AAV-MEDIATED GENE THERAPY RESTORING THE OTOFERLIN GENE

Abstract

The present inventors report here, in the DFNB9 mouse model (OTOF knock-out mice), the first proof-of-principle that cochlear delivery of a fragmented cDNA via a dual-AAV vector approach can effectively and long-lastingly correct the profound deafness phenotype of these mice when administered well after their auditory system has matured (P30). The present invention therefore concerns a vector system that allows the expression of the full-length Otoferlin polypeptide, or of a functional fragment thereof, in inner hair cells, for use for treating patients suffering from DFNB9 deafness or preventing DFNB9 deafness in patients having DFNB9 mutations, wherein said patients are patients having a developed and mature auditory system, such as new born babies, toddlers, infants, teenagers or adults.

Claims

1-12. (canceled)

13. A method for treating patients suffering from DFNB9 deafness or for preventing DFNB9 deafness in patients having DFNB9 mutations, wherein said patients are human having a developed and mature auditory system, such as new-born babies, toddlers, infants, teenagers or adults, said method comprising administering to said patients a vector system that allows the expression of the full-length Otoferlin polypeptide, or of a functional fragment thereof, in inner hair cells.

14. The method of claim 13, wherein said Otoferlin polypeptide has the sequence SEQ ID NO:1.

15. The method of claim 13, wherein said vector system comprises at least one AAV particle comprising a polynucleotide encoding the full-length of the Otoferlin polypeptide or a functional fragment thereof.

16. The method of claim 13, wherein said vector system comprises at least two AAV particles, each of them comprising a polynucleotide comprising a partial coding sequence that encodes i) the N-terminal part of the Otoferlin polypeptide or of a functional fragment thereof, for one, and ii) the C-terminal part of the Otoferlin polypeptide or of a functional fragment thereof, for the other.

17. The method of claim 13, wherein said vector system comprises at least two AAV particles, each of said AAV particles comprising either: a) a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5′ to 3′: a suitable promoter followed by a partial coding sequence that contains the N-terminal part of the Otoferlin gene, and a splice donor site, or b) a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5′ to 3′: a splice acceptor site, a partial coding sequence that contains the C-terminal part of the Otoferlin gene, optionally followed by a polyadenylation sequence, wherein the said first and second polynucleotides also contain a recombinogenic sequence that is located after the splice donor site in said first polynucleotide and before the splice acceptor site in said second polynucleotide, and wherein the coding sequences in the first and second polynucleotides when combined encode the full-length of the Otoferlin polypeptide, or a functional fragment thereof.

18. The method of claim 17, wherein the Otoferlin gene has the sequence SEQ ID NO:2.

19. The method of claim 17, wherein said N-terminal part of the Otoferlin gene is of SEQ ID NO:3 and said C-terminal part of the Otoferlin gene is of SEQ ID NO:4.

20. The method of claim 15, wherein said AAV particles are of the AAV2 serotype.

21. The method of claim 13, wherein said vector system comprises AAV2 particles in which the capsid has been modified by substituting the tyrosine amino acid residues into phenylalanine amino acid residues.

22. The method of claim 13, wherein said human patients have been diagnosed from the DFNB9 deafness after language acquisition.

23. The method of claim 13, wherein said patients are teenagers or adult humans suffering from DFNB9 deafness induced by thermosensitive mutations.

24. The method of claim 13, wherein said patients are teenagers or adult humans suffering from DFNB9 deafness induced by thermosensitive mutations chosen from: P.Q994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del.

25. The method of claim 1, wherein said vector system is administered in a pharmaceutical composition also containing a pharmaceutically acceptable vehicle.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0153] FIG. 1 shows the expression of otoferlin in HEK293 cells following dual AAV-vector delivery.

[0154] A) A schematic representation of the recombinant AAV vector pair used in this study, and of the recombination, transcription, splicing, and translation processes producing the full-length protein otoferlin in co-infected cells. The recombinant AAV-Otof NT and AAV-Otof CT vectors contain the 5′ and 3′ parts of the otoferlin cDNA, respectively. The recombinogenic bridging sequence present in the two recombinant vectors is indicated by a gray sphere. The red bars under the protein diagram denote the two peptides used to produce the antibodies against the N-terminal and C-terminal parts of otoferlin. Abbreviations: ITR, inverted terminal repeats; smCBA, cytomegalovirus immediate early/chicken β-actin chimeric promoter; SA, splice acceptor site; SD, splice donor site; polyA, polyadenylation signal; C2, C2 domain; TM, transmembrane domain. B) HEK293 cells were infected with AAV-Otof NT alone (upper panel), AAV-Otof CT alone (middle panel), or AAV-Otof NT and AAV-Otof CT together (lower panel). They were stained for otoferlin (green) with a polyclonal antibody directed against the C-terminal part of the protein 48 hours later, and cell nuclei were labeled with DAPI (blue). Only co-infected cells produce otoferlin. Scale bars: 15 μm.

[0155] FIG. 2 shows that the dual AAV-mediated gene therapy in P10 Otof −/− mice restores otoferlin expression and prevents deafness.

[0156] (a) Left panel: Mosaic confocal image of the middle and apical turns of the injected cochlea immunostained for otoferlin on P70 (green). Cell nuclei are stained with DAPI (blue). A large proportion of the IHCs, but none of the outer hair cells (OHC), express otoferlin. Arrowheads indicate nontransduced IHCs. Inset: Higher magnification of the boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs co-immunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of post-synaptic glutamate receptors (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) Left panel: Four weeks after the dual AAV injection, Otof −/− mice displayed ABR thresholds in response to clicks or tone-bursts at frequencies of 8 kHz, 16 kHz, and 32 kHz (green dots, n=8) close to those of wild-type mice (black dots, n=8). By contrast, Otof −/− mice receiving AAV-Otof NT (orange dots, n=3) or no injection (blue dots, n=6) had no identifiable ABR waves up to sound intensity levels of 86 dB SPL. Right panel: In the Otof −/− mice treated on P10 (arrow), the hearing thresholds for click stimuli were stable for at least six months after recovery. (c) Left panel: ABR traces, recorded three weeks after therapeutic injection, in a wild-type mouse, an Otof −/− mouse (Otof −/−), and a rescued Otof −/− mouse (Otof −/− injected), showing similar waveforms in the wild-type and rescued mice. Right panel: bar graph showing the latency and normalized amplitude of ABR wave I in rescued Otof −/− mice (grey, n=8) and wild-type mice (black, n=5).

[0157] FIG. 3 shows that dual AAV-mediated gene therapy in Otof −/− mice on P17 durably restores otoferlin expression and hearing.

[0158] (a) Left panel: Mosaic confocal image of the middle and apical turns of the injected cochlea, immunostained for otoferlin (green) on P80. Cell nuclei are stained with DAPI (blue). Most IHCs express otoferlin, whereas outer hair cells (OHC) do not. Arrowheads indicate non-transduced IHCs. Inset: Higher magnification of the boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs coimmunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of postsynaptic glutamate receptors (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) Left panel: ABR thresholds of untreated Otof −/− mice (blue, n=5), treated Otof −/− mice (green, n=5), and wild-type mice (black, n=5) in response to clicks or tone-burst stimuli at frequencies of 8, 16, and 32 kHz, four weeks after intracochlear injection of the recombinant vector pair in the treated mice. Right panel: time course of hearing recovery in Otof −/− mice receiving injections on P17 (arrow). Hearing restoration to near-wild type levels is maintained for at least twenty weeks post-injection. (c) Left panel: ABR traces, recorded two weeks after therapeutic injection, in a wild-type mouse (black), an Otof −/− mouse (Otof −/−), and a rescued Otof −/− mouse (Otof −/− injected), showing similar waveforms in the wild-type and rescued mice. Right panel: bar graph showing that the latency of ABR wave I in rescued Otof −/− mice (n=5) is similar to that in wild-type mice (n=5), whereas its normalized amplitude is about half that in wild-type mice.

[0159] FIG. 4 shows that dual AAV-mediated gene therapy in Otof −/− mice on P30 restores otoferlin expression and hearing in a sustained manner.

[0160] (a) Left panel: Mosaic confocal image of the middle and apical turns of the injected cochlea, immunostained for otoferlin on P40 (green). Cell nuclei are stained with DAPI (blue). Most IHCs express otoferlin, whereas outer hair cells (OHC) do not. Arrowheads indicate non-transduced IHCs. Inset: Higher magnification of the boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs coimmunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of postsynaptic glutamate receptors (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) ABR thresholds of untreated Otof −/− mice (blue, n=3), treated Otof−/− mice (green, n=3) and wild-type mice (black, n=3) in response to clicks or tone-burst stimuli at frequencies of 8, 16, and 32 kHz, three weeks (left panel), fourteen weeks, and twenty weeks (right panel) after intracochlear injection of the recombinant vector pair in the treated mice. In these mice hearing restoration to near-wild type levels is maintained for at least twenty weeks post-injection. (c) Left panel: ABR traces, recorded seven weeks after therapeutic injection, in a wild-type mouse (black), an Otof −/− mouse (Otof −/−), and a rescued Otof −/− mouse (Otof −/− injected), showing similar waveforms in the wild-type and rescued mice. Right panel: bar graph showing that the latency of ABR wave I in rescued Otof −/− mice (n=3) is similar to that in wild-type mice (n=3), whereas its normalized amplitude is about half that in wild-type mice.

[0161] FIG. 5 shows the dual AAV-mediated gene therapy in Otof.sup.ts/ts mice restores otoferlin normal expression and hearing. A) Confocal image of IHCs (outlined by dashed lines) located in the mid-turn cochlea from a wild-type (Otof.sup.ts/ts mouse (left panel), an Otof.sup.ts/ts mouse (middle panel), and a treated Otof.sup.ts/ts (right panel) mouse, immunostained for otoferlin (green). While otoferlin shows abnormal aggregation at the IHC base in the non-treated Otof.sup.ts/ts mouse, its expression in the IHCs of the treated mice is nearly normal. B) ABR waveforms, recorded four weeks after therapeutic injection, in a wild-type mouse (black), an Otof.sup.ts/ts mouse (blue), and a rescued Otof.sup.ts/ts mouse (green), showing similar waveforms in the wild-type and rescued mice, while no ABR waves are detected in the untreated mutant.

[0162] The schema on FIG. 6 discloses the differential maturation of hearing system in humans and in mice (Shnerson and Willott, J. Comp. Physiol. Psychol. 1980 February; 94(1):36-40).

[0163] FIG. 7 describes some of the mutations of the DFNB9 gene that have been identified so far. These mutations underlay recessive form of the prelingual deafness DFNB9.

[0164] FIG. 8 shows (A) the protein aggregation and misfolding of Otoferlin in the inner hair cells of Otof.sup.ts/ts mouse and (B) the auditory brainstem responses (ABRs) in Otof.sup.+/ts, and Otof.sup.ts/ts mice (see also FIG. 5).

[0165] FIG. 9 discloses the effect of unilateral injection of the AAV-Otof NT plus AAV-Otof CT recombinant vector pair on Otof.sup.ts/ts mice. 5 weeks after the injection, the sensory epithelium of the treated cochleas of three Otof.sup.ts/ts mice was microdissected and immunolabeled for otoferlin. Otoferlin expression in the IHC of the treated cochlea has been measured and compared with its expression in Otof.sup.ts/ts non-treated mice (see also FIG. 5).

[0166] FIG. 10 discloses the voltage-activation curve of Ica (A) and corresponding ΔC.sub.m responses (B) in wild-type, Otof.sup.ts/ts and Otof.sup.ts/ts treated IHC. Changes in cell membrane capacitance (ΔC.sub.m) were used to monitor fusion of synaptic vesicles during exocytosis.

EXAMPLES

I. Material and Methods

Animals

[0167] Otoferlin knockout (Otof −/−) mice produced in the C57BL/6 strain (Roux I. et al, Cell, 127, 277-289 (2006) were backcrossed with FVB mice for more than ten generations to obtain a homogeneous FVB genetic background, as this background, unlike the C57BL/6 background, is associated with stable hearing thresholds in the first ten months of life (Kommareddi, P., et al. J Assoc Res Otolaryngol 16, 695-712 (2015)). Recombinant AAV2 vectors were delivered to the Otof −/− mice in an FVB genetic background. All procedures and animal handling complied with Institut National de la Santé et de la Recherche Médicale, Institut Pasteur, and NIH welfare guidelines, and approved protocol requirements at the University of California, San Francisco. Before surgery, mice were anesthetized by intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg/kg), xylazine hydrochloride (Xyla-ject, 10 mg/kg), and acepromazine (2 mg/kg). The depth of anesthesia was checked by monitoring the deep tissue response to toe pinch. Before and every 24 hours after surgery for a week, the mice received subcutaneous injection of carprofen (2 mg/kg) to reduce inflammation and pain. Animals were monitored for signs of distress and abnormal weight loss after surgery.

[0168] A mouse model carrying a thermosensitive mutation in the C2F domain (Otof.sup.ts/ts) (p.E1804del) was generated. The Otof.sup.ts/ts mice are profoundly deaf. The results shown on FIG. 8 highlight that the distribution of otoferlin in the IHCs of these mice is abnormal/strongly perturbed: the protein is aggregated and misfolded in the inner hair cells. Moreover, when auditory brainstem responses (ABRs) are recorded in Otof.sup.+/ts, and Otof.sup.ts/ts mice to monitor the electrical response of the primary auditory neurons and the successive neuronal relays of the central auditory pathway to a click stimulus, it is observed that, at the age of one month, ABR characteristic waveform is obtained for Otof.sup.+/ts mice at the various intensities tested (40-86 dB), but no response is elicited in Otof.sup.ts/ts mice, even at 100 dB.

Recombinant AAV2 Vector Constructs and Packaging

[0169] The full-length coding sequence of the murine otoferlin cDNA (Otof1 isoform 1; NM_001100395.1) was divided into a 5′ fragment (nucleotides 1-2448) and a 3′ fragment (nucleotides 2449-5979), and these fragments were synthesized (Genscript, Piscataway, N.J.). The 5′ construct contained the 5′ part of the Otof1 cDNA (encoding amino acids 1-816, which includes the C2A, C2B, and C2C domains of the protein) and a splice donor (SD) site, and the 3′ construct contained the 3′ part of the Otof1 cDNA (encoding amino acids 817-1992, which includes the C2D, C2E, C2F and transmembrane domains of the protein), a splice acceptor site (SA). In addition, both constructs contain the alkaline phosphatase recombinogenic bridging sequence [Lay Y et al, Hum Gene Ther 17, 1036-1042 (2006); Ghosh A. et al, Hum Gene Ther 22, 77-83 (2011); Dyka F. M. et al, Hum Gene Ther Methods 25, 166-177 (2014)]. Recognition sites for NotI/NheI and MfeI/KpnI restriction endonucleases were added to these constructs, which were then inserted into an AAV pTR22 vector plasmid as previously described [Lay Y et al, Hum Gene Ther 17, 1036-1042 (2006); Ghosh A. et al, Hum Gene Ther 22, 77-83 (2011); Dyka F. M. et al, Hum Gene Ther Methods 25, 166-177 (2014)], producing a pair of recombinant vectors referred to as AAV-Otof NT and AAV-Otof CT. An additional recombinant vector containing the green fluorescent protein (GFP) cDNA was engineered to serve as a positive control of cell transduction. The recombinant vectors were packaged in the AAV2 quadY-F capsid (Petrs-Silva H. et al, Molecular therapy: the journal of the American Society of Gene Therapy 19, 293-301 (2011), and recombinant viruses were purified and titered by the University of Florida Ocular Gene Therapy Core, as previously described [Zolotukhin S. et al, Methods 28, 158-167 (2002); Jacobson S G et al., Molecular therapy: the journal of the American Society of Gene Therapy 13, 1074-1084 (2006)].

Transgene Expression in Transfected HEK293 Cells

[0170] HEK293 cells were grown in 6-well plates on polylysine-coated coverslips in Dulbecco's modified Eagle's medium supplemented with 1× non-essential amino acids and 10% fetal bovine serum (Gibco), and penicillin-streptomycin (Pen/Strep, Invitrogen). On the next day, cells were infected as previously described (Lopes V. S. et al, Gene Ther 20, 824-833 (2013). Briefly, the Coverslips with the cells at 75% confluence were incubated in 200 μl of serum-free medium containing either one or both AAV2-Otof recombinant viruses (10 000 genome-containing particles/cell for each vector) at 37° C. with 5% CO2. Two hours later, 1 ml of complete medium was added. The next day the medium was changed, and cells were incubated for an additional 48 hours. The cells were fixed with 4% paraformaldehyde in 0.1 M phosphate buffered saline (PBS), pH 7.4, at 4° C. for two hours, rinsed three times with PBS, and incubated with 0.25% Triton X-100 and 5% normal goat serum in PBS at room temperature for one hour. The cells were then incubated with previously characterized rabbit polyclonal antibodies, 14 cc and C19, directed against the N-terminal part (amino acids 196-211) and the C-terminal part (amino acids 1848-1978) of otoferlin, respectively (Roux I. et al, Cell, 127, 277-289 (2006) (dilution 1:200) at 4° C. overnight. The samples were rinsed twice with PBS, and incubated with Cy3-conjugated goat anti-rabbit IgG secondary antibody (Life Technologies, dilution 1:2000) in PBS at room temperature for two hours. The samples were then rinsed twice in PBS, stained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize cell nuclei, mounted on a glass slide with a drop of Fluorsave medium (Biochem Laboratories, France), and observed with an Olympus confocal immunofluorescence microscope.

Vector Delivery to the Cochlea

[0171] The virus was delivered to the left cochlea as previously described (Akil O. et al, Neuron 75, 283-293 (2012)). Anesthetized Otof −/− mice received an injection of the AAV2-Otof vector pair through the round window membrane into the scala tympani of the cochlea on P10, P17, or P30. The ear was approached via a dorsal incision (Duan M et al, Gene Ther 11 Suppl 1, S51-56 (2004). A small hole was made in the bulla with an 18G needle, and expanded with forceps. The round window membrane was gently punctured with a borosilicate capillary glass pipette, which was then removed. When perilymph efflux stopped, a fixed volume (2 μl) containing the AAV2-Otof NT (6.3×10.sup.12 vg/ml) and AAV2-Otof CT (4.5×10.sup.12 vg/ml) vector pair was injected into the scala tympani with a fine glass micropipette (outer tip diameter of 10 μm) over a period of one minute. The pipette was pulled out, and the niche was rapidly sealed with fascia and adipose tissue. The wound was sutured in layers with a 6-0 absorbable chromic suture (Ethicon).

Auditory Testing

[0172] Auditory testing was carried out in anesthetized Otof.sup.+/+ mice, Otof mice, and rescued Otof mice at different time points, in a sound-proof chamber, as previously described (Akil O. et al, Neuron 75, 283-293 (2012). The mice were anesthetized with an intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg/ml) and xylazine hydrochloride (Xyla-ject, 10 mg/ml), with subsequent injections of one fifth of the initial dose if required. Body temperature was maintained with a heating pad and monitored with a rectal probe throughout recording. Auditory brainstem responses (ABR) were recorded with the TDT BioSig III system (Tucker Davis Technologies) and three subdermal needle electrodes located on the mouse scalp: one at the vertex, one below the pinna of the left ear (reference electrode), and one below the contralateral ear (ground electrode). The sound stimuli were clicks (5 ms duration, 31 Hz) and tone pips at 8, 16, and 32 kHz (10 ms duration, cosine squared shaping, 21 Hz). They were delivered in free-field conditions, with monaural response recording from the left ear (the right ear was blocked during the recording). For each sound stimulus, electroencephalographic (EEG) activity was recorded for 20 ms at a sampling rate of 25 kHz, with filtering (0.3-3 kHz). EEG waveforms for 512 stimuli and 1000 stimuli were averaged for clicks and tone bursts, respectively. The sound stimulus intensity was decremented in 5 dB sound pressure level (SPL) intervals down from the maximum intensity tested (86 dB SPL). The hearing threshold was defined as the lowest stimulus level at which ABR peaks for waves I-V were clearly and repeatedly present upon visual inspection. These threshold evaluations were confirmed by the offline analysis of stored waveforms. The latency of ABR wave I was measured as the time interval between the click stimulus and the peak amplitude of wave I. In addition, the values of wave I peak amplitudes on the ABR traces were normalized against the mean value in control wild-type mice (taken as 100%) for a comparison between rescued Otof −/− mice and wild-type mice.

Inner Hair Cell and Synaptic Ribbon Counts

[0173] Mouse cochleas were perfused with 4% paraformaldehyde in 0.1 M PBS (pH 7.4) and incubated in the same fixative at 4° C. for two hours. The cochleas were rinsed three times with PBS, and decalcified by incubation with 5% ethylenediamine tetra-acetic acid (EDTA) in 0.1 M PBS at 4° C. overnight. The cochlear sensory epithelium (organ of Corti) was microdissected into a surface preparation, preincubated in 0.25% Triton X-100 and 5% normal goat serum in PBS (blocking buffer) at room temperature for one hour, and incubated with the primary antibody at 4° C. overnight. The following antibodies were used: rabbit antiotoferlin C-terminal part (C19, 1:250 dilution) 1, mouse (IgG1) anti-CtBP2/ribeye, mouse (IgG2a) anti-glutamate receptor subunit A2 (Millipore, 1:200 dilution), and rabbit anti-GFP (Invitrogen, A11122; 1:250 dilution). The samples were rinsed three times in PBS, and incubated with the appropriate secondary antibody: Alexa Fluor 488-conjugated anti-mouse IgG1, Alexa Fluor 568-conjugated anti-mouse IgG2a (Life Technologies, 1:1000 dilution), or Atto Fluor 647-conjugated anti-rabbit IgG (Sigma, 1:200 dilution). The samples were washed three times in PBS, and mounted on a glass slide in one drop of Fluorsave, with DAPI to stain cell nuclei. Fluorescence confocal z-stacks of the organ of Corti were obtained with an LSM 700 confocal microscope (Zeiss, Oberkochen, Germany) equipped with a high-resolution objective (numerical aperture of 1.4, 60×oil-immersion objective). Images were acquired in a 512×512 or 1024×1024 raster (pixel size=0.036 μm in x and y) with 0.2 μm z steps. Inner hair cells (IHCs) producing otoferlin and synaptic ribbons were counted by the 3D rendering of z-stacks of up to 20 confocal images. To calculate the proportion of IHCs expressing the otoferlin transgene, we divided the total number of IHCs producing otoferlin by the total number of IHCs identified by their DAPI-stained cell nuclei (a minimum of 150 consecutive analyzed).

Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

[0174] Total mRNA was extracted (Trizol, Invitrogen) from the left cochleas of six Otof+/+ mice and six Otof −/− mice rescued on P10. Reverse transcription (RT) was carried out with oligodT primers and superscript II RNase H.sup.− (Invitrogen) at 42° C. for 50 minutes. Two microliters of the RT reaction product were used for the polymerase chain reaction (PCR; Taq DNA polymerase, Invitrogen) consisting of 35 cycles (94° C. for 30 s, 60° C. for 45 s, 72° C. for 60 s) with final extension at 72° C. for 10 minutes. The PCR primer pair (forward primer TGTCTCAGAGCTCCGAGGCA (SEQ ID NO:14) and reverse primer ATCGTGGAGGAGGAACTGGGCA (SEQ ID NO:15) was designed to amplify a 2676 bp intermediate fragment (nucleotides 27 to 2702) of the otoferlin cDNA (GenBank accession number NM_001100395.1) encompassing the junction between the AAV-Otof NT and AAV-Otof CT inserts. PCR products were purified by electrophoresis on a 2% agarose gel containing 0.5 mg/ml ethidium bromide (Qiaquick gel extraction kit, QIAGEN), sequenced (Elim Biopharmaceuticals), and checked for sequence identity to the otoferlin cDNA sequence.

Statistical Analyses

[0175] Data are expressed as the mean±standard deviation (SD). All statistical analyses were carried out with the non-parametric Mann-Whitney Utest. Statistical significance is indicated in the figures as follows: n.s., not significant; *, p<0.05; **, p<0.01; ***, p<0.001.

II. Results

[0176] An AAV2-based vector was engineered to express the green fluorescent protein (GFP) gene under the control of a chimeric CMV-chicken β-actin promoter. This expression cassette was packaged in the AAV2 quadY-F capsid wherein four surface tyrosine (Y) residues of the AAV2 capsid have been replaced by phenylalanine (F) residues, which was shown to increase the efficiency of gene transfer in the retina (Petrs-Silva H. et al, Molecular therapy: the journal of the American Society of Gene Therapy 19(2):293-301 (2011)). The recombinant virus was injected through the round window membrane into the left cochlea of five wild-type mice on P2. GFP immunostaining of the sensory epithelium three weeks after injection revealed the transduction of various types of cells including IHCs. The transduction rate for IHCs was 78±6% (mean±SD), demonstrating the suitability of this AAV serotype to deliver therapeutic genes to these cells (not shown). The coding sequence of the murine otoferlin cDNA was split into a 5′ fragment (Otof NT, nucleotides 1-2448) and a 3′ fragment (Otof CT, nucleotides 2449-5979), each of which was inserted into an AAV vector carrying a recombinogenic bridging sequence (Ghosh A. et al, Hum Gene Ther 22(1):77-83 (2011); Dyka F M et al, Hum Gene Ther Methods 25(2):166-177 (2014)). The AAV-Otof NT recombinant vector carries the 5′ part of the cDNA followed by a splice donor site, and the AAV-Otof CT recombinant vector carries a splice acceptor site followed by the 3′ part of the cDNA (see Methods and FIG. 1). Each of these recombinant vectors was packaged in the AAV2 quadY-F capsid. HEK293 cells were infected with AAV-Otof NT, AAV Otof CT, or both recombinant viruses, and immunostained for otoferlin 48 hours later. Two different antibodies were used, directed against the C-terminal part or the N-terminal part of the protein (Roux I, et al, Cell 127:277-289 (2006)), and obtained identical results. Otoferlin was detected only in cells infected simultaneously with both viruses, thus indicating that the two vectors were able to recombine and generate concatemers via their inverted terminal repeats, with correct splicing of the resulting transcript to produce the protein (FIG. 1).

[0177] A single unilateral injection of the AAV-Otof NT plus AAV-Otof CT recombinant vector pair was administered to Otof −/− mice through the round window membrane into the left cochlea, before (on P10) or after hearing onset. Injections after hearing onset were carried out at one of two different time points, P17 and P30, because the maturation of IHC ribbon synapses is still underway at P17 (Kros C J et al, Nature 394(6690):281-284 (1998); Wong A B et al, EMBO J 33(3):247-264 (2014)), whereas the cochlea is mature at P30 (Song L. et al, J Acoust Soc Am 119(4):2242-2257 (2006)). Eight weeks after the injection of the recombinant vector pair on P10, the sensory epithelium of the treated cochleas of three Otof −/− mice was microdissected and immunolabeled for otoferlin (with an antibody directed against the C-terminal part of the protein) to estimate the IHC transduction rate. The protein was detected in more than 60% of the IHCs (64±6%, mean±SD, n=3 cochleas), but not in other cell types (FIG. 2a, left panel). This result provides evidence that a large cDNA can effectively be reconstituted in cochlear sensory cells upon the local delivery of a recombinant AAV-vector pair in vivo, with sustained, widespread production of the protein by a large proportion of the cells. The accuracy of the pre-mRNA splicing process in transduced cells was checked by RT-PCR and sequence analysis of a large fragment of the otoferlin transcript encompassing the junction between the Otof NT and Otof CT cDNAs (not shown) was made.

[0178] Auditory brainstem response (ABR) recordings in the mice four weeks after the P10 injection demonstrated a substantial restoration of hearing thresholds in response to click and tone-burst stimuli (8, 16, and 32 kHz) in all the treated mice (n=8), but no restoration in the Otof −/− mice receiving either AAV-Otof NT or AAV-Otof CT alone (n=3 each), or in the absence of injection (n=6) (FIGS. 2b, 2c). The ABR thresholds for both click and tone-burst stimuli in the treated mice were similar to those of control wild-type mice (n=8; Mann-Whitney U test, p >0.15 for all comparisons). The long-term efficacy of gene therapy was evaluated by carrying out ABR recordings in response to clicks at several post-injection time points between 1 and 30 weeks. From the fourth week onward, the ABR thresholds of the treated mice did not differ significantly from those of wild-type mice (Mann-Whitney U test, p >0.05 for comparisons at all stages) (FIG. 2b). However, the amplitudes of ABR wave I, which reflects the electrical responses of primary auditory neurons to the sound stimulus, were 39±7% (mean±SD) of the mean value for wild-type mice (Mann-Whitney U test, p=0.002), whereas wave I latencies (1.15±0.09 ms) were similar to those in wild-type mice (1.27±0.05 ms; Mann-Whitney U test, p=0.06) (FIG. 2c).

[0179] Thirty weeks after the injection, six of the eight mice receiving injections on P10 still had hearing thresholds within 10 dB of those of wild-type mice. Gene therapy before hearing onset therefore prevents deafness in Otof −/− mice. The Inventors have previously shown that about half of the IHC ribbons degenerate in Otof −/− mice (Roux I, et al, Cell 127:277-289 (2006)). The numbers of presynaptic ribbons (together with postsynaptic glutamate receptors) was analysed in the transduced IHCs and the nontransduced IHCs of treated Otof −/− cochleas eight weeks after the injection on P10, by immunofluorescence and 3D confocal microscopy imaging (FIG. 2a, right panel). The number of ribbons per IHC in transduced cells (12.5±1.8, mean±SD, n=48 cells from 3 mice) was almost twice higher than in non-transduced cells (6.9±1.3, n=48 cells from 3 mice; Mann-Whitney U test, p<10.sup.−4), but remained lower than in wild-type IHCs (16±1.3, n=48 cells from 3 mice; Mann-Whitney U test, p<10.sup.−4), potentially accounting for the incomplete recovery of wave I amplitude on ABR recordings.

[0180] After injection of the recombinant vector pair into the cochlea of P17 or P30 Otof −/− mice, otoferlin was detected in IHCs throughout the treated cochlea, but not in IHCs of the contralateral cochlea (not shown). IHC transduction rates were similar in the two groups of mice (82±9% and 85±7%, for n=5 and n=3 cochleas treated on P17 and P30, respectively), and higher than those in mice receiving injections on P10 (Mann-Whitney U test, p<0.05 for both comparisons) (FIGS. 3a and 4a). ABR recordings four weeks after injection showed hearing recovery in all the mice receiving injections on P17 (n=5), with ABR thresholds in response to clicks or tone-burst stimuli remarkably similar to those in wild-type mice (n=5; Mann-Whitney U test, p >0.2 for all comparisons). Hearing thresholds in response to clicks remained unchanged for 20 weeks after injection, demonstrating a sustained restoration of hearing in these mice despite a mean ABR wave I amplitude about half that in wild-type mice (47±10%) (FIGS. 3b,c).

[0181] Likewise, Otof−/− mice receiving injections on P30 displayed a similar recovery of hearing as early as three weeks after the injection, with ABR thresholds in response to clicks or tone-burst stimuli persisting at the wild-type level for 20 weeks post-injection (n=3, Mann-Whitney U test, p >0.5 for comparisons at all stages), despite a mean ABR wave I amplitude about half (55±10%) that in wild-type mice (FIG. 4b,c). The numbers of presynaptic ribbons (together with postsynaptic glutamate receptors) was analysed in the transduced IHCs and the non-transduced IHCs of Otof −/− cochleas treated on P17 and on P30, by immunofluorescence and 3D confocal microscopy imaging (FIGS. 3a and 4a). The numbers of ribbons per IHC in transduced cells (10.0±1.3, mean±SD, n=48 cells from 3 mice treated on P17 and analysed on P80, and 8.9±2.3, n=48 cells from 3 mice treated on P30 and analyzed on P40) were higher than in non-transduced cells from the same cochleas (6.2±1.3, n=48 cells, and 5.8±0.7, n=48 cells, respectively; Mann-Whitney U test, p<10-4 for both comparisons), but they were lower than in IHCs of 10-week old wild-type mice (16±1.3, n=48 cells from 3 mice; Mann-Whitney U test, p<10-4 for both comparisons). As the number of ribbons per IHC was already markedly reduced in untreated Otof −/− mice analyzed on P15 (8.2±1.0, n=48 cells from 3 mice), and remained unexpectedly stable in the non-transduced IHCs of treated mice at later stages (see above the values for P40, P70, and P80), it can be inferred that gene therapy in the IHCs of Otof −/− mice increased the number of ribbons by promoting their production rather than preventing their degeneration.

[0182] Using the dual AAV gene therapy disclosed above, administered at p30 in the animals, it has also been possible to restore both the normal distribution of otoferlin and the hearing function to near normal ABR thresholds in a mouse model carrying a human thermosensible mutation in its DFNB9 gene (Otof.sup.ts/ts mice, FIG. 5).

[0183] More precisely, it has been shown that dual viral gene therapy overwrites otoferlin aggregates due to the human thermosensitive mutation in said DFNB9 mouse model (FIG. 9). In this experiment, a single unilateral injection of the AAV-Otof NT plus AAV-Otof CT recombinant vector pair was administered to Otof.sup.ts/ts mice through the round window membrane into the left cochlea, after hearing onset were carried out at P30. 5 weeks after the injection, the sensory epithelium of the treated cochleas of three Otof.sup.ts/ts mice was microdissected and immunolabeled for otoferlin (see FIG. 9). Otoferlin expression in the IHC (dashed lines) of the treated cochlea was found nearly normal when compared to the otoferlin aggregates in non-treated cochlea of the Otof.sup.ts/ts mouse (arrows).

[0184] It has been eventually found that said dual viral gene therapy restores the calcium currents and exocytosis of the IHC in this animal model, as shown on FIG. 10.