown). CpG was used as an adjuvant. Interestingly, CpG itself was also effective against the metastases. CpG was found to eliminate MDSC (3). Listeria.sup.at itself was also effective against metastases, by killing tumor cells through the production of ROS, in confirmation of earlier studies (12). However, the combination of CpG+TT/Listeria.sup.at-TT.sub.856-1313 was most effective, i.e. the number of metastases was significantly lower in the CpG+TT/Listeria.sup.at-TT.sub.856-1313 group compared to all control groups.

[0048] Listeria-TT and gemcitabine is highly effective against metastases and tumors in mice with pancreatic cancer. In clinical trials of Listeria-recall antigens in patients with pancreatic cancer, the patients would be expected to be treated with gemcitabine. Therefore, it was tested whether gemcitabine affected Listeria-recall antigen immunizations. Since gemcitabine is known for eliminating MDSCs, which are a major contributor to immune suppression, it was expected that gemcitabine will reduce immune suppression and the recall antigens can do their job better.

[0049] Listeria was starved in saline for 30 min, and subsequently cultured in yeast medium (keeps Listeria alive but Listeria does not replicate) for 60 min. This treatment allowed the injection of 10.sup.7 CFU of Listeria every day instead of 10.sup.4 CFU every day. Then, Listeria-TT was tested in combination with gemcitabine (Gem). Mice with pancreatic cancer were treated with gemcitabine ip (1.2 mg/300 μl per dose; every 3rd day, starting day 3 after tumor cell injection), followed by Listeria-TT ip starting on day 10 after tumor cell injection (10.sup.7 CFU every day for 4 days, followed by a rest period of 3 days, followed by another 3 injections with 10.sup.7 CFU of Listeria-TT). All mice were euthanized on day 21. Untreated mice will die between day 21-28 after tumor cell injection in this highly aggressive pancreatic cancer model. The combination of gemcitabine and Listeria-TT eliminated metastases completely and primary tumors nearly completely (FIG. 5). This was even much better than the Listeria-TT in the breast cancer model (4T1). The results suggest that gemcitabine improved the effect of TT on the Panc-02 tumor while the higher number of Listeria (10E7 instead of 10E4), completely eliminated the metastases. In conclusion, gemcitabine had a positive effect on Listeria-TT.

[0050] FIG. 6A-B illustrates the combination of Listeria-TT and Gemcitabine efficacy on advanced pancreatic cancer. Earlier figures show the effect on early pancreatic cancer.

[0051] FIG. 7A-B shows that Gemcitabine reduces the myeloid-derived suppressor cells (MDSC) and tumor-associated macrophage (TAM) populations. Both strongly suppress T cells. By reducing these populations, T cell responses are strongly improved, as shown in Tables 2 and 3.

[0052] Table 2 Shows T cell responses in the Panc-02 mice treated with Listeria-TT and Gemcitabine. The T cell responses in Listeria-TT and Gemcitabine is far better than in the separate groups.

[0053] Table 3 Shows T cell responses in the KPC mice treated with Listeria-TT and Gemcitabine. The T cell responses in Listeria-TT and Gemcitabine is far better than in the separate groups.

[0054] Table 4 shows that the combination of Listeria-TT and Gemcitabine reduces inhibitory cytokines produced by MDSC and TAM, and improve expression levels of CD80 involved in T cell stimulation.

[0055] FIG. 8 shows a new model that combines Listeria-recall antigens with gemcitabine (GEM). Listeria induces high levels of reactive oxygen species (ROS) and ROS reduces the levels of the enzyme cytidine deaminase (CDA). CDA is an enzyme that inactivates gemcitabine and is present at high levels in tumor cells and macrophages in cancer patients and tumor-bearing mice. With the use of Listeria, tumor cells now become sensitive to Gemcitabine through Listeria-induced ROS. FIG. 9 shows that Listeria reduces CDA in Hela and PANC-1 tumor cells. FIG. 10 shows an immunization protocol developed for the combination therapy.

TABLE-US-00004 TABLE 1 Immunodominant CD8 epitopes in fragments of recall  antigens, MHC haplotype, and corresponding mouse strain. Mouse Recall Epitopes within the strain/ Antigen cloned fragments syngeneic Ref for (cloned reacting with mouse MHC tumor cell  CD8 fragment).sup.ref CD8 T cells haplotype line epitopes TT(856-1313.sup.6 GYNAPGIPL(1228- H2-d BALB/ 7 1236) (SEQ ID NO: 1) c/4T MV(38-351) LDRLVRLIG (52-59 H2-k AKR/J/ 8 (SEQ ID NO: 2) BW-Sp3 MV(38-351) VESPGQLI (81-88) H2-k AKR/J/ 8 (SEQ ID NO: 3) BW-Sp3 PV(42-273) SNAYSHFYDGFSKVP H2-d BALB/c/ 9 LKDQS (202-221)* 4T1 (SEQ ID NO: 4) The numbers between parentheses represent the position of the amino acid within the antigen. *CD8 epitope is present within the amino acid sequence.

TABLE-US-00005 TABLE 2 CD4 and CD8 T cell responses to Listeria-TT improved by GEM in vivo Panc-02 mice. Percentage Saline GEM LM-TT + GEM LM-TT CD3CD4CD69 15.5 14.2 28.5 14.2 CD3CD8CD69 16.7 15.5 33.2 15.5 CD3CD4Perforin 7.9 14.9 22.7 14.9 CD3CD8Perforin 2.1 4.8 6.2 4.9 CD3CD4Granzyme B 4.9 4.8 9.9 5.9 CD3CD8Granzyme B 1.2 1.1 2.4 1.2 CD3CD4IFNγ 2.6 2.7 5.0 3.0 CD3CD8IFNγ 0.5 0.4 0.9 0.4
Panc-02 mice with advanced pancreatic cancer were treated with one high and multiple low doses of Listeria-TT (LM-TT) and GEM as described in FIG. 7A. T cells were analyzed in the spleens (of 3 mice pooled) by flow cytometry. This experiment was performed once.

TABLE-US-00006 TABLE 3 CD4 and CD8 T cell responses to Listeria-TT improved by GEM in vivo KPC mice. Percentage Saline GEM LM-TT + GEM LM-TT CD3CD4CD69 13.5 10.01 17.34 6.59 CD3CD8CD69 12.3 17.5 23.92 18.8 CD3CD4Perforin 0.26 7.90 14.27 8.22 CD3CD8Perforin 0.25 15.60 16.70 14.73 CD3CD4Granzyme B 3.1 3.5 12.17 4.82 CD3CD8Granzyme B 1.6 9.71 12.60 9.82 CD3CD4IFNγ 0.3 0.0 0.16 0.41 CD3CD8IFNγ 0.0 1.7 3.33 1.85
KPC mice with advanced pancreatic cancer were treated with one high and multiple low doses of Listeria-TT (LM-TT) and GEM as described in FIG. 7A. T cells were analyzed in the spleen by flow cytometry. This experiment was performed once.

TABLE-US-00007 TABLE 4 Analysis of MDSC and TAM in Panc-02 mice. Treatment Saline LM-TT LM-TT + GEM GEM Percentage of MDSC (CD11b.sup.+Gr1.sup.+) in Blood IL-10 3.46 2.44 1.45 2.76 IL-6 4.25 4.05 2.70 3.59 TNFα 3.64 8.42 11.6 8.49 MARCO 3.38 3.70 1.79 3.84 CD80 1.28 1.08 1.17 1.78 Percentage of TAM (CD11b.sup.+F4/80.sup.+) in Metastases IL-10 1.45 0.65 0.72 1.47 IL-6 1.09 0.76 0.42 1.25 TNFα 4.78 8.73 8.04 8.85 MARCO 1.96 2.16 1.33 1.94 CD80 1.93 3.07 5.26 4.28
Panc-02 mice with advanced pancreatic cancer were treated with one high and multiple low doses of Listeria-TT (LM-TT) and GEM as described in FIG. 7A. MDSC and TAM were analyzed in the metastases by flow cytometry. Metastases of 3 mice were pooled. This experiment was performed once.

Discussion

[0056] The success of cancer immunotherapy has been hindered by two major problems. One problem is that tumor-associated antigens (TAA), used in cancer vaccines, are often self-antigens that are overexpressed or mutated in tumor cells compared to normal cells. The T cells in the thymus have been taught earlier in life not to react to self-antigens, and therefore it is difficult to induce strong T cell responses to TAA. The other problem is that most cancer patients are old, and the elderly react less efficiently to vaccines than young adults. This is often due to lack of naïve T cells (only generated at young age, and are used during life) that react for the first time to a new antigen and are responsible for the generation of memory T cells upon repeated exposures with the same antigen. None of the vaccines currently available avoids the need of naïve T cells at an older age, and none of the vaccines allow delivery of highly immunogenic recall antigens directly into tumor cells by live attenuated bacteria.

[0057] The present approach overcomes the problem of poorly immunogenic antigens in cancer vaccination by using highly immunogenic recall antigens, and at the same time avoids the need of naive T cells in older age. The present procedure involves reactivating memory T cells to foreign highly immunogenic antigens to which most individuals have been exposed during childhood when plenty of naïve T cells are available, such as tetanus toxoid (TT), measle virus (MV), polio virus (PV) antigens, and by the selective delivery of these antigens into tumor cells by an attenuated non-toxic and non-pathogenic bacterium, such as Listeria monocytogenes. These memory T cells will now kill infected tumor cells presenting the highly immunogenic antigens. In previous studies, Listeria has been used for the selective delivery of anticancer agents to the tumor microenvironment and into tumor cells of metastases and tumors. Listeria was effectively cleared by the immune system in normal tissue but not in the heavily immune-suppressed microenvironment of metastasis and primary tumor (10, 11).

[0058] However, immune suppression may not be completely overcome by this treatment. This problem can be resolved by combining the Listeria-recall antigens with a chemotherapeutic, such as gemcitabine, that reduces the number of myeloid-derived suppressor cells (MDSCs). MDSCs are the most important contributor to immune suppression in the tumor microenvironment.

[0059] All together, these results are very impressive. Also, the mechanism that Listeria-induced ROS improves gemcitabine sensitivity is very important because most clinicians don't want to stop gemcitabine treatment in pancreatic cancer patients. And most important, the combination therapy is effective against advanced pancreatic cancer, and can work at young and old age, because elderly patients lack naïve T cells (required to develop memory T cells). With the present approach, one immediately reactivates memory T cells to tetanus toxoid antigens, measle virus antigens and poliovirus antigens, and avoids the need of naïve T cells at older age. Since the Listeria with the recall antigens selectively infect tumor cells in vivo, the memory T cells that circulate in blood for life can now kill the infected tumor cells. These memory T cells were generated during childhood with the childhood vaccines.

[0060] The most obvious uses of the present invention are treatment of types of cancer for which there are practically no effective treatments, such as pancreatic cancer, which is almost always detected in metastatic form, or ovarian cancer. Good candidates also include cancers for which surgery to remove the primary tumor is often not an option because of tumor location, such as head and neck cancers or inoperable hepatocellular carcinoma. A third cohort of patients that would be expected to benefit from such therapy are patients with various types of metastatic disease, which is recurrent or refractory to standard treatments, such as for example lung and colon cancers as well as breast cancer.

REFERENCES

[0061] 1. Achkar J M, Fries B C. 2010. Candida infections of the genitourinary tract. Clinical microbiology reviews 23: 253-73. [0062] 2. Eroles P, Sentandreu M, Elorza M V, Sentandreu R. 1997. The highly immunogenic enolase and Hsp70p are adventitious Candida albicans cell wall proteins. Microbiology 143 (Pt 2): 313-20. [0063] 3. Lechner M G, Epstein A L. 2011. A new mechanism for blocking myeloid-derived suppressor cells by CpG. Clinical cancer research: an official journal of the American Association for Cancer Research 17: 1645-8. [0064] 4. Bracci L, Schiavoni G, Sistigu A, Belardelli F. 2014. Immune-based mechanisms of cytotoxic chemotherapy: implications for the design of novel and rationale-based combined treatments against cancer. Cell Death Differ 21: 15-25. [0065] 5. Rice J, Buchan S, Stevenson F K. 2002. Critical components of a DNA fusion vaccine able to induce protective cytotoxic T cells against a single epitope of a tumor antigen. Journal of immunology 169: 3908-13. [0066] 6. Reveneau N, Geoffroy M C, Locht C, Chagnaud P, Mercenier A. 2002. Comparison of the immune responses induced by local immunizations with recombinant Lactobacillus plantarum producing tetanus toxin fragment C in different cellular locations. Vaccine 20: 1769-77. [0067] 7. Weidinger G, Czub S, Neumeister C, Harriott P, ter Meulen V, Niewiesk S. 2000. Role of CD4(+) and CD8(+) T cells in the prevention of measles virus-induced encephalitis in mice. J Gen Virol 81: 2707-13. [0068] 8. Usherwood E J, Nash A A. 1995. Lymphocyte recognition of picornaviruses. J Gen Virol 76 (Pt 3): 499-508. [0069] 9. Chandra D, Jahangir A, Quispe-Tintaya W, Einstein M H, Gravekamp C. 2013. Myeloid-derived suppressor cells have a central role in attenuated Listeria monocytogenes-based immunotherapy against metastatic breast cancer in young and old mice. British Journal of Cancer 108: 2281-2290. Epub 2013 May 2. [0070] 10. Quispe-Tintaya W, Chandra D, Jahangir A, Harris M, Casadevall A, Dadachova E, Gravekamp C. 2013. Nontoxic radioactive Listeria(at) is a highly effective therapy against metastatic pancreatic cancer. Proc Natl Acad Sci USA. 21; 110(21):8668-73, Epub 2013 Apr. 22. [0071] 11. U.S. Patent Application Publication No. 2014/0147379 A1, published May 29, 2014, Dadachova et al., Radiobacteria for Therapy of Cancer. [0072] 12. Kim, S. H., Castro, F., Paterson, Y. & Gravekamp, C. 2009. High efficacy of a Listeria-based vaccine against metastatic breast cancer reveals a dual mode of action. Cancer Res 69, 5860-5866.