METHODS OF DIAGNOSING DISEASE

20220128556 · 2022-04-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The application provides new and improved methods for diagnosing IBS.

    Claims

    1.-40. (canceled)

    41. A method comprising: detecting in a biological sample from a subject the level of at least two of (i), (ii), and (iii): (i) a bacterial strain of a taxa associated with irritable bowel syndrome (IBS); (ii) a microbial gene involved in a pathway associated with IBS, wherein the pathway is selected from the group consisting of amino acid biosynthesis, amino acid degradation, starch degradation, galactose degradation, sulfate reduction, sulfate assimilation, and cysteine biosynthesis; or (iii) a metabolite associated with IBS, a precursor thereof, or a breakdown product thereof, wherein the metabolite is a urine metabolite or a fecal metabolite, and comparing the detected level of (i), (ii), or (iii) to the corresponding level of (i), (ii), or (iii) in a biological sample from a subject that does not have IBS, wherein the subject is determined to have IBS when there is an increase in the detected level of (i), (ii), or (iii) compared to the corresponding level of (i), (ii), or (iii) in the biological sample from the subject that does not have IBS.

    42. The method of claim 41, wherein the detecting of the bacterial strain comprises 16S amplicon sequencing or shotgun sequencing.

    43. The method of claim 41, wherein the detecting of the metabolite comprises performing gas chromatography and liquid chromatography mass spectrometry (GC/LC MS).

    44. The method of claim 41, wherein the biological sample comprises a fecal sample, a urine sample, or an oral sample.

    45. The method of claim 41, wherein the subject is a human.

    46. The method of claim 41, wherein the bacterial strain comprises a 16S rRNA gene sequence having at least 97% sequence identity to any one of SEQ ID NOs:1-10 or is of the group consisting of Lachnospiraceae, Firmicutes, Butyricicoccus, Clostridiales, and Ruminococcaceae.

    47. The method of claim 41, wherein the bacterial strain belongs to an operational taxonomic unit (OTU) selected from Table 11.

    48. The method of claim 41, wherein the pathway is selected from the group consisting of pathways listed in Table 4.

    49. The method of claim 41, wherein the detecting the microbial gene comprises detecting a bacterial species carrying the gene or detecting a nucleic acid sequence encoding the gene.

    50. The method of claim 41, wherein the urine metabolite comprises A 80987, Ala-Leu-Trp-Gly, Medicagenic acid 3-O-b-D-glucuronide, or (−)-Epigallocatechin sulfate or is selected from the group consisting of the metabolites listed in Table 6.

    51. The method of claim 41, wherein the subject is determined to have a subcategory of IBS based on the comparing.

    52. The method of claim 41, wherein the urine metabolite is: A 80987, Medicagenic acid 3-O-b-D-glucuronide, N-Undecanoylglycine, Ala-Leu-Trp-Gly, or Gamma-glutamyl-Cysteine, Tricetin 3′-methyl ether 7,5′-diglucuronide, Alloathyriol, Torasemide, (−)-Epigallocatechin sulfate, or Tetrahydrodipicolinate.

    53. The method of claim 41, wherein the urine metabolite is selected from the group consisting of the metabolites listed in Table 21a and Table 21b.

    54. The method of claim 41, wherein the fecal metabolite comprises 3-deoxy-D-galactose, Tyrosine, I-Urobilin, Adenosine, Glu-Ile-Ile-Phe, 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one, 2-Phenylpropionate, MG(20:3(8Z,11Z,14Z)/0:0/0:0), 1,2,3-Tris(1-ethoxyethoxy)propane, Staphyloxanthin, Hexoses, 20-hydroxy-E4-neuroprostane, Nonyl acetate, 3-Feruloyl-1,5-quinolactone, trans-2-Heptenal, Pyridoxamine, L-Arginine, Dodecanedioic acid, Ursodeoxycholic acid, 1-(Malonylamino)cyclopropanecarboxylic acid, Cortisone, 9,10,13-Trihydroxystearic acid, Glu-Ala-Gln-Ser, Quasiprotopanaxatriol, N-Methylindolo[3,2-b]-5alpha-cholest-2-ene, PG(20:0/22:1(11Z)), (−)-Epigallocatechin, 2-Methyl-3-ketovaleric acid, Secoeremopetasitolide B, PC(20:1(11Z)/P-16:0), Glu-Asp-Asp, N5-acetyl-N5-hydroxy-L-ornithine acid, Silicic acid, (1xi,3xi)-1,2,3,4-Tetrahydro-1-methyl-beta-carboline-3-carboxylic acid, PS(36:5), Chorismate, Isoamyl isovalerate, PA(O-36:4), PE(P-28:0) or gamma-Glutamyl-S-methylcysteinyl-beta-alanine.

    55. The method of claim 41, wherein the fecal metabolite is selected from the group consisting of metabolites listed in Table 8.

    56. The method of claim 41, wherein the fecal metabolite is selected from the group consisting of metabolites listed in Table 13.

    57. The method of claim 41, further comprising detecting two or more bacterial strains of two or more bacterial taxa associated with IBS, two or more microbial genes involved in a pathway associated with IBS, or two or more metabolites associated with IBS.

    58. The method of claim 41, wherein the method further comprises treating the subject determined to have IBS.

    59. A method of treating irritable bowel syndrome (IBS) in a subject in need thereof comprising administering to the subject a treatment for IBS selected from loperamide, a laxative, an antidepressant, an antibiotic, a probiotic, or a live biotherapeutic after detecting in a biological sample from the subject an elevated level of at least two of (i), (ii), and (iii): (i) a bacterial strain of a taxa associated with irritable bowel syndrome (IBS), wherein the bacteria strain comprises a 16S rRNA gene sequence having at least 97% sequence identity to any one of SEQ ID NOs:1-10, (ii) a microbial gene involved in a pathway associated with IBS, wherein the pathway is selected from the group consisting of amino acid biosynthesis, amino acid degradation, starch degradation, galactose degradation, sulfate reduction, sulfate assimilation, and cysteine biosynthesis, or (iii) a metabolite associated with IBS, a precursor thereof, or a breakdown product thereof, wherein the metabolite is a urine metabolite or a fecal metabolite, as compared to the corresponding level of (i), (ii), or (iii) in a biological sample from a subject that does not have IBS.

    60. A kit comprising reagents for detecting: a. a bacterial strain of a taxa associated with IBS, wherein the bacteria strain comprises a 16S rRNA gene sequence having at least 97% sequence identity to any one of SEQ ID NOs:1-10; b. a microbial gene involved in a pathway associated with IBS, wherein the pathway is selected from the group consisting of pathways listed in Table 4; or c. a metabolite associated with IBS, wherein the metabolite is a urine metabolite or a fecal metabolite.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0010] FIGS. 1A-1D. Microbiota compositional analysis of Control and IBS groups. (FIG. 1A) Principal Co-Ordinate Analysis (PCoA) of microbiota beta diversity showing significant difference between Control and IBS groups. PCoA performed using Spearman distance at 16S genus level (p-value=0.001; Control: n=63, IBS n=78). (FIG. 1B) Predictive taxa for IBS determined by Random Forest machine learning on shotgun dataset (Control: n=59; IBS n=80). (FIG. 1C) PCoA of the microbiota composition showing no significant difference between IBS clinical subtypes. PCoA performed using Spearman distance at 16S OTU level (p-value=0.976; IBS-C: n=29, IBS-D: n=20, IBS-M: n=29). (FIG. 1D) Shotgun genus profile of Control and IBS groups (Control: n=58, IBS: n=78). P-values for data/tests presented in panels A and C were calculated using Permutational MANOVA (R function/package:adonis/vegan)

    [0011] FIG. 2. PCoA of microbiota diversity shows significant difference between Control and IBS groups. PCoA performed using Spearman distance at shotgun genus level (p-value=0.001; Control: n=58, IBS n=78).

    [0012] FIGS. 3A-3C. Microbiota diversity of IBS and Control groups. (FIG. 3A). The diversity (Observed richness) of the IBS group was significantly different from the Control group based on Wilcoxon rank sum test (pvalue=9.215e-08, Control: n=63, IBS: n=78). (FIG. 3B) The diversity (observed richness) of the IBS clinical sub-types were significantly different from the Control group based on Kruskal-Wallis (p-value=1.28e-06, Control: n=63; IBS-C: n=29; IBS-D: n=20; IBS-M: n=29). (FIG. 3C) The diversity (Shannon index) of the Control was significantly different from the IBS group using differences based on Wilcoxon (p-value=0.00032, Control: n=63, IBS: n=78).

    [0013] FIGS. 4A-4C. Comparison of Control and IBS urine and fecal metabolomes. (FIG. 4A) PCoA of urine volatile organic compounds (FAIMS) metabolomes. Adonis p-value=0.001; (Control: n=65; IBS: n=80). (FIG. 4B) PCoA of urine MS metabolomics using Spearman distance. Adonis p-value=0.001; (Control: n=63; IBS: n=80). (FIG. 4C) PCoA of fecal MS metabolomics using Spearman distance. Adonis p-value=0.001; (Control: n=63; IBS: n=80). P-values we calculated using Permutational MANOVA (R function/package:adonis/vegan)

    [0014] FIG. 5. PCoA of FAIMS urine metabolomics using Spearman distance shows a significant difference between Control and IBS clinical sub-types (Adonis p-value=0.001; Control: n=63; IBS-C: n=29; IBS-D: n=20; IBS-M: n=29).

    [0015] FIGS. 6A-6B. Urine metabolomic Receiver operating characteristic (ROC) curves to distinguish IBS from Control status. (FIG. 6A) ROC curve analysis using 10-Fold cross-validation on urine LC/GC-MS metabolomics (Control: n=61; IBS: n=78 where 85% (52/61 of the control group and 95% (74/78) of the IBS group were correctly predicted. (FIG. 6B) ROC curve analysis using 10-Fold cross-validation on urine FAIMS metabolomics (Control: n=63; IBS: n=78 where 70% (44/63 of the control group and 83% (65/78) of the IBS group were correctly predicted.

    [0016] FIG. 7. PCoA of fecal metabolomics using Spearman distance shows no significant difference between the IBS clinical sub-types (p-value=0.202; IBS-C: n=29; IBS-D: n=20; IBS-M: n=29).

    [0017] FIG. 8. Between class analysis (BCA) showing two microbiota-IBS clusters when compared to the Control group (Control: n=63, IBS Cluster I: n=35, IBS Cluster II: n=43).

    [0018] FIG. 9. Core workflow of an alternative machine learning pipeline. N represents number of features returned by Least Absolute Shrinkage and Selection Operator (LASSO).

    [0019] FIG. 10. Principal Coordinate analysis of co-abundant genes in metagenomics samples shows a significant split between IBS (80 samples) and Controls (59 samples). Significance of the split was determined using PMANOVA (p<0.001).

    [0020] FIG. 11. Heatmap of microbiome OTU data with hierarchical clustering using Canberra distance and ward linkage.

    [0021] FIG. 12. Alpha diversity (observed species) of the healthy controls and the three IBS subgroups (IBS-1, IBS-2, IBS-3). Observed species (richness) is defined as the count of unique OTU's within a sample. Significance was determined using ANOVA.

    [0022] FIG. 13. PCoA of Canberra distances of healthy controls and the three IBS subgroups (IBS-1, IBS-2, IBS-3) at the genus level for samples sequenced using 16S.

    [0023] FIG. 14. PCoA of Canberra distances of healthy controls and the three IBS subgroups (IBS-1, IBS-2, IBS-3) at the species level for shotgun sequenced samples.

    [0024] FIG. 15. PCoA of Canberra distances of healthy controls and the three IBS subgroups (IBS-1, IBS-2, IBS-3) for the fecal metabolomics samples.

    [0025] FIG. 16. PCoA of Canberra distances of healthy controls and the three IBS subgroups (IBS-1, IBS-2, IBS-3) for the urine metabolomics samples.

    [0026] FIG. 17. Microbiota compositional analysis of Control and IBS groups. PCoA of the metagenomic species analysis (co-abundant genes, CAGs) showing a significant difference between Control and IBS groups. (Control: n=59; IBS n=80). P-values for data/tests presented were calculated using Permutational MANOVA (R function/package:adonis/vegan)

    DISCLOSURE OF THE INVENTION

    [0027] Bacterial Taxa as Predictive Features of IBS

    [0028] The inventors have identified bacterial taxa that are predictive of IBS, as demonstrated in the examples. Accordingly, the invention provides methods for diagnosing IBS comprising detecting the presence of certain bacterial taxa. As detailed below, the bacterial taxa used in the invention may be defined with reference to 16S rRNA gene sequences, or the invention may use Linnaean taxonomy. Bacteria of either category of taxa may be detected using Clade-specific bacterial genes, 16S sequences, transcriptomics, metabolomics, or a combination of such techniques. Preferably, these methods comprise detecting bacteria (i.e. one or more bacterial strains) in a fecal sample from a patient. Alternatively, the bacteria may be detected from an oral sample, such as a swab. Generally, detecting a bacterial taxa associated with IBS in the methods of the invention comprises measuring the relative abundance of the bacteria in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacterial species which may include one or more of the following genera: Actinomyces, Oscillibacter, Paraprevotella, Lachnospiraceae, Erysipelotrichaceae and Coprococcus. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting a bacterial strain belonging to a genus selected from the group consisting of: Escherichia, Clostridium, Streptococcus, Parabacteroides, Turicibacter, Eubacterium, Bacteroides, Klebsiella, Pseudoflavonifractor, and Enterococcus. In a particular embodiment, the bacterial species is of the genus Actinomyces. In a particular embodiment, the bacterial species is of the genus Oscillibacter. In a particular embodiment, the bacterial species is of the genus Paraprevotella. In a particular embodiment, the bacterial species is of the genus Lachnospiraceae. In a particular embodiment, the bacterial species is of the genus Erysipelotrichaceae. In a particular embodiment, the bacterial species is of the genus Coprococcus. In a particular embodiment, the bacterial species is of the genus Escherichia. In a particular embodiment, the bacterial species is of the genus Clostridium. In a particular embodiment, the bacterial species is of the genus Streptococcus. In a particular embodiment, the bacterial species is of the genus Parabacteroides. In a particular embodiment, the bacterial species is of the genus Turicibacter. In a particular embodiment, the bacterial species is of the genus Eubacterium. In a particular embodiment, the bacterial species is of the genus Bacteroides. In a particular embodiment, the bacterial species is of the genus Klebsiella. In a particular embodiment, the bacterial species is of the genus Pseudoflavonifractor. In a particular embodiment, the bacterial species is of the genus Enterococcus. In preferred embodiments, the method of the invention comprises detecting bacteria (i.e. one or more bacterial strains) of more than one of the genera listed in Table 1, such as detecting bacteria of Actinomyces, Oscillibacter, Paraprevotella, Lachnospiraceae, Erysipelotrichaceae and Coprococcus. In certain embodiments, the bacteria (i.e. one or more bacterial strains) may be detected using Clade-specific bacterial genes, 16S sequences, transcriptomics or metabolomics. In any such embodiments, detecting the bacteria comprises measuring the relative abundance of the bacteria in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. The examples demonstrate that such methods are particularly effective.

    [0029] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial species selected from the following: Ruminococcus gnavus, Coprococcus catus, Bamesiella intestinihominis, Anaerotruncus colihominis, Eubacterium eligens, Clostridium symbiosum, Roseburia inulinivorans, Paraprevotella clara, Ruminococcus lactaris, Clostridium citroniae, Clostridium leptum, Ruminococcus bromii, Bacteroides thetaiotaomicron, Eubacterium biforme, Bifidobacterium adolescentis, Parabacteroides distasonis, Dialister invisus, Bacteroides faecis, Butyrivibrio crossotus, Clostridium nexile, Bacteroides cellulosilyticus, Pseudoflavonifractor capillosus, Streptococcus anginosus, Streptococcus sanguinis, Desulfovibrio desulfuricans and/or Clostridium ramosum. In certain embodiments, the method of the invention comprises detecting two or more species from the above list, such as at least 5, 10, 15, 20 or all of the species. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial strains that may be selected from the list consisting of Lachnospiraceae bacterium_3_1_46FAA, Lachnospiraceae bacterium_7_1_58FAA, Lachnospiraceae bacterium_1_4_56FAA, Lachnospiraceae bacterium_2_1_58FAA, Coprococcus sp_ART55_1, Alistipes sp_AP11 and/or Bacteroides sp_1_1_6, or corresponding strains, such as strains with a 16S rRNA gene sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the 16S gene rRNA sequence of the reference bacterium. In certain embodiments, the method of the invention comprises detecting two or more bacteria from the above list, such as at least 3, 4, 5 or all of the bacteria. In any such embodiments, detecting the bacteria comprises measuring the relative abundance of the bacteria in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In certain embodiments, the bacteria (i.e. one or more bacterial strains) may be detected using Clade-specific bacterial genes, 16S sequences, transcriptomics or metabolomics.

    [0030] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial species selected from the following: Prevotella buccalis, Butyricicoccus pullicaecorum, Granulicatella elegans, Pseudoflavonifractor capillosus, Clostridium ramosum, Streptococcus sanguinis, Clostridium citroniae, Desulfovibrio desulfuricans, Haemophilus pittmaniae, Paraprevotella clara, Streptococcus anginosus, Anaerotruncus colihominis, Clostridium symbiosum, Mitsuokella multacida, Clostridium nexile, Lactobacillus fermentum, Eubacterium biforme, Clostridium leptum, Bacteroides pectinophilus, Coprococcus catus, Eubacterium eligens, Roseburia inulinivorans, Bacteroides faecis, Bamesiella intestinihominis, Bacteroides thetaiotaomicron, Ruminococcus bromii, Ruminococcus gnavus, Ruminococcus lactaris, Parabacteroides distasonis, Butyrivibrio crossotus, Bacteroides cellulosilyticus, Bifidobacterium adolescentis, and/or Dialister invisus. In certain embodiments, the method of the invention comprises detecting two or more species from the above list, such as at least 5, 10, 15, 20 or all of the species. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial strains that may be selected from the list consisting of Lachnospiraceae bacterium_2_1_58FAA, Lachnospiraceae bacterium_7_1_58FAA, Lachnospiraceae bacterium_1_4_56FAA, Lachnospiraceae bacterium_3_1_46FAA, Alistipes sp_AP11, Bacteroides_sp_1_1_6, and/or Coprococcus_sp_ART55_1, or corresponding strains, such as strains with a 16S rRNA gene sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the 16S gene rRNA sequence of the reference bacterium. In certain embodiments, the method of the invention comprises detecting two or more bacteria from the above list, such as at least 3 or 4 or all of the bacteria. In any such embodiments, detecting the bacteria (i.e. one or more bacterial strains) comprises measuring the relative abundance of the bacteria in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In certain embodiments, the bacteria (i.e. one or more bacterial strains) may be detected using clade-specific bacterial genes, 16S sequences, transcriptomics or metabolomics.

    [0031] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial strains belonging to an operational taxonomic unit (OTU) associated with IBS. As known in the art, an operational taxonomic unit (OTU) is an operational definition used to classify groups of closely related individuals. As used herein, an “OTU” is a group of organisms which are grouped by DNA sequence similarity of a specific taxonomic marker gene (49). In some embodiments, the specific taxanomic marker gene is the 16S rRNA gene. In some embodiments, the Ribosomal Database Project (RDP) taxonomic classifier is used to assign taxonomy to representative OTU sequences. For example, the sequence information in Table 12 can be used to classify whether bacteria (i.e. one or more bacterial strains) belong to the OTUs listed in Table 11. Bacteria having at least 97% sequence identity to the sequences in Table 12 belong to the corresponding OTUs in Table 11. In preferred embodiments, the OTU is selected from tables 1, 11 and/or 12. In any such embodiments, detecting the bacteria (i.e. one or more bacterial strains) comprises measuring the relative abundance of the bacteria in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0032] In certain embodiments, the bacterial species belongs to a sequence-based taxon. In preferred embodiments, the sequence-based taxon is selected from tables 1-3.

    [0033] In one embodiment, a bacterial species or strain predictive of IBS is more abundant in patients suffering from IBS. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial species or strain, wherein increased abundance is associated with IBS, and wherein the strain or species is selected from: Ruminococcus gnavus, Lachnospiraceae bacterium_3_1_46FAA, Lachnospiraceae bacterium_7_1_58FAA, Anaerotruncus colihominis, Lachnospiraceae bacterium_1_4_56FAA, Clostridium symbiosum, Clostridium citroniae, Lachnospiraceae bacterium_2_1_58FAA, Clostridium nexile, and/or Clostridium ramosum, In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial species or strains which is more abundant in patients suffering from IBS. In certain embodiments, the method of the invention comprises detecting two or more species or strains from the above list, such as at least 5, 10, 15, 20 or all of the species.

    [0034] In one embodiment, the bacterial species predictive of IBS is significantly more abundant in patients suffering from IBS. In a preferred embodiment, the bacterial species predictive of IBS that is significantly more abundant in patients suffering from IBS is Ruminococcus gnavus and/or Lachnospiraceae spp.

    [0035] In one embodiment, a bacterial species or strain predictive of IBS is less abundant in patients suffering from IBS. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial species or strain, wherein decreased abundance is associated with IBS, and wherein the strain or species is selected from: Coprococcus catus, Barnesiella intestinihominis, Eubacterium eligens, Paraprevotella clara, Ruminococcus lactaris, Eubacterium biforme, and/or Coprococcus sp_ART55_1. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial species or strains which are less abundant in patients suffering from IBS.

    [0036] In one embodiment, the bacterial species predictive of IBS is significantly less abundant in patients suffering from IBS. In a preferred embodiment, the bacterial species predictive of IBS that is significantly less abundant in patients suffering from IBS is Barnesiella intestinihominis and/or Coprococcus catus.

    [0037] In a particular embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacterial taxa which are predictive of IBS selected from table 2. In certain embodiments, the bacterial taxa predictive of IBS are significantly more abundant in patients suffering from IBS, for example as shown in tables 2 and/or 3. In other embodiments, the bacterial taxa predictive of IBS is significantly less abundant in patients suffering from IBS, for example as shown in tables 2 and/or 3.

    [0038] In one embodiment, a bacterial species or strain predictive of IBS is differentially abundant in patients suffering from IBS. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial species, wherein differential abundance is associated with IBS, and wherein the species is selected from: Ruminococcus gnavus, Clostridium bolteae, Anaerotruncus colihominis, Flavonifractor plautii, Clostridium clostridioforme, Clostridium hathewayi, Clostridium symbiosum, Ruminococcus torques, Alistipes senegalensis, Prevotella copri, Eggerthella lenta, Clostridium asparagiforme, Barnesiella intestinihominis, Clostridium citroniae, Eubacterium eligens, Clostridium ramosum, Coprococcus catus, Eubacterium biforme, Ruminococcus lactaris, Bacteroides massiliensis, Haemophilus parainfluenzae, Clostridium nexile, Clostridium innocuum, Bacteroides Xylanisolvens, Oxalobacter formigenes, Alistipes putredinis, Paraprevotella clara and/or Odoribacter splanchnicus. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial strain, wherein differential abundance is associated with IBS, and wherein the strain is selected from: Clostridiales bacterium 1 7 47FAA, Lachnospiraceae bacterium 1 4 56FA, Lachnospiraceae bacterium 51 57FAA, Lachnospiraceae bacterium 3 1 46FAA, Lachnospiraceae bacterium 7 1 58FAA, Coprococcus sp ART55 1, Lachnospiraceae bacterium 3 1 57FAA CT1, Lachnospiraceae bacterium 2 1 58FAA and/or Eubacterium sp 3 1 31. In certain embodiments, the bacteria (i.e. one or more bacterial strains) may be detected using Clade-specific bacterial genes, 16S sequences, transcriptomics or metabolomics.

    [0039] In one embodiment, a bacterial species or strain predictive of IBS is differentially abundant in patients suffering from IBS. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial species, wherein differential abundance is associated with IBS, and wherein the species is selected from: Escherichia coli, Streptococcus aginosus, Parabacteroides johnsonii, Streptococcus gordonii, Clostridium boltae, Turicibacter sanguinis, Paraprevotella Xylamphila, Streptococcus mutans, Bacteroides plebeius, Clostridium clostridioforme, Klebsiella pneumoniae, Clostridium hathewayi, Bacteroides fragilis, Prevotella disiens, Clostridium leptum, Pseudoflavonifractor capillosus, Bacteroides intestinalis, Enterococcus faecalis, Streptococcus infantis, Alistipes shahii, Clostridium asparagiforme, Clostridium symbiosum and/or Streptococcus sanguinis. In a particular embodiment, the method of the invention comprises measuring the abundance of a bacterial strain, wherein differential abundance is associated with IBS, and wherein the strain is selected from: Clostridiales bacterium 1 7 47FAA, Eubacterium sp 3 1 31, Lachnospiraceae bacterium 5 1 57FAA, Clostridiaceae bacterium JC118 and/or Lachnospiraceae bacterium 1 4 56FA. In certain embodiments, the bacteria (i.e. one or more bacterial strains) may be detected using Clade-specific bacterial genes, 16S sequences, transcriptomics or metabolomics.

    [0040] In one embodiment, the fecal microbiota alpha diversity of patients with IBS is reduced. In one embodiment, the intra-individual microbiota diversity of patients with IBS is reduced. In one embodiment, the fecal microbiota alpha diversity of patients with IBS is significantly lower than non-IBS patients. In one embodiment, the intra-individual microbiota diversity of patients with IBS is significantly lower than non-IBS patients. In a further embodiment, the microbiota alpha diversity is not significantly different between IBS clinical subtypes.

    [0041] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more bacterial strains belonging to an operational taxonomic unit (OTU) associated with IBS. In preferred embodiments, the OTU is selected from table 11. In one embodiment, the OTU associated with IBS is classified as belonging to the Firmicutes phylum. In a particular embodiment, the OTU associated with IBS is classified as belonging to the Clostridia class. In a particular embodiment, the OTU associated with IBS is classified as belonging to the Clostridiales order. In a particular embodiment, the OTU associated with IBS is classified as belonging to the Clostridiales Lachnospiraceae family or the Ruminococcaceae family. In a particular embodiment, the OTU associated with IBS is classified as belonging to the Butyricicoccus genus.

    [0042] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacterial strains belonging to one or more OTUs listed in Table 11. The sequences in Table 12 can be used to classify bacteria as belonging to the OTUs listed in Table 11. Bacteria (i.e. one or more bacterial strains) having at least 97% sequence identity to the sequences in Table 12 belong to the corresponding OTUs in Table 11. The alignment is across the length of the sequence. In both Metaphlan2 and HUMAnN2 runs, alignment for species composition is done using bowtie 2. Bowtie2 is run with “very-sensitive argument” and the alignment performed is “Global alignment”.

    [0043] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 1. In certain such embodiments, the bacteria is classified as belonging to the Lachnospiraceae family.

    [0044] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 2. In certain such embodiments, the bacteria is classified as belonging to the Firmicutes phylum.

    [0045] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 3. In certain such embodiments, the bacteria is classified as belonging to the Butyricicoccus genus.

    [0046] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 4. In certain such embodiments, the bacteria is classified as belonging to the Lachnospiraceae family.

    [0047] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 5. In certain such embodiments, the bacteria is classified as belonging to the Clostridiales order.

    [0048] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 6. In certain such embodiments, the bacteria is classified as belonging to the Ruminococcaceae family.

    [0049] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 7. In certain such embodiments, the bacteria is classified as belonging to the Ruminococcaceae family.

    [0050] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 8. In certain such embodiments, the bacteria is classified as belonging to the Firmicutes phylum.

    [0051] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No: 9. In certain such embodiments, the bacteria is classified as belonging to the Ruminococcaceae family.

    [0052] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting bacteria (i.e. one or more bacterial strains) having a 16S rRNA gene sequence at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to SEQ ID No:10. In certain such embodiments, the bacteria is classified as belonging to the Lachnospiraceae family.

    [0053] In preferred embodiments, the invention provides a method for diagnosing IBS, comprising detecting different bacteria (i.e. one or more bacterial strains) having 16S rRNA gene sequences at least 97% (e.g. 98%, 99%, 99.5% or 100%) identical to two or more of SEQ ID No:1-10, such as 5, 8, or all of SEQ ID No:1-10.

    [0054] Alteration of Pathways as a Predictor of IBS

    [0055] The inventors have identified that certain pathways are over or underrepresented in the genomes of the microbiota of patients suffering from IBS. Therefore, the invention provides methods for diagnosing IBS based on the presence or abundance of genes, pathways, or bacteria carrying such genes. Methods of diagnosis comprising detecting genes involved in one or more of the pathways identified herein may be particularly useful for use with different populations of patients because different patient populations may have different microbiome populations.

    [0056] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting microbial genes involved in one or more of the pathways selected from the list in table 4. In certain embodiments, the presence, or increased abundance relative to a control (non-IBS) individual, of genes involved in a pathway recited in Table 4 is associated with IBS. In a preferred embodiment, the method comprises detecting genes involved in amino acid biosynthesis/degradation pathways. The data show that these pathways are significantly more abundant in patients with IBS. In a preferred embodiment, the method comprises detecting genes involved in starch degradation V pathway. The data show that such genes are significantly more abundant in patients with IBS. In another embodiment, genes that are significantly more abundant in patients with IBS are associated with Lachnospiraceae and Ruminococcus species. In certain embodiments, the method of the invention comprises detecting genes involved in at least 2, 5, 10, 15, 20 or 30 of the pathways in table 4. In any such embodiments, detecting the genes comprises measuring the relative abundance of the genes, or bacteria carrying the genes in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In certain embodiments, the presence of the microbial genes is detected by detecting metabolites in the sample. In certain embodiments, the presence of the microbial genes is detected by detecting a taxa of bacteria know to carry the microbial genes.

    [0057] In other embodiments, the absence or decreased abundance relative to a control (non-IBS) individual of genes involved in a pathway are associated with IBS, for example as shown in table 4. In a preferred embodiment, genes involved in galactose degradation, sulfate reduction, sulfate assimilation and cysteine biosynthesis pathways are detected. The data show that these pathways are significantly less abundant in patients with IBS. In a particular embodiment, pathways indicative of sulphur metabolism are less abundant in patients with IBS. In any such embodiments, detecting the genes comprises measuring the relative abundance of the genes, or bacteria carrying the genes in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0058] In certain embodiments, methods comprising detecting the presence or absence or relative abundance of genes involved in a pathway comprise detecting nucleic acid sequences in a sample from the patient. Additionally or alternatively, the methods comprise detecting bacterial species known to carry the genes of the relevant pathway.

    [0059] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting the differential abundance of one or more pathways predictive of IBS relative to control (non-IBS) individuals. In a particular embodiment, the adenosine ribonucleotide de novo biosynthesis functional pathway is differentially abundant in IBS relative to control (non-IBS) individuals. In a preferred embodiment, the adenosine ribonucleotide de novo biosynthesis functional pathway is more abundant in IBS patients relative to control (non-IBS) individuals.

    [0060] Alteration of Metabolomes as a Predictor of IBS

    [0061] The inventors have identified metabolites that are associated with IBS and the invention provides methods for diagnosing IBS that comprise detecting such metabolites. Methods of diagnosis comprising detecting metabolites identified herein may be particularly useful for use with different populations of patients because different patient populations may have different microbiome populations, but there may be more uniformity in terms of detectable metabolites. Generally, detecting a metabolite associated with IBS in the methods of the invention comprises measuring the concentration of the metabolite in a sample or measuring changes in the concentration of a metabolite and optionally comparing the concentration to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In some embodiments, detecting a metabolite associated with IBS in the methods of the invention comprises measuring the concentration of a precursor of the metabolite and optionally comparing the concentration to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In some embodiments, detecting a metabolite associated with IBS in the methods of the invention comprises measuring the concentration of a breakdown product of the metabolite and optionally comparing the concentration to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In certain embodiments, the method comprises detecting a bacterial taxa known to produce a metabolite predictive of IBS.

    [0062] Alteration of Urine Metabolomes as a Predictor of Ibs

    [0063] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting urine metabolites which may include one or more of the following: A 80987, Ala-Leu-Trp-Gly, Medicagenic acid 3-O-b-D-glucuronide and/or (−)-Epigallocatechin sulfate. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites selected from the list in table 5. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In other embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, and normalising the concentration relative to urine creatinine levels in each sample. In some embodiments, the method comprises detecting a precursor or breakdown product of the above metabolites. In one embodiment, machine learning is applied to urine metabolome data to diagnose IBS.

    [0064] In a particular embodiment, the method comprises detecting adenosine, such as measuring the concentration of adenosine in a sample. The examples demonstrate that adenosine is more abundant in IBS patients relative to control (non-IBS) individuals. Thus, a level of adenosine that is increased relative to a healthy control is indicative of IBS.

    [0065] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that are differentially abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS). In one embodiment, the one or more urine metabolites that are differentially abundant in patients suffering from IBS are: N-Undecanoylglycine, Gamma-glutamyl-Cysteine, Alloathyriol, Trp-Ala-Pro, A 80987, Medicagenic acid 3-O-b-D-glucuronide, Ala-Leu-Trp-Gly, Butoctamide hydrogen succinate, (−)-Epicatechin sulfate, 1,4,5-Trimethyl-naphtalene, Tricetin 3′-methyl ether 7,5′-diglucuronide, Torasemide, (−)-Epigallocatechin sulfate, Dodecanedioylcarnitine, 1,6,7-Trimethylnaphthalene, Tetrahydrodipicolinate, Sumiki's acid, Silicic acid, Delphinidin 3-(6″-O-4-malyl-glucosyl)-5-glucoside, L-Arginine, Leucyl-Methionine, Phe-Gly-Gly-Ser, Gin-Met-Pro-Ser, Creatinine, Ala-Asn-Cys-Gly, 2-hydroxy-2-(hydroxymethyl)-2H-pyran-3(6H)-one, Thiethylperazine, 5-((2-iodoacetamido)ethyl)-1-aminonapthalene sulfate, dCTP, Isoleucyl-Proline, 3,4-Methylenesebacic acid, Dimethylallylpyrophosphate/Isopentenyl pyrophosphate, (4-Hydroxybenzoyl)choline, Diazoxide, 3,5-Di-O-galloyl-1,4-galactarolactone, 2-Hydroxypyridine, Decanoylcarnitine, Asp-Met-Asp-Pro, 3-Methyldioxyindole, (1S,3R,4S)-3,4-Dihydroxycyclohexane-1-carboxylate, Ala-Lys-Phe-Cys, 3-Indolehydracrylic acid, [FA (18:0)] N-(9Z-octadecenoyl)-taurine, Ferulic acid 4-sulfate, Urea, N-Carboxyacetyl-D-phenylalanine, 4-Methoxyphenylethanol sulfate, UDP-4-dehydro-6-deoxy-D-glucose, Linalyl formate, Demethyloleuropein, 5′-Guanosyl-methylene-triphosphate, Allyl nonanoate, 2-Phenylethyl octanoate, beta-Cellobiose, D-Galactopyranosyl-(1->3)-D-galactopyranosyl-(1->3)-L-arabinose, Cys-Phe-Phe-Gln, Hippuric acid, Cys-Pro-Pro-Tyr, Met-Met-Thr-Trp, methylphosphonate, 3′-Sialyllactosamine, 2,4,6-Octatriynoic acid, Delphinidin 3-O-3″,6″-O-dimalonylglucoside, L-Valine, Met-Met-Cys, Cysteinyl-Cysteine, (all-E)-1,8,10-Heptadecatriene-4,6-diyne-3,12-diol, L-Lysine, Pivaloylcarnitine, Lenticin, Phenol glucuronide, Tyrosyl-Cysteine, Osmundalin, Tetrahydroaldosterone-3-glucuronide, N-Methylpyridinium, L-prolyl-L-proline, Glutarylcarnitine, [FA (15:4)] 6,8,10,12-pentadecatetraenal, Methyl bisnorbiotinyl ketone, Acetoin, LysoPC(18:2(9Z,12Z)), Hexyl 2-furoate, N-carbamoyl-L-glutamate, L-Homoserine, L-Asparagine, Tiglylcarnitine, Thymine, 3-hydroxypyridine, Menadiol disuccinate, 9-Decenoylcarnitine, Pyrocatechol sulfate, sedoheptulose anhydride, (+)-gamma-Hydroxy-L-homoarginine, Thioridazine, Cys-Glu-Glu-Glu, Marmesin rutinoside, L-Serine, L-Urobilinogen, Isobutyrylglycine, S-Adenosylhomocysteine, 2,3-dioctanoylglyceramide, 3-Methoxy-4-hydroxyphenylglycol glucuronide, sulfoethylcysteine, Hydroxyphenylacetylglycine, Pyrroline hydroxycarboxylic acid, 1-(alpha-Methyl-4-(2-methylpropyl)benzeneacetate)-beta-D-Glucopyranuronic acid, 2-Methylbutylacetate, N1-Methyl-4-pyridone-3-carboxamide, Cortolone-3-glucuronide, Asn-Cys-Gly, N6,N6,N6-Trimethyl-L-lysine, Benzylamine, 5-Hydroxy-L-tryptophan, Armillaric acid, Leucine/Isoleucine, 2-Butylbenzothiazole, D-Sedoheptulose 7-phosphate, [Fv Dimethoxy,methyl(9:1)] (2S)-5,7-Dimethoxy-3′,4′-methylenedioxyflavanone, Oxoadipic acid, Thr-Cys-Cys, Creatine, Hydroxybutyrylcarnitine, 5′-Dehydroadenosine, Phe-Thr-Val, dUDP, L-Glutamine and/or Kaempferol 3-(2″,3″-diacetyl-4″-p-coumaroylrhamnoside). In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites predictive of IBS. In one embodiment, the urine metabolite predictive of IBS is selected from: N-Undecanoylglycine, Gamma-glutamyl-Cysteine, Alloathyriol, Trp-Ala-Pro, A 80987, Medicagenic acid 3-O-b-D-glucuronide, Ala-Leu-Trp-Gly, Butoctamide hydrogen succinate, (−)-Epicatechin sulfate, 1,4,5-Trimethyl-naphtalene, Tricetin 3′-methyl ether 7,5′-diglucuronide, Torasemide, (−)-Epigallocatechin sulfate, Dodecanedioylcarnitine, 1,6,7-Trimethylnaphthalene, Tetrahydrodipicolinate, Sumiki's acid, Silicic acid, Delphinidin 3-(6″-O-4-malyl-glucosyl)-5-glucoside, L-Arginine, Leucyl-Methionine, Phe-Gly-Gly-Ser, Gin-Met-Pro-Ser, Creatinine, Ala-Asn-Cys-Gly, 2-hydroxy-2-(hydroxymethyl)-2H-pyran-3(6H)-one, Thiethylperazine, 5-((2-iodoacetamido)ethyl)-1-aminonapthalene sulfate, dCTP, Isoleucyl-Proline, 3,4-Methylenesebacic acid, Dimethylallylpyrophosphate/Isopentenyl pyrophosphate, (4-Hydroxybenzoyl)choline, Diazoxide, 3,5-Di-O-galloyl-1,4-galactarolactone, 2-Hydroxypyridine, Decanoylcarnitine, Asp-Met-Asp-Pro, 3-Methyldioxyindole, (1S,3R,4S)-3,4-Dihydroxycyclohexane-1-carboxylate, Ala-Lys-Phe-Cys, 3-Indolehydracrylic acid, [FA (18:0)] N-(9Z-octadecenoyl)-taurine, Ferulic acid 4-sulfate, Urea, N-Carboxyacetyl-D-phenylalanine, 4-Methoxyphenylethanol sulfate, UDP-4-dehydro-6-deoxy-D-glucose, Linalyl formate, Demethyloleuropein, 5′-Guanosyl-methylene-triphosphate, Allyl nonanoate, 2-Phenylethyl octanoate, beta-Cellobiose, D-Galactopyranosyl-(1->3)-D-galactopyranosyl-(1->3)-L-arabinose, Cys-Phe-Phe-Gln, Hippuric acid, Cys-Pro-Pro-Tyr, Met-Met-Thr-Trp, methylphosphonate, 3′-Sialyllactosamine, 2,4,6-Octatriynoic acid, Delphinidin 3-O-3″,6″-0-dimalonylglucoside, L-Valine, Met-Met-Cys, Cysteinyl-Cysteine, (all-E)-1,8,10-Heptadecatriene-4,6-diyne-3,12-diol, L-Lysine, Pivaloylcarnitine, Lenticin, Phenol glucuronide, Tyrosyl-Cysteine, Osmundalin, Tetrahydroaldosterone-3-glucuronide, N-Methylpyridinium, L-prolyl-L-proline, Glutarylcarnitine, [FA (15:4)] 6,8,10,12-pentadecatetraenal, Methyl bisnorbiotinyl ketone, Acetoin, LysoPC(18:2(9Z,12Z)), Hexyl 2-furoate, N-carbamoyl-L-glutamate, L-Homoserine, L-Asparagine, Tiglylcarnitine, Thymine, 3-hydroxypyridine, Menadiol disuccinate, 9-Decenoylcarnitine, Pyrocatechol sulfate, sedoheptulose anhydride, (+)-gamma-Hydroxy-L-homoarginine, Thioridazine, Cys-Glu-Glu-Glu, Marmesin rutinoside, L-Serine, L-Urobilinogen, Isobutyrylglycine, S-Adenosylhomocysteine, 2,3-dioctanoylglyceramide, 3-Methoxy-4-hydroxyphenylglycol glucuronide, sulfoethylcysteine, Hydroxyphenylacetylglycine, Pyrroline hydroxycarboxylic acid, 1-(alpha-Methyl-4-(2-methylpropyl)benzeneacetate)-beta-D-Glucopyranuronic acid, 2-Methylbutylacetate, N1-Methyl-4-pyridone-3-carboxamide, Cortolone-3-glucuronide, Asn-Cys-Gly, N6,N6,N6-Trimethyl-L-lysine, Benzylamine, 5-Hydroxy-L-tryptophan, Armillaric acid, Leucine/Isoleucine, 2-Butylbenzothiazole, D-Sedoheptulose 7-phosphate, [Fv Dimethoxy,methyl(9:1)] (2S)-5,7-Dimethoxy-3′,4′-methylenedioxyflavanone, Oxoadipic acid, Thr-Cys-Cys, Creatine, Hydroxybutyrylcarnitine, 5′-Dehydroadenosine, Phe-Thr-Val, dUDP, L-Glutamine and/or Kaempferol 3-(2″,3″-diacetyl-4″-p-coumaroylrhamnoside).. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting differential abundance of one or more urine metabolites selected from the list in table 6. In certain embodiments, the method of the invention comprises detecting 2, 5, 10, 15 or 20 or all of the metabolites from table 6. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In some embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, and normalising the concentration relative to urine creatinine levels in each sample. In some embodiments, the method comprises detecting a precursor or breakdown product of the above metabolites.

    [0066] In certain embodiments, the abundance of urine metabolites is significantly increased in patients with IBS, for example as shown in table 6. In one embodiment, the method comprises detecting metabolites involved in fatty acid oxidation and/or fatty acid metabolism, which are significantly more abundant in patients with IBS. In a preferred embodiment, N-Undecanoylglycine is detected, which is significantly more abundant in patients with IBS. In another preferred embodiment, Decanoylcarnitine is detected, which is significantly more abundant in patients with IBS.

    [0067] In one embodiment, a urine metabolite predictive of IBS is more abundant in patients suffering from IBS compared to a healthy control. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that have been found to be predictive that a patient is suffering from IBS. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that are more abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS). In certain embodiments, the abundance of urine metabolites is increased in patients with IBS, for example as shown in table 6 and/or table 21b. In one embodiment, the one or more urine metabolites that are more abundant in patients suffering from IBS are: A 80987, Medicagenic acid 3-O-b-D-glucuronide, N-Undecanoylglycine, Ala-Leu-Trp-Gly, Gamma-glutamyl-Cysteine, Butoctamide hydrogen succinate, (−)-Epicatechin sulfate, 1,4,5-Trimethyl-naphtalene, Trp-Ala-Pro, Dodecanedioylcarnitine, 1,6,7-Trimethylnaphthalene, Sumiki's acid, Phe-Gly-Gly-Ser, 2-hydroxy-2-(hydroxymethyl)-2H-pyran-3(6H)-one, 5-((2-iodoacetamido)ethyl)-1-aminonapthalene sulfate, Thiethylperazine, dCTP, Dimethylallylpyrophosphate/Isopentenyl pyrophosphate, Asp-Met-Asp-Pro, 3,5-Di-O-galloyl-1,4-galactarolactone, Decanoylcarnitine, [FA (18:0)] N-(9Z-octadecenoyl)-taurine, UDP-4-dehydro-6-deoxy-D-glucose, Delphinidin 3-O-3″,6″-O-dimalonylglucoside, Osmundalin and/or Cysteinyl-Cysteine. In a preferred embodiment, one or more urine metabolites selected from: A 80987, Medicagenic acid 3-O-b-D-glucuronide, N-Undecanoylglycine, Ala-Leu-Trp-Gly, and/or Gamma-glutamyl-Cysteine are detected, which are more abundant in patients with IBS compared to healthy controls. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting an increase in abundance of one or more urine metabolites selected from the list in table 6 and/or table 21b. In certain embodiments, the method of the invention comprises detecting 2, 5, 10, 15 or 20 or all of the metabolites from table 6 and/or table 21b. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In some embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, and normalising the concentration relative to urine creatinine levels in each sample. In some embodiments, the method comprises detecting a precursor or breakdown product of the above metabolites. In a preferred embodiment, epicatechin sulfate is detected, which is more abundant in patients with IBS. In a preferred embodiment, medicagenic acid 3-O-b-D-glucuronide is detected, which is more abundant in patients with IBS.

    [0068] In certain embodiments, the abundance of urine metabolites is significantly decreased in patients with IBS, for example as shown in table 6. In one embodiment, the method comprises detecting metabolites involved in the biosynthesis of nitric oxide, which are significantly less abundant in patients with IBS. In one embodiment amino acids are significantly less abundant in patients with IBS, for example L-arginine.

    [0069] In one embodiment, a urine metabolite predictive of IBS is less abundant in patients suffering from IBS compared to a healthy control. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that have been found to be predictive that a patient is not suffering from IBS, i.e. that the patient is a healthy control. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that are less abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS). In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that are more abundant in healthy controls (i.e. from one or more subjects who does not suffer from IBS) compared to patients suffering from IBS. In certain embodiments, the abundance of urine metabolites is decreased in patients with IBS, for example as shown in table 6 and/or table 21a. In one embodiment, the one or more urine metabolites that are less abundant in patients suffering from IBS are: Tricetin 3′-methyl ether 7,5′-diglucuronide, Alloathyriol, Torasemide, (−)-Epigallocatechin sulfate, Tetrahydrodipicolinate, Silicic acid, Delphinidin 3-(6″-O-4-malyl-glucosyl)-5-glucoside, Creatinine, L-Arginine, Leucyl-Methionine, Gln-Met-Pro-Ser, Ala-Asn-Cys-Gly, Isoleucyl-Proline, 3,4-Methylenesebacic acid, (4-Hydroxybenzoyl)choline, Diazoxide, (1S,3R,4S)-3,4-Dihydroxycyclohexane-1-carboxylate, 2-Hydroxypyridine, Ala-Lys-Phe-Cys, 3-Methyldioxyindole, N-Carboxyacetyl-D-phenylalanine, Urea, Ferulic acid 4-sulfate, 3-Indolehydracrylic acid, Demethyloleuropein, 5′-Guanosyl-methylene-triphosphate, Linalyl formate, 4-Methoxyphenylethanol sulfate, Allyl nonanoate, D-Galactopyranosyl-(1->3)-D-galactopyranosyl-(1->3)-L-arabinose, Met-Met-Thr-Trp, Cys-Pro-Pro-Tyr, methylphosphonate, 2-Phenylethyl octanoate, Hippuric acid, Glutarylcarnitine and/or Cys-Phe-Phe-Gln. In a preferred embodiment, one or more urine metabolites selected from: Tricetin 3′-methyl ether 7,5′-diglucuronide, Alloathyriol, Torasemide, (−)-Epigallocatechin sulfate and/or Tetrahydrodipicolinate are detected, which are less abundant in patients with IBS compared to healthy controls. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting a decrease in abundance of one or more urine metabolites selected from the list in table 6 and/or table 21a. In certain embodiments, the method of the invention comprises detecting 2, 5, 10, 15 or 20 or all of the metabolites from table 6 and/or table 21a. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In some embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, and normalising the concentration relative to urine creatinine levels in each sample. In some embodiments, the method comprises detecting a precursor or breakdown product of the above metabolites.

    [0070] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more urine metabolites that are differentially abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS). In a preferred embodiment, the one or more urine metabolites that are differentially abundant in patients suffering from IBS are sulfate, glucuronide, carnitine, glycine and glutamine conjugates. In one embodiment, the method comprises detecting metabolites involved in phase 2 metabolism, which are is upregulated in patients with IBS. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In other embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, and normalising the concentration relative to urine creatinine levels in each sample.

    [0071] Alteration of Fecal Metabolomes as a Predictor of IBS

    [0072] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites selected from: 3-deoxy-D-galactose, Tyrosine, I-Urobilin, Adenosine, Glu-Ile-Ile-Phe, 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one, 2-Phenylpropionate, MG(20:3(8Z,11Z,14Z)/0:0/0:0), 1,2,3-Tris(1-ethoxyethoxy)propane, Staphyloxanthin, Hexoses, 20-hydroxy-E4-neuroprostane, Nonyl acetate, 3-Feruloyl-1,5-quinolactone, trans-2-Heptenal, Pyridoxamine, L-Arginine, Dodecanedioic acid, Ursodeoxycholic acid, 1-(Malonylamino)cyclopropanecarboxylic acid, Cortisone, 9,10,13-Trihydroxystearic acid, Glu-Ala-Gln-Ser, Quasiprotopanaxatriol, N-Methylindolo[3,2-b]-5alpha-cholest-2-ene, PG(20:0/22:1(11Z)), (−)-Epigallocatechin, 2-Methyl-3-ketovaleric acid, Secoeremopetasitolide B, PC(20:1(11Z)/P-16:0), Glu-Asp-Asp, N5-acetyl-N5-hydroxy-L-ornithine acid, Silicic acid, (1xi,3xi)-1,2,3,4-Tetrahydro-1-methyl-beta-carboline-3-carboxylic acid, PS(36:5), Chorismate, Isoamyl isovalerate, PA(0-36:4), PE(P-28:0) and/or gamma-Glutamyl-S-methylcysteinyl-beta-alanine. In certain embodiments, the method of the invention comprises detecting at least 2, 5, 10, 15 or 20 or all of these metabolites. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0073] In one embodiment, the invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites selected from: L-Phenylalanine, Adenosine, MG(20:3(8Z,11Z,14Z)/0:0/0:0), L-Alanine, 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one, Glu-Ile-Ile-Phe, Glu-Ala-Gln-Ser, 2,4,8-Eicosatrienoic acid isobutylamide, Piperidine, Staphyloxanthin, beta-Carotinal, Hexoses, Ile-Arg-Ile, 11-Deoxocucurbitacin I, 1-(Malonylamino)cyclopropanecarboxylic acid, PG(37:2), [PR] gamma-Carotene/beta,psi-Carotene, 20-hydroxy-E4-neuroprostane, Ethylphenyl acetate, Dodecanedioic acid, Ile-Lys-Cys-Gly, Tuberoside, D-galactal, 3,6-Dihydro-4-(4-methyl-3-pentenyl)-1,2-dithiin, demethylmenaquinone-6, L-Arginine, PC(o-16:1(9Z)/14:1(9Z)), Mesobilirubinogen, Traumatic acid, alpha-Tocopherol succinate, 3-Methylcrotonylglycine, (S)-(E)-8-(3,6-Dimethyl-2-heptenyl)-4′,5,7-trihydroxyflavanone, xi-7-Hydroxyhexadecanedioic acid, beta-Pinene, Leu-Ser-Ser-Tyr, Orotic acid, Heptane-1-thiol, Glu-Asp-Asp, LysoPE(18:2(9Z,12Z)/0:0), LysoPE(22:0/0:0), Creatine, Inosine, SM(d32:2), Arg-Leu-Val-Cys, PS(0-18:0/15:0), Pyridoxamine, N-Heptanoylglycine, Hematoporphyrin IX, 3beta,5beta-Ketotriol, 2-Phenylpropionate, trans-2-Heptenal, LysoPC(0:0/18:0), Linoleoyl ethanolamide, LysoPE(24:0/0:0), 2-Methyl-3-hydroxyvaleric acid, Quasiprotopanaxatriol, N-oleoyl isoleucine, (−)-(E)-1-(4-Hydroxyphenyl)-7-phenyl-6-hepten-3-ol, [FA hydroxy(4:0)] N-(3S-hydroxy-butanoyl)-homoserine lactone, Riboflavin cyclic-4′,5′-phosphate, Arg-Lys-Trp-Val, PC(20:1(11Z)/P-16:0), 3,5-Dihydroxybenzoic acid, Tyrosine, 2,3-Epoxymenaquinone, His-Met-Val-Val, PI(41:2), Phenol, 3,3′-Dithiobis[2-methylfuran], Ala-Leu-Trp-Pro, 1,2,3-Tris(1-ethoxyethoxy)propane, Vanilpyruvic acid, 2-Hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate, Secoeremopetasitolide B, 2-O-Benzoyl-D-glucose, Ile-Leu-Phe-Trp, (R)-lipoic acid, PA(20:4(5Z,8Z,11Z,14Z)e/2:0), PE(P-16:0e/0:0), Benzyl isobutyrate, Hexyl 2-furoate, Trp-Ala-Ser, LysoPC(15:0), 4-Hydroxycrotonic acid, 3-Feruloyl-1,5-quinolactone, Furfuryl octanoate, PC(22:2(13Z,16Z)/15:0), (−)-1-Methylpropyl 1-propenyl disulphide, PC (36:6), Leucyl-Glycine, CE(16:2), Triterpenoid, Violaxanthin, [FA hydroxy(17:0)] heptadecanoic acid, 2-Hydroxyundecanoate, Chorismate, delta-Dodecalactone, 3-O-Protocatechuoylceanothic acid, PG(16:1(9Z)/16:1(9Z)), p-Cresol sulfate, Quercetin 3′-sulfate, PS(26:0)), Ala-Leu-Phe-Trp, L-Glutamic acid 5-phosphate, N,2,3-Trimethyl-2-(1-methylethyl)butanamide, Isoamyl isovalerate, n-Dodecane, PC(14:1(9Z)/14:1(9Z)), Lucyoside Q, Endomorphin-1, 3-Hydroxy-10′-apo-b,y-carotenal, Pyrroline hydroxycarboxylic acid, S-Propyl 1-propanesulfinothioate, N-Methylindolo[3,2-b]-5alpha-cholest-2-ene, Tocopheronic acid, 1-(2,4,6-Trimethoxyphenyl)-1,3-butanedione, Homogentisic acid, LysoPE(18:1(9Z)/0:0), N-stearoyl valine, trans-Carvone oxide, 1,1′-Thiobis-1-propanethiol, 2-(Ethylsulfonylmethyl)phenyl methylcarbamate, menaquinone-4, Benzeneacetamide-4-O-sulphate, N5-acetyl-N5-hydroxy-L-ornithine, Succinic acid, Asn-Lys-Val-Pro, LysoPC(14:1(9Z)), Phenol glucuronide, 2-methyl-Butanoic acid, 2-methylbutyl ester, 3-O-Caffeoyl-1-O-methylquinic acid, [FA hydroxy(24:0)] 3-hydroxy-tetracosanoic acid, N-(2-hydroxyhexadecanoyl)-sphinganine-1-phospho-(1′-myo-inositol), gamma-Dodecalactone, PA(22:1(11Z)/0:0), Butyl butyrate, TG(20:5(5Z,8Z,11Z,14Z,17Z)/18:1(9Z)/22:5(7Z,10Z,13Z,16Z,19Z))[iso6], Clausarinol, 4-Methyl-2-pentanone, Trigoneline, Arg-Val-Pro-Tyr, 2,3-Methylenesuccinic acid, Serinyl-Threonine, Lycoperoside D, Geraniol, 1-18:2-lysophosphatidylglycerol, omega-6-Hexadecalactone, Ambrettolide, gamma-Glutamyl-S-methylcysteinyl-beta-alanine, FA oxo(22:0), D-Ribose, LysoPC(17:0), PA(0-36:4), C19 Sphingosine-1-phosphate, 4-Hydroxy-5-(dihydroxyphenyl)-valeric acid-O-methyl-O-sulphate, PE(14:1(9Z)/14:0), Citronellyl tiglate, Ethyl methylphenylglycidate (isomer 1), N-Acetyl-leu-leu-tyr and/or PS(O-34:3). In certain embodiments, the method of the invention comprises detecting at least 2, 5, 10, 15 or 20 or all of these metabolites. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0074] In a preferred embodiment, method comprises detecting the fecal metabolite L-tyrosine. In a preferred embodiment, the method comprises detecting L-arginine. In a preferred embodiment, method comprises detecting the bile acid ursodeoxycholic acid (UDCA). In a preferred embodiment, the method comprises detecting bile pigment lurobilin. In a preferred embodiment, the method comprises detecting dodecanedioic acid. In a preferred embodiment, the method comprises detecting L-Phenylalanine. In a preferred embodiment, the method comprises detecting L-Phenylalanine. In a preferred embodiment, the method comprises detecting Adenosine. In a preferred embodiment, the method comprises detecting MG(20:3(8Z,11Z,14Z)/0:0/0:0). In a preferred embodiment, the method comprises detecting L-Alanine. In a preferred embodiment, the method comprises detecting 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one.

    [0075] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites selected from the list in table 7. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites selected from the list in table 13. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value. In one embodiment, machine learning is applied to fecal metabolome data to diagnose IBS.

    [0076] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites that are differentially abundant in patients suffering from IBS. In one embodiment, the one or more fecal metabolites that are differentially abundant in patients suffering from IBS are: 2-Phenylpropionate, 3-Buten-1-amine, Adenosine, I-Urobilin, 2,3-Epoxymenaquinone, [FA (22:5)] 4,7,10,13,16-Docosapentaynoic acid, 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one, Cucurbitacin S, N-Heptanoylglycine, 11-Deoxocucurbitacin I, Staphyloxanthin, Piperidine, Leu-Ser-Ser-Tyr, L-Urobilin, L-Phenylalanine, Ala-Leu-Trp-Pro, 3-Feruloyl-1,5-quinolactone, PG(P-16:0/14:0), 3-deoxy-D-galactose, MG(20:3(8Z,11Z,14Z)/0:0/0:0), Mesobilirubinogen, L-Alanine, Tyrosine, PG(O-30:1), beta-Pinene, 2,4,8-Eicosatrienoic acid isobutylamide, Glutarylglycine, [PR] gamma-Carotene/beta,psi-Carotene, Neuromedin B (1-3), Heptane-1-thiol, Violaxanthin, Isolimonene, Ile-Lys-Cys-Gly, His-Met-Val-Val, Allyl caprylate, Hydroxyprolyl-Tryptophan, Dodecanedioic acid, 2-O-Benzoyl-D-glucose, 2-Ethylsuberic acid, D-Urobilin, 20-hydroxy-E4-neuroprostane, PG(O-31:1), Anigorufone, Nonyl acetate, L-Arginine, PG(P-32:1), Glu-Ala-Gln-Ser, PG(31:0), Cucurbitacin I, Arg-Lys-Phe-Val, Genipinic acid, Hexoses, Lys-Phe-Phe-Phe, PI(41:2), D-galactal, Traumatic acid, Adenine, PC(22:2(13Z,16Z)/15:0), 2-Phenylethyl beta-D-glucopyranoside, PG(37:2), Glycerol tributanoate, Arg-Leu-Pro-Arg, 2-O-p-Coumaroyl-D-glucose, 3,4-Dihydroxyphenyllactic acid methyl ester, PG(P-28:0), PG(34:0), L-Lysine, Ribitol, LysoPE(18:2(9Z,12Z)/0:0), PA(20:4(5Z,8Z,11Z,14Z)e/2:0), 5-Dehydroshikimate, Threoninyl-Isoleucine, L-Methionine, PS(26:0)), alpha-Pinene, Fenchene, Glu-Ile-Ile-Phe, Gln-Phe-Phe-Phe, Ursodeoxycholic acid, PC(34:2), 3,17-Androstanediol glucuronide, Pyridoxamine, [ST hydrox] (25R)-3alpha,7alpha-dihydroxy-5beta-cholestan-27-oyl taurine, PA(42:2), [FA (16:0)] 2-bromo-hexadecanal, 3,6-Dihydro-4-(4-methyl-3-pentenyl)-1,2-dithiin, 3-Methylcrotonylglycine xi-7-Hydroxyhexadecanedioic acid, Camphene, 2-Hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate, 7C-aglycone, 1-(3-Aminopropyl)-4-aminobutanal, Benzyl isobutyrate, (S)-(E)-8-(3,6-Dimethyl-2-heptenyl)-4′,5,7-trihydroxyflavanone, 1,3-di-(5Z,8Z,11Z,14Z,17Z-eicosapentaenoyl)-2-hydroxy-glycerol (d5), SM(d18:0/18:0), L-Homoserine, 17beta-(Acetylthio)estra-1,3,5(10)-trien-3-ol acetate, [ST (2:0)] 5beta-Chola-3,11-dien-24-oic Acid, PG(33:2), PE(22:4(7Z,10Z,13Z,16Z)/P-16:0), Protoporphyrinogen IX, alpha-Tocopherol succinate, Methyl (9Z)-6′-oxo-6,5′-diapo-6-carotenoate, PG(16:1(9Z)/16:1(9Z)), PC(o-22:1(13Z)/20:4(8Z,11Z,14Z,17Z)), PG(31:2), alpha-phellandrene, [PS (12:0/13:0)] 1-dodecanoyl-2-tridecanoyl-sn-glycero-3-phosphoserine (ammonium salt), Glu-Asp-Asp, PG(33:1), PA(0-20:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)), [FA oxo(19:0)] 18-oxo-nonadecanoic acid, PG(16:1(9Z)/18:0), Leu-Val, demethylmenaquinone-6, PC(o-16:1(9Z)/14:1(9Z)), PG(P-32:0), (24E)-3beta,15alpha,22S-Triacetoxylanosta-7,9(11),24-trien-26-oic acid, PA(33:5), LysoPC(0:0/18:0), Ile-Arg-Ile, Lauryl acetate, Glu-Glu-Gly-Tyr, 3-(Methylthio)-1-propanol, (−)-(E)-1-(4-Hydroxyphenyl)-7-phenyl-6-hepten-3-ol, Dimethyl benzyl carbinyl butyrate and/or Methyl 2,3-dihydro-3,5-dihydroxy-2-oxo-3-indoleacetic acid. In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting differential abundance of one or more fecal metabolites selected from the list in table 8. In certain embodiments, the method of the invention comprises detecting at least 2, 5, 10, 15 or 20 or all of these metabolites. In some embodiments, the method comprises detecting a precursor or breakdown product of the above metabolites.

    [0077] In certain embodiments, the abundance of metabolites is significantly increased in patients with IBS, for example as shown in table 8. In one embodiment, bile acids are significantly more abundant in patients with IBS. In a particular embodiment, [ST hydroxy] (25R)-3alpha,7alpha-dihydroxy-5beta-cholestan-27-oyl taurine is detected or is measured. It is significantly more abundant in patients with IBS. In a particular embodiment, [ST (2:0)] 5beta-Chola-3,11-dien-24-oic acid is detected or is measured. It is significantly more abundant in patients with IBS. In a particular embodiment, UDCA is detected or is measured, it is significantly more abundant in patients with IBS. In another embodiment, amino acids are significantly more abundant in patients with IBS. for example tyrosine and/or lysine. In particular embodiments, the method of the invention comprises detecting or quantifying the levels of tyrosine or lysine in a sample and diagnosing IBS. In certain embodiments, the abundance of metabolites is significantly decreased in patients with IBS, for example as shown in table 8.

    [0078] In one embodiment, the present invention provides a method for diagnosing IBS, comprising detecting one or more fecal metabolites that are differentially abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS). In a preferred embodiment, the one or more fecal metabolites that are differentially abundant in patients suffering from IBS are sulfate, glucuronide, carnitine, glycine and glutamine conjugates. In one embodiment, the method comprises detecting metabolites involved in phase 2 metabolism, which are is upregulated in patients with IBS. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0079] In one embodiment, the present invention provides a method for diagnosing IBS-D (IBS associated with diarrhoea), comprising detecting one or more fecal metabolites that are differentially abundant in patients suffering from IBS-D. In one embodiment, bile acids are differentially abundant in patients with IBS-D. In one embodiment, total bile acid, secondary bile acids, sulphated bile acids, UDCA and/or conjugated bile acids are differentially abundant in patients with IBS-D. In a particular embodiment, total bile acid is differentially abundant in patients with IBS-D. In a particular embodiment, secondary bile acids are differentially abundant in patients with IBS-D. In a particular embodiment, sulphated bile acids are differentially abundant in patients with IBS-D. In a particular embodiment, UDCA is differentially abundant in patients with IBS-D. In a particular embodiment, conjugated bile acids are differentially abundant in patients with IBS-D. In any such embodiments, detecting the metabolite comprises measuring the concentration of the metabolite in a sample, for example the concentration relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0080] Methods of Detecting Urine Metabolites

    [0081] GC/LC-MS

    [0082] Metabolites may be detected by any suitable method known in the art. In one embodiment, urine metabolites that are differentially abundant in patients suffering from IBS compared to a healthy control (i.e. from one or more subjects who does not suffer from IBS) are detected using GC/LC-MS.

    [0083] In a particular embodiment, GC/LC-MS is preferably used for detecting urine metabolites that are predictive of IBS. For urine metabolomics, the values of metabolites may be normalized with reference to urine creatinine levels in each sample.

    [0084] FAIMS (High Field Asymmetric Waveform Ion Mobility Spectrometry)

    [0085] In one embodiment, urine metabolites that are differentially abundant in patients suffering from IBS are detected using FAIMS. In a particular embodiment, FAIMS is preferably used for detecting urine metabolites that are predictive of IBS. For urine metabolomics, the values of metabolites may be normalized with reference to urine creatinine levels in each sample.

    [0086] Ion mobility spectrometry (IMS) is a well-known technique for analysing ion separation in the gaseous phase based on differences in ion mobilities under the influence of an electric field. Field Asymmetric Ion Mobility Spectrometry (FAIMS) is a specific example of an IMS technique that uses a high voltage asymmetric waveform at radio frequency combined with a static compensation voltage applied between two electrodes to separate ions at atmospheric pressure. Different ions pass through the electric fields to a detector at different compensation voltages. Thus, by varying the compensation voltage, a FAIMS analyser can detect the presence of different ions in the sample. The FAIMS instrument benefits from small size and lack of pumping requirements, allowing for portability as a standalone instrument. FAIMS is described in more detail in reference (20).

    [0087] The FAIMS output consists of two modes: a positive mode (for positively charged ions) and a negative mode (for negatively charged ions). Each of these modes is made up of 51 dispersion fields (DFs), totaling 102 DFs taking both modes into account. Each DF is applied to the testing sample following the principle of linear sweep voltammetry, i.e. the compensation voltage is varied from a starting value to an end value, separated by 512 equally spaced voltages. The ion current value at each of the equally spaced voltages is measured. Each pair of compensation voltage and measured ion current can be referred to as a data point. Across all dispersion fields for both the positive and negative modes, there are 52224 data points.

    [0088] Previous applications of FAIMS have used the method to study gastrointestinal toxicity, bile acid diarrhoea, and colorectal cancer. For example, PCT application WO 2016/038377 describes a method for diagnosing coeliac disease or bile acid diarrhoea by analysing the concentration of a signature compound in a body sample from a test subject using FAIMS and comparing this concentration with a reference for the concentration of the signature compound in an individual who does not suffer from the disease. An increase in the concentration of the signature compound in the body sample from the test subject compared to the reference suggests that the subject is suffering from the disease being screened for, or has a pre-disposition thereto, or provides a negative prognosis of the subject's condition.

    [0089] In use, the FAIMS analyser is operated by running the device with air (no sample) and water, to clean the analyser. A urine sample is then introduced to obtain the signals. The FAIMS analyser is operated with water and then with air again before the next test sample is run. The signals from all of the dispersion fields are then aligned using crosscorrelation.

    [0090] In some embodiments, the method of diagnosing IBS of the present invention is a computer-implemented method. In a preferred embodiment, the computer-implemented method is a method for analysing a FAIMS profile of a urine sample to determine the presence or absence of IBS and/or classify the urine sample into an IBS subset is provided. The method comprises: [0091] obtaining signals corresponding to the FAIMS profile of the urine sample, air, and water; [0092] pre-processing the obtained signals by performing one or more of: smoothing the signals, trimming off baseline noise from the signals, and aligning the signals in regions of interest; [0093] extracting a plurality of features from the pre-processed signal; and [0094] applying a trained classifier using the extracted features to determine the presence or absence of IBS and/or classify the urine sample into an IBS subset.

    [0095] Advantageously, by applying signal smoothing to the received signals, the raw signal strength is retained while reducing the ‘noise’ in the signal. By trimming the signal, noise is reduced, improving the quality of the output and reducing technical artefacts between runs caused by crosscontamination and carry-over signals.

    [0096] Overall, the method retains more features for analysis compared to the prior art method, which, in the context of a diagnostic application, improves the capability to distinguish between populations and stratify subgroups within a population.

    [0097] Preferably, pre-processing the obtained signals comprises all three steps of smoothing the signals, trimming off baseline noise from the signals, and aligning the signals in regions of interest.

    [0098] Obtaining the FAIMS signal may comprise analysing the biological sample with a FAIMS system to produce a signal corresponding to the FAIMS profile of the biological sample.

    [0099] Preferably, the signal smoothing is performed using a Savitzky-Golay filter, as described in Anal. Chem., 36(8), 1964, Savitzky A., Golay M J E. “Smoothing and Differentiation of Data by Simplified Least Squares Procedures”, pages 1627-1639 (21). Using a Savitzky-Golay filter is advantageous because it keeps the peak signal values intact, which can improve the accuracy of the classification. The signal smoothing may be applied to the dispersion fields of both positive and negative modes of the signal.

    [0100] The signal trimming may be performed using an optimised baseline cut-off. The signal alignment may be performed using cross correlation.

    [0101] Selection of features from the signals may be performed using a linear regression model, for example LASSO. LASSO is described in more detail in Journal of the Royal Statistical Society, Series B, 58(1), 1996, R. Tibshirani, “Regression Shrinkage and Selection via the Lasso”, pages 267-288 (22).

    [0102] The trained classifier is preferably a support vector machine. Alternatively, the classifier may be a random forest. In a preferred embodiment, the classifier is a random forest.

    [0103] Integrative Analysis of Diet, Microbiome and Metabolome in IBS Patients

    [0104] In certain embodiments, the invention provides a method of diagnosing IBS comprising one or more of i) detecting a bacterial species, for example as discussed above, ii) detecting genes involved in one or more of the pathways, for example as discussed above, iii) detecting metabolites, for example as discussed above. In any such embodiments, detecting the bacteria, gene or metabolite comprises measuring the abundance or concentration of said marker in a sample, for example the relative to a corresponding sample from a control (non-IBS) individual or relative to a reference value.

    [0105] In one embodiment, the invention provides a method of diagnosing IBS, comprising detecting the depletion of a bacterial species. In one embodiment, the depleted bacterial species is one or more of the following: Paraprevotella species, Bacteroides species, Barnesiella intestinihominis, Eubacterium eligens, Ruminococcus lactaris, Eubacterium biforme, Desulfovibrio desulfuricans, Coprococcus species and Eubacterium species. In certain embodiments, the method of the invention comprises detecting one or more of Paraprevotella species, Bacteroides species, Barnesiella intesfinihominis, Eubacterium eligens, Ruminococcus lactaris, Eubacterium biforme, Desulfovibrio desulfuricans, Coprococcus species and Eubacterium species.

    [0106] In one embodiment, the invention provides a method of diagnosing IBS, comprising detecting the differential utilisation of dietary components. In a particular embodiment, the invention provides a method of diagnosing IBS, comprising detecting the differential utilisation of a high protein diet.

    [0107] In one embodiment, the invention provides a method of diagnosing IBS, comprising detecting higher levels of peptides and amino acids. In another embodiment, the invention provides a method of diagnosing IBS, comprising detecting increased levels of L-alanine, L-lysine, L-methionine, L-phenylalanine and/or tyrosine.

    [0108] In one embodiment, the invention provides a method of diagnosing IBS, comprising detecting increased levels of bile acids. In a particular embodiment, the invention provides a method of diagnosing IBS, comprising detecting increased levels of UDCA, sulfolithocholylglycine and [ST hydrox](25R)-3alpha,7alpha-dihydroxy-5beta-cholestan-27-oyl taurine and/or Iurobilin.

    [0109] In one embodiment, the invention provides a method of diagnosing IBS, comprising detecting increased levels of metabolites. In another embodiment, the invention provides a method of diagnosing IBS, comprising detecting increased levels of allantoin, cis-4-decenedioic acid, decanoylcarnitine and/or dodecanedioylcarnitine.

    [0110] Diagnostic Methods

    [0111] The inventors have developed new and improved methods for diagnosing IBS.

    [0112] In preferred embodiments, the methods of the invention are for use in diagnosing a patient resident in Europe, such as Northern Europe, preferably Ireland or a patient that has a European, Northern European or Irish diet. The examples demonstrate that the methods of the invention are particular effective for such patients.

    [0113] In certain embodiments of any aspect of the invention, the abundance of bacteria, genes or metabolites is assessed relative to control (non-IBS) individuals. In preferred embodiments, the abundance of urine metabolites is assessed relative to control (non-IBS) individuals. Such reference values may be generated using any technique established in the art.

    [0114] In certain embodiments of any aspect of the invention, comparison to a corresponding sample from a control (non-IBS) individual is a comparison to a corresponding sample from a healthy individual.

    [0115] Preferably the method of diagnosing IBS has a sensitivity of greater than 40% (e.g. greater than 45%, 50% or 52%, e.g. 53% or 58%) and a specificity of greater than 90% (e.g. greater than 93% or 95%, e.g. 96%).

    [0116] In certain embodiments, the method of diagnosis is a method of monitoring the course of treatment for IBS.

    [0117] In certain embodiments, the step of detecting the presence or abundance of bacteria, such as in a fecal sample, comprises a nucleic acid based quantification methodology, for example 16S rRNA gene amplicon sequencing. Methods for qualitative and quantitative determination of bacteria in a sample using 16S rRNA gene amplicon sequencing are described in the literature and will be known to a person skilled in the art. Other techniques may involve PCR, rtPCR, qPCR, high throughput sequencing, metatranscriptomic sequencing, or 16S rRNA analysis.

    [0118] In alternative aspects of any embodiment of the invention, the invention provides a method for diagnosing the risk of developing IBS.

    [0119] In any embodiment of the invention, modulated abundance of a bacterial strain, species, metabolite or gene pathway is indicative of IBS. In preferred embodiments, the abundance of the bacterial strain, species or OTU as a proportion of the total microbiota in the sample is measured to determine the relative abundance of the strain, species or OTU. In preferred embodiments, the concentration of a metabolite is measured, in particular a urine metabolite. In preferred embodiments, the abundance of bacterial strains carrying a gene pathway of interest as a proportion of the total microbiota in the sample is measured to determine the relative abundance of the strains, or concentrations of gene sequences are measured. Then, in such preferred embodiments, the relative abundance of the bacterium or OTU or the concentration of the metabolite or gene sequence in the sample is compared with the relative abundance or concentration in the same sample from a control (non-IBS) individual. A difference in relative abundance of the bacterium or OTU in the sample, e.g. a decrease or an increase, compared to the reference is a modulated relative abundance. As explained herein, detection of modulated abundance can also be performed in an absolute manner by comparing sample abundance values with absolute reference values. Therefore, the invention provides a method of determining IBS status in an individual comprising the step of assaying a biological sample from the individual for a relative abundance of one or more IBS-associated bacteria and/or a modulated concentration of a metabolite or gene pathway, wherein a modulated relative abundance of the bacteria or modulated concentration of a metabolite or gene pathway is indicative of IBS. Similarly, the invention provides a method of determining whether an individual has an increased risk of having IBS comprising the step of assaying a biological sample from the individual for a relative abundance of one or more IBS-associated oral bacteria or IBS-associated metabolites or gene pathways, wherein modulated relative abundance or concentration is indicative of an increased risk.

    [0120] In any embodiment of the invention, detecting a bacteria may comprise detecting “modulated relative abundance”. As used herein, the term “modulated relative abundance” as applied to a bacterium or OTU in a sample from an individual should be understood to mean a difference in relative abundance of the bacterium or OTU in the sample compared with the relative abundance in the same sample from a control (non-IBS) individual (hereafter “reference relative abundance”). In one embodiment, the bacterium or OTU exhibits increased relative abundance compared to the reference relative abundance. In one embodiment, the bacterium or OTU exhibits decreased relative abundance compared to the reference relative abundance. Detection of modulated abundance can also be performed in an absolute manner by comparing sample abundance values with absolute reference values. In one embodiment, the reference abundance values are obtained from age and/or sex matched individuals. In one embodiment, the reference abundance values are obtained from individuals from the same population as the sample (i.e. Celtic origin, North African origin, Middle Eastern origin). Method of isolating bacteria from oral and fecal sample are routine in the art and are further described below, as are methods for detecting abundance of bacteria. Any suitable method may be employed for isolating specific species or genera of bacteria, which methods will be apparent to a person skilled in the art. Any suitable method of detecting bacterial abundance may be employed, including agar plate quantification assays, fluorimetric sample quantification, qPCR, 16S rRNA gene amplicon sequencing, and dye-based metabolite depletion or metabolite production assays.

    [0121] Stratifying Patients

    [0122] In certain embodiments, the methods of the invention are for use in stratifying patients according to the type of IBS that they are suffering from. In particular, in certain embodiments, the methods of the invention are for diagnosing a patient suffering from IBS as having a normal-like microbiota (i.e. a microbiota composition similar to the microbiota composition of a person without IBS), or an altered microbiota (i.e. a microbiota dissimilar to the microbiota of a person without IBS) (see Jeffery I B, O'Toole P W, Ohman L, Claesson M J, Deane J, Quigley E M, Simren M. 2012. “An irritable bowel syndrome subtype defined by species-specific alterations in fecal microbiota.” Gut 61:997-1006 (23)). Patients suffering from IBS with a normal-like microbiota may benefit from different treatments compared to patients with an altered microbiota, so the methods of the invention may result in more appropriate treatment strategies and better outcomes for patients. Therefore, in certain embodiments, the methods of the invention comprise developing and/or recommending a treatment plan for a patient based on their microbiota. IBS patients with normal-like microbiota may benefit from treatments known to ameliorate anxiety or depression. IBS patients with an altered microbiota may benefit from treatments able to instigate beneficial changes in the microbiota and/or address dysbiosis, such as live biotherapeutic products, in particular compositions comprising Blautia hydrogenotrophica (as described in WO2018109461). IBS patients with an altered microbiota may also benefit from diet adjustments, such as a FODMAP (fermentable oligo-, di-, monosaccharides and polyols) diet. Compositions comprising Blautia hydrogenotrophica are also effective for treating visceral hypersensitivity (as described in WO2017148596), which patients with normal-like microbiota may experience, so such compositions will also be useful for treating such patients.

    [0123] In certain embodiments, the invention provides a method for stratifying patients suffering from IBS into subgroups based on their microbiome and/or metabolome. In a particular embodiment, the method of the invention comprises detecting one or more bacterial strains belonging to at least one genus selected from the group consisting of: Anaerostipes, Anaerotruncus, Anaerofilum, Bacteroides, Blaufia, Eggerthella, Streptococcus, Gordonibacter, Holdemania, Ruminococcus, Veilonella, Akkermansia, Alistipes, Bamesiella, Butyricicoccus, Butyricimonas, Clostridium, Coprococcus, Faecalibacterium, Haemophilus, Howardella, Methanobrevibacter, Oscillobacter, Prevotella, Pseudoflavonifractor, Roseburia, Slackia, Sporobacter and Victivallis. In a particular embodiment, the method of the invention comprises detecting bacterial species which may belong to Clostridium clusters IV, XI or XVIII. In a particular embodiment, the method of the invention comprises detecting bacterial strains which may include one or more of the following species: Anaerostipes hadrus, Bacteroides ovatus, Bacteroides thetaiotaomicron, Clostridium asparagiforme, Clostridium boltaea, Clostridium hathewayi, Clostridium symbiosum, Coprococcus comes, Ruminococcus gnavus, Streptococcus salivarus, Ruminococcus torques, Alistipes senegalensis, Eubacterium eligens, Eubacterium siraeum, Faecalibacterium prausnitzii, Roseburia hominis, Haemophilus parainfluenzae, Ruminococcus callidus, Veilonella parvula and Coprococcus sp. ART55/1. In a particular embodiment, the method of the invention comprises detecting one or more of the following bacterial strains: Lachnospiracaea bacterium 3 1 46FAA, Lachnospiracaea bacterium 5 1 63FAA, Lachnospiracaea bacterium 7 1 58FAA and Lachnospiracaea bacterium 8 1 57FAA. In a particular embodiment, the method of the invention comprises detecting bacterial taxa selected from tables 17, 18, 19 and/or 20. In certain embodiments, the method of the invention comprises detecting a metabolite associated with an IBS subgroup. In certain embodiments, the metabolite is detected in a fecal sample. In certain embodiments, the metabolite is detected in a urine sample.

    [0124] In certain embodiments, the invention provides a method of assessing whether a patient suffering from IBS would benefit from a treatment able to instigate beneficial changes in the microbiota and/or address dysbiosis, such as a live biotherapeutic product. In a particular embodiment, the method of the invention comprises detecting one or more bacterial strains belonging to at least one genus selected from the group consisting of: Anaerostipes, Anaerotruncus, Anaerofilum, Bacteroides, Blaufia, Eggerthella, Streptococcus, Gordonibacter, Holdemania, Ruminococcus, Veilonella, Akkermansia, Alistipes, Bamesiella, Butyricicoccus, Butyricimonas, Clostridium, Coprococcus, Faecalibacterium, Haemophilus, Howardella, Methanobrevibacter, Oscillobacter, Prevotella, Pseudoflavonifractor, Roseburia, Slackia, Sporobacter and Victivallis. In a particular embodiment, the method of the invention comprises detecting bacterial species which may belong to Clostridium clusters IV, XI or XVIII. In a particular embodiment, the method of the invention comprises detecting bacterial strains which may include one or more of the following species: Anaerostipes hadrus, Bacteroides ovatus, Bacteroides thetaiotaomicron, Clostridium asparagiforme, Clostridium boltaea, Clostridium hathewayi, Clostridium symbiosum, Coprococcus comes, Ruminococcus gnavus, Streptococcus salivarus, Ruminococcus torques, Alistipes senegalensis, Eubacterium eligens, Eubacterium siraeum, Faecalibacterium prausnitzii, Roseburia hominis, Haemophilus parainfluenzae, Ruminococcus callidus, Veilonella parvula and Coprococcus sp. ART55/1. In a particular embodiment, the method of the invention comprises detecting one or more of the following bacterial strains: Lachnospiracaea bacterium 3 1 46FAA, Lachnospiracaea bacterium 5 1 63FAA, Lachnospiracaea bacterium 7 1 58FAA and Lachnospiracaea bacterium 8 1 57FAA. In a particular embodiment, the method of the invention comprises detecting bacterial taxa selected from tables 17, 18, 19 and/or 20. In certain embodiments, the method of the invention comprises detecting a metabolite associated with an IBS subgroup. In certain embodiments, the metabolite is detected in a fecal sample. In certain embodiments, the metabolite is detected in a urine sample.

    [0125] In certain embodiments, the method of the invention comprises identifying a subgroup which is characterised by an altered microbiome and/or metabolome relative to healthy control subjects. In certain embodiments, the method of the invention comprises identifying a subgroup which is characterised by a microbiome and/or metabolome similar to healthy control subjects. In certain embodiments, the methods of the invention are for use in classifying of a patient suffering from IBS into a subgroup based on their microbiome. In certain embodiments, the methods of the invention are for use in determining whether a patient suffering from IBS would benefit from a treatment able to instigate beneficial changes in the microbiota and/or address dysbiosis, such as live biotherapeutic products. In certain embodiments, it may be deemed that a patient suffering from IBS would benefit from a treatment able to instigate beneficial changes in the microbiota and/or address dysbiosis, such as live biotherapeutic products, if said patient is classified as belonging to a subgroup characterised by an altered microbiome and/or metabolome relative to healthy control subjects. In certain embodiments, it may be deemed that a patient suffering from IBS would not benefit from a treatment able to instigate changes in the microbiota and/or address dysbiosis, such as live biotherapeutic products, if said patient is classified as belonging to a subgroup characterised by similar microbiome and/or metabolome to healthy control subjects.

    [0126] Kits

    [0127] The invention also provides kits comprising reagents for performing the methods of the invention, such as kits containing reagents for detecting one or more, such as two or more of the bacterial species, genes or metabolites set out above. As such, provided are kits that find use in practicing the subject methods of diagnosing IBS, as mentioned above. The kit may be configured to collect a biological sample, for example a urine sample or a fecal sample. In a preferred embodiment, the kit is configured to collect a urine sample. The individual may be suspected of having IBS. The individual may be suspected of being at increased risk of having IBS. A kit can comprise a sealable container configured to receive the biological sample. A kit can comprise polynucleotide primers. The polynucleotide primers may be configured for amplifying a 16S rRNA polynucleotide sequence from at least one IBS-associated bacterium to form an amplified 16S rRNA polynucleotide sequence. A kit may comprise a detecting reagent for detecting the amplified 16S rRNA sequence. A kit may comprise instructions for use.

    EXAMPLES

    Summary

    [0128] Background & Aims: Diagnosis and stratification of irritable bowel syndrome (IBS) is based on symptoms and other disease exclusion. Whether the pathogenesis begins centrally and/or at the end organ is unclear. Some patients have an alteration in their microbiota. Therefore, microbiome and metabolomic profiling was conducted to identify biomarkers for the condition.

    [0129] To work toward an evidence-based stratification of patients with IBS, a metagenomic study of fecal samples was performed, along with metabolomic analyses of urine and faeces in patients with IBS (according to the Rome IV criteria) in comparison with controls. Microbiome and metabolomic signatures are evident in IBS but these are independent of the traditional clinical symptom-based subsets of IBS (IBS-D vs IBS-C, IBS-alternating or mixed).

    [0130] Methods: 80 patients with IBS (Rome IV) and 65 non-IBS controls were enrolled.

    [0131] Anthropometric, medical and dietary information were collected with fecal and urine samples for microbiome and metabolomic analyses. Shotgun and 16S rRNA amplicon sequencing were performed on feces, and urine and fecal metabolites were analysed by gas chromatography (GC)—and liquid chromatography (LC) mass spectrometry (MS).

    [0132] Results: Differential connections between diet and the microbiome with alterations of the metabolome were evident in IBS. Microbiota composition and predicted microbiome function in patients with IBS differed significantly from those of controls, but these were independent of IBS-symptom subtypes. Fecal metabolomic profiles also differed significantly between IBS patients and controls and were discriminatory for the condition. The urine metabolome contained an array of predictive metabolites but was mainly dominated by dietary and medication-related metabolites.

    [0133] Conclusion: Despite clinical heterogeneity, IBS can be identified by species-, metagenomics and fecal metabolomic-signatures which are independent of symptom-based subtypes of IBS. These findings are useful for diagnosing IBS and for developing precision therapeutics for IBS.

    Example 1—Microbiota Profiling of Ibs Patients and Controls

    [0134] Materials and Methods

    [0135] Subject recruitment: Eighty patients aged 16-70 years with IBS meeting the Rome IV criteria were recruited at Cork University Hospital. Clinical subtyping of the patients (15) was as follows: IBS with constipation (IBS-C), mixed IBS (IBS-M) or IBS with diarrhea (IBS-D). Sixty-five controls of the same age range and of the same ethnicity and geographic region were recruited. Descriptive statistics for the study population are presented in Table 10.

    [0136] Exclusion criteria included the use of antibiotics within 6 weeks prior to study enrolment, other chronic illnesses including gastrointestinal diseases, severe psychiatric disease, abdominal surgery other than hernia repair or appendectomy. Standard-of-care blood analysis was carried out on all participants if recent results were not available, and all subjects were tested by serology to exclude coeliac disease. The inclusion/exclusion criteria for the control population were the same as for the IBS population with the exception of having to fulfil the Rome IV criteria for IBS. Gastrointestinal (GI) symptom history, psychological symptoms, diet, medical history and medication data were collected on each participant (both IBS and controls) and using the following questionnaires: Bristol Stool Score (BSS), Hospital Anxiety and Depression Scale (HADS) (24); Food Frequency Questionnaire (FFQ) (25). Ethical approval for the study was granted by the Cork Research Ethics Committee (protocol number: 4DC001) before commencing the study and all participants provided written informed consent to take part.

    [0137] Sample collection: Fecal and urine samples were collected from all participants for microbiome and metabolomics profiling. Subjects collected a freshly voided fecal sample at home using a collection kit and brought the sample to the clinic that day, when a fresh urine sample was collected. Samples were kept at 4° C. until brought to the laboratory for storage at −80° C. which was within a few hours of the sample collection.

    [0138] Microbiome profiling and metagenomics-16S amplicon sequencing: Genomic DNA was extracted and amplified from frozen fecal samples (0.25 g) using the method described by Brown et al. (26). The modifications from the methods described by Brown et al. (26) included bead beating tubes consisting of 0.5 g of 0.1 mm zirconia beads and 4×3.5 mm glass beads. Fecal samples were homogenised via bead beating for 3×60 s cycles and cooled on ice between each cycle. Genomic DNA was visualised on 0.8% agarose gel and quantified using the SimpliNano Spectrometer (Biochrom™, US). The PCR master mix used 2× Phusion Taq High-Fidelity Mix (Thermo Scientific, Ireland) and 15 ng of DNA. The resulting PCR products were purified, quantified and equimolar amounts of each amplicon were then pooled before being sent for sequencing to the commercial supplier (GATC Biotech AG, Konstanz, Germany) on the MiSeq (2×250 bp) chemistry platforms. Sequencing was performed by GATC Biotech, Germany on an Illumina MiSeq instrument using a 2×250 bp paired end sequencing run.

    [0139] Microbiome profiling and metagenomics—16S amplicon sequencing: Using the Qiagen DNeasy Blood & Tissue Kit and following the manufacturer's instructions, microbial DNA was extracted from 0.25 g of each of 144 frozen fecal samples (IBS: n=80 and control (n=64). No fecal sample was available for one control subject. The 16S rRNA gene amplicons preparation and sequencing was carried out using the 16S Sequencing Library Preparation Nextera protocol developed by Illumina (San Diego, Calif., USA). 15 ng of each of the DNA fecal extracts was amplified using PCR and primers targeting the V3-V4 variable region of the 16S rRNA gene using the following gene-specific primers:

    TABLE-US-00001 16S Amplicon PCR Forward Primer (S-D-Bact-0341-b-S-17) = 5′ (SEQ ID NO: 40) TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG 16S Amplicon PCR Reverse Primer (S-D-Bact-0785-a-A-21) = 5′ (SEQ ID NO: 41) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCT AATCC

    [0140] The amplicon size was 531 bp. The products were purified and forward and reverse barcodes were attached by a second round of adapter PCR.

    [0141] Microbiome profiling and metagenomics—Shotgun sequencing: For shotgun sequencing, 1 μg (concentration>5 ng/μL) of high molecular weight DNA for each sample was sent to GATC Biotech, Germany for sequencing on Illumina HiSeq platform (HiSeq 2500) using 2×250 bp paired-end chemistry. This returned 2,714,158,144 raw reads (2,612,201,598 processed reads) of which 45.6% were mapped to an average of 222,945 gene families per sample with a mean count value of 8,924,302±2,569,353 per sample.

    [0142] Bioinformatics analysis (16S amplicon sequencing): Miseq 16S sequencing data was returned for 144 subjects. Data generated for 3 samples (2 IBS and 1 control) were removed as the number of reads returned from sequencing was too low for analysis, leaving 141 samples (control: n=63, IBS n=78). Raw amplicon sequence data were merged and the reads trimmed using the flash methodology (27). The USEARCH pipeline was used to generate the OTU table (28). The UPARSE algorithm was used to cluster the sequences into OTUs at 97% similarity (29). UCHIME chimera removal algorithm was used with Chimeraslayer to remove chimeric sequences (30). The Ribosomal Database Project (RDP) taxonomic classifier was used to assign taxonomy to the representative OTU sequences (28) and microbiota compositional (abundance and diversity) information was generated.

    [0143] Bioinformatics analysis (Shotgun metagenomic sequencing): For shotgun metagenomics, 6 control samples were not sequenced due to data not passing QC or no sample available (control: n=59; IBS n=80). The number of raw read pairs obtained after sequencing, varied from 5,247,013 to 21,280,723 (Mean=9,763,159±2,408,048). Reads were processed in accordance with the Standard Operating Procedure of Human Microbiome Project (HMP) Consortium (31). Metagenomic composition and functional profiles were generated using HUMAnN2 pipeline (32). For each sample, multiple profiles were obtained, including: microbial composition profiles from clade-specific gene information (using MetaPhlAn2), Gene family abundance, pathways stratified per organism, total pathway coverage and abundance.

    [0144] Machine learning: An in-house machine learning pipeline was applied to each datatype (16S, shotgun, and urine and fecal MS metabolomics) using a twostep approach applying the Least Absolute Shrinkage and Selection Operator (LASSO) feature selection followed by Random Forest

    [0145] (RF) modelling (33). The models were implemented using R software version 3.4.0, using package glmnet version 2.0-10 for LASSO feature selection, and R package randomForest version 4.6-12. (34).

    [0146] Each variable consisted of data from 78 IBS patients IBS and 64 controls. First, feature selection was performed using the LASSO algorithm to improve accuracy and interpretability of models by efficiently selecting the relevant features. This process was tuned by parameter lambda, which was optimized for each dataset using a grid search. The training data was filtered to include only the features selected by the LASSO algorithm, and RF was then used for modelling whereby 1500 trees were built. Both LASSO feature selection and RF modelling were performed using 10-fold cross validation (CV) repeated 10 times (10-fold, 10 repeats, R package caret version 6.0-76.), which generated an internal 10-fold prediction yielding an optimal model that predicts the IBS or Control classification of samples. This 10-fold cross-validation procedure was repeated ten times and the average area under the curve (AUC), sensitivity and specificity were reported.

    [0147] Results

    [0148] Microbiome Differs Between IBS and Controls but not Across IBS Clinical Subtypes

    [0149] Microbiota profiling by 16S rRNA amplicon sequencing and Principal Co-Ordinate Analysis (PCoA) of the microbiota composition data confirmed that the microbiota of subjects with IBS was distinct from that of controls (FIG. 1a), albeit with some degree of overlap.

    [0150] Machine learning was used to identify bacterial taxa predictive of IBS and control groups (FIG. 1b). These taxa belonged to the Ruminococcaceae, Lachnospiraceae and Bacteroides families/genera.

    [0151] Machine learning (based on shotgun data) identified 6 genera predictive of IBS which included Lachnospiraceae, Oscillibacter and Coprococcus with an Area under the Curve (AUC) of 0.835 (sensitivity: 0.815 and specificity: 0.704; Table 1).

    [0152] At the species level, 40 predictive features (AUC of 0.878; sensitivity: 0.894, specificity: 0.687; Table 2) were identified which included Ruminococcus gnavus and Lachnospiraceae spp which were significantly more abundant in IBS, while Barnesiella intestinihominis and Coprococcus catus were among taxa significantly less abundant in IBS based on pairwise comparison (Table 3). These alterations are consistent with previous studies (10-12), where the taxa that were significantly differentially abundant belonged to the Ruminococcaceae, Lachnospiraceae and Bacteroidetes families/genera.

    [0153] Clinical subtypes of IBS did not separate in a PCoA of microbiota beta diversity derived from 16S profiling data (FIG. 1c). Metagenomic shotgun sequencing corroborated 16S profiling in separating IBS subjects from controls (FIG. 2). Moreover, the microbiota composition at genus and species level (as assigned using shotgun sequence data) underscored the microbiota composition differences between IBS and controls. (FIG. 1d). Pairwise comparison of the annotated metagenome dataset identified 232 shotgun pathways stratified per organism that were significantly more abundant in the IBS group compared to the controls (Table 4). These notably included a number of amino acid biosynthesis/degradation pathways whose altered activity may be relevant to IBS pathophysiology (35).

    [0154] Other pathways that were less abundant in the metagenome of subjects with IBS included galactose degradation, sulfate reduction, sulfate assimilation and cysteine biosynthesis, collectively indicative of a reduced sulphur metabolism in IBS. The genes encoding 12 pathways were more abundant in IBS subjects including those for starch degradation V. Of a total of 232 functional pathways that were significantly more abundant in the IBS group, 113 were associated with the Lachnospiraceae family or the Ruminococcus species.

    [0155] Discussion

    [0156] A species-level microbiome signature for IBS was identified that included some broad taxonomic groups (lower abundance of Bacteroides species, elevated levels of Lachnospiraceae and Ruminococcus spp.) as well as a list of 32 taxa whose collected abundance values could discriminate between IBS and controls. The ability to distinguish the microbiota of subjects with IBS from controls is superior to that of an earlier study based on a supervised split (10), or one which could not distinguish between control and IBS microbiota (12), but which also reported no statistical difference in the phenotypes of the IBS subjects and controls for rates of anxiety, depression, stool frequency and Bristol stool form. The relatively mild disease symptoms of this IBS cohort (12) may have confounded identifying a microbiome signature. Supporting this, in a recent study of the gut microbiome in IBS and IBD, microbiome alterations were significantly associated with a physician diagnosed IBS group but were of fewer and of lower significance in the self-diagnosed IBS subgroup (36).

    Example 2—Urine Metabolome Profiling of Ibs Patients and Controls

    [0157] Materials and Methods

    [0158] Subject recruitment and sample collection were carried out as described in Example 1.

    [0159] Urine FAIMS: FAIMS analysis was performed using a protocol modified from that of Arasaradnam et al. (37) and described below. Any other appropriate method known in the art for detecting metabolites may be used in the methods of the invention. Frozen (−80° C.) urine samples were thawed overnight at 4° C., 5 mL of each urine sample was aliquoted into a 20 mL glass vial and placed into an ATLAS sampler (Owlstone, UK) attached to the Lonestar FAIMS instrument (Owlstone, UK). The sample was heated to 40° C. and sequentially run three times.

    [0160] Each sample run had a flow rate over the sample of 500 mL/min of clean dry air.

    [0161] Further make-up air was added to create a total flow rate of 2.5 L/min. The FAIMS was scanned from 0 to 99% dispersion field in 51 steps, +6 V to −6 V compensation voltage in 512 steps and both positive and negative ions were detected to produce an untargeted volatile organic compound (VOC) profile for each sample. The signals for each sample at each DF were smoothed using the Savitzky-Golay filter (window size=9, degree=3). The signals were trimmed based on an optimized cut-off of 0.007 for positive mode and −0.007 for negative mode outputs, to obtain the region of interest, and reduce the baseline noise. Signals were aligned to the trimmed signals at each DF, using cross-correlation, using the mean signal as reference to make them comparable. Since the initial DFs of the FAIMS signal, and higher DFs were non-informative, signals corresponding to 17th DF till 42nd DF of both, positive, and negative modes were considered. These pre-processing steps were performed using customized programs developed in Python, v. 2.7.11, with relevant packages (Scipy v-1.1, and Numpy v-1.15.2). To further reduce the complexity, and to retain informative data, kurtosis normality tests were performed on each feature vector and features with raw p-value >0.1, were considered, and final profile was generated for various statistical analyses.

    [0162] Bioinformatics analysis of urine metabolome data (FAIMS): Each urine sample analysed using FAIMS yielded a profile with ca. 52,224 data points. A pooled profile containing these data points for each sample was generated for pre-processing, to reduce the noise, size, and complexity of the data.

    [0163] Urine GC/LC MS: 5 mL samples of frozen urine were sent on dry ice to Metabolomic Discoveries (now Metabolon), Potsdam, Germany. Untargeted metabolomics analysis was performed using liquid chromatography (LC) and Solid Phase Microextraction (SPME) gas chromatography (GC) and metabolites were identified using electrospray ionization mass spectrometry (ESI-MS). Short chain fatty acids (SCFA) analysis was also performed by LC-tandem mass spectrometry.

    [0164] For urine metabolomics, the values of metabolites were normalized with reference to urine creatinine levels in each sample.

    [0165] Bioinformatics analysis of urine metabolome data (MS): Urine MS metabolomics data was returned for all IBS subjects (n=80) and all but 2 controls (n=63) as these did not pass QC or no sample was available. A total of 2,887 metabolites were returned from untargeted urine metabolomics analysis, of which 594 were identified. Only the identified features with peak values normalized by creatinine levels in urine (mg/dl) were considered for further analysis.

    [0166] Machine learning: An in-house machine learning pipeline was applied to each datatype (in this example, urine MS metabolomics) using a twostep approach applying the Least Absolute Shrinkage and Selection Operator (LASSO) feature selection followed by Random Forest (RF) modelling (38), as described in Example 1. The models were implemented using R software version 3.4.0, using package glmnet version 2.0-10 for LASSO feature selection, and RF package randomForest version 4.6-12. (34). The ability of urine FAIMS metabolomics to differentiate between health classes was tested using support vector machines (SVM), with a linear kernel, using python 2.7 and Scikit-Learn (v 0.19.2) (39). Features of FAIMS profile were selected using kurtosis normality test. These features were centered and scaled. The samples were split into training and test set, for 10 fold cross validation. Class weights were balanced. Other parameters were set to default. No supervised feature selection was used.

    [0167] Results

    [0168] Altered Urine Metabolomes in IBS

    [0169] Metabolomic analysis was extended to all subjects, focusing initially on urine as a non-invasive test sample. Two methods were compared: High field asymmetric waveform ion mobility spectrometry (FAIMS) analysis for volatile organics, and both GC- and LC-MS.

    [0170] The FAIMS technique did not identify discriminatory metabolites directly, but separated samples/subjects by characteristic plumes of ionized metabolites. In unsupervised analysis, FAIMS readily identified urine samples from controls and IBS (FIG. 4a) but could not distinguish between IBS clinical subtypes (FIG. 5).

    [0171] GC/LC-MS analysis of the urine metabolome also separated IBS patients from controls (FIG. 4b) and with greater accuracy than FAIMS (FIGS. 6a and 6b).

    [0172] Machine learning identified four urine metabolomics features predictive of IBS (AUC 0.999; sensitivity: 0.988, specificity: 1.000) which were reflective of dietary components (Table 5). Pairwise comparison of control and IBS urine metabolomes identified 127 differentially abundant features (Table 6). 89 urine metabolites were significantly less abundant in IBS subjects including a number of amino acids such as L-arginine, a precursor for the biosynthesis of nitric oxide which is associated both with mucosal defence as well as IBS pathophysiology (40). Another 38 metabolites were present at significantly higher levels in IBS including an acylgylcine (N-undecanoylglycine) and an acylcarnitine (decanoylcarnitine). Elevated levels of metabolites from these groups are associated with altered fatty acid oxidation/metabolism and disease (41,42,43).

    [0173] Discussion

    [0174] Urine metabolomics was highly discriminatory for IBS. The machine learning model showed that the compounds identified were predominantly diet- or medication-associated.

    Example 3—Fecal Metabolome Profiling of Ibs Patients and Controls

    [0175] Materials and Methods

    [0176] Subject recruitment and sample collection were carried out as described in Example 1.

    [0177] Fecal GC/LC MS: 1 g samples of frozen feces were sent on dry ice to Metabolomic Discoveries (now Metabolon), Potsdam, Germany. For LC-MS, the samples were dried and resuspended to a final concentration of 10 mg per 400 μL before analysis. GC-MS and SCFA analysis were performed using wet samples. Untargeted metabolomics and SCFA analysis was carried out as described previously for urine MS metabolomics.

    [0178] Bioinformatics analysis of fecal metabolome data: Fecal MS metabolomics data was returned for all IBS subjects (n=80) and all but 2 controls (n=63) as these did not pass QC or no sample was available. 2,933 metabolites were returned from untargeted fecal metabolomics analysis carried out by the service provider of which 753 were identified. Metabolites identified using LC-MS were not normalized, since the fecal samples were already normalized with dry weight (10 mg per 400 μL) during sample preparation. Metabolites identified using GC-MS were normalized with corresponding sample wet weights. Only the identified metabolites were considered for further analyses. Machine learning analysis was carried out as described previously for the urine metabolome. Summary statistics for all datasets were generated using the Wilcoxon rank sum test with q-value adjustment for multiple testing.

    [0179] Machine learning: An in-house machine learning pipeline was applied to each datatype (in this example, fecal MS metabolomics) using a twostep approach applying the Least Absolute Shrinkage and Selection Operator (LASSO) feature selection followed by Random Forest (RF) modelling (38), as described in Example 1. The models were implemented using R software version 3.4.0, using package glmnet version 2.0-10 for LASSO feature selection, and RF package randomForest version 4.6-12. (39).

    [0180] Results

    [0181] Altered Fecal Metabolomes in IBS

    [0182] Analysis of the Fecal Metabolome by GC/LC-MS Separated IBS Patients from Controls

    [0183] (FIG. 4c) but no difference was observed between the clinical IBS subtypes (FIG. 7). Machine learning applied to this dataset identified 40 fecal metabolites predictive of IBS (AUC:0.862, sensitivity: 0.821 and specificity: 0.647; Table 7) which included the amino acids L-tyrosine, and L-arginine; the bile acid UDCA; a bile pigment Iurobilin and dodecanedioic acid, an indicator of fatty acid oxidation defects (44).

    [0184] Machine learning applied to the shotgun species dataset produced a marginally better prediction model for IBS than the fecal metabolomic model (AUC 0.878, sensitivity 0.894 and specificity 0.687) based on 40 predictive species (Table 2). The adenosine ribonucleotide de novo biosynthesis functional pathway was significantly more abundant in 11 of the 32 predictive species which resonates with adenosine being the fourth highest ranked predictive metabolite for IBS.

    [0185] Pairwise comparison analysis of metabolites identified 128 significantly differential abundant features including 77 which were significantly depleted in IBS (Table 8). 51 fecal metabolites were significantly more abundant including tyrosine and lysine and three Bile Acids (BAs):[ ST hydroxy] (25R)-3alpha,7alpha-dihydroxy-5beta-cholestan-27-oyl taurine; [ST (2:0)] 5beta-Chola-3,11-dien-24-oic acid, and UDCA, which is one of the predictive metabolites for IBS.. BAs affect water absorption in intestine, and can lead to diarrhea (45).

    [0186] The level of bile acid metabolites in the subgroups was analysed and a significant difference was observed in the IBS-D subtype for most bile acid categories (Total BAs, secondary BAs, sulphated BAs, UDCA and conjugated BAs) when compared to the control subjects as shown in Table 9a. These differences were associated with an altered functional potential, reflected by the ursodeoxycholate biosynthesis and glycocholate metabolism pathway gene abundances correlating with the secondary BAs, UDCA and total BA levels (Table 9b). Primary BAs and taurine:glycine conjugated BAs were not significantly different across the groups. Similar findings (in a smaller IBS/control cohort) were reported by Dior and colleagues (46) for secondary BAs, sulphated BAs and UDCA and taurine:glycine conjugated BAs.

    [0187] Thus the differences in fecal microbiome composition and predicted function in IBS patients and controls are mirrored by differences in the measured metabolome in the two sample types.

    [0188] Discussion

    [0189] Here it is shown that the microbiome of patients with IBS is distinct from that of controls and this is reflected in fecal metabolome profiles. However, metagenome and metabolome configurations do not distinguish the so-called clinical subtypes of IBS (IBS-C, -D, -M).

    [0190] The fecal metabolome correlated well with taxonomic and functional data for the microbiota.

    Example 4—Fecal Metabolome Profiling of Ibs Patients and Controls with an Alternative Machine Learning Pipeline

    [0191] Materials and Methods

    [0192] Subject recruitment and sample collection were carried out as described in Example 1.

    [0193] Fecal GC/LC MS: 1 g samples of frozen feces were sent on dry ice to Metabolomic Discoveries (now Metabolon), Potsdam, Germany. For LC-MS, the samples were dried and resuspended to a final concentration of 10 mg per 400 μL before analysis. GC-MS and SCFA analysis were performed using wet samples. Untargeted metabolomics and SCFA analysis was carried out as described previously for urine MS metabolomics.

    [0194] Bioinformatics analysis of fecal metabolome data: Fecal MS metabolomics data was returned for all IBS subjects (n=80) and all but 2 controls (n=63) as these did not pass QC or no sample was available. 2,933 metabolites were returned from untargeted fecal metabolomics analysis carried out by the service provider of which 753 were identified. Metabolites identified using LC-MS were not normalized, since the fecal samples were already normalized with dry weight (10 mg per 400 μL) during sample preparation. Metabolites identified using GC-MS were normalized with corresponding sample wet weights. Only the identified metabolites were considered for further analyses. Machine learning analysis was carried out as described previously for the urine metabolome. Summary statistics for all datasets were generated using the Wilcoxon rank sum test with q-value adjustment for multiple testing.

    [0195] Machine learning: An in-house machine learning pipeline was applied to the fecal metabolomic data. The machine learning pipeline used in this example is similar to the machine learning pipeline used in Examples 1 to 3, but comprised additional optimization and validation steps, using a two step approach within a ten-fold cross-validation. Within each validation fold Least Absolute Shrinkage and Selection Operator (LASSO) feature selection was carried out followed by Random Forest (RF) modelling and an optimised model was validated against the cross validation test data which is external to the cross-validation training subset.

    [0196] The classified fecal metabolome sample profiles were log.sub.10 transformed before they were analysed in the machine learning pipeline. The transformed profiles were then used to classify the samples as IBS (80 samples) or Control (63 samples). The classified samples were then analysed in the machine learning pipeline.

    [0197] FIG. 9 shows the machine learning pipeline used in this example. The classified fecal metabolome sample profiles were first split into a training set and a test set. The training set was then used to generate an optimal lambda (λ) range for use by the LASSO algorithm. The optimal lambda (λ) range was generated using the previously described cross-validated LASSO and using the glmnet package (version 2.0-18). Pre-determination of an optimal lambda (λ) range reduces the computational time to run the pipeline and removes the need for a user to specify the ranges manually

    [0198] After determination of the lambda (λ) range, the samples were assigned weights based on their class probabilities. The weights assigned to the training samples in this step were used in all subsequent applicable steps.

    [0199] A LASSO algorithm substantially as described in Examples 1 to 3 was then applied to the weighted training samples. In this example, the LASSO algorithm used the previously calculated optimal lambda (λ) range, and used the Caret (version 6.0-84 in this example) and glmnet (version 2.0-18 in this example) packages, The ROC AUC (receiver operating characteristic, area under curve) metric was calculated using 10-fold internal cross validation, repeated 10 times. The feature coefficients identified by the optimized LASSO algorithm were extracted and features with non-zero coefficients were selected for further analysis. In FIG. 9, N refers to the number of features returned by the LASSO algorithm. If the number of features selected by LASSO was fewer than 5, then all of the features (pre-LASSO) were used to generate the random forest, i.e. the LASSO filtering was ignored by the random forest generator. If the number of features selected by LASSO was greater than or equal to 5, then only those features selected by LASSO were used for generation of the random forest (downstream classifier generation); otherwise all the features are considered for the classifier generation step.

    [0200] Following feature selection using LASSO, an optimized random forest classifier (with 1500 trees) was generated using the selected features, or all of the features, as determined by N. This optimised random forest classifier can be used to predict the external test fold. Random forest generation was performed using Caret (version 6.0-84) and internal cross validation, by tuning the ‘mtry’ parameter to maximise the ROC AUC metric. For tuning, if the number of selected features is greater than or equal to 5, mtry ranges from 1 to the square root of the number of selected features or else the range is from 1 to 6. The optimized random forest classifier was then applied to the test set and the performance of the classifier was calculated via the AUC, sensitivity, and specificity metrics.

    [0201] Both LASSO feature selection and RF modelling were performed within a 10-fold cross validation (CV), which generated an internal 10-fold prediction model that predicts the IBS or control classification of samples. This 10-fold cross-validation procedure was repeated ten times and the average AUC, sensitivity and specificity are reported. The optimized model is then used to predict the cross-validation test subset, and final classifier performance metrics are calculated from across the ten folds of the cross-validation (AUC, Sensitivity and Specificity).

    [0202] Results

    [0203] Fecal Metabolome is Predictive of IBS

    [0204] The optimized random forest classifier was investigated for its predictive ability to classify samples as IBS or Control. External validation was 10-fold cross validation. Internal validation was 10-fold cross validation, repeated 10 times.

    [0205] The performance summary and feature details are shown in Table 13. Features selected by LASSO having coefficients less than zero are associated with IBS, while positive coefficients are associated with Controls. Overall, for 10 folds, the mean ROC AUC was 0.686 (±0.132). Sensitivity, and specificity were 0.737 (±0.181), and 0.476 (±0.122), respectively. Accuracy was observed to be 0.622±0.095.

    [0206] The classification threshold was also optimized to achieve maximum sensitivity and specificity using pROC package (version 1.15.0) and Youden J score. The obtained optimized values for Sensitivity and Specificity were 0.55, and 0.794, respectively. Thresholds were also optimized such that specificity >=0.9. The optimized values thus obtained for Sensitivity and Specificity were 0.288, and 0.905, respectively, at a threshold equal to 0.689.

    [0207] The analysis identified 158 metabolites predictive of IBS, which are listed in Table 13. Metabolites with the highest RF feature importance included L-Phenylalanine, Adenosine and MG(20:3(8Z,11Z,14Z)/0:0/0:0). Increased levels of phenylethylamine, which is involved in the key metabolism pathway of phenylalanine, were found in fecal extracts of IBS mice compared with healthy control mice (47), indicating a connection between fecal phenylalanine levels and IBS, which is consistent with the present findings. Other metabolites which were predictive of IBS included the amino acids Lalanine, L-arginine, tyrosine and inosine previously reported as a biomarker of IBS (along with adenosine). The identified metabolites also included dodecanedioic acid, which, as discussed in Example 3, is an indicator of fatty acid oxidation defects (32).

    [0208] Discussion

    [0209] Here it is shown that the fecal metabolome profile of patients with IBS is distinct from that of controls. This observation is consistent with the results obtained using a different machine learning pipeline, as described in Example 3.

    Example 5—Co-Abundance Analysis of Gene Families with the Alternative Machine Learning Pipeline

    [0210] Materials and Methods

    [0211] Subject recruitment and sample collection were carried out as described in Example 1.

    [0212] Co-abundance clustering: Clusters of co-abundant genes (CAGs) representing metagenomically-defined species variables were identified using gene family abundances. The generation of the gene family abundances is described in detail in Example 1, but for completeness is also detailed below.

    [0213] Microbiome profiling and metagenomics: Genomic DNA was extracted and amplified from frozen fecal samples (0.25 g) using the method described by Brown et al. (26).

    [0214] Microbiome profiling and metagenomics—Shotgun sequencing: Genomic DNA was extracted as described above. For shotgun sequencing, 1 μg (concentration>5 ng/μL) of high molecular weight DNA for each sample was sent to GATC Biotech, Germany for sequencing on Illumina HiSeq platform (HiSeq 2500) using 2×250 bp paired-end chemistry. This returned 2,714,158,144 raw reads (2,612,201,598 processed reads) of which 45.6% were mapped to an average of 222,945 gene families per sample with a mean count value of 8,924,302±2,569,353 per sample.

    [0215] Bioinformatics analysis (16S amplicon sequencing): Miseq 16S sequencing data was returned for 144 subjects. Data generated for 3 samples (2 IBS and 1 control) were removed as the number of reads returned from sequencing was too low for analysis, leaving 141 samples (control: n=63, IBS n=78). Raw amplicon sequence data were merged and the reads trimmed using the flash methodology (27). The USEARCH pipeline was used to generate the OTU table (28). The UPARSE algorithm was used to cluster the sequences into OTUs at 97% similarity (29). UCHIME chimera removal algorithm was used with Chimeraslayer to remove chimeric sequences (30). The Ribosomal Database Project (RDP) taxonomic classifier was used to assign taxonomy to the representative OTU sequences (28) and microbiota compositional (abundance and diversity) information was generated.

    [0216] Bioinformatics analysis (Shotgun metagenomic sequencing): For shotgun metagenomics, 6 control samples were not sequenced due to data not passing QC or no sample available (control: n=59; IBS n=80). The number of raw read pairs obtained after sequencing, varied from 5,247,013 to 21,280,723 (Mean=9,763,159±2,408,048). Reads were processed in accordance with the Standard Operating Procedure of Human Microbiome Project (HMP) Consortium (31). Metagenomic composition and functional profiles were generated using HUMAnN2 pipeline (32). For each sample, multiple profiles were obtained, including: microbial composition profiles from clade-specific gene information (using MetaPhlAn2), Gene family abundance, Pathway coverage and abundance.

    [0217] After clusters of co-abundant genes representing metagenomically-defined species variables were identified from the gene family abundances, using the HUMAnN2 pipeline, a co-abundance analysis of the gene families was performed using a modified canopy clustering algorithm (Nielsen et al., 2014) (48). The canopy clustering algorithm was run with default parameters for 139 samples (IBS (80 samples) or Controls (59 samples)) using the relative abundance of 1,706,571 gene families (UniRef90 database) stratified by species using the HUMAnN2 methodology (Franzosa et al., 2018) (32).

    [0218] The resulting gene family clusters were filtered to keep those where at least 90% of the cluster signal originated from more than three samples and contained more than two gene families. This was in order to remove clusters driven by outliers or with too few values, as recommended by Nielsen et al, 2014 (48). The clusters remaining after filtering were termed co-abundant groups or CAGs.

    [0219] Abundance Indices of CAGs: The abundance indices of the CAGs were generated by Singular Value Decomposition (SVD) as implemented in Principal Component Analysis (PCA) using the dudi.pca command with default parameters (ade4 package in R. R version 3.5.1). The first principal component was extracted as the index and directionality was corrected by the index being compared to the median CAG gene abundance using the spearman correlation of all values within a CAG. CAGs returning a negative correlation were corrected by inverting the principal component values for that CAG. The principal component values were then scaled by subtracting the minimum value for a CAG from each CAG value.

    [0220] Assignment of Taxonomy to CAGs: As each CAG is composed of multiple gene families, taxonomy was assigned to a CAG by reporting the most common genera and species associated with the gene families in the CAGs, along with the percentage of the CAG that they composed. For CAGs where a genus or species represented greater than 60% of the gene families, a taxonomy was assigned.

    [0221] CAG results: After filtering for a minimum of 3 gene families per CAG, the strain level information (as represented by CAGs) within the shotgun dataset consisted of a total of 955 CAGs. The CAGs had a mean of 41.09 and maximum of 3,174 gene families. The distribution of CAGs across samples was sparse, with the mean number of CAGs per sample at 31.86 (3.34% of all 955 CAGs) and the max number of CAGs observed in any sample at 80 (8.38% of CAGs). The CAG cluster profile obtained was used to calculate inter-sample correlation distance based on Kendall correlation. Principal coordinate analysis based on this Beta-diversity metric showed a significant split between IBS and Controls (FIG. 2, PMANOVA p-value <0.001, vegan library), as seen in FIG. 10. No significant split was observed between the IBS subtypes (PMANOVA p-value=0.919).

    [0222] Machine learning: The in-house machine learning pipeline described in Example 4 was applied to the CAG profiles, following preliminary multivariate analysis.

    [0223] Results

    [0224] CAG Cluster Profiles are Predictive of IBS (IBS v Control)

    [0225] An informative way to reduce the complexity of metagenomic data while increasing biological signal is to assemble the reads into Co-abundant Gene groups or CAGs, representing strain-level variables and commonly referred to as metagenomic species. The optimized random forest classifier, generated using the CAG cluster profiles as input data, was investigated for its predictive ability to classify samples as IBS or Control. External validation was 10 fold CV, while internal validations for optimization, were 10 fold CV repeated 10 times.

    [0226] Analysis of these strain-level variables significantly differentiated IBS from controls, as shown in FIG. 17.

    [0227] The performance summary, and feature details are described in table 14. Features selected by LASSO having coefficients less than zero are associated with IBS while positive coefficients are associated with Controls.

    [0228] Machine learning applied to the metagenomic species (CAGs) dataset produced prediction model for IBS based on 136 predictive features (Table 14). Overall, for 10 folds, the mean ROC AUC was 0.814 (±0.134). Sensitivity, and specificity were 0.875(±0.102), and 0.497 (±0217), respectively. Accuracy was observed to be 0.713±0.134.

    [0229] The classification threshold was optimized to achieve maximum sensitivity and specificity using pROC package and Youden J score. The obtained optimized values for Sensitivity and Specificity were 0.75, and 0.797, respectively. Thresholds were also optimized such that specificity was equal to or greater than (>=) 0.9. The optimized values thus obtained for Sensitivity and Specificity were 0.3875, and 0.915, respectively, at a threshold equal to 0.791.

    [0230] Therefore, the analysis identified 136 CAGs predictive of IBS (table 14). Taxonomic assignment of the CAGs was sparse, with the majority of features unclassified, but assigned features were broadly consistent with the species-level analysis. The CAGs to which taxonomy was assigned include those associated with the genera Escherichia, Clostridium and Streptococcus, amongst others. At the species level, predictive CAGs included those associated with Escherichia coli, Streptococcus anginosus, Parabacteroides johnsonii, Streptococcus gordonii, Clostridium bolteae, Turicibacter sanguinis and Paraprevotella xylamphila, amongst others. A number of CAGs associated with individual strains were also identified, including Clostridiales bacterium 1_7_47 FAA, Eubacterium sp 3_1_31, Lachnospiraceae bacterium 5_1_57 FAA and Clostridiaceae bacterium JC118.

    [0231] Discussion

    [0232] Here it is shown that the microbiome of patients with IBS is distinct from that of controls, and that machine learning can be applied to co-abundance clustering of genes to reliably detect IBS.

    [0233] A strain-level microbiome signature for IBS comprising 136 metagenomic species was identified. The separation between the microbiota of IBS and controls by unsupervised analysis exceeds that of earlier reports (10, 12). The limitations of 16S amplicon datasets and the relatively mild disease symptoms may account for failure to identify a microbiome signature in one report (12). Moreover, microbiome alterations were significantly associated with physician-diagnosed IBS, but were less significant in self-reported Rome criteria IBS (36).

    Example 6—Stratification of Ibs Subtypes Using Unsupervised Learning

    [0234] Background

    [0235] The current approach to stratification of patients into clinical subtypes based on predominant symptoms has significant limitations. This Example uses microbiome profiling to stratify IBS patients into subgroups.

    [0236] Materials and Methods

    [0237] Subject recuitment: A total of 142 samples were used for the analyses. Patients were recruited through gastroenterology clinics at Cork University Hospital, advertisements in the hospital, GP practices and shopping centres and emails to university staff. 80 patients were selected with IBS satisfying the Rome III/IV criteria and agreed inclusion/exclusion criteria and 65 healthy control. Not all samples were used for each analysis due to differing availability of sample specific datasets (Table 15). For example, sequencing data from 3 samples were of too poor quality to include with data from the remaining 142 samples and so were removed from the analyses.

    [0238] Microbiome profiling: The samples were sequenced using 16S rRNA amplicon sequencing as described in Example 1. The resulting table showed abundance measures for each taxa across all 142 samples. If OTUs were present in 30% or less of samples they were filtered from the table.

    [0239] Machine learning: Unsupervised learning was used to group the samples. A heatmap of the microbiome OTU table was generated along with hierarchical clustering applied using the Ward2 dendrogram and the Canberra distance measure.

    [0240] Results

    [0241] Descriptive Analysis of Samples

    [0242] Of 142 samples that were analysed, 64 samples were healthy controls with the remaining 78 samples being IBS. Out of the 78, a group of 29 was diagnosed as the IBS-C subtype, a group of 20 was diagnosed as the IBS-D subtype and a group of 29 was diagnosed as the IBS-M subtype.

    [0243] Identification of Subtypes

    [0244] The hierarchical clustering identified 4 clusters (FIG. 11). The four clusters showed an uneven distribution of IBS and healthy controls. This altered beta diversity between healthy and IBS and within IBS provided the basis for the identification of three IBS subgroups (IBS-1, IBS-2, IBS-3). IBS-1 and IBS-2 subgroups relate to clusters 1 and 2 respectively with the IBS samples that co-cluster with healthy controls (clusters 3 and 4) being grouped into the IBS-3 subgroup. All healthy control samples are considered as a separate group in Examples 7-9.

    [0245] Discussion

    [0246] Here it is shown that hierarchical clustering applied to microbiome data may be used to define phenotypically distinct subgroups within the IBS population.

    Example 7—Microbiome Profiling and Differential Abundance Analysis (Genus Level) of Ibs Subgroups

    [0247] Materials and Methods

    [0248] Subjects: The same subjects were studied as in Example 6. The number of samples analysed in this Example is shown in Table 15.

    [0249] Analysis of alpha diversity: The same OTU data was used as in Example 6. Observed species (richness) is a measure of diversity defined as the count of unique OTU's within a sample. Statistical analysis was performed using ANOVA.

    [0250] Analysis of beta diversity: Principal Component Analysis with Canberra distance was used to analyse the differences in diversity of 16S data across the three IBS subgroups. Statistical analysis was performed using Pairwise Permutational MANOVA (adonis function, vegan library in R). The following six pairwise comparisons were made:

    [0251] 1. IBS-1 subgroup vs Healthy (significant).

    [0252] 2. IBS-1 subgroup vs IBS-2 subgroup (significant).

    [0253] 3. IBS-1 subgroup vs IBS-3 subgroup (significant).

    [0254] 4. IBS-2 subgroup vs IBS-3 subgroup (significant).

    [0255] 5. IBS-2 subgroup vs Healthy (significant).

    [0256] 6. IBS-3 subgroup vs Healthy (not significant).

    [0257] Differential abundance analysis: Statistical analysis was carried out using the DESeq2 pipeline (R library: DESeQ2). Differentially abundant taxa at the genus level were identified for the above six pairwise comparisons.

    [0258] Results

    [0259] Differences in Alpha Diversity Across Subgroups

    [0260] Applying the subgroup stratification of Example 1 to the OTU table and analysing the alpha diversity using the observed species metric within each of the groups revealed significant differences between all 4 groups, as shown in FIG. 12.

    [0261] Principal Coordinate Analysis of Beta Diversity of 16S Data

    [0262] An analysis of the beta diversity using Principal Coordinate Analysis with Canberra distance at genus level across the three IBS subgroups, the results of which are shown in FIG. 13, replicated the distinct separation of the groups as observed in the clustering analysis (Example 1). Pairwise Permutational MANOVA testing of all groups indicated that 5 of the 6 pairwise comparisons were significantly different with the IBS-3 subgroup versus Healthy being not significant indicating a lack of a distinct split between the healthy group and IBS-3 subgroup.

    [0263] The results show that the IBS-3 subgroup can be claimed to have a normal-like microbiota composition as evidenced by its lack of separation from the healthy controls.

    [0264] The results of Principal Coordinate Analysis for Examples 7-9 are summarised in Table 16.

    [0265] Differential Abundance Analysis—Genus Level

    [0266] The differentially abundant genera identified in this study are shown in Table 17. For the comparison of the IBS-1 subgroup to Healthy groups there were in total 23 significant taxa where 6 were increased in abundance (adjusted p-value <0.05). With the IBS-2 subgroup vs Healthy groups there was 13 significant taxa where 6 were increased in abundance (adjusted p-value <0.05) and IBS-3 subgroup group when compared to the healthy group identified only 1 significant taxa (adjusted p-value <0.05) which was increased in abundance (Table 17). Notably, it was observed that Blautia and Eggertella were increased in both altered IBS groups (IBS-1 and IBS-2 subgroups). Butyricoccus, Copproccus and Prevotella were decreased in both altered IBS groups. Veillonella was the only genus to be increased in the Normal-like IBS group (IBS-3 subgroup).

    [0267] The IBS-1 and IBS-2 subgroups were also compared to the normal-like IBS-3 subgroup. The results are shown in Table 18. As expected the genus level changes in the IBS-1 and IBS-2 subgroups to IBS-3 subgroup was similar to those seen for the IBS-1 and IBS-2 subgroups compared to the healthy controls (Table 17). Like in the comparison to the Healthy group both Blautia and Eggertella have increased in abundance and Prevotella has decreased. Flavonifrator has also increased in abundance across both altered IBS groups when comparing to the normal-like IBS group (IBS-3) which was not the case when comparing to the healthy group.

    [0268] Discussion

    [0269] Here it is shown that the IBS subgroups identified in Example 6 have distinct microbiome profiles. A number of differentially abundant genera were identified that are increased or decreased in particular subgroups. This may be informative for future stratification.

    Example 8—Metagenomic Profiling and Differential Abundance Analysis (Species Level) of IBS Subgroups

    [0270] Materials and Methods

    [0271] Subjects: The same subjects were studied as in Examples 6 and 7. The number of samples analysed in this Example is shown in Table 15.

    [0272] Metagenome profiling: Samples were sequenced using Shotgun sequencing as described in Example 1. Quality assessment of reads was carried out using FASTQC and MultiQC. The Humann2 pipeline (which includes metaphlan2) was used to determine abundance measures for taxa at the species level. In brief the output files from the humann2 pipeline showing the relative abundance for each taxonomy were merged into a single table of relative abundance values for each taxonomy across all samples. The number of counts associated with each value of relative abundance can be inferred by multiplying each relative abundance value with the total number of reads in the sample which contains each relative abundance value and taking the integer part of the resulting value. The final output was then a count table for species level taxa across all 142 samples. Again, if taxa were present in 30% or less of samples then they were removed from the table.

    [0273] Analysis of beta diversity: Principal Coordinate Analysis was performed as described in Example 6.

    [0274] Differential abundance analysis: Statistical analysis was carried out as described in Example 7. Differentially abundant metabolites at the species level were identified for the same six pairwise comparisons.

    [0275] Results

    [0276] Principal Coordinate Analysis of Beta Diversity of Metagenomics Data

    [0277] As shown in FIG. 14, the clustering from Example 6 is retained for the metagenomics dataset. Permutational MANOVA tests performed on the same pairwise comparisons as in the microbiome analysis (Example 7) showed the metagenomic beta diversity of the stratified samples to be the same in terms of significance to that of the microbiome beta diversity (Table 16).

    [0278] Differential Abundance Analysis—Species Level

    [0279] As in Example 7, an intersection matrix was used to portray the taxa between groups that had increased or decreased in abundance (Table 19). The matrix easily captured the difference between all the IBS groups showing the dissimilarities and similarities between each IBS group compared to the Healthy group relative to significance in species abundance. The fact that the normal-like IBS group is essentially the same as the healthy group in terms of species abundance is reflected in the absence of any species within the normal-like column of the intersection matrix (Table 19). For the altered IBS groups, Ruminoccus gnavus was increased in abundance in both IBS-1 and IBS-2 subgroups. Three different species of Clostridium have also increased across both altered IBS groups when compared to the Healthy group.

    [0280] Using the same intersection matrix methodology, it was also invenstigated what species were significantly differentially abundant across the altered IBS groups (IBS-2 and IBS-3) when compared to the normal-like IBS group (IBS-3). The results are shown in Table 20. Notable differences were observed. Firstly, no species was found significantly differentially abundant between the IBS-1 subgroup group and the IBS-3 subgroup group. Secondly, in the IBS-2 subgroup group compared to the IBS-3 subgroup group there were only 4 species which were significantly differentially abundant. Amongst these, Ruminoccus gnavus and a Clostridium species showed significant increases in abundance. The comparison between both altered IBS groups also revealed a low number of significantly differentially abundant species.

    [0281] Discussion

    [0282] Notably, the separation of altered IBS groups (IBS-1 and IBS-2) to the normal-like (IBS-3) and healthy subjects that was seen here (FIG. 14) was extremely similar to that observed for the microbiome analysis (Example 7, FIG. 13).

    [0283] This study also revealed that a number of species are significantly differentially abundant across the IBS subgroups, but not between the IBS-3 group and healthy subjects.

    [0284] In summary, this study demonstrated that the IBS subgroups identified in Example 6 have distinct metagenomic profiles, which may be informative for future stratification.

    Example 9—Metabolomics Profiling and Differential Abundance Analysis of Ibs Subgroups

    [0285] Materials and Methods

    [0286] Subjects: The same subjects were studied as in Examples 6-8. The number of samples analysed in this Example is shown in Table 15.

    [0287] Metabolome profiling: LC/GC-MS was used to measure the quantity of metabolomes for urine and fecal metabolites in each sample, as described in Examples 2 and 3, respectively, except SFCA analysis was not performed. The output measurement is a laser intensity and can be viewed in signal form as a peak on a spectrograph. Results from all samples are collated into a matrix of peak values for each metabolite detected across all 142 samples. Urine peak values were normalised to creatinine values. Faecal peak values were normalised to either dry weight of sample (LC) or wet weight of sample (GC).

    [0288] Analysis of beta diversity: Principal Coordinate Analysis was performed as described in Example 6.

    [0289] Results

    [0290] Principal Coordinate Analysis of Beta Diversity of Fecal and Urine Metabolomics Data

    [0291] Using the normalised peak value data from the metabolomic results and the stratification from Examples 6-8, the beta diversity between the altered IBS groups, the normal-like IBS group and the Healthy group was determined. The results of Principal Coordinate Analysis for fecal and urine metabolomics data are shown in FIGS. 15 and 16, respectively. With respect to the fecal metabolomics samples, Permutational MANOVA tests of all six pairwise comparisons revealed the separation between groups in terms of significance to be exactly the same as that found previously for both the microbiome samples and the metagenome samples (Table 16). However, with respect to the urine metabolomic samples, the beta diversity analysis displayed different separation between groups in terms of significance, in contrast to other profiles. The Permutational MANOVA results for the separation of groups in the urine metabolomics for pairwise comparisons showed that only the 3 pairwise comparisons of the IBS groups (IBS-1, IBS-2 and IBS-3) to the Healthy were significant in terms of separation (Table 16). Notably, in the urine metabolomic dataset there is a significant separation between the normal-like IBS-3 group and the Healthy group (FIG. 16), whereas the converse result of IBS-3 subgroup and the Healthy subjects not being significantly separated was a characteristic of the microbiome, metagenome (Examples 7 and 8) and faecal metabolomics (FIG. 15) datasets.

    [0292] Discussion

    [0293] Here it is shown that the IBS subgroups identified in Example 6 have distinct fecal metabolomic profiles. The results obtained for the urine metabolomics data differed from those obtained for the microbiome, metagenomics and fecal metabolomics data. This may be informative for future stratification.

    Example 10—Urine Metabolome Profiling of Ibs Patients and Controls with an Alternative Machine Learning Pipeline

    [0294] Materials and Methods

    [0295] Subject recruitment and sample collection were carried out as described in Example 1.

    [0296] Urine FAIMS: FAIMS analysis was performed using a protocol modified from that of Arasaradnam et al. (37) and described below. Any other appropriate method known in the art for detecting metabolites may be used in the methods of the invention. Frozen (−80° C.) urine samples were thawed overnight at 4° C., 5 mL of each urine sample was aliquoted into a 20 mL glass vial and placed into an ATLAS sampler (Owlstone, UK) attached to the Lonestar FAIMS instrument (Owlstone, UK). The sample was heated to 40° C. and sequentially run three times.

    [0297] Each sample run had a flow rate over the sample of 500 mL/min of clean dry air.

    [0298] Further make-up air was added to create a total flow rate of 2.5 L/min. The FAIMS was scanned from 0 to 99% dispersion field in 51 steps, ′+6 V to −6 V compensation voltage in 512 steps and both positive and negative ions were detected to produce an untargeted volatile organic compound (VOC) profile for each sample. The signals for each sample at each DF were smoothed using the Savitzky-Golay filter (window size=9, degree=3). The signals were trimmed based on an optimized cut-off of 0.007 for positive mode and −0.007 for negative mode outputs, to obtain the region of interest, and reduce the baseline noise. Signals were aligned to the trimmed signals at each DF, using crosscorrelation, using the mean signal as reference to make them comparable. Since the initial DFs of the FAIMS signal, and higher DFs were non-informative, signals corresponding to 17th DF till 42nd DF of both, positive, and negative modes were considered. These pre-processing steps were performed using customized programs developed in Python, v. 2.7.11, with relevant packages (Scipy v-1.1, and Numpy v-1.15.2). To further reduce the complexity, and to retain informative data, kurtosis normality tests were performed on each feature vector and features with raw p-value >0.1, were considered, and final profile was generated for various statistical analyses.

    [0299] Bioinformatics analysis of urine metabolome data (FAIMS): Each urine sample analysed using FAIMS yielded a profile with ca. 52,224 data points. A pooled profile containing these data points for each sample was generated for pre-processing, to reduce the noise, size, and complexity of the data.

    [0300] Urine GC/LC MS: 5 mL samples of frozen urine were sent on dry ice to Metabolomic Discoveries (now Metabolon), Potsdam, Germany. Untargeted metabolomics analysis was performed using liquid chromatography (LC) and Solid Phase Microextraction (SPME) gas chromatography (GC) and metabolites were identified using electrospray ionization mass spectrometry (ESI-MS). Short chain fatty acids (SCFA) analysis was also performed by LC-tandem mass spectrometry.

    [0301] For urine metabolomics, the values of metabolites were normalized with reference to urine creatinine levels in each sample.

    [0302] Bioinformatics analysis of urine metabolome data (MS): Urine MS metabolomics data was returned for all IBS subjects (n=80) and all but 2 controls (n=63) as these did not pass QC or no sample was available. A total of 2,887 metabolites were returned from untargeted urine metabolomics analysis, of which 594 were identified. Only the identified features with peak values normalized by creatinine levels in urine (mg/dl) were considered for further analysis.

    [0303] Machine learning: An in-house machine learning pipeline was applied to the urine metabolomic data. The machine learning pipeline used in this example is similar to the machine learning pipeline used in Examples 1 to 3, but comprised additional optimization and validation steps, using a two step approach within a ten-fold cross-validation. Within each validation fold Least Absolute Shrinkage and Selection Operator (LASSO) feature selection was carried out followed by Random Forest (RF) modelling and an optimised model was validated against the cross validation test data which is external to the cross-validation training subset.

    [0304] The classified urine metabolome sample profiles were log 10 transformed before they were analysed in the machine learning pipeline. The transformed profiles were then used to classify the samples as IBS (80 samples) or Control (63 samples). The classified samples were then analysed in the machine learning pipeline.

    [0305] FIG. 9 shows the machine learning pipeline used in this example. The classified fecal metabolome sample profiles were first split into a training set and a test set. The training set was then used to generate an optimal lambda (λ) range for use by the LASSO algorithm. The optimal lambda (λ) range was generated using the previously described cross-validated LASSO and using the glmnet package (version 2.0-18). Pre-determination of an optimal lambda (λ) range reduces the computational time to run the pipeline and removes the need for a user to specify the ranges manually.

    [0306] After determination of the lambda (λ) range, the samples were assigned weights based on their class probabilities. The weights assigned to the training samples in this step were used in all subsequent applicable steps.

    [0307] A LASSO algorithm substantially as described in Examples 1 to 3 was then applied to the weighted training samples. In this example, the LASSO algorithm used the previously calculated optimal lambda (λ) range, and used the Caret (version 6.0-84 in this example) and glmnet (version 2.0-18 in this example) packages, The ROC AUC (receiver operating characteristic, area under curve) metric was calculated using 10-fold internal cross validation, repeated 10 times. The feature coefficients identified by the optimized LASSO algorithm were extracted and features with non-zero coefficients were selected for further analysis. In FIG. 9, N refers to the number of features returned by the LASSO algorithm. If the number of features selected by LASSO was fewer than 5, then all of the features (pre-LASSO) were used to generate the random forest, i.e. the LASSO filtering was ignored by the random forest generator. If the number of features selected by LASSO was greater than or equal to 5, then only those features selected by LASSO were used for generation of the random forest (downstream classifier generation); otherwise all the features are considered for the classifier generation step.

    [0308] Following feature selection using LASSO, an optimized random forest classifier (with 1500 trees) was generated using the selected features, or all of the features, as determined by N. This optimised random forest classifier can be used to predict the external test fold. Random forest generation was performed using Caret (version 6.0-84) and internal cross validation, by tuning the ‘mtry’ parameter to maximise the ROC AUC metric. For tuning, if the number of selected features is greater than or equal to 5, mtry ranges from 1 to the square root of the number of selected features or else the range is from 1 to 6. The optimized random forest classifier was then applied to the test set and the performance of the classifier was calculated via the AUC, sensitivity, and specificity metrics.

    [0309] Both LASSO feature selection and RF modelling were performed within a 10-fold cross validation (CV), which generated an internal 10-fold prediction model that predicts the IBS or control classification of samples. This 10-fold cross-validation procedure was repeated ten times and the average AUC, sensitivity and specificity are reported. The optimized model is then used to predict the cross-validation test subset, and final classifier performance metrics are calculated from across the ten folds of the cross-validation (AUC, Sensitivity and Specificity).

    [0310] Results

    [0311] Metabolomic analysis was extended its application to all subjects, focusing initially on urine as a non-invasive test sample. Two methods were compared: FAIMS analysis for volatile organics, and combined GC-/LC-MS. The FAIMS technique did not identify discriminatory metabolites directly, but separated samples/subjects by characteristic plumes of ionized metabolites. In unsupervised analysis, FAIMS readily identified urine samples from controls and IBS (FIG. 4a), but could not distinguish among IBS clinical subtypes (FIG. 5). GC/LC-MS analysis of the urine metabolome also separated IBS patients from controls (FIG. 4b) and with greater accuracy than FAIMS (FIGS. 6a and 6b).

    [0312] Machine learning identified urine metabolomics features that are predictive of IBS (AUC 1.000; sensitivity: 1.000, specificity: 0.97, see Table 21a and 21b). Features that were highly predictive included dietary components such as epicatechin sulfate and medicagenic acid 3-O-b-Dglucuronide but also an acylgylcine (N-undecanoylglycine) and an acylcarnitine (decanoylcarnitine) (Table 21a and 21b). Pairwise comparison of control and IBS urine metabolomes identified 127 differentially abundant features (Table 6). Eighty nine urine metabolites were significantly less abundant in IBS subjects including a number of amino acids such as L-arginine, a precursor for the biosynthesis of nitric oxide which is associated both with mucosal defence and perhaps IBS pathophysiology. Another 38 metabolites were present at significantly higher levels in IBS including an acylgylcine (N-undecanoylglycine) and an acylcarnitine (decanoylcarnitine). Elevated levels of metabolites from these groups are associated with altered fatty acid oxidation/metabolism and disease.

    [0313] Discussion

    [0314] Although urine metabolomics was highly discriminatory for IBS, the machine learning analysis showed that the compounds identified were predominantly diet- or medication-associated. This observation is consistent with the results obtained using a different machine learning pipeline, as described in Example 2.

    CONCLUSION

    [0315] The findings of the current study have clinical implications. First, the microbiome and fecal metabolome, and the urine metabolome, offer objective biomarkers for IBS.

    [0316] Second, the traditional Rome subtyping of IBS is not supported by differences in microbiome and metabolome and it may be time to look for an alternative basis for disease classification.

    [0317] Third, while the results in no way detract from the concept of an altered brain-gut axis in IBS, they point toward disturbances of the diet-microbiome-metabolome axis which are consistent with the complaints of many patients and should inform the design of future therapeutic interventions in IBS.

    [0318] The taxa, pathways and metabolites that distinguish IBS subjects from controls identified here may be targeted by a range of microbiota-directed therapies such as fecal transplants, antibiotics, probiotics or live biotherapeutics.

    [0319] Fourth, hierarchical clustering can be used to identify distinct IBS subtypes with differing microbiomes and fecal metabolomes. Some subgroups have an altered microbiome and fecal metabolome, whilst one subgroup had a normal-like microbiome and fecal metabolome. The identification and characterisation of these subgroups as described herein may be informative for future stratification and treatment.

    [0320] Current stratification into clinical subtypes of IBS should not form the basis for therapeutic decisions, because the altered microbiota (compared to control subjects) is similar in the subtypes, consistent with alternating between constipation and diarrheal forms in many patients. A more informative stratification would be achieved by fecal microbiota and metabolome profiling. The metagenomic and metabolomic signatures that distinguish IBS subjects from controls identified here may be targeted by these microbiota-directed therapies.

    REFERENCES

    [0321] 1. Enck, P. et al Irritable bowel syndrome—dissection of a disease. A 13-steps polemic. Z Gastroenterol. 2017 July; 55(7):679-684. [0322] 2. Enck P, Aziz Q, Barbara G, et al. Irritable bowel syndrome. Nat. Rev. Dis. Primers 2016; 2:16014. [0323] 3. Soares R L. Irritable bowel syndrome: a clinical review. World J. Gastroenterol. 2014; 20:12144-60. [0324] 4. Van Oudenhove L, Aziz Q. The role of psychosocial factors and psychiatric disorders in functional dyspepsia. Nat. Rev. Gastroenterol. Hepatol. 2013; 10:158-67. [0325] 5. Koloski N A, Jones M, Kalantar J, et al. The brain-gut pathway in functional gastrointestinal disorders is bidirectional: a 12-year prospective population-based study. Gut 2012; 61:1284-90. [0326] 6. Schwille-Kiuntke J, Mazurak N, Enck P. Systematic review with meta-analysis: post-infectious irritable bowel syndrome after travellers' diarrhoea. Aliment. Pharmacol. Ther. 2015; 41:1029-37. [0327] 7. Quigley E M M. The Gut-Brain Axis and the Microbiome: Clues to Pathophysiology and Opportunities for Novel Management Strategies in Irritable Bowel Syndrome (IBS). J. Clin. Med. 2018; 7. [0328] 8. Lacy, B. E. and Patel, N. K. Rome Criteria and a Diagnostic Approach to Irritable Bowel Syndrome. J Clin Med. 2017 Oct. 26; 6(11). [0329] 9. Carroll I M, Ringel-Kulka T, Keku T O, et al. Molecular analysis of the luminal- and mucosalassociated intestinal microbiota in diarrhea-predominant irritable bowel syndrome. Am. J. Physiol. Gastrointest. Liver Physiol. 2011; 301:G799-807. [0330] 10. Rajilic-Stojanovic M, Biagi E, Heilig H G, et al. Global and Deep Molecular Analysis of Microbiota Signatures in Fecal Samples From Patients With Irritable Bowel Syndrome. Gastroenterology 2011; 141:1792-1801. [0331] 11. Jeffery I B, O'Toole P W, Ohman L, et al. An irritable bowel syndrome subtype defined by species-specific alterations in faecal microbiota. Gut 2012; 61:997-1006. [0332] 12. Tap J, Derrien M, Tornblom H, et al. Identification of an Intestinal Microbiota Signature Associated With Severity of Irritable Bowel Syndrome. Gastroenterology 2017; 152:111-123. [0333] 13. Collins S M. A role for the gut microbiota in IBS. Nat. Rev. Gastroenterol. Hepatol. 2014; 11:497-505. [0334] 14. Ohman L, Simren M. Intestinal microbiota and its role in irritable bowel syndrome (IBS). Curr. Gastroenterol. Rep. 2013; 15:323. [0335] 15. Tao Bai, Jing Xia, Yudong Jiang, Huan Cao, Yong Zhao, Lei Zhang, Huan Wang, Jun Song, and Xiaohua Hou. Comparison of the Rome IV and Rome III criteria for IBS diagnosis: A cross-sectional survey. Journal of gastroenterology and hepatology 32.5 (2017), pp. 1018-1025. [0336] 16. Magda Guilera, Agustin Balboa, and Fermin Mearin. Bowel habit subtypes and temporal patterns in irritable bowel syndrome: systematic review. The American journal of gastroenterology 100.5 (2005), p. 1174. [0337] 17. Drossman D A, Morris C B, Schneck S, et al. International survey of patients with IBS: symptom features and their severity, health status, treatments, and risk taking to achieve clinical benefit. J. Clin. Gastroenterol. 2009; 43:541-50. [0338] 18. Marcus J Claesson, Ian B Jeffery, Susana Conde, Susan E Power, Eibhlis M O'connor, Siobhan Cusack, Hugh M B Harris, Mairead Coakley, Bhuvaneswari Lakshminarayanan, Orla O'sullivan, et al. Gut microbiota composition correlates with diet and health in the elderly. Nature 488.7410 (2012), p. 178. [0339] 19. Lacy B E, Everhart K K, Weiser K T, et al. IBS patients' willingness to take risks with medications. Am. J. Gastroenterol. 2012; 107:804-9. [0340] 20. R. Guevremont, High-field asymmetric waveform ion mobility spectrometry: a new tool for mass spectrometry. J. Chromatogr. A, November 2004: 1058 (1-2): 3-19. [0341] 21. Savitzky A., Golay M J E. “Smoothing and Differentiation of Data by Simplified Least Squares Procedures”, Anal. Chem., 36(8), 1964, pages 1627-1639. [0342] 22. R. Tibshirani, “Regression Shrinkage and Selection via the Lasso”, Journal of the Royal Statistical Society, Series B, 58(1), 1996, pages 267-288. [0343] 23. Jeffery I B, O'Toole P W, Ohman L, Claesson M J, Deane J, Quigley E M, Simren M. 2012. “An irritable bowel syndrome subtype defined by species-specific alterations in fecal microbiota.” Gut 61:997-1006. [0344] 24. Zigmond, A. S. and R. P. Snaith, The hospital anxiety and depression scale. Acta Psychiatr. Scand., 1983. 67(6): p. 361-70. [0345] 25. Power, S. E., et al., Food and nutrient intake of Irish community-dwelling elderly subjects: who is at nutritional risk? J. Nutr. Health Aging., 2014. 18(6): p. 561-72. [0346] 26. Brown J R, Flemer B, Joyce S A, et al. Changes in microbiota composition, bile and fatty acid metabolism, in successful faecal microbiota transplantation for Clostridioides difficile infection. BMC Gastroenterol. 2018; 18:131. [0347] 27. Magoc T, Salzberg S L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011; 27:2957-63. [0348] 28. Edgar R C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010; 26:2460-1. [0349] 29. Edgar R C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013; 10:996-8. [0350] 30. Edgar R C, Haas B J, Clemente J C, et al. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011; 27:2194-200. [0351] 31. Consortium H M P. The Human Microbiome Project Consortium. Structure, function and diversity of the healthy human microbiome. Nature 2012; 486:207-14. [0352] 32. Franzosa E A, McIver L J, Rahnavard G, et al. Species-level functional profiling of metagenomes and metatranscriptomes. Nat. Methods 2018; 15:962-968. [0353] 33. Flemer B, Warren R D, Barrett M P, et al. The oral microbiota in colorectal cancer is distinctive and predictive. Gut 2018; 67:1454-1463. [0354] 34. Core Team R. R: A language and environment for statistical computing. 2017. R Foundation for Statistical Computing, Vienna, Austria.; https://www.R-project.org/. [0355] 35. Shankar V, Homer D, Rigsbee L, et al. The networks of human gut microbe-metabolite associations are different between health and irritable bowel syndrome. ISME J. 2015; 9:1899-903. [0356] 36. Vich Vila A, Imhann F, Collij V, et al. Gut microbiota composition and functional changes in inflammatory bowel disease and irritable bowel syndrome. Sci. Transl. Med. 2018; 10. [0357] 37. Arasaradnam R P, Westenbrink E, McFarlane M J, et al. Differentiating coeliac disease from irritable bowel syndrome by urinary volatile organic compound analysis—a pilot study. PLoSOne 2014; 9:e107312. [0358] 38. Flemer B, Warren R D, Barrett M P, et al. The oral microbiota in colorectal cancer is distinctive and predictive. Gut 2018; 67:1454-1463. [0359] 39. Neis, E. P., Dejong, C. H. & Rensen, S. S. The role of microbial amino acid metabolism in host metabolism. Nutrients 7, 2930-2946 (2015). Pedregosa F, et al. Scikit-learn: Machine Learning in Python. Journal of Machine Learning Research 12, 825-2830 (2011). [0360] 40. Wallace J L. Nitric oxide in the gastrointestinal tract: opportunities for drug development. Br. J. Pharmacol. 2019; 176:147-154. [0361] 41. Hoppel C. The role of carnitine in normal and altered fatty acid metabolism. Am. J. Kidney Dis. 2003; 41:54-12. [0362] 42. Liu X, Liu Y, Cheng M, et al. Metabolomic Responses of Human Hepatocytes to Emodin, Aristolochic Acid, and Triptolide: Chemicals Purified from Traditional Chinese Medicines. J. Biochem. Mol. Toxicol. 2015; 29:533-43. [0363] 43. Vishwanath V A. Fatty Acid Beta-Oxidation Disorders: A Brief Review. Ann. Neurosci. 2016; 23:51-5. [0364] 44. Korman S H, Waterham H R, Gutman A, et al. Novel metabolic and molecular findings in hepatic carnitine palmitoyltransferase I deficiency. Mol. Genet. Metab. 2005; 86:337. [0365] 45. Riemsma R, Al M, Corro Ramos I, et al. SeHCAT [tauroselcholic (selenium-75) acid] for the investigation of bile acid malabsorption and measurement of bile acid pool loss: a systematic review and cost-effectiveness analysis. Health Technol. Assess. 2013; 17:1-236. [0366] 46. Dior M, Delagreverie H, Duboc H, et al. Interplay between bile acid metabolism and microbiota in irritable bowel syndrome. Neurogastroenterol. Motil. 2016; 28:1330-40. [0367] 47. Yu L M, Zhao K J, Wang S S, Wang X and Lu B. Gas chromatography/mass spectrometry based metabolomic study in a murine model of irritable bowel syndrome. World J Gastroenterol. 2018. 24(8):894-904. doi: 10.3748/wjg.v24.i8.894. [0368] 48. Nielsen, H. B., Almeida, M., Juncker, A. S., Rasmussen, S., Li, J., Sunagawa, S., . . . MetaHIT Consortium. (2014). Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes. Nature Biotechnology. hops://doi. org/10. 1038/nbt.2939. [0369] 49. Blaxter, M.; Mann, J.; Chapman, T.; Thomas, F.; Whitton, C.; Floyd, R.; Abebe, E. (October 2005). “Defining operational taxonomic units using DNA barcode data”. Philos Trans R Soc Lond B Biol Sci. 360 (1462): 1935-43.

    TABLES

    [0370]

    TABLE-US-00002 TABLE 1 Genus level (16S) Machine learning LASSO and Random Forest (RF) statistics of genera predictive of IBS LASSO RF lambda AUC Sens Spec mtry AUC Sens Spec 0.074 0.780 0.824 0.501 1 0.835 0.815 0.704 10-fold Cross Validation 10-fold Cross Validation Reference Reference Prediction Control IBS Prediction Control IBS Control 30.3 14.2 Control 41.7 14.7 IBS 28.7 65.8 IBS 17.3 65.3 Accuracy (average) 0.687 Accuracy (average) 0.770 Rank # Ranking Genus Rank # Ranking Genus 1 100.00 Actinomyces 1 100 Lachnospiraceae_noname 2 12.71 Oscillibacter 2 99.02 Oscillibacter 3 3.41 Paraprevotella 3 67.51 Coprococcus 4 3.11 Lachnospiraceae_noname 4 35.29 Erysipelotrichaceae_noname 5 1.49 Erysipelotrichaceae_noname 5 25.79 Paraprevotella 6 0.53 Coprococcus 6 0 Actinomyces Analysis had 2 classes: Control and IBS and included 139 samples (IBS: n = 80 and Control: n = 59) Metrics reported are the average values from 10 repeats of 10-fold Cross Validation. Taxonomy classified using the RDP classfier, database version 2.10.1.

    TABLE-US-00003 TABLE 2 Identification of predictive features of IBS by Shotgun species Machine learning LASSO and Random Forest (RF) statistics LASSO RF lambda AUC Sens Spec mtry AUC Sens Spec 0.04 0.662 0.675 0.516 1 0.878 0.894 0.687 10-fold Cross Validation 10-fold Cross Validation Reference Reference Prediction Control IBS Prediction Control IBS Control 30.5 26 Control 40.5 8.5 IBS 28.5 54 IBS 18.5 71.5 Accuracy (average) 0.608 Accuracy (average) 0.806 Rank # Ranking Taxon Rank # Ranking Taxon 1 100 Prevotella_buccalis 1 100 Ruminococcus_gnavus 2 25.43 Butyricicoccus_pullicaecorum 2 89.92 Lachnospiraceae_bacterium_3_1_46FAA 3 9.96 Granulicatella_elegans 3 82.31 Coprococcus_catus 4 2.8 Pseudoflavonifractor_capillosus 4 78.74 Lachnospiraceae_bacterium_7_1_58FAA 5 2.5 Clostridium_ramosum 5 77.9 Barnesiella_intestinihominis 6 2.17 Streptococcus_sanguinis 6 74.39 Anaerotruncus_colihominis 7 1.47 Clostridium_citroniae 7 71.53 Eubacterium_eligens 8 1.13 Desulfovibrio_desulfuricans 8 69.19 Lachnospiraceae_bacterium_1_4_56FAA 9 0.76 Haemophilus_pittmaniae 9 64.93 Clostridium_symbiosum 10 0.72 Paraprevotella_clara 10 59.37 Roseburia_inulinivorans 11 0.48 Lachnospiraceae_bacterium_7_1_58FAA 11 54.02 Paraprevotella_clara 12 0.45 Streptococcus_anginosus 12 53.32 Ruminococcus_lactaris 13 0.35 Anaerotruncus_colihominis 13 51.1 Clostridium_citroniae 14 0.29 Lachnospiraceae_bacterium_1_4_56FAA 14 50.26 Lachnospiraceae_bacterium_2_1_58FAA 15 0.24 Clostridium_symbiosum 15 50.2 Clostridium_leptum 16 0.23 Mitsuokella_multacida 16 49.57 Ruminococcus_bromii 17 0.21 Clostridium_nexile 17 47.96 Bacteroides_thetaiotaomicron 18 0.14 Lachnospiraceae_bacterium_3_1_46FAA 18 47.14 Eubacterium_biforme 19 0.13 Lactobacillus_fermentum 19 46.17 Bifidobacterium_adolescentis 20 0.12 Eubacterium_biforme 20 44.94 Parabacteroides_distasonis 21 0.12 Clostridium_leptum 21 42.72 Coprococcus_sp_ART55_1 22 0.11 Bacteroides_pectinophilus 22 37.99 Dialister_invisus 23 0.087 Coprococcus_catus 23 36.52 Bacteroides_faecis 24 0.047 Alistipes_sp_AP11 24 33.42 Butyrivibrio_crossotus 25 0.04 Eubacterium_eligens 25 33 Clostridium_nexile 26 0.037 Roseburia_inulinivorans 26 31.09 Bacteroides_cellulosilyticus 27 0.036 Bacteroides_faecis 27 27.59 Pseudoflavonifractor_capillosus 28 0.034 Barnesiella_intestinihominis 28 27.43 Streptococcus_anginosus 29 0.025 Lachnospiraceae_bacterium_2_1_58FAA 29 25.94 Streptococcus_sanguinis 30 0.024 Bacteroides_thetaiotaomicron 30 21.48 Desulfovibrio_desulfuricans 31 0.0075 Ruminococcus_bromii 31 21.3 Clostridium_ramosum 32 0.0048 Ruminococcus_gnavus 32 20.91 Alistipes_sp_AP11 33 0.0037 Ruminococcus_lactaris 33 16.77 Lactobacillus_fermentum 34 0.0029 Parabacteroides_distasonis 34 9.17 Mitsuokella_multacida 35 0.0026 Butyrivibrio_crossotus 35 7.55 Haemophilus_pittmaniae 36 0.0022 Bacteroides_cellulosilyticus 36 5.71 Bacteroides_pectinophilus 37 0.00096 Bifidobacterium_adolescentis 37 3.29 Prevotella_buccalis 38 0.00056 Bacteroides_sp_1_1_6 38 1.15 Bacteroides_sp_1_1_6 39 0.00049 Dialister_invisus 39 1.04 Granulicatella_elegans 40 0.00048 Coprococcus_sp_ART55_1 40 0 Butyricicoccus_pullicaecorum Analysis had 2 classes: Control and IBS and included 139 samples (IBS: n = 80 and Control: n = 59) LASSO feature selection 288 variables

    TABLE-US-00004 TABLE 3 Shotgun species differentially abundant between the IBS and Control groups Wilcoxon Species IBS (IQR) Control (IQR) Statistic p-value q-value Ruminococcus.sub.—gnavus 0.0136 (0-0.187) 0 (0-0) 1209 <0.001 <0.001 Clostridium.sub.—bolteae 0.016 (0-0.0873) 0 (0-0.00248) 1189 <0.001 <0.001 Clostridiales.sub.—bacterium_1_7_47FAA 0 (0-0.0122) 0 (0-0) 1401 <0.001 <0.001 Anaerotruncus.sub.—colihominis 0 (0-0.0266) 0 (0-0) 1457 <0.001 0.00029 Lachnospiraceae.sub.—bacterium_1_4_56FAA 0.000465 (0-0.0453) 0 (0-0) 1433 <0.001 0.00029 Flavonifractor.sub.—plautii 0.000835 (0-0.0266) 0 (0-0) 1480.5 <0.001 0.00087 Clostridium.sub.—clostridioforme 0 (0-0.0209) 0 (0-0) 1612 0.0001 0.00087 Clostridium.sub.—hathewayi 0.00177 (0-0.0316) 0 (0-0) 1468 0.000106 0.00087 Clostridium.sub.—symbiosum 0.00164 (0-0.0882) 0 (0-0) 1515 0.000201 0.00147 Ruminococcus.sub.—torques 0.557 (0.266-1.33) 0.249 (0.107-0.568) 1428 0.000245 0.00161 Alistipes.sub.—senegalensis 0 (0-0.016) 0.0155 (0-0.0885) 3027 0.000365 0.00218 Prevotella.sub.—copri 0 (0-0) 0 (0-0.596) 2835 0.000607 0.00309 Eggerthella.sub.—lenta 0 (0-0.00447) 0 (0-0) 1645.5 0.000612 0.00309 Lachnospiraceae.sub.—bacterium_5_1_57FAA 0 (0-0) 0 (0-0) 1885 0.00116 0.00546 Lachnospiraceae.sub.—bacterium_3_1_46FAA 0.0729 (0.0207-0.2) 0.0212 (0.00171-0.0787) 1534.5 0.00135 0.0059 Clostridium.sub.—asparagiforme 0 (0-0.0113) 0 (0-0) 1651 0.00177 0.00705 Barnesiella.sub.—intestinihominis 0.558 (0-1.75) 1.41 (0.587-2.35) 2968.5 0.00182 0.00705 Clostridium.sub.—citroniae 0.00289 (0-0.0237) 0 (0-0.00399) 1630 0.00194 0.00709 Eubacterium.sub.—eligens 0.669 (0.0405-1.27) 1.18 (0.395-2.12) 2947 0.00258 0.00874 Lachnospiraceae.sub.—bacterium_7_1_58FAA 0.0273 (0.0102-0.0683) 0.0121 (0.00511-0.0273) 1579.5 0.00266 0.00874 Coprococcus_sp_ART_551 0 (0-0) 0 (0-4.25) 2817.5 0.00376 0.0118 Lachnospiraceae.sub.—bacterium_3_1_57FAA_CT1 0.000675 (0-0.0517) 0 (0-0.000522) 1675 0.004 0.0119 Clostridium.sub.—ramosum 0 (0-0) 0 (0-0) 1927.5 0.00532 0.0152 Coprococcus.sub.—catus 0.238 (0.0985-0.426) 0.338 (0.239-0.512) 2877 0.0068 0.0186 Eubacterium.sub.—biforme 0 (0-0.37) 0.222 (0-0.86) 2815 0.00721 0.0189 Ruminococcus.sub.—lactaris 0 (0-0.488) 0.41 (0-0.99) 2814.5 0.00986 0.0249 Bacteroides.sub.—massiliensis 0 (0-0) 0 (0-1.19) 2729 0.0108 0.0253 Lachnospiraceae.sub.—bacterium_2_1_58FAA 0.00245 (0-0.0446) 0 (0-0.0101) 1735 0.0111 0.0253 Haemophilus.sub.—parainfluenzae 0 (0-0.0112) 0.00638 (0-0.0493) 2788.5 0.0115 0.0253 Clostridium.sub.—nexile 0 (0-0.00897) 0 (0-0) 1846.5 0.0119 0.0253 Clostridium.sub.—innocuum 0 (0-0.00333) 0 (0-0) 1869.5 0.012 0.0253 Bacteroides.sub.—xylanisolvens 0.00587 (0-0.103) 0.0561 (0.00379-0.163) 2807 0.0144 0.0296 Oxalobacter.sub.—formigenes 0 (0-0) 0 (0-0) 2575 0.0167 0.0332 Alistipes.sub.—putredinis 1.29 (0-3.26) 3.05 (0.483-4.23) 2796.5 0.0177 0.0342 Paraprevotella.sub.—clara 0 (0-0.014) 0 (0-0.179) 2714 0.0192 0.036 Odoribacter.sub.—splanchnicus 0.357 (0-0.687) 0.573 (0.0488-0.883) 2772 0.0217 0.0395 Eubacterium_sp_3_1_31 0 (0-0) 0 (0-0) 1951 0.0266 0.0472 Shotgun compositional analysis performed on 139 samples (IBS: n = 78 and Control: n = 58) Median abundance % represented as inter-quartile range (IQR)

    TABLE-US-00005 TABLE 4 Genes associated with pathways differentially abundant between IBS and the Control groups Pathway IBS Control Wilcoxon p- q- Pathway_Species names (IQR) (IQR) Statistic value value PWY_6700_unclassified queuosine biosynthesis 0.00641 0.0102 3496 0 0 (0.00467-0.0083) (0.0082-0.0155) NONMEVIPP_PWY_unclassified methylerythritol phosphate 0.0124 0.017 3421 0 0.000142 pathway I (0.00846-0.015) (0.0138-0.0199) PWY_5667_unclassified CDP-diacylglycerol 0.00867 0.0129 3395 0 0.000142 biosynthesis I (0.00609-0.0115) (0.00984-0.0159) PWY_6737_unclassified starch degradation V 0.0158 0.0221 3398 0 0.000142 (0.00983-0.02) (0.0166-0.0268) PWY0_1319_unclassified CDP-diacylglycerol 0.00867 0.0129 3395 0 0.000142 biosynthesis II (0.00609-0.0115) (0.00984-0.0159) PWY_2942_unclassified L-lysine biosynthesis III 0.00753 0.0113 3374 0 0.000159 (0.00574-0.00975) (0.00881-0.014) PWY_6387_unclassified UDP-N-acetylmuramoyl- 0.0155 0.022 3376 0 0.000159 pentapeptide biosynthesis I (0.0115-0.0191) (0.0168-0.0277) (meso-diaminopimelate containing) PWY_724_unclassified superpathway of L-lysine, L- 0.00666 0.00967 3369 0 0.000159 threonine and L-methionine (0.00519-0.00858) (0.00778-0.0117) biosynthesis II PWY_6386_unclassified UDP-N-acetylmuramoyl- 0.016 0.0227 3360 0 0.000166 pentapeptide biosynthesis II (0.0119-0.0197) (0.0174-0.0286) (lysine-containing) PWY_6703_unclassified preQ0 biosynthesis 0.00304 0.00503 3357 0 0.000166 (0.00198-0.00418) (0.00351-0.00691) PWY_5097_unclassified L-lysine biosynthesis VI 0.00973 0.014 3340 0 0.000219 (0.00701-0.0127) (0.0107-0.0175) PWY0_1296_Clostridium_bolteae purine ribonucleosides 0 0 1467 0 0.00024 degradation (0-0.0000507) (0-0) UNINTEGRATED_unclassified UNINTEGRATED 8.68 10.6 3328 0 0.00024 (6.59-9.76) (9.11-11.8) PWY_7187_unclassified pyrimidine 0.00302 0.00453 3323 0 0.000249 deoxyribonucleotides de novo (0.00241-0.00404) (0.0035-0.00555) biosynthesis II PWY_6124_unclassified inosine-5′-phosphate 0.00091 0.00153 3318 0 0.000258 biosynthesis II (0.000715-0.0013) (0.00111-0.00211) PEPTIDOGLYCANSYN_PWY_unclassified peptidoglycan biosynthesis I 0.0132 0.0179 3305 0 0.000305 (meso-diaminopimelate (0.00956-0.0165) (0.014-0.0252) containing) PWY_5686_unclassified UMP biosynthesis 0.0146 0.0198 3302 0 0.000305 (0.0108-0.0187) (0.0161-0.0242) PWY_6151_unclassified S-adenosyl-L-methionine 0.0121 0.0159 3299 0 0.000305 cycle I (0.00814-0.0148) (0.0129-0.0189) PWY_7219_unclassified adenosine ribonucleotides de 0.0197 0.0308 3300 0 0.000305 novo biosynthesis (0.0155-0.0268) (0.021-0.0373) UNINTEGRATED_Ruminococcus_gnavus UNINTEGRATED 0 0 1431.5 0 0.000326 (0-0.21) (0-0) ANAGLYCOLYSIS_PWY_unclassified glycolysis III (from glucose) 0.00221 0.00375 3285.5 0 0.000365 (0.00115-0.00326) (0.00288-0.00472) COA_PWY_1_unclassified coenzyme A biosynthesis I 0.0129 0.0179 3273 0 0.000431 (0.00896-0.016) (0.0131-0.0211) PWY_6123_unclassified inosine-5′-phosphate 0.00117 0.00198 3274 0 0.000431 biosynthesis I (0.000849-0.00167) (0.0014-0.00266) PWY_5686_Lachnospiraceae_bacterium_7_1_58FAA UMP biosynthesis 0 0 1490 0 0.000471 (0-0.0000914) (0-0) ASPASN_PWY_unclassified superpathway of L-aspartate 0.000953 0.00134 3245 0 0.000492 and L-asparagine biosynthesis (0.000508-0.0012) (0.000972-0.00189) COA_PWY_1_Lachnospiraceae_bacterium_7_1_58FAA coenzyme A biosynthesis I 0 0 1511 0 0.000492 (0-0.000138) (0-0) HISDEG_PWY_unclassified L-histidine degradation I 0.00142 0.00363 3239 0 0.000492 (0.000609-0.00296) (0.00176-0.00524) PWY_6121_unclassified 5-aminoimidazole 0.0133 0.0182 3248 0 0.000492 ribonucleotide biosynthesis I (0.00989-0.0166) (0.0137-0.0221) PWY_6122_unclassified 5-aminoimidazole 0.0137 0.0189 3240 0 0.000492 ribonucleotide biosynthesis II (0.0103-0.0177) (0.0139-0.0227) PWY_6277_unclassified superpathway of 5- 0.0137 0.0189 3240 0 0.000492 aminoimidazole ribonucleotide (0.0103-0.0177) (0.0139-0.0227) biosynthesis PWY_6737_Ruminococcus_gnavus starch degradation V 0 0 1571 0 0.000492 (0-0.0000431) (0-0) PWY_7111_Lachnospiraceae_bacterium_7_1_58FAA pyruvate fermentation to 0.0000524 0 1336 0 0.000492 isobutanol (engineered) (0-0.000133) (0-0.000026) PWY_7219_Lachnospiraceae_bacterium_7_1_58FAA adenosine ribonucleotides de 0.0000374 0 1372 0 0.000492 novo biosynthesis (0-0.000151) (0-0) PWY_7219_Ruminococcus_gnavus adenosine ribonucleotides de 0 0 1529.5 0 0.000492 novo biosynthesis (0-0.0000285) (0-0) PWY_7221_unclassified guanosine ribonucleotides de 0.0135 0.0179 3256 0 0.000492 novo biosynthesis (0.00938-0.0172) (0.0143-0.0237) PWY0_1296_Ruminococcus_gnavus purine ribonucleosides 0 0 1600 0 0.000492 degradation (0-0.0000432) (0-0) THRESYN_PWY_unclassified superpathway of L-threonine 0.00446 0.00613 3257 0 0.000492 biosynthesis (0.00339-0.00534) (0.00445-0.00756) TRNA_CHARGING_PWY_unclassified tRNA charging 0.0138 0.0199 3239 0 0.000492 (0.0111-0.0192) (0.0143-0.0263) UNINTEGRATED_Clostridium_bolteae UNINTEGRATED 0 0 1435 0 0.000492 (0-0.359) (0-0) VALSYN_PWY_Lachnospiraceae_bacterium_7_1_58FAA L-valine biosynthesis 0.0000524 0 1336 0 0.000492 (0-0.000133) (0-0.000026) PWY_841_unclassified superpathway of purine 0.0018 0.00305 3237 0 0.000499 nucleotides de novo (0.00142-0.00242) (0.00178-0.00397) biosynthesis I PWY_2942_Lachnospiraceae_bacterium_7_1_58FAA L-lysine biosynthesis III 0 0 1524 0 0.000521 (0-0.0000645) (0-0) PWY_5973_unclassified cis-vaccenate biosynthesis 0.00195 0.00338 3231.5 0 0.000521 (0.000762-0.00314) (0.00249-0.00421) PWY_7221_Lachnospiraceae_bacterium_7_1_58FAA guanosine ribonucleotides de 0 0 1475 0 0.000521 novo biosynthesis (0-0.0000568) (0-0) DENOVOPURINE2_PWY_unclassified superpathway of purine 0.00181 0.00318 3225 0 0.000576 nucleotides de novo (0.00153-0.0026) (0.00192-0.00433) biosynthesis II PWY_6545_unclassified pyrimidine 0.00126 0.00221 3222 0 0.000596 deoxyribonucleotides de novo (0.000884-0.00184) (0.00158-0.00312) biosynthesis III PWY0_1296_unclassified purine ribonucleosides 0.0113 0.0152 3220 0 0.000596 degradation (0.00861-0.0148) (0.0117-0.0209) PWY0_166_unclassified superpathway of pyrimidine 0.00237 0.00396 3221 0 0.000596 deoxyribonucleotides de novo (0.00171-0.00372) (0.00313-0.0053) biosynthesis (E. coli) PWY_7663_unclassified gondoate biosynthesis 0.00177 0.00284 3202 0 0.000826 (anaerobic) (0.000653-0.00263) (0.00208-0.00353) PWY_5695_unclassified urate biosynthesis/inosine 5′- 0.00353 0.00623 3199 0 0.000857 phosphate degradation (0.00208-0.00572) (0.00364-0.00997) NONMEVIPP_PWY_Ruminococcus_torques methylerythritol phosphate 0.000113 0 1405.5 0 0.00113 pathway I (0-0.00033) (0-0.000079) PWY_3001_unclassified superpathway of L-isoleucine 0.00515 0.00742 3180 0 0.00118 biosynthesis I (0.00409-0.0064) (0.00549-0.0085) PANTOSYN_PWY_unclassified pantothenate and coenzyme A 0.0028 0.00417 3169 0 0.00142 biosynthesis I (0.00173-0.00405) (0.00311-0.00545) PWY_6386_Lachnospiraceae_bacterium_7_1_58FAA UDP-N-acetylmuramoyl- 0 0 1582 0 0.00145 pentapeptide biosynthesis II (0-0.0000798) (0-0) (lysine-containing) PWY_6387_Lachnospiraceae_bacterium_7_1_58FAA UDP-N-acetylmuramoyl- 0 0 1582 0 0.00145 pentapeptide biosynthesis I (0-0.0000712) (0-0) (meso-diaminopimelate containing) PWY_7219_Clostridium_bolteae adenosine ribonucleotides de 0 0 1568 0 0.00145 novo biosynthesis (0-0.0000501) (0-0) PWY_6122_Ruminococcus_gnavus 5-aminoimidazole 0 0 1687.5 0 0.00154 ribonucleotide biosynthesis II (0-0.0000227) (0-0) PWY_6277_Ruminococcus_gnavus superpathway of 5- 0 0 1687.5 0 0.00154 aminoimidazole ribonucleotide (0-0.0000227) (0-0) biosynthesis PWY_6737_Clostridium_clostridioforme starch degradation V 0 0 1685.5 0 0.00154 (0-0.000027) (0-0) UNINTEGRATED_Lachnospiraceae_bacterium_1_4_56FAA UNINTEGRATED 0 0 1566.5 0 0.00154 (0-0.0687) (0-0) PWY_5188_Lachnospiraceae_bacterium_7_1_58FAA tetrapyrrole biosynthesis I 0 0 1554 0 0.00155 (from glutamate) (0-0.0000684) (0-0) CALVIN_PWY_unclassified Calvin-Benson-Bassham cycle 0.00666 0.00836 3152 0 0.00166 (0.00482-0.00804) (0.00703-0.0101) PWY_4984_Lachnospiraceae_bacterium_7_1_58FAA urea cycle 0 0 1510 0 0.00172 (0-0.0000923) (0-0) PWY_7184_unclassified pyrimidine 0.00137 0.00233 3149 0 0.00172 deoxyribonucleotides de novo (0.000978-0.00222) (0.00168-0.00388) biosynthesis I PWY_7199_unclassified pyrimidine 0.00137 0.00215 3147 0 0.00174 deoxyribonucleosides salvage (0.000839-0.0022) (0.00147-0.00285) UNINTEGRATED_Lachnospiraceae_bacterium_2_1_58FAA UNINTEGRATED 0 0 1667 0.00011 0.00185 (0-0.0361) (0-0) PANTO_PWY_Ruminococcus_gnavus phosphopantothenate 0 0 1642.5 0.00012 0.00193 biosynthesis I (0-0.0000557) (0-0) PWY_6737_Clostridium_bolteae starch degradation V 0 0 1651 0.00012 0.00193 (0-0.0000318) (0-0) PWY_6151_Ruminococcus_gnavus S-adenosyl-L-methionine 0 0 1712 0.00012 0.00198 cycle I (0-0.0000345) (0-0) PWY_6609_Ruminococcus_gnavus adenine and adenosine salvage 0 0 1718 0.00014 0.00232 III (0-0.0000122) (0-0) PEPTIDOGLYCANSYN_PWY_Lachnospiraceae_bacterium_7_1_58FAA peptidoglycan biosynthesis I 0 0 1629 0.00015 0.00243 (meso-diaminopimelate (0-0.0000774) (0-0) containing) PWY_7219_Clostridium_symbiosum adenosine ribonucleotides de 0 0 1608.5 0.00016 0.00248 novo biosynthesis (0-0.0000445) (0-0) PWY_6122_Clostridium_clostridioforme 5-aminoimidazole 0 0 1769 0.00016 0.00249 ribonucleotide biosynthesis II (0-0) (0-0) PWY_6277_Clostridium_clostridioforme superpathway of 5- 0 0 1769 0.00016 0.00249 aminoimidazole ribonucleotide (0-0) (0-0) biosynthesis UNINTEGRATED_Lachnospiraceae_bacterium_3_1_46FAA UNINTEGRATED 0.062 0 1481 0.00019 0.00284 (0-0.202) (0-0.0573) PWY_7219_Lachnospiraceae_bacterium_3_1_46FAA adenosine ribonucleotides de 0.0000183 0 1515.5 0.0002 0.00304 novo biosynthesis (0-0.000202) (0-0) PWY_6125_unclassified superpathway of guanosine 0.0022 0.00331 3105 0.00021 0.00309 nucleotides de novo (0.00171-0.00324) (0.00255-0.00535) biosynthesis II PWY_5667_Lachnospiraceae_bacterium_7_1_58FAA CDP-diacylglycerol 0 0 1598.5 0.00023 0.00325 biosynthesis I (0-0.0000801) (0-0) PWY0_1319_Lachnospiraceae_bacterium_7_1_58FAA CDP-diacylglycerol 0 0 1598.5 0.00023 0.00325 biosynthesis II (0-0.0000801) (0-0) CENTFERM_PWY_unclassified pyruvate fermentation to 0 0.000128 3033 0.00026 0.00361 butanoate (0-0.000114) (0-0.000282) NONMEVIPP_PWY_Lachnospiraceae_bacterium_3_1_46FAA methylerythritol phosphate 0 0 1587 0.00026 0.00361 pathway I (0-0.000137) (0-0) PWY_6590_unclassified superpathway of Clostridium 0 0.000161 3034 0.00026 0.00361 acetobutylicum acidogenic (0-0.000145) (0-0.000354) fermentation PWY_7220_Clostridiales_bacterium_1_7_47FAA adenosine 0 0 1798 0.00027 0.00361 deoxyribonucleotides de novo (0-0) (0-0) biosynthesis II PWY_7222_Clostridiales_bacterium_1_7_47FAA guanosine 0 0 1798 0.00027 0.00361 deoxyribonucleotides de novo (0-0) (0-0) biosynthesis II PWY_7219_Clostridium_clostridioforme adenosine ribonucleotides de 0 0 1723 0.00029 0.0038 novo biosynthesis (0-0.00002) (0-0) UNINTEGRATED_Clostridium_clostridioforme UNINTEGRATED 0 0 1702.5 0.00034 0.00441 (0-0.238) (0-0) UNINTEGRATED_Prevotella_copri UNINTEGRATED 0 0 2854 0.00034 0.00441 (0-0) (0-0.318) PWY_7221_Ruminococcus_gnavus guanosine ribonucleotides de 0 0 1771 0.00034 0.00442 novo biosynthesis (0-0) (0-0) PWY_6386_Ruminococcus_gnavus UDP-N-acetylmuramoyl- 0 0 1772 0.00035 0.00447 pentapeptide biosynthesis II (0-0) (0-0) (lysine-containing) PWY_6387_Ruminococcus_gnavus UDP-N-acetylmuramoyl- 0 0 1773 0.00036 0.00447 pentapeptide biosynthesis I (0-0) (0-0) (meso-diaminopimelate containing) PWY_6737_Lachnospiraceae_bacterium_3_1_46FAA starch degradation V 0 0 1569.5 0.00036 0.00447 (0-0.000114) (0-0) PWY0_1296_Clostridium_clostridioforme purine ribonucleosides 0 0 1773 0.00036 0.00447 degradation (0-0) (0-0) PWY_7219_Prevotella_copri adenosine ribonucleotides de 0 0 2850 0.00037 0.00448 novo biosynthesis (0-0) (0-0.00058) PWY_5667_Ruminococcus_gnavus CDP-diacylglycerol 0 0 1744 0.00038 0.00453 biosynthesis I (0-0.0000191) (0-0) PWY_7111_Clostridium_bolteae pyruvate fermentation to 0 0 1660.5 0.00038 0.00453 isobutanol (engineered) (0-0.0000345) (0-0) PWY0_1319_Ruminococcus_gnavus CDP-diacylglycerol 0 0 1744 0.00038 0.00453 biosynthesis II (0-0.0000191) (0-0) NONOXIPENT_PWY_Clostridium_bolteae pentose phosphate pathway 0 0 1717 0.00039 0.00456 (non-oxidative branch) (0-0.0000225) (0-0) PWY_7229_unclassified superpathway of adenosine 0.00617 0.00829 3063 0.00043 0.00492 nucleotides de novo (0.00471-0.00799) (0.00609-0.0109) biosynthesis I UNINTEGRATED_Lachnospiraceae_bacterium_7_1_58FAA UNINTEGRATED 0.157 0 1502 0.00043 0.00492 (0-0.239) (0-0.155) PWY_6737_Lachnospiraceae_bacterium_2_1_58FAA starch degradation V 0 0 1827 0.00044 0.00498 (0-0) (0-0) PWY_6122_Clostridium_bolteae 5-aminoimidazole 0 0 1751 0.00046 0.00511 ribonucleotide biosynthesis II (0-0.0000142) (0-0) PWY_6277_Clostridium_bolteae superpathway of 5- 0 0 1751 0.00046 0.00511 aminoimidazole ribonucleotide (0-0.0000142) (0-0) biosynthesis PANTO_PWY_unclassified phosphopantothenate 0.00787 0.00981 3058 0.00047 0.00512 biosynthesis I (0.00518-0.0101) (0.00729-0.0139) THISYNARA_PWY_unclassified superpathway of thiamin 0.000524 0.000835 3053 0.0005 0.00551 diphosphate biosynthesis III (0.000233-0.000888) (0.000431-0.00134) (eukaryotes) PWY0_1296_Lachnospiraceae_bacterium_3_1_46FAA purine ribonucleosides 0 0 1601.5 0.00057 0.00615 degradation (0-0.000154) (0-0) PWY_6121_Ruminococcus_gnavus 5-aminoimidazole 0 0 1802.5 0.00061 0.00642 ribonucleotide biosynthesis I (0-0) (0-0) PWY_7221_Clostridium_clostridioforme guanosine ribonucleotides de 0 0 1802.5 0.00061 0.00642 novo biosynthesis (0-0) (0-0) PWY_2942_Ruminococcus_gnavus L-lysine biosynthesis III 0 0 1772 0.00061 0.00645 (0-0) (0-0) PWY_6897_Escherichia_coli thiamin salvage II 0 0 1598.5 0.00063 0.00655 (0-0.000205) (0-0) UNINTEGRATED_Clostridiales_bacterium_1_7_47FAA UNINTEGRATED 0 0 1773 0.00063 0.00655 (0-0) (0-0) NONMEVIPP_PWY_Lachnospiraceae_bacterium_7_1_58FAA methylerythritol phosphate 0 0 1682 0.0007 0.00689 pathway I (0-0.0000615) (0-0) PEPTIDOGLYCANSYN_PWY_Lachnospiraceae_bacterium_3_1_46FAA peptidoglycan biosynthesis I 0 0 1635 0.00069 0.00689 (meso-diaminopimelate (0-0.000136) (0-0) containing) PWY_6121_Clostridium_bolteae 5-aminoimidazole 0 0 1806.5 0.00068 0.00689 ribonucleotide biosynthesis I (0-0) (0-0) PWY_6163_Lachnospiraceae_bacterium_3_1_46FAA chorismate biosynthesis from 0 0 1636 0.0007 0.00689 3-dehydroquinate (0-0.000137) (0-0) PWY_6700_Prevotella_copri queuosine biosynthesis 0 0 2815 0.00069 0.00689 (0-0) (0-0.000255) PWY_7221_Prevotella_copri guanosine ribonucleotides de 0 0 2814 0.0007 0.00689 novo biosynthesis (0-0) (0-0.000402) PWY_5097_Prevotella_copri L-lysine biosynthesis VI 0 0 2813 0.00072 0.00692 (0-0) (0-0.000589) PWY_6121_Clostridium_clostridioforme 5-aminoimidazole 0 0 1856 0.00072 0.00692 ribonucleotide biosynthesis I (0-0) (0-0) ARO_PWY_unclassified chorismate biosynthesis I 0.0121 0.0144 3030 0.00073 0.00696 (0.00844-0.0155) (0.0125-0.018) PWY_2942_Prevotella_copri L-lysine biosynthesis III 0 0 2812 0.00074 0.00696 (0-0) (0-0.000514) ANAEROFRUCAT_PWY_unclassified homolactic fermentation 0.000931 0.00178 3026 0.00077 0.00703 (0.000346-0.00226) (0.00105-0.00325) PWY_6122_Ruminococcus_torques 5-aminoimidazole 0.0000587 0 1531.5 0.00078 0.00703 ribonucleotide biosynthesis II (0-0.000253) (0-0.0000671) PWY_6277_Ruminococcus_torques superpathway of 5- 0.0000587 0 1531.5 0.00078 0.00703 aminoimidazole ribonucleotide (0-0.000253) (0-0.0000671) biosynthesis PWY_7111_Clostridium_symbiosum pyruvate fermentation to 0 0 1715 0.00079 0.00703 isobutanol (engineered) (0-0.0000329) (0-0) PWY_7111_Lachnospiraceae_bacterium_1_4_56FAA pyruvate fermentation to 0 0 1754.5 0.00079 0.00703 isobutanol (engineered) (0-0.0000173) (0-0) VALSYN_PWY_Clostridium_symbiosum L-valine biosynthesis 0 0 1715 0.00079 0.00703 (0-0.0000329) (0-0) VALSYN_PWY_Lachnospiraceae_bacterium_1_4_56FAA L-valine biosynthesis 0 0 1754.5 0.00079 0.00703 (0-0.0000173) (0-0) PANTO_PWY_Lachnospiraceae_bacterium_2_1_58FAA phosphopantothenate 0 0 1783 0.00081 0.00721 biosynthesis I (0-0) (0-0) PANTO_PWY_Lachnospiraceae_bacterium_3_1_46FAA phosphopantothenate 0 0 1603 0.00086 0.00757 biosynthesis I (0-0.000224) (0-0) PWY_1042_Alistipes_senegalensis glycolysis IV (plant cytosol) 0 0 2807.5 0.00095 0.00776 (0-0) (0-0.0000773) PWY_1042_unclassified glycolysis IV (plant cytosol) 0.00674 0.00932 3015 0.00093 0.00776 (0.00521-0.0103) (0.00716-0.0114) PWY_5686_Ruminococcus_gnavus UMP biosynthesis 0 0 1829 0.00093 0.00776 (0-0) (0-0) PWY_6386_Lachnospiraceae_bacterium_3_1_46FAA UDP-N-acetylmuramoyl- 0 0 1641 0.00093 0.00776 pentapeptide biosynthesis II (0-0.000134) (0-0) (lysine-containing) PWY_6387_Lachnospiraceae_bacterium_3_1_46FAA UDP-N-acetylmuramoyl- 0 0 1642 0.00095 0.00776 pentapeptide biosynthesis I (0-0.000125) (0-0) (meso-diaminopimelate containing) PWY_6608_unclassified guanosine nucleotides 0.00112 0.0016 3015 0.00093 0.00776 degradation III (0.000637-0.00162) (0.00113-0.00218) PWY_6897_unclassified thiamin salvage II 0.000728 0.00191 3015 0.00091 0.00776 (0.000211-0.00193) (0.000663-0.00348) PWY_7219_Lachnospiraceae_bacterium_2_1_58FAA adenosine ribonucleotides de 0 0 1830 0.00095 0.00776 novo biosynthesis (0-0) (0-0) PWY0_1296_Clostridiales_bacterium_1_7_47FAA purine ribonucleosides 0 0 1830 0.00095 0.00776 degradation (0-0) (0-0) PYRIDNUCSYN_PWY_Alistipes_senegalensis NAD biosynthesis I (from 0 0 2822 0.00093 0.00776 aspartate) (0-0) (0-0.0000477) PEPTIDOGLYCANSYN_PWY_Ruminococcus_gnavus peptidoglycan biosynthesis I 0 0 1831 0.00098 0.00788 (meso-diaminopimelate (0-0) (0-0) containing) PWY_5097_Ruminococcus_gnavus L-lysine biosynthesis VI 0 0 1800 0.00098 0.00788 (0-0) (0-0) HISDEG_PWY_Clostridium_symbiosum L-histidine degradation I 0 0 1727 0.00102 0.00819 (0-0.0000378) (0-0) PWY_6737_Clostridium_nexile starch degradation V 0 0 1833 0.00103 0.00819 (0-0) (0-0) PWY_7111_Lachnospiraceae_bacterium_3_1_46FAA pyruvate fermentation to 0 0 1630 0.00106 0.00821 isobutanol (engineered) (0-0.000163) (0-0) UNINTEGRATED_Anaerotruncuscoli_hominis UNINTEGRATED 0 0 1735 0.00104 0.00821 (0-0.0845) (0-0) VALSYN_PWY_Lachnospiraceae_bacterium_3_1_46FAA L-valine biosynthesis 0 0 1630 0.00106 0.00821 (0-0.000163) (0-0) COMPLETE_ARO_PWY_unclassified superpathway of aromatic 0.0113 0.014 3006 0.00107 0.00826 amino acid biosynthesis (0.00793-0.0146) (0.0121-0.0171) PWY_6126_unclassified superpathway of adenosine 0.00376 0.0063 3005 0.00109 0.00833 nucleotides de novo (0.00249-0.00626) (0.00407-0.00855) biosynthesis II PWY_7221_Clostridium_symbiosum guanosine ribonucleotides de 0 0 1805 0.00111 0.00847 novo biosynthesis (0-0) (0-0) SULFATE_CYS_PWY_unclassified superpathway of sulfate 0 0.000348 2955 0.00112 0.00851 assimilation and cysteine (0-0.000316) (0-0.000681) biosynthesis COA_PWY_1_Ruminococcus_gnavus coenzyme A biosynthesis I 0 0 1885 0.00116 0.00869 (0-0) (0-0) PWY_7221_Lachnospiraceae_bacterium_2_1_58FAA guanosine ribonucleotides de 0 0 1885 0.00116 0.00869 novo biosynthesis (0-0) (0-0) UNINTEGRATED_Flavonifractor_plautii UNINTEGRATED 0 0 1708 0.0012 0.00892 (0-0.0595) (0-0) GLUCONEO_PWY_unclassified gluconeogenesis I 0 0 2878 0.00121 0.00894 (0-0) (0-0.000509) PEPTIDOGLYCANSYN_PWY_Dorea_formicigenerans peptidoglycan biosynthesis I 0.000118 0.0000523 1538.5 0.00127 0.00919 (meso-diaminopimelate (0.0000391-0.000188) (0-0.0000868) containing) PWY_5345_unclassified superpathway of L-methionine 0 0.000278 2907 0.00125 0.00919 biosynthesis (by (0-0.000269) (0-0.000587) sulfhydrylation) PWY_6151_Prevotella_copri S-adenosyl-L-methionine 0 0 2780 0.00127 0.00919 cycle I (0-0) (0-0.000419) COA_PWY_unclassified coenzyme A biosynthesis I 0.00195 0.00274 2993 0.00131 0.00939 (0.00102-0.00281) (0.00193-0.00357) PWY_5676_unclassified acetyl-CoA fermentation to 0 0.000349 2955 0.00132 0.00942 butanoate II (0-0.000384) (0-0.000738) PWY_6163_unclassified chorismate biosynthesis from 0.0125 0.0148 2992 0.00133 0.00942 3-dehydroquinate (0.00817-0.0161) (0.0126-0.0183) PWY_6121_Ruminococcus_torques 5-aminoimidazole 0.0000675 0 1569.5 0.00137 0.00968 ribonucleotide biosynthesis I (0-0.000275) (0-0.0000799) PWY_1042_Lachnospiraceae_bacterium_3_1_46FAA glycolysis IV (plant cytosol) 0 0 1692 0.00139 0.00972 (0-0.000148) (0-0) PWY_1269_Alistipes_senegalensis CMP-3-deoxy-D-manno- 0 0 2813.5 0.00143 0.00996 octulosonate biosynthesis I (0-0) (0-0.0000637) ARO_PWY_Lachnospiraceae_bacterium_3_1_46FAA chorismate biosynthesis I 0 0 1694 0.00144 0.00998 (0-0.000143) (0-0) PWY_6386_Dorea_formicigenerans UDP-N-acetylmuramoyl- 0.000127 0.0000649 1544.5 0.00147 0.0101 pentapeptide biosynthesis II (0.0000421-0.0002) (0-0.0001) (lysine-containing) PWY6163_Clostridium_symbiosum chorismate biosynthesis from 0 0 1858.5 0.00153 0.0105 3-dehydroquinate (0-0) (0-0) COA_PWY_1_Lachnospiraceae_bacterium_3_1_46FAA coenzyme A biosynthesis I 0 0 1729 0.00163 0.011 (0-0.000126) (0-0) PWY_4242_unclassified pantothenate and coenzyme A 0.00153 0.00235 2979 0.00162 0.011 biosynthesis III (0.000733-0.00238) (0.00155-0.003) PWY_5690_unclassified TCA cycle II (plants and 0.000228 0.000308 2976 0.00166 0.011 fungi) (0.0000986-0.000334) (0.000183-0.000568) PWY_7219_Lachnospiraceae_bacterium_1_4_56FAA adenosine ribonucleotides de 0 0 1861.5 0.00166 0.011 novo biosynthesis (0-0) (0-0) PWY0_1296_Eubacterium_eligens purine ribonucleosides 0.000272 0.00049 2976.5 0.00163 0.011 degradation (0-0.000601) (0.000165-0.00121) DTDPRHAMSYN_PWY_Coprococcus_catus dTDP-L-rhamnose 0 0.0000813 2941 0.0017 0.0112 biosynthesis I (0-0.0000999) (0-0.000126) PWY_7219_Alistipes_senegalensis adenosine ribonucleotides de 0 0 2841 0.00172 0.0113 novo biosynthesis (0-0) (0-0.0000724) PWY_6122_Flavonifractor_plautii 5-aminoimidazole 0 0 1745.5 0.00175 0.0114 ribonucleotide biosynthesis II (0-0.0000315) (0-0) superpathway of 5- PWY_6277_Flavonifractor_plautii aminoimidazole ribonucleotide 0 0 1745.5 0.00175 0.0114 biosynthesis (0-0.0000315) (0-0) PWY_6703_Barnesiella_intestinihominis preQ0 biosynthesis 0.0000794 0.000364 2960 0.00177 0.0114 thiamin formation from (0-0.000487) (0.000113-0.000656) PWY_7357_Escherichia_coli pyrithiamine and oxythiamine 0.0000172 0 1634.5 0.0018 0.0115 (yeast) (0-0.000274) (0-0.00002) pyrimidine PWY_7197_unclassified deoxyribonucleotide 0.00157 0.0021 2971 0.00182 0.0116 phosphorylation (0.00108-0.00214) (0.00148-0.00331) PWY_7221_Lachnospiraceae_bacterium_3_1_46FAA guanosine ribonucleotides de 0 0 1678 0.00185 0.0117 novo biosynthesis (0-0.000128) (0-0) NONOXIPENT_PWY_Ruminococcus_gnavus pentose phosphate pathway 0 0 1836 0.00189 0.0118 (non-oxidative branch) (0-0) (0-0) PWY_6122_Lachnospiraceae_bacterium_3_1_57FAA_CT1 5-aminoimidazole 0 0 1756 0.0019 0.0118 ribonucleotide biosynthesis II (0-0.0000249) (0-0) superpathway of 5- PWY_6277_Lachnospiraceae_bacterium_3_1_57FAA_CT1 aminoimidazole ribonucleotide 0 0 1756 0.0019 0.0118 biosynthesis (0-0.0000249) (0-0) PWY_6527_unclassified stachyose degradation 0.00523 0.00717 2969 0.00188 0.0118 (0.00393-0.0076) (0.00534-0.0099) COBALSYN_PWY_unclassified adenosylcobalamin salvage 0.0009 0.00144 2967 0.00193 0.0119 from cobinamide I (0.000478-0.00157) (0.000936-0.00204) PWY_7111_Clostridiales_bacterium_1_7_47FAA pyruvate fermentation to 0 0 1838 0.00199 0.0121 isobutanol (engineered) (0-0) (0-0) UNINTEGRATED_Clostridium_symbiosum UNINTEGRATED 0 0 1705 0.00197 0.0121 (0-0.174) (0-0) PWY_5667_Ruminococcus_torques CDP-diacylglycerol 0.000305 0.000163 1562 0.00207 0.0125 biosynthesis I (0.00014-0.000741) (0.0000809-0.000322) PWY0_1319_Ruminococcus_torques CDP-diacylglycerol 0.000305 0.000163 1562 0.00207 0.0125 biosynthesis II (0.00014-0.000741) (0.0000809-0.000322) PWY_6121_Lachnospiraceae_bacterium_3_1_46FAA 5-aminoimidazole 0 0 1709.5 0.00214 0.0128 ribonucleotide biosynthesis I (0-0.000138) (0-0) COMPLETE_ARO_PWY_Lachnospiraceae_bacterium_3_1_46FAA superpathway of aromatic 0 0 1721 0.00218 0.0129 amino acid biosynthesis (0-0.000136) (0-0) PWY_7228_unclassified superpathway of guanosine 0.00256 0.00372 2959 0.00218 0.0129 nucleotides de novo (0.00191-0.00381) (0.00261-0.00549) biosynthesis I PWY_7383_unclassified anaerobic energy metabolism 0.00124 0.00178 2959 0.00218 0.0129 (invertebrates, cytosol) (0.000886-0.00209) (0.00137-0.0024) BRANCHED_CHAIN_AA_SYN_PWY_unclassified superpathway of branched 0.0073 0.0096 2957 0.00224 0.0131 amino acid biosynthesis (0.00558-0.0099) (0.00716-0.0114) PWY_7111_Clostridium_hathewayi pyruvate fermentation to 0 0 1808 0.00224 0.0131 isobutanol (engineered) (0-0.000012) (0-0) SO4ASSIM_PWY_unclassified sulfate reduction I 0 0.000167 2911 0.00228 0.0133 (assimilatory) (0-0.000189) (0-0.000471) PWY_5667_Lachnospiraceae_bacterium_3_1_46FAA CDP-diacylglycerol 0 0 1691 0.00234 0.0134 biosynthesis I (0-0.000123) (0-0) PWY_6121_Flavonifractor_plautii 5-aminoimidazole 0 0 1787 0.00235 0.0134 ribonucleotide biosynthesis I (0-0.0000305) (0-0) PWY0_1319_Lachnospiraceae_bacterium_3_1_46FAA CDP-diacylglycerol 0 0 1691 0.00234 0.0134 biosynthesis II (0-0.000123) (0-0) UNINTEGRATED_Clostridium_asparagiforme UNINTEGRATED 0 0 1772.5 0.00232 0.0134 (0-0.0534) (0-0) PWY_6387_Dorea_formicigenerans UDP-N-acetylmuramoyl- 0.000117 0.0000518 1577.5 0.00242 0.0137 pentapeptide biosynthesis I (0.0000381-0.000188) (0-0.000099) (meso-diaminopimelate containing) HISTSYN_PWY_Bifidobacterium_longum L-histidine biosynthesis 0 0 1666.5 0.00245 0.0139 (0-0.000348) (0-0) PWY_5686_Prevotella_copri UMP biosynthesis 0 0 2741 0.00251 0.014 (0-0) (0-0.000261) PWY_6163_Clostridium_bolteae chorismate biosynthesis from 0 0 1888 0.00251 0.014 3-dehydroquinate (0-0) (0-0) PWY_7219_Clostridiales_bacterium_1_7_47FAA adenosine ribonucleotides de 0 0 1888 0.00251 0.014 novo biosynthesis (0-0) (0-0) PWY0_1296_Lachnospiraceae_bacterium_2_1_58FAA purine ribonucleosides 0 0 1889 0.00258 0.0143 degradation (0-0) (0-0) ANAGLYCOLYSIS_PWY_Alistipessenega_lensis glycolysis III (from glucose) 0 0 2699 0.00274 0.0144 (0-0) (0-0.0000535) P162_PWY_unclassified L-glutamate degradation V 0 0.000101 2878 0.00276 0.0144 (via hydroxyglutarate) (0-0.000097) (0-0.000248) PWY_5667_Clostridium_symbiosum CDP-diacylglycerol 0 0 1892 0.00279 0.0144 biosynthesis I (0-0) (0-0) PWY_6122_Lachnospiraceae_bacterium_3_1_46FAA 5-aminoimidazole 0 0 1685 0.00279 0.0144 ribonucleotide biosynthesis II (0-0.000152) (0-0) PWY_6151_Coprococcus_sp_ART55_1 S-adenosyl-L-methionine 0 0 2831 0.0028 0.0144 cycle I (0-0) (0-0.00132) PWY_6163_Clostridium_clostridioforme chorismate biosynthesis from 0 0 1892 0.00279 0.0144 3-dehydroquinate (0-0) (0-0) PWY_6277_Lachnospiraceae_bacterium_3_1_46FAA superpathway of 5- 0 0 1685 0.00279 0.0144 aminoimidazole ribonucleotide (0-0.000152) (0-0) biosynthesis PWY_6703_Ruminococcus_lactaris preQ0 biosynthesis 0 0.000313 2896 0.0027 0.0144 (0-0.000472) (0-0.00112) PWY_7111_Eubacterium_eligens pyruvate fermentation to 0.000291 0.0006 2944 0.00266 0.0144 isobutanol (engineered) (0.0000056-0.000699) (0.000222-0.00138) PWY_7220_unclassified adenosine 0.00178 0.00306 2943 0.00275 0.0144 deoxyribonucleotides de novo (0.00117-0.00316) (0.00187-0.00451) biosynthesis II PWY_7222_unclassified guanosine 0.00178 0.00306 2943 0.00275 0.0144 deoxyribonucleotides de novo (0.00117-0.00316) (0.00187-0.00451) biosynthesis II PWY0_1297_Ruminococcus_gnavus superpathway of purine 0 0 1890 0.00265 0.0144 deoxyribonucleosides (0-0) (0-0) degradation PWY0_1319_Clostridium_symbiosum CDP-diacylglycerol 0 0 1892 0.00279 0.0144 biosynthesis II (0-0) (0-0) UNINTEGRATED_Clostridium_hathewayi UNINTEGRATED 0 0 1755 0.00272 0.0144 (0-0.135) (0-0) VALSYN_PWY_Eubacterium_eligens L-valine biosynthesis 0.000291 0.0006 2944 0.00266 0.0144 (0.0000056-0.000699) (0.000222-0.00138) PWY_6163_Ruminococcus_gnavus chorismate biosynthesis from 0 0 1894 0.00294 0.0151 3-dehydroquinate (0-0) (0-0) PWY_7237_Clostridium_symbiosum myo-, chiro- and scillo-inositol 0 0 1805 0.00294 0.0151 degradation (0-0.0000168) (0-0) PWY_7221_Eubacterium_eligens guanosine ribonucleotides de 0.000313 0.00064 2934 0.003 0.0153 novo biosynthesis (0-0.000718) (0.000165-0.00139) PWY_7111_Ruminococcus_gnavus pyruvate fermentation to 0 0 1807 0.00307 0.0155 isobutanol (engineered) (0-0.000012) (0-0) PWY_7219_Eubacterium_eligens adenosine ribonucleotides de 0.000359 0.000821 2933.5 0.00307 0.0155 novo biosynthesis (0-0.000874) (0.000196-0.00177) UNINTEGRATED_Alistipes_senegalensis UNINTEGRATED 0 0 2823 0.00321 0.0161 (0-0) (0-0.0557) PWY_7456_Coprococcus_sp_ART55_1 mannan degradation 0 0 2822 0.00327 0.0163 (0-0) (0-0.0017) PWY_5667_Clostridium_bolteae CDP-diacylglycerol 0 0 1842 0.00333 0.0165 biosynthesis I (0-0) (0-0) PWY_6609_Alistipes_senegalensis adenine and adenosine salvage 0 0 2720 0.00335 0.0165 III (0-0) (0-0.0000493) PWY01319_Clostridium_bolteae CDP-diacylglycerol 0 0 1842 0.00333 0.0165 biosynthesis II (0-0) (0-0) DTDPRHAMSYN_PWY_Eggerthella_lenta dTDP-L-rhamnose 0 0 1901 0.00354 0.0168 biosynthesis I (0-0) (0-0) GALACTUROCAT_PWY_unclassified D-galacturonate degradation I 0.000718 0.000953 2926 0.00351 0.0168 (0.000477-0.000989) (0.000665-0.00121) PANTO_PWY_Coprococcus_sp_ART55_1 phosphopantothenate 0 0 2818 0.00349 0.0168 biosynthesis I (0-0) (0-0.00103) PWY_5659_Coprococcus_sp_ART55_1 GDP-mannose biosynthesis 0 0 2820.5 0.00357 0.0168 (0-0) (0-0.00163) PWY_6151_Barnesiella_intestinihominis S-adenosyl-L-methionine 0.000125 0.000331 2915 0.00349 0.0168 cycle I (0-0.000411) (0.000128-0.0006) PWY_6151_Eubacterium_eligens S-adenosyl-L-methionine 0.000375 0.000622 2921 0.00356 0.0168 cycle I (0-0.000799) (0.000203-0.00149) PWY_6305_unclassified putrescine biosynthesis IV 0.00134 0.00181 2927 0.00346 0.0168 (0.000913-0.00206) (0.00136-0.00253) PWY_7219_Coprococcus_sp_ART55_1 adenosine ribonucleotides de 0 0 2821.5 0.00352 0.0168 novo biosynthesis (0-0) (0-0.00158) PWY_7219_Flavonifractor_plautii adenosine ribonucleotides de 0 0 1791.5 0.00342 0.0168 novo biosynthesis (0-0.0000552) (0-0) PWY_7221_Ruminococcus_torques guanosine ribonucleotides de 0.0000312 0 1648 0.00344 0.0168 novo biosynthesis (0-0.000251) (0-0.0000344) TRPSYN_PWY_Coprococcus_sp_ART55_1 L-tryptophan biosynthesis 0 0 2822.5 0.00346 0.0168 (0-0) (0-0.00129) HSERMETANA_PWY_unclassified L-methionine biosynthesis III 0.000828 0.00133 2923 0.00366 0.017 (0.000622-0.00151) (0.000792-0.00222) NONMEVIPP_PWY_Lachnospiraceae_bacterium_1_1_57FAA methylerythritol phosphate 0 0 1837.5 0.00361 0.017 pathway I (0-0) (0-0) PWY_5484_unclassified glycolysis II (from fructose 6- 0.000523 0.00113 2923 0.00363 0.017 phosphate) (0.000135-0.00178) (0.000569-0.00222) PWY_621_Coprococcus_sp_ART55_1 sucrose degradation III 0 0 2818.5 0.0037 0.0171 (sucrose invertase) (0-0) (0-0.00264) UNINTEGRATED_Coprococcus_sp_ART55_1 UNINTEGRATED 0 0 2816.5 0.00382 0.0176 (0-0) (0-0.923) PWY_2942_Coprococcus_sp_ART55_1 L-lysine biosynthesis III 0 0 2814.5 0.00395 0.0182 (0-0) (0-0.00118) GLYCOGENSYNTH_PWY_Coprococcus_sp_ART55_1 glycogen biosynthesis I (from 0 0 2813.5 0.00402 0.0183 ADP-D-Glucose) (0-0) (0-0.00155) THRESYN_PWY_Coprococcus_sp_ART55_1 superpathway of L-threonine 0 0 2813.5 0.00402 0.0183 biosynthesis (0-0) (0-0.00116) COA_PWY_1_Clostridiales_bacterium_1_7_47FAA coenzyme A biosynthesis I 0 0 1917.5 0.0041 0.0184 (0-0) (0-0) COA_PWY_Clostridiales_bacterium_1_7_47FAA coenzyme A biosynthesis I 0 0 1918.5 0.00421 0.0184 (0-0) (0-0) GALACT_GLUCUROCAT_PWY_unclassified superpathway of hexuronide 0.000628 0.000997 2912.5 0.00423 0.0184 and hexuronate degradation (0.000439-0.00109) (0.000653-0.00132) PWY_3001_Coprococcus_sp_ART55_1 superpathway of L-isoleucine 0 0 2811.5 0.00415 0.0184 biosynthesis I (0-0) (0-0.00107) PWY_5667_Clostridium_clostridioforme CDP-diacylglycerol 0 0 1918.5 0.00421 0.0184 biosynthesis I (0-0) (0-0) PWY_6123_Coprococcus_sp_ART55_1 inosine-5′-phosphate 0 0 2811.5 0.00415 0.0184 biosynthesis I (0-0) (0-0.0012) PWY_7111_Coprococcus_sp_ART55_1 pyruvate fermentation to 0 0 2810.5 0.00422 0.0184 isobutanol (engineered) (0-0) (0-0.00099) PWY_7111_Lachnospiraceae_bacterium_1_1_57FAA pyruvate fermentation to 0 0 1789 0.00417 0.0184 isobutanol (engineered) (0-0.0000348) (0-0) PWY_7208_Coprococcus_sp_ART55_1 superpathway of pyrimidine 0 0 2811.5 0.00415 0.0184 nucleobases salvage (0-0) (0-0.00111) PWY01319_Clostridium_clostridioforme CDP-diacylglycerol 0 0 1918.5 0.00421 0.0184 biosynthesis II (0-0) (0-0) UDPNAGSYN_PWY_Coprococcus_sp_ART55_1 UDP-N-acetyl-D-glucosamine 0 0 2810.5 0.00422 0.0184 biosynthesis I (0-0) (0-0.00137) VALSYN_PWY_Lachnospiraceae_bacterium_1_1_57FAA L-valine biosynthesis 0 0 1789 0.00417 0.0184 (0-0.0000348) (0-0) PWY_5097_Coprococcus_sp_ART55_1 L-lysine biosynthesis VI 0 0 2809.5 0.00429 0.0185 (0-0) (0-0.0012) PWY_6700_Coprococcus_sp_ART55_1 queuosine biosynthesis 0 0 2809.5 0.00429 0.0185 (0-0) (0-0.00117) PWY_6527_Coprococcus_sp_ART55_1 stachyose degradation 0 0 2808.5 0.00436 0.0186 (0-0) (0-0.00172) PWY_6737_Clostridium_hathewayi starch degradation V 0 0 1880 0.00437 0.0186 (0-0) (0-0) PWY0_1296_Clostridium_asparagiforme purine ribonucleosides 0 0 1919.5 0.00432 0.0186 degradation (0-0) (0-0) PWY_5104_Coprococcus_sp_ART55_1 L-isoleucine biosynthesis IV 0 0 2807.5 0.00443 0.0187 (0-0) (0-0.0012) PWY_6122_Lachnospiraceae_bacterium_2_1_58FAA 5-aminoimidazole 0 0 1920.5 0.00444 0.0187 ribonucleotide biosynthesis II (0-0) (0-0) PWY_6277_Lachnospiraceae_bacterium_2_1_58FAA superpathway of 5- 0 0 1920.5 0.00444 0.0187 aminoimidazole ribonucleotide (0-0) (0-0) biosynthesis BRANCHED_CHAIN_AA_SYN_PWY_Coprococcus_sp_ART55_1 superpathway of branched 0 0 2806.5 0.00451 0.0189 amino acid biosynthesis (0-0) (0-0.00108) PWY_5103_Coprococcus_sp_ART55_1 L-isoleucine biosynthesis III 0 0 2806.5 0.00451 0.0189 (0-0) (0-0.000978) ILEUSYN_PWY_Coprococcus_sp_ART55_1 L-isoleucine biosynthesis I 0 0 2804.5 0.00466 0.0193 (from threonine) (0-0) (0-0.00114) PYRIDNUCSYN_PWY_Coprococcus_sp_ART55_1 NAD biosynthesis I (from 0 0 2804.5 0.00466 0.0193 aspartate) (0-0) (0-0.00108) VALSYN_PWY_Coprococcus_sp_ART55_1 L-valine biosynthesis 0 0 2804.5 0.00466 0.0193 (0-0) (0-0.00114) PWY_6124_Coprococcus_sp_ART55_1 inosine-5′-phosphate 0 0 2803.5 0.00473 0.0195 biosynthesis II (0-0) (0-0.00113) PWY0_1297_Clostridiales_bacterium_1_7_47FAA superpathway of purine 0 0 1923.5 0.0048 0.0197 deoxyribonucleosides (0-0) (0-0) degradation NONOXIPENT_PWY_Eubacterium_eligens pentose phosphate pathway 0.000394 0.000617 2899 0.00486 0.0199 (non-oxidative branch) (0-0.000819) (0.000177-0.00142) GLYCOGENSYNTH_PWY_Eubacterium_biforme glycogen biosynthesis I (from 0 0.000125 2840 0.00497 0.0202 ADP-D-Glucose) (0-0.000268) (0-0.000507) PWY_6737_Clostridium_symbiosum starch degradation V 0 0 1845 0.00501 0.0202 (0-0) (0-0) UNINTEGRATED_Eubacterium_eligens UNINTEGRATED 0.192 0.324 2900 0.00496 0.0202 (0.0259-0.367) (0.12-0.706) VALSYN_PWY_Clostridium_bolteae L-valine biosynthesis 0 0 1823.5 0.00498 0.0202 (0-0.0000142) (0-0) PWY_7111_unclassified pyruvate fermentation to 0.0115 0.0136 2899 0.0051 0.0205 isobutanol (engineered) (0.00851-0.0145) (0.0108-0.0164) PWY_5667_Ruminococcus_obeum CDP-diacylglycerol 0.0000317 0.0000943 2881 0.00517 0.0206 biosynthesis I (0-0.000122) (0.0000231-0.00024) PWY_7219_Barnesiella_intestinihominis adenosine ribonucleotides de 0.000173 0.000512 2894 0.00513 0.0206 novo biosynthesis (0-0.000674) (0.000192-0.000716) PWY0_1319_Ruminococcus_obeum CDP-diacylglycerol 0.0000317 0.0000943 2881 0.00517 0.0206 biosynthesis II (0-0.000122) (0.0000231-0.00024) ILEUSYN_PWY_unclassified L-isoleucine biosynthesis I 0.0117 0.0138 2897 0.00524 0.0207 (from threonine) (0.00851-0.0145) (0.0115-0.0164) VALSYN_PWY_unclassified L-valine biosynthesis 0.0117 0.0138 2897 0.00524 0.0207 (0.00851-0.0145) (0.0115-0.0164) PWY_1042_Ruminococcus_obeum glycolysis IV (plant cytosol) 0 0 2796.5 0.0053 0.0209 (0-0) (0-0.000149) PWY_7221_Lachnospiraceae_bacterium_1_4_56FAA guanosine ribonucleotides de 0 0 1927.5 0.00532 0.0209 novo biosynthesis (0-0) (0-0) PWY0_1298_unclassified superpathway of pyrimidine 0.000285 0.000382 2895.5 0.00535 0.0209 deoxyribonucleosides (0.000138-0.00042) (0.000236-0.000607) degradation PWY_4984_Flavonifractor_plautii urea cycle 0 0 1823 0.00561 0.0219 (0-0.0000361) (0-0) X1CMET2_PWY_Bacteroides_massiliensis N10-formyl-tetrahydrofolate 0 0 2741 0.00562 0.0219 biosynthesis (0-0) (0-0.00036) PWY_7111_Barnesiella_intestinihominis pyruvate fermentation to 0.000125 0.00033 2886 0.00584 0.0225 isobutanol (engineered) (0-0.000436) (0.000123-0.000561) VALSYN_PWY_Barnesiella_intestinihominis L-valine biosynthesis 0.000125 0.00033 2886 0.00584 0.0225 (0-0.000436) (0.000123-0.000561) PWY_5103_unclassified L-isoleucine biosynthesis III 0.00655 0.00852 2888 0.00592 0.0228 (0.00495-0.00942) (0.00635-0.0104) PWY_6471_unclassified peptidoglycan biosynthesis IV 0 0 1903 0.00604 0.0231 (Enterococcus faecium) (0-0) (0-0) PWY0_1296_Eubacterium_biforme purine ribonucleosides 0 0.000114 2824.5 0.00604 0.0231 degradation (0-0.000317) (0-0.000641) SALVADEHYPOX_PWY_unclassified adenosine nucleotides 0.00109 0.00141 2886 0.00608 0.0232 degradation II (0.000787-0.00145) (0.00112-0.00192) PWY_6737_Dorea_formicigenerans starch degradation V 0.000204 0.000116 1640 0.00619 0.0235 (0.0000983-0.000285) (0.0000639-0.000195) PWY_6121_Lachnospiraceae_bacterium_1_1_57FAA 5-aminoimidazole 0 0 1829 0.00629 0.0238 ribonucleotide biosynthesis I (0-0.0000328) (0-0) PWY7111_Flavonifractor_plautii pyruvate fermentation to 0 0 1817 0.00632 0.0238 isobutanol (engineered) (0-0.0000355) (0-0) VALSYN_PWY_Flavonifractor_plautii L-valine biosynthesis 0 0 1817 0.00632 0.0238 (0-0.0000355) (0-0) PWY_7357_Ruminococcus_obeum thiamin formation from 0.0000515 0.000128 2869.5 0.00645 0.0242 pyrithiamine and oxythiamine (0-0.000208) (0.0000665-0.000336) (yeast) PANTO_PWY_Ruminococcus_torques phosphopantothenate 0.000375 0.000285 1644 0.00658 0.0245 biosynthesis I (0.000178-0.0007) (0.000106-0.000385) PWY_1042_Barnesiella_intestinihominis glycolysis IV (plant cytosol) 0.000203 0.000417 2875 0.00656 0.0245 (0-0.000564) (0.000167-0.000662) ARO_PWY_Clostridium_bolteae chorismate biosynthesis I 0 0 1947 0.00667 0.0246 (0-0) (0-0) COMPLETE_ARO_PWY_Clostridium_bolteae superpathway of aromatic 0 0 1947 0.00667 0.0246 amino acid biosynthesis (0-0) (0-0) PWY_6121_Eubacterium_biforme 5-aminoimidazole 0 0.000154 2820 0.0067 0.0246 ribonucleotide biosynthesis I (0-0.000322) (0-0.000682) PWY_7219_Anaerotruncus_colihominis adenosine ribonucleotides de 0 0 1907 0.00663 0.0246 novo biosynthesis (0-0) (0-0) PWY_5686_Barnesiella_intestinihominis UMP biosynthesis 0.000113 0.000344 2871 0.00674 0.0247 (0-0.000461) (0.00011-0.000565) PWY_6527_Faecalibacterium_prausnitzii stachyose degradation 0 0 2765 0.0069 0.0252 (0-0) (0-0.000995) PWY_1042_Lachnospiraceae_bacterium_1_1_57FAA glycolysis IV (plant cytosol) 0 0 1910 0.0071 0.0258 (0-0) (0-0) PWY_7111_Clostridium_clostridioforme pyruvate fermentation to 0 0 1920 0.00724 0.0261 isobutanol (engineered) (0-0) (0-0) PWY66_422_Eubacterium_biforme D-galactose degradation V 0 0.000163 2815 0.00721 0.0261 (Leloir pathway) (0-0.000342) (0-0.000623) VALSYN_PWY_Clostridium_clostridioforme L-valine biosynthesis 0 0 1920 0.00724 0.0261 UDP-N-acetylmuramoyl- (0-0) (0-0) PWY_6386_Lachnospiraceae_bacterium_1_1_57FAA pentapeptide biosynthesis II 0 0 1864 0.00739 0.0264 (lysine-containing) (0-0) (0-0)0.0000949 PWY0_1296_Coprococcus_catus purine ribonucleosides 0.0000464 2866 0.0074 0.0264 degradation (0-0.000124) (0.0000532-0.000137) PWY66_422_unclassified D-galactose degradation V 0.00592 0.0069 2871 0.00742 0.0264 (Leloir pathway) (0.00417-0.00827) (0.0057-0.00939) UNINTEGRATED_Barnesiella_intestinihominis UNINTEGRATED 0.162 0.368 2868.5 0.0074 0.0264 (0-0.485) (0.163-0.537) PWY_241_unclassified C4 photosynthetic carbon 0 0 2742.5 0.00759 0.0266 assimilation cycle, NADP-ME (0-0) (0-0.000143) type PWY_6317_unclassified galactose degradation I (Leloir 0.00592 0.0069 2870 0.00752 0.0266 pathway) (0.00417-0.00827) (0.0057-0.00939) PWY_6387_Lachnospiraceae_bacterium_1_1_57FAA UDP-N-acetylmuramoyl- 0 0 1865 0.00754 0.0266 pentapeptide biosynthesis I (0-0) (0-0) (meso-diaminopimelate containing) PWY_7111_Lachnospiraceae_bacterium_2_1_58FAA pyruvate fermentation to 0 0 1952 0.00759 0.0266 isobutanol (engineered) (0-0) (0-0) VALSYN_PWY_Clostridium_hathewayi L-valine biosynthesis 0 0 1887.5 0.00755 0.0266 (0-0) (0-0) PWY_4981_unclassified L-proline biosynthesis II (from 0.00162 0.00283 2867 0.00782 0.0273 arginine) (0.000595-0.00345) (0.00117-0.0045) PWY_7111_Ruminococcus_lactaris pyruvate fermentation to 0 0.000125 2826.5 0.00798 0.0278 isobutanol (engineered) (0-0.000202) (0-0.000338) PEPTIDOGLYCANSYN_PWY_Lachnospiraceae_bacterium_1_1_57FAA peptidoglycan biosynthesis I 0 0 1891.5 0.00822 0.0284 (meso-diaminopimelate (0-0) (0-0) containing) PWY_6122_Eubacterium_biforme 5-aminoimidazole 0 0.000167 2805 0.00833 0.0284 ribonucleotide biosynthesis II (0-0.000389) (0-0.000642) PWY_6277_Eubacterium_biforme superpathway of 5- 0 0.000167 2805 0.00833 0.0284 aminoimidazole ribonucleotide (0-0.000389) (0-0.000642) biosynthesis PWY_6608_Odoribacter_splanchnicus guanosine nucleotides 0.0000571 0.000171 2845 0.00823 0.0284 degradation III (0-0.000193) (0-0.000303) PWY_6609_Lachnospiraceae_bacterium_2_1_58FAA adenine and adenosine salvage 0 0 1926 0.00833 0.0284 III (0-0) (0-0) PWY_7219_Bacteroides_massiliensis adenosine ribonucleotides de 0 0 2742 0.00821 0.0284 novo biosynthesis (0-0) (0-0.00056) PWY_7221_Barnesiella_intestinihominis guanosine ribonucleotides de 0.0000759 0.000342 2856 0.00834 0.0284 novo biosynthesis (0-0.000478) (0.000114-0.000576) PWY_7221_Flavonifractor_plautii guanosine ribonucleotides de 0 0 1851.5 0.00856 0.0291 novo biosynthesis (0-0.0000288) (0-0) NONOXIPENT_PWY_Ruminococcus_lactaris pentose phosphate pathway 0 0 2742 0.00878 0.0292 (non-oxidative branch) (0-0) (0-0.000296) PWY_3841_Bacteroides_massiliensis folate transformations II 0 0 2730 0.00867 0.0292 (0-0) (0-0.000393) PWY_5667_Barnesiella_intestinihominis CDP-diacylglycerol 0.00013 0.000316 2852 0.00878 0.0292 biosynthesis I (0-0.000513) (0.000143-0.000605) PWY_6609_Eubacterium_biforme adenine and adenosine salvage 0 0.000121 2799.5 0.00871 0.0292 III (0-0.000335) (0-0.00067) PWY_7219_Clostridium_hathewayi adenosine ribonucleotides de 0 0 1872 0.00867 0.0292 novo biosynthesis (0-0) (0-0) thiamin formation from PWY_7357_Eubacterium_biforme pyrithiamine and oxythiamine 0 0 2706 0.00867 0.0292 (yeast) (0-0) (0-0.000193) PWY0_1319_Barnesiella_intestinihominis CDP-diacylglycerol 0.00013 0.000316 2852 0.00878 0.0292 biosynthesis II (0-0.000513) (0.000143-0.000605) superpathway of thiamin THISYNARA_PWY_Ruminococcus_obeum diphosphate biosynthesis III 0 0.000078 2833 0.00881 0.0292 (eukaryotes) (0-0.0000872) (0-0.000176) PWY_7219_Lachnospiraceae_bacterium_1_1_57FAA adenosine ribonucleotides de 0 0 1814 0.00884 0.0293 novo biosynthesis (0-0.0000818) (0-0) PANTO_PWY_Eggerthella_lenta phosphopantothenate 0 0 1881 0.00902 0.0297 biosynthesis I (0-0) (0-0) PWY_5121_unclassified superpathway of 0 0 2657 0.00899 0.0297 geranylgeranyl diphosphate (0-0) (0-0.000128) biosynthesis II (via MEP) PWY_7219_Ruminococcus_torques adenosine ribonucleotides de 0.000353 0.000225 1669 0.00912 0.0299 novo biosynthesis (0.000193-0.000936) (0.000127-0.000465) PWY_7219_Paraprevotella_clara adenosine ribonucleotides de 0 0 2758 0.00918 0.03 novo biosynthesis (0-0.0000432) (0-0.000387) VALSYN_PWY_Dorea_formicigenerans L-valine biosynthesis 0.000131 0.0000863 1671 0.00929 0.0303 (0.0000661-0.0002) (0.0000473-0.000133) PWY_6122_Lachnospiraceae_bacterium_1_1_57FAA 5-aminoimidazole 0 0 1828 0.00943 0.0306 ribonucleotide biosynthesis II (0-0.0000438) (0-0) PWY_6277_Lachnospiraceae_bacterium_1_1_57FAA superpathway of 5- 0 0 1828 0.00943 0.0306 aminoimidazole ribonucleotide (0-0.0000438) (0-0) biosynthesis PWY_5097_Barnesiella_intestinihominis L-lysine biosynthesis VI 0.000202 0.000436 2846 0.00961 0.0311 (0-0.000581) (0.000171-0.000668) PWY_2723_Escherichia_coli trehalose degradation V 0 0 1781.5 0.00986 0.0317 (0-0.0000739) (0-0) PYRIDNUCSYN_PWY_unclassified NAD biosynthesis I (from 0.00198 0.00236 2849 0.00986 0.0317 aspartate) (0.00123-0.00265) (0.0017-0.00321) PWY_7219_Eubacterium_biforme adenosine ribonucleotides de 0 0.000158 2792 0.01 0.0321 novo biosynthesis (0-0.000456) (0-0.000928) PWY_6151_Eubacterium_biforme S-adenosyl-L-methionine 0 0.000196 2790 0.0103 0.0329 cycle I (0-0.000483) (0-0.0007) UNINTEGRATED_Eubacterium_biforme UNINTEGRATED 0 0.11 2790 0.0103 0.0329 (0-0.192) (0-0.235) PWY_7357_unclassified thiamin formation from 0.00307 0.00454 2845 0.0104 0.033 pyrithiamine and oxythiamine (0.00178-0.00543) (0.00291-0.00637) (yeast) PWY_5188_Coprococcus_catus tetrapyrrole biosynthesis I 0 0.000028 2794.5 0.0106 0.0336 (from glutamate) (0-0.0000326) (0-0.0000766) PWY_5686_Ruminococcus_obeum UMP biosynthesis 0.0000767 0.000124 2838 0.0108 0.034 (0-0.000177) (0.0000616-0.000249) PWY_7111_Clostridium_asparagiforme pyruvate fermentation to 0 0 1890 0.0108 0.034 isobutanol (engineered) (0-0) (0-0) DTDPRHAMSYN_PWY_Eubacterium_biforme dTDP-L-rhamnose 0 0.0000106 2759 0.011 0.0346 biosynthesis I (0-0.0000352) (0-0.000117) PWY_1042_Eggerthella_lenta glycolysis IV (plant cytosol) 0 0 1939 0.0112 0.0351 (0-0) (0-0) PWY_6700_Paraprevotella_clara queuosine biosynthesis 0 0 2726.5 0.0112 0.0351 (0-0) (0-0.000342) UNINTEGRATED_Clostridium_citroniae UNINTEGRATED 0 0 1795 0.0115 0.0358 (0-0.0845) (0-0) ARO_PWY_Dorea_formicigenerans chorismate biosynthesis I 0.0001 0.0000586 1701 0.0115 0.0359 (0-0.000171) (0-0.0000962) PWY_6122_Eubacterium_eligens 5-aminoimidazole 0.000314 0.000572 2833 0.0117 0.0362 ribonucleotide biosynthesis II (0-0.000728) (0.00017-0.0012) PWY_6277_Eubacterium_eligens superpathway of 5- 0.000314 0.000572 2833 0.0117 0.0362 aminoimidazole ribonucleotide (0-0.000728) (0.00017-0.0012) biosynthesis PWY_6737_Roseburia_inulinivorans starch degradation V 0.000516 0.000276 1690 0.0117 0.0362 (0.0000853-0.00175) (0.0000219-0.000721) PANTO_PWY_Bacteroides_xylanisolvens phosphopantothenate 0 0.0000913 2797.5 0.0118 0.0365 biosynthesis I (0-0.00015) (0-0.000371) PWY_2942_Eggerthella_lenta L-lysine biosynthesis III 0 0 1917 0.0119 0.0365 (0-0) (0-0) PWY_6151_Bacteroides_massiliensis S-adenosyl-L-methionine 0 0 2714.5 0.0119 0.0365 cycle I (0-0) (0-0.0004) COA_PWY_1_Ruminococcus_torques coenzyme A biosynthesis I 0.000285 0.000164 1693 0.0121 0.0366 (0.000109-0.000644) (0.0000489-0.000362) PWY_5686_Eubacterium_biforme UMP biosynthesis 0 0.000118 2779 0.012 0.0366 (0-0.000297) (0-0.000531) PWY_6386_Ruminococcus_torques UDP-N-acetylmuramoyl- 0.000366 0.00023 1691 0.012 0.0366 pentapeptide biosynthesis II (0.000152-0.000861) (0.0000872-0.000405) (lysine-containing) GLYCOLYSIS_unclassified glycolysis I (from glucose 6- 0.000572 0.00128 2832 0.0122 0.0368 phosphate) (0.000142-0.00214) (0.000583-0.00265) ARO_PWY_Lachnospiraceae_bacterium_1_1_57FAA chorismate biosynthesis I 0 0 1920 0.0127 0.0379 (0-0) (0-0) NONMEVIPP_PWY_Paraprevotella_clara methylerythritol phosphate 0 0 2718.5 0.0127 0.0379 pathway I (0-0) (0-0.000313) PWY_2942_Flavonifractor_plautii L-lysine biosynthesis III 0 0 1898 0.0126 0.0379 (0-0) (0-0) PWY_6163_Lachnospiraceae_bacterium_1_1_57FAA chorismate biosynthesis from 0 0 1898 0.0126 0.0379 3-dehydroquinate (0-0) (0-0) PWY_7219_Eggerthella_lenta adenosine ribonucleotides de 0 0 1898 0.0126 0.0379 novo biosynthesis (0-0) (0-0) PWY_6121_Eubacterium_eligens 5-aminoimidazole 0.000339 0.000526 2825.5 0.0128 0.0382 ribonucleotide biosynthesis I (0-0.00074) (0.000181-0.00124) TCA_unclassified TCA cycle I (prokaryotic) 0.0000488 0.000173 2802 0.0128 0.0382 (0-0.000226) (0-0.000483) PWY_5695_Lachnospiraceae_bacterium_3_1_57FAA_CT1 urate biosynthesis/inosine 5′- 0 0 1946 0.0131 0.0385 phosphate degradation (0-0) (0-0) PWY_6387_Barnesiella_intestinihominis UDP-N-acetylmuramoyl- 0.000121 0.000347 2818 0.0131 0.0385 pentapeptide biosynthesis I (0-0.000453) (0.000104-0.000553) (meso-diaminopimelate containing) PWY_6936_Eubacterium_biforme seleno-amino acid biosynthesis 0 0.0000634 2761 0.0131 0.0385 (0-0.00025) (0-0.000465) UNINTEGRATED_Roseburia_hominis UNINTEGRATED 0.23 0.303 2825.5 0.013 0.0385 (0.155-0.33) (0.227-0.417) PWY_2942_Bacteroides_massiliensis L-lysine biosynthesis III 0 0 2707.5 0.0133 0.0391 (0-0) (0-0.000345) ARGININE_SYN4_PWY_unclassified L-ornithine de novo 0 0.0000637 2772.5 0.0135 0.0395 biosynthesis (0-0.000111) (0-0.000168) PWY_5100_Eubacterium_biforme pyruvate fermentation to 0 0.000138 2768 0.0135 0.0395 acetate and lactate II (0-0.000376) (0-0.000697) PWY_6527_Lachnospiraceae_bacterium_3_1_57FAA_CT1 stachyose degradation 0 0 1902 0.0136 0.0396 superpathway of &beta;-D- (0-0) (0-0) GLUCUROCAT_PWY_unclassified glucuronide and D-glucuronate 0.000751 0.00107 2822.5 0.0137 0.0397 degradation (0.000425-0.0012) (0.000643-0.00137) PWY_6609_Coprococcus_catus adenine and adenosine salvage 0.0000683 0.000126 2816.5 0.0137 0.0397 III (0-0.000172) (0.0000688-0.000197) PWY_6737_Clostridium_asparagiforme starch degradation V 0 0 1931.5 0.0137 0.0397 (0-0) (0-0) UNINTEGRATED_Bacteroides_massiliensis UNINTEGRATED 0 0 2712 0.014 0.0404 peptidoglycan biosynthesis I (0-0) (0-0.428) PEPTIDOGLYCANSYN_PWY_Barnesiella_intestinihominis (meso-diaminopimelate 0.000123 0.000352 2811 0.0143 0.0405 containing) (0-0.000469) (0.0000938-0.000593) PWY_5667_Ruminococcus_lactaris CDP-diacylglycerol 0 0.0000533 2768.5 0.0143 0.0405 biosynthesis I (0-0.000104) (0-0.00028) UDP-N-acetylmuramoyl- PWY_6386_Barnesiella_intestinihominis pentapeptide biosynthesis II 0.000133 0.000362 2811 0.0143 0.0405 (lysine-containing) (0-0.000464) (0.000117-0.000573) PWY_6700_Barnesiella_intestinihominis queuosine biosynthesis 0.000178 0.000401 2813.5 0.0142 0.0405 (0-0.000563) (0.000155-0.00058) PWY_7282_Bacteroides_fragilis 4-amino-2-methyl-5- 0 0 1852 0.0142 0.0405 phosphomethylpyrimidine (0-0.000108) (0-0) biosynthesis (yeast) PWY0_1319_Ruminococcus_lactaris CDP-diacylglycerol 0 0.0000533 2768.5 0.0143 0.0405 biosynthesis II (0-0.000104) (0-0.00028) PWY66_399_unclassified gluconeogenesis III 0.000175 0.000336 2803 0.0142 0.0405 (0-0.00044) (0-0.000942) PANTO_PWY_Paraprevotella_clara phosphopantothenate 0 0 2728 0.0144 0.0406 biosynthesis I (0-0.0000509) (0-0.000372) PANTO_PWY_Lachnospiraceae_bacterium_1_1_57FAA phosphopantothenate 0 0 1830 0.0144 0.0407 biosynthesis I (0-0.0000863) (0-0) PWY_5667_Clostridium_nexile CDP-diacylglycerol 0 0 1960 0.0147 0.0412 biosynthesis I (0-0) (0-0) PWY0_1319_Clostridium_nexile CDP-diacylglycerol 0 0 1960 0.0147 0.0412 biosynthesis II (0-0) (0-0) PWY_2942_Barnesiella_intestinihominis L-lysine biosynthesis III 0.00013 0.000425 2809 0.0149 0.0414 (0-0.000585) (0.000138-0.000612) PWY_5855_Escherichia_coli ubiquinol-7 biosynthesis 0 0 1802.5 0.0151 0.0414 (prokaryotic) (0-0.000103) (0-0) PWY_5856_Escherichia_coli ubiquinol-9 biosynthesis 0 0 1802.5 0.0151 0.0414 (prokaryotic) (0-0.000103) (0-0) PWY_5857_Escherichia_coli ubiquinol-10 biosynthesis 0 0 1802.5 0.0151 0.0414 (prokaryotic) (0-0.000103) (0-0) PWY_6708_Escherichia_coli ubiquinol-8 biosynthesis 0 0 1802.5 0.0151 0.0414 (prokaryotic) (0-0.000103) (0-0) PWY_6737_Lachnospiraceae_bacterium_7_1_58FAA starch degradation V 0 0 1893.5 0.0148 0.0414 (0-0) (0-0) PWY_7111_Clostridium_citroniae pyruvate fermentation to 0 0 1961 0.015 0.0414 isobutanol (engineered) (0-0) (0-0) VALSYN_PWY_Clostridium_citroniae L-valine biosynthesis 0 0 1961 0.015 0.0414 (0-0) (0-0) HISTSYN_PWY_Lachnospiraceae_bacterium_7_1_58FAA L-histidine biosynthesis 0 0 1936.5 0.0152 0.0416 (0-0) (0-0) ARGSYN_PWY_Escherichia_coli L-arginine biosynthesis I (via 0 0 1839 0.0155 0.0425 L-ornithine) (0-0.000139) (0-0) CALVIN_PWY_Ruminococcus_torques Calvin-Benson-Bassham cycle 0.0000569 0 1755 0.0157 0.0428 (0-0.000357) (0-0.0000924) PANTO_PWY_Barnesiella_intestinihominis phosphopantothenate 0.000134 0.000375 2805 0.0157 0.0428 biosynthesis I (0-0.000584) (0.0000885-0.000625) PWY_7221_Bacteroides_massiliensis guanosine ribonucleotides de 0 0 2696.5 0.0158 0.0429 novo biosynthesis (0-0) (0-0.000451) UBISYN_PWY_Escherichia_coli superpathway of ubiquinol-8 0 0 1813 0.0159 0.0431 biosynthesis (prokaryotic) (0-0.000111) (0-0) PWY_6125_Eggerthella_lenta superpathway of guanosine 0 0 1964 0.0161 0.0434 nucleotides de novo (0-0) (0-0) biosynthesis II PWY_6737_Lachnospiraceae_bacterium_1_1_57FAA starch degradation V 0 0 1845.5 0.0161 0.0434 (0-0.0000376) (0-0) PWY0_1296_Roseburia_inulinivorans purine ribonucleosides 0.000235 0.000104 1720 0.0163 0.0439 degradation (0.0000364-0.000771) (0-0.000394) PWY0_162_unclassified superpathway of pyrimidine 0.00204 0.00306 2808 0.0164 0.044 ribonucleotides de novo (0.00166-0.00355) (0.00191-0.00456) biosynthesis PWY_5188_Flavonifractor_plautii tetrapyrrole biosynthesis I 0 0 1900.5 0.0168 0.0449 (from glutamate) (0-0) (0-0) PWY_6609_Eggerthella_lenta adenine and adenosine salvage 0 0 1941.5 0.0168 0.0449 III (0-0) (0-0) UNINTEGRATED_Lachnospiraceae_bacterium_3_1_57FAA_CT1 UNINTEGRATED 0 0 1840.5 0.017 0.0453 (0-0.164) (0-0) PWY_4981_Eggerthella_lenta L-proline biosynthesis II (from 0 0 1921 0.0172 0.0456 arginine) (0-0) (0-0) PWY0_1586_Eggerthella_lenta peptidoglycan maturation 0 0 1921 0.0172 0.0456 (meso-diaminopimelate (0-0) (0-0) containing) PWY_5667_Eubacterium_eligens CDP-diacylglycerol 0.000143 0.000286 2797 0.0173 0.0457 biosynthesis I (0-0.00054) (0.0000566-0.000829) PWY0_1319_Eubacterium_eligens CDP-diacylglycerol 0.000143 0.000286 2797 0.0173 0.0457 biosynthesis II (0-0.00054) (0.0000566-0.000829) PWY_5097_Paraprevotella_clara L-lysine biosynthesis VI 0 0 2708 0.0175 0.0459 (0-0) (0-0.000309) PWY_6163_Flavonifractor_plautii chorismate biosynthesis from 0 0 1943.5 0.0175 0.0459 3-dehydroquinate (0-0) (0-0) PWY0_1296_Clostridium_hathewayi purine ribonucleosides 0 0 1922 0.0175 0.0459 degradation (0-0) (0-0) COA_PWY_1_Roseburia_inulinivorans coenzyme A biosynthesis I 0.00024 0.0000936 1732.5 0.0176 0.046 (0-0.000831) (0-0.000258) PEPTIDOGLYCANSYN_PWY_Flavonifractor_plautii peptidoglycan biosynthesis I 0 0 1969 0.0179 0.0466 (meso-diaminopimelate (0-0) (0-0) containing) PWY_5097_Roseburia_hominis L-lysine biosynthesis VI 0 0.0000777 2767 0.018 0.0466 (0-0.000114) (0-0.000217) PWY_6386_Flavonifractor_plautii UDP-N-acetylmuramoyl- 0 0 1969 0.0179 0.0466 pentapeptide biosynthesis II (0-0) (0-0) (lysine-containing) PWY_6387_Flavonifractor_plautii UDP-N-acetylmuramoyl- 0 0 1969 0.0179 0.0466 pentapeptide biosynthesis I (0-0) (0-0) (meso-diaminopimelate containing) UNINTEGRATED_Eggerthella_lenta UNINTEGRATED 0 0 1904.5 0.0181 0.0467 (0-0) (0-0) PWY_6700_Bacteroides_massiliensis queuosine biosynthesis 0 0 2683 0.0182 0.0471 (0-0) (0-0.000379) ENTBACSYN_PWY_Escherichia_coli enterobactin biosynthesis 0 0 1816.5 0.0185 0.0472 (0-0.000363) (0-0) PWY_5667_Bacteroides_xylanisolvens CDP-diacylglycerol 0 0.0000409 2747 0.0185 0.0472 biosynthesis I (0-0.00008) (0-0.000238) PWY_6936_Eubacterium_ventriosum seleno-amino acid biosynthesis 0 0 1796 0.0185 0.0472 (0-0.000117) (0-0.0000282) PWY0_1319_Bacteroides_xylanisolvens CDP-diacylglycerol 0 0.0000409 2747 0.0185 0.0472 biosynthesis II (0-0.00008) (0-0.000238) ILEUSYN_PWY_Dorea_formicigenerans L-isoleucine biosynthesis I 0.000123 0.0000638 1737 0.0186 0.0474 (from threonine) (0-0.0002) (0-0.000127) PWY_6151_Ruminococcus_lactaris S-adenosyl-L-methionine 0 0.000105 2756 0.0186 0.0474 cycle I (0-0.000141) (0-0.000277) COMPLETE_ARO_PWY_Lachnospiraceae_bacterium_1_1_57FAA superpathway of aromatic 0 0 1947.5 0.019 0.0482 amino acid biosynthesis (0-0) (0-0) PWY_6703_Bacteroides_massiliensis preQ0 biosynthesis 0 0 2671 0.0193 0.0488 (0-0) (0-0.000264) PWY_7111_Bacteroides_massiliensis pyruvate fermentation to 0 0 2679 0.0194 0.0488 isobutanol (engineered) (0-0) (0-0.00032) VALSYN_PWY_Bacteroides_massiliensis L-valine biosynthesis 0 0 2679 0.0194 0.0488 (0-0) (0-0.00032) VALSYN_PWY_Ruminococcus_lactaris L-valine biosynthesis 0 0.0000852 2755 0.0193 0.0488 (0-0.000131) (0-0.000222) PWY_5505_unclassified L-glutamate and L-glutamine 0 0 2614.5 0.0198 0.0493 biosynthesis (0-0) (0-0.0000582) PWY_5667_Paraprevotella_clara CDP-diacylglycerol 0 0 2703 0.0197 0.0493 biosynthesis I (0-0.0000281) (0-0.000278) PWY_5695_Roseburia_inulinivorans urate biosynthesis/inosine 5′- 0.00028 0.000136 1737.5 0.0199 0.0493 phosphate degradation (0.00005-0.000871) (0-0.000359) PWY_6122_Eggerthella_lenta 5-aminoimidazole 0 0 1916 0.0199 0.0493 ribonucleotide biosynthesis II (0-0) (0-0) PWY_6277_Eggerthella_lenta superpathway of 5- 0 0 1916 0.0199 0.0493 aminoimidazole ribonucleotide (0-0) (0-0) biosynthesis PWY_7221_Lachnospiraceae_bacterium_3_1_57FAA_CT1 guanosine ribonucleotides de 0 0 1929 0.02 0.0493 novo biosynthesis (0-0) (0-0) PWY0_1319_Paraprevotella_clara CDP-diacylglycerol 0 0 2703 0.0197 0.0493 biosynthesis II (0-0.0000281) (0-0.000278) UNINTEGRATED_Clostridium_nexile UNINTEGRATED 0 0 1898 0.0198 0.0493 (0-0.14) (0-0) UNINTEGRATED_Paraprevotella_clara UNINTEGRATED 0 0 2705 0.02 0.0493 (0-0.0495) (0-0.292) PANTO_PWY_Ruminococcus_lactaris phosphopantothenate 0 0.000092 2738 0.0202 0.0496 biosynthesis I (0-0.000108) (0-0.000242) PWY_5097_Bacteroides_massiliensis L-lysine biosynthesis VI 0 0 2684 0.0202 0.0496 (0-0) (0-0.000376) Shotgun functional analysis performed on 139 samples (IBS: n = 78 and Control: n = 58) Median abundance % represented as inter-quartile range (IQR)

    TABLE-US-00006 TABLE 5 Urine MS metabolomic Machine learning LASSO and Random Forest (RF) statistics of urine metabolites predictive of IBS LASSO RF lambda AUC Sens Spec mtry AUC Sens Spec 0.050 1 0.978 1 1 0.999 0.988 1.000 10-fold Cross Validation 10-fold Cross Validation Reference Reference Prediction Control IBS Prediction Control IBS Control 64 1.8 Control 64 1 IBS  0 78.2 IBS  0 79 Accuracy (average) 0.9875 Accuracy (average) 0.9931 Rank # Ranking Metabolite Rank # Ranking Metabolite 1 100.00 A 80987 1 100 A 80987 2 60.15 Ala-Leu-Trp-Gly 2 89.74 Ala-Leu-Trp-Gly 3 38.02 Medicagenic acid 3-O-b-D-glucuronide 3 86.81 Medicagenic acid 3-O-b-D-glucuronide 4 1.95 (−)-Epigallocatechin sulfate 4 0.00 (−)-Epigallocatechin sulfate Analysis had 2 classes: Control and IBS and included 144 samples (IBS: n = 80 and Control: n = 64) Metrics reported are the average values from 10 repeats of 10-fold Cross Validation.

    TABLE-US-00007 TABLE 6 urine metabolites significantly differentially abundant between IBS patients and non-IBS patients IBS Control Wilcoxon Metabolite (A.U.) (A.U.) Log2FC Statistic p-value q-value N-Undecanoylglycine 212.2 16.5 3.686 28 <0.001 <0.001 Gamma-glutamyl-Cysteine 614.2 84.8 2.856 410 <0.001 <0.001 Alloathyriol 1.5 453.1 −8.265 4101 <0.001 <0.001 Trp-Ala-Pro 6.1 0.2 4.646 763.5 <0.001 <0.001 A 80987 730.8 0.1 12.885 0 <0.001 <0.001 Medicagenic acid 3-O-b-D- 475.4 12.8 5.212 0 <0.001 <0.001 glucuronide Ala-Leu-Trp-Gly 420.3 120.5 1.802 83 <0.001 <0.001 Butoctamide hydrogen succinate 319 3.1 6.677 423 <0.001 <0.001 (−)-Epicatechin sulfate 274 209.8 0.385 506 <0.001 <0.001 1,4,5-Trimethyl-naphtalene 15.2 0 8.739 658.5 <0.001 <0.001 Tricetin 3′-methyl ether 7,5′- 0.6 22.5 −5.156 4094 <0.001 <0.001 diglucuronide Torasemide 0.5 38.2 −6.289 4023 <0.001 <0.001 (−)-Epigallocatechin sulfate 129.1 165.2 −0.356 3826 <0.001 <0.001 Dodecanedioylcarnitine 61.9 9.7 2.679 1054 <0.001 <0.001 1,6,7-Trimethylnaphthalene 17.2 0.1 7.234 1082.5 <0.001 <0.001 Tetrahydrodipicolinate 1.8 71.6 −5.324 3671 <0.001 <0.001 Sumiki's acid 84667.1 58728.8 0.528 1181 <0.001 <0.001 Silicic acid 4 734.3 −7.527 3556 <0.001 <0.001 Delphinidin 3-(6″-O-4-malyl- 0.2 16.2 −6.341 3548 <0.001 <0.001 glucosyl)-5-glucoside L-Arginine 0 13.7 −8.547 3540 <0.001 <0.001 Leucyl-Methionine 9.5 60.7 −2.682 3526 <0.001 <0.001 Phe-Gly-Gly-Ser 420 359.6 0.224 1250 <0.001 <0.001 Gln-Met-Pro-Ser 179.8 272.8 −0.601 3507 <0.001 <0.001 Creatinine 729604.9 752607.5 −0.045 3500 <0.001 <0.001 Ala-Asn-Cys-Gly 177.5 229.7 −0.372 3431 <0.001 <0.001 2-hydroxy-2-(hydroxymethyl)-2H- 508.8 256 0.991 1329 <0.001 <0.001 pyran-3(6H)-one Thiethylperazine 38 9.7 1.974 1365 <0.001 <0.001 5-((2-iodoacetamido)ethyl)-1- 627.5 257.7 1.284 1366.5 <0.001 <0.001 aminonapthalene sulfate dCTP 379 323.1 0.231 1390 <0.001 <0.001 Isoleucyl-Proline 10391.2 12988.5 −0.322 3362 <0.001 <0.001 3,4-Methylenesebacic acid 452826.1 482052 −0.09 3344 <0.001 <0.001 Dimethylallylpyrophosphate/Isopentenyl 15680 9743.9 0.686 1425 <0.001 <0.001 pyrophosphate (4-Hydroxybenzoyl)choline 68.6 112.2 −0.711 3329 <0.001 <0.001 Diazoxide 145.7 212 −0.541 3318 <0.001 <0.001 3,5-Di-O-galloyl-1,4- 638.5 539.3 0.243 1458 <0.001 <0.001 galactarolactone 2-Hydroxypyridine 37.8 164.2 −2.121 3300 <0.001 <0.001 Decanoylcamitine 152.9 46.7 1.71 1463 <0.001 <0.001 Asp-Met-Asp-Pro 894.5 744.1 0.266 1473 <0.001 <0.001 3-Methyldioxyindole 203 326 −0.683 3250 0.00022 0.00161 (1S,3R,4S)-3,4- 749.3 1010.2 −0.431 3244 0.000243 0.00173 Dihydroxy cyclohexane-1- carboxylate Ala-Lys-Phe-Cys 47.3 107.7 −1.186 3238 0.000269 0.00187 3-Indolehydracrylic acid 972.6 1898.6 −0.965 3216 0.000385 0.00261 [FA (18:0)] N-(9Z-octadecenoyl)- 197 178.2 0.145 1545 0.000404 0.00267 taurine Ferulic acid 4-sulfate 1569 3452.2 −1.138 3174 0.000746 0.00482 Urea 188415 198969.2 −0.079 3172 0.000769 0.00487 N-Carboxyacetyl-D-phenylalanine 307.4 438.4 −0.512 3166 0.000843 0.00522 4-Methoxyphenylethanol sulfate 476.3 889.1 −0.9 3155 0.000996 0.00604 UDP-4-dehydro-6-deoxy-D-glucose 192.4 171.7 0.164 1606 0.00104 0.00606 Linalyl formate 20.8 30.6 −0.555 3153 0.00103 0.00606 Demethyloleuropein 9.1 21.5 −1.233 3148 0.00111 0.0063 5′-Guanosyl-methylene-triphosphate 337.4 428.7 −0.346 3140 0.00125 0.00683 Allyl nonanoate 18.4 24 −0.385 3140 0.00125 0.00683 2-Phenylethyl octanoate 67.9 184.7 −1.444 3132 0.0014 0.00754 beta-Cellobiose 163.4 117.1 0.48 1628 0.00145 0.00762 D-Galactopyranosyl-(1−>3)-D- 271.6 756.8 −1.479 3125 0.00156 0.00805 galactopyranosyl-(1−>3)-L-arabinose Cys-Phe-Phe-Gln 41.1 62 −0.593 3114 0.00182 0.00927 Hippuric acid 89463.1 125800 −0.492 3108 0.00199 0.00993 Cys-Pro-Pro-Tyr 51.1 73.6 −0.527 3098 0.00229 0.0112 Met-Met-Thr-Trp 112 151.5 −0.436 3085 0.00275 0.0132 methylphosphonate 476.1 515.7 −0.115 3084 0.00279 0.0132 3′-Sialyllactosamine 84.8 129.1 −0.606 3082 0.00287 0.0134 2,4,6-Octatriynoic acid 1438.5 1703.3 −0.244 3079 0.00299 0.0137 Delphinidin 3-O-3″,6″-O- 229.7 164.6 0.481 1681 0.00307 0.0139 dimalonylglucoside L-Valine 8240.3 7936.7 0.054 1685 0.00325 0.0142 Met-Met-Cys 192.1 163.5 0.233 1685 0.00325 0.0142 Cysteinyl-Cysteine 14357 11017.4 0.382 1687 0.00334 0.0144 (all-E)-1,8,10-Heptadecatriene-4,6- 378 788.6 −1.061 3068 0.00348 0.0145 diyne-3,12-diol L-Lysine 135.9 76.8 0.823 1689 0.00343 0.0145 Pivaloylcarnitine 1262.9 1788 −0.502 3059 0.00393 0.0159 Lenticin 113 217.8 −0.946 3059 0.00393 0.0159 Phenol glucuronide 405.7 287.8 0.495 1701 0.00403 0.0159 Tyrosyl-Cysteine 957.9 802.2 0.256 1705 0.00426 0.0159 Osmundalin 533.8 317.1 0.751 1703 0.00414 0.0159 Tetrahydroaldosterone-3-glucuronide 781.6 975.4 −0.32 3054 0.0042 0.0159 N-Methylpyridinium 3882.3 13043 −1.748 3055 0.00414 0.0159 L-prolyl-L-proline 3080.2 5296.2 −0.782 3056 0.00409 0.0159 Glutarylcamitine 698.7 864.8 −0.308 3042 0.00492 0.018 [FA (15:4)] 6,8,10,12- 2303.5 3781 −0.715 3042 0.00492 0.018 pentadecatetraenal Methyl bisnorbiotinyl ketone 2259.7 1986.7 0.186 1720 0.00519 0.0187 Acetoin 1239.3 785.6 0.658 1726 0.00561 0.02 LysoPC(18:2(9Z,12Z)) 0.8 48.3 −5.859 3029 0.00584 0.0205 Hexyl 2-furoate 17 24.7 −0.537 3021 0.00647 0.0225 N-carbamoyl-L-glutamate 331.9 423.8 −0.353 3018 0.00673 0.0231 L-Homoserine 4000.7 5333.1 −0.415 3012 0.00726 0.0246 L-Asparagine 300 384.8 −0.359 3011 0.00736 0.0246 Tiglylcarnitine 314.5 762.4 −1.278 3008 0.00764 0.025 Thymine 110 76.8 0.519 1751 0.00774 0.025 3-hydroxypyridine 271.4 556.5 −1.036 3007 0.00774 0.025 Menadiol disuccinate 793.6 2024.6 −1.351 3005 0.00793 0.0254 9-Decenoylcamitine 1951.1 2609.8 −0.42 2996 0.00888 0.0275 Pyrocatechol sulfate 27377.5 40427.9 −0.562 2996 0.00888 0.0275 sedoheptulose anhydride 4159 10851.9 −1.384 2995 0.00899 0.0275 (+)-gamma-Hydroxy-L- 272.2 398.3 −0.549 2997 0.00877 0.0275 homoarginine Thioridazine 884.1 1048.3 −0.246 2984 0.0103 0.0312 Cys-Glu-Glu-Glu 37.3 56.8 −0.609 2977 0.0112 0.0329 Marmesin rutinoside 17.8 36.1 −1.025 2977 0.0112 0.0329 L-Serine 991.6 1146.2 −0.209 2978 0.0111 0.0329 L-Urobilinogen 8.5 139.7 −4.035 2976 0.0113 0.033 Isobutyrylglycine 2274.1 2694.4 −0.245 2974 0.0116 0.0334 S-Adenosylhomocysteine 135.5 454.5 −1.746 2968 0.0125 0.0356 2,3-dioctanoylglyceramide 887.1 1277.1 −0.526 2966 0.0128 0.0357 3-Methoxy-4-hydroxyphenylglycol 0.5 10.7 −4.335 2966.5 0.0127 0.0357 glucuronide sulfoethylcysteine 5602.3 8425.3 −0.589 2965 0.013 0.0358 Hydroxyphenylacetylglycine 460.1 568.5 −0.305 2962 0.0134 0.0367 Pyrroline hydroxycarboxylic acid 13972.6 16170.5 −0.211 2961 0.0136 0.0368 1-(alpha-Methyl-4-(2- 131.6 259.6 −0.98 2956 0.0144 0.0383 methylpropyl)benzeneacetate)-beta- D-Glucopyranuronic acid 2-Methylbutylacetate 1958.5 2726.3 −0.477 2956 0.0144 0.0383 N1-Methyl-4-pyridone-3- 6162.4 9041.6 −0.553 2955 0.0146 0.0384 carboxamide Cortolone-3-glucuronide 520.3 620.8 −0.255 2953 0.0149 0.039 Asn-Cys-Gly 255.4 231 0.145 1813 0.0164 0.0413 N6,N6,N6-Trimethyl-L-lysine 2282.7 2591.3 −0.183 2946 0.0162 0.0413 Benzylamine 66.3 218.7 −1.722 2947 0.016 0.0413 5-Hydroxy-L-tryptophan 177.9 218.1 −0.294 2945 0.0164 0.0413 Armillaric acid 25 44.5 −0.833 2941 0.0172 0.0429 Leucine/Isoleucine 979.3 1135.6 −0.214 2939 0.0176 0.0435 2-Butylbenzothiazole 441.4 381.3 0.211 1821 0.018 0.0441 D-Sedoheptulose 7-phosphate 297.5 497.5 −0.742 2936 0.0182 0.0442 [Fv Dimethoxy,methyl(9:1)] (2S)- 651.1 1201.2 −0.883 2935 0.0184 0.0444 5,7-Dimethoxy-3′,4′- methylenedioxyflavanone Oxoadipic acid 487.5 617.2 −0.341 2934 0.0186 0.0445 Thr-Cys-Cys 2325.9 2798.8 −0.267 2933 0.0188 0.0446 Creatine 4511 15140.7 −1.747 2930 0.0195 0.0458 Hydroxybutyrylcarnitine 156.7 259.7 −0.729 2929 0.0197 0.0459 5′-Dehydroadenosine 168.5 106.9 0.656 1833 0.0206 0.0462 Phe-Thr-Val 47.6 82.5 −0.793 2925 0.0206 0.0462 dUDP 149.3 319.2 −1.096 2925 0.0206 0.0462 L-Glutamine 616.2 706.6 −0.197 2926 0.0204 0.0462 Kaempferol 3-(2″,3″-diacetyl-4″-p- 32.8 113.1 −1.788 2927 0.0201 0.0462 coumaroylrhamnoside) Metabolomic analysis performed on 139 samples (IBS: n = 78 and Control: n = 61) Median concentration represented as arbitary unit (A.U.) Log2FC, log2 fold change between the groups

    TABLE-US-00008 TABLE 7 Fecal MS metabolomic Machine learning LASSO and Random Forest (RF) statistics for diagnosing IBS LASSO RF lambda AUC Sens Spec mtry AUC Sens Spec 0.051 1 0.700 0.475 1 0.862 0.821 0.647 10-fold Cross Validation for Training Set 10-fold Cross Validation for Training Set Reference Reference Prediction Control IBS Prediction Control IBS Control 29.9 24 Control 40.5 14.4 IBS 33.1 56 IBS 22.5 65.6 Accuracy (average) 0.601 Accuracy (average) 0.742 Rank # Ranking Metabolite Rank # Ranking Metabolite 1 100.00 3-deoxy-D-galactose 1 100 3-deoxy-D-galactose 2 97.93 Tyrosine 2 86.3 Tyrosine 3 51.16 I-Urobilin 3 80.8 I-Urobilin 4 0.13 Adenosine 4 80.0 Adenosine 5 0.09 Glu-Ile-Ile-Phe 5 78.9 Glu-Ile-Ile-Phe 6 0.06 3,6-Dimethoxy-19-norpregna- 6 77.1 3,6-Dimethoxy-19-norpregna- l,3,5,7,9-pentaen-20-one l,3,5,7,9-pentaen-20-one 7 0.04 2-Phenylpropionate 7 62.9 2-Phenylpropionate 8 0.04 MG(20:3(8Z,11Z,14Z)/0:0/0:0) 8 61.9 MG(20:3(8Z,11Z,14Z)/0:0/0:0) 9 0.03 1,2,3-Tris(1-ethoxyethoxy)propane 9 60.4 1,2,3-Tris(1-ethoxyethoxy)propane 10 0.03 Staphyloxanthin 10 60.3 Staphyloxanthin 11 0.02 Hexoses 11 59.0 Hexoses 12 0.02 20-hydroxy-E4-neuroprostane 12 58.2 20-hydroxy-E4-neuroprostane 13 0.02 Nonyl acetate 13 56.7 Nonyl acetate 14 0.01 3-Feruloyl-1,5-quinolactone 14 56.2 3-Feruloyl-1,5-quinolactone 15 0.01 trans-2-Heptenal 15 53.0 trans-2-Heptenal 16 0.01 Pyridoxamine 16 48.9 Pyridoxamine 17 0.01 L-Arginine 17 46.3 L-Arginine 18 0.01 Dodecanedioic acid 18 44.9 Dodecanedioic acid 19 0.01 Ursodeoxycholic acid 19 43.5 Ursodeoxycholic acid 20 0.003 1-(Malonylamino)cyclopropanecarboxylic acid 20 43.5 1-(Malonylamino)cyclopropanecarboxylic acid 21 0.002 Cortisone 21 42.5 Cortisone 22 0.002 9,10,13-Trihydroxystearic acid 22 42.4 9,10,13-Trihydroxystearic acid 23 0.002 Glu-Ala-Gln-Ser 23 36.6 Glu-Ala-Gln-Ser 24 0.002 Quasiprotopanaxatriol 24 36.3 Quasiprotopanaxatriol 25 0.001 N-Methylindolo[3,2-b]-5alpha-cholest-2-ene 25 35.3 N-Methylindolo[3,2-b]-5alpha-cholest-2-ene 26 0.001 PG(20:0/22:1(11Z)) 26 34.4 PG(20:0/22:1(11Z)) 27 0.001 (−)-Epigallocatechin 27 34.3 (−)-Epigallocatechin 28 0.001 2-Methyl-3-ketovaleric acid 28 30.8 2-Methyl-3-ketovaleric acid 29 0.001 Secoeremopetasitolide B 29 30.4 Secoeremopetasitolide B 30 0.001 PC(20:1(11Z)/P-16:0) 30 28.7 PC(20:1(11Z)/P-16:0) 31 0.001 Glu-Asp-Asp 31 26.3 Glu-Asp-Asp 32 0.001 N5-acetyl-N5-hydroxy-L-ornithine acid 32 23.9 N5-acetyl-N5-hydroxy-L-ornithine acid 33 0.001 Silicic acid 33 22.7 Silicic acid 34 0.0005 (1xi,3xi)-1,2,3,4-Tetrahydro-1-methyl-beta- 34 22.2 (1xi,3xi)-1,2,3,4-Tetrahydro-1-methyl-beta- carboline-3-carboxylic acid carboline-3-carboxylic acid 35 0.0004 PS(36:5) 35 21.9 PS(36:5) 36 0.0002 Chorismate 36 17.6 Chorismate 37 0.0002 Isoamyl isovalerate 37 17.5 Isoamyl isovalerate 38 0.0002 PA(O-36:4) 38 12.5 PA(O-36:4) 39 0.0001 PE(P-28:0) 39 8.0 PE(P-28:0) 40 0.00001 gamma-Glutamyl-S-methylcysteinyl-beta- 40 0 gamma-Glutamyl-S-methylcysteinyl-beta- alanine alanine Analysis had 2 classes: Control and IBS and included 143 samples (IBS: n = 80 and Control: n = 63) 753 predictors were used in the model No test set

    TABLE-US-00009 TABLE 8 Fecal metabolites differentially abundant between the IBS and Control groups IBS Control Wilcoxon Metabolite (A.U.) (A.U.) Log2FC Statistic p-value q-value 2-Phenylpropionate 1323182.1 3247921.9 −1.296 3374 0 0.00505 3-Buten-1-amine 280286.1 167168.2 0.746 1388 0 0.00505 Adenosine 125862.8 222491.1 −0.822 3340 0 0.00505 I-Urobilin 2129046.3 508459.2 2.066 1444 0 0.00505 2,3-Epoxymenaquinone 245989.6 547357.5 −1.154 3313 0 0.00505 [FA (22:5)] 4,7,10,13,16-Docosapentaynoic 516717.6 1051721 −1.025 3309 0 0.00505 acid 3,6-Dimethoxy-19-norpregna-1,3,5,7,9- 961706.2 2013326.2 −1.066 3298 0 0.00505 pentaen-20-one Cucurbitacin S 1617422.3 812194.6 0.994 1462 0.0001 0.00505 N-Heptanoylglycine 581244.7 1189914.8 −1.034 3296 0.0001 0.00505 11-Deoxocucurbitacin I 1509367.4 1026985.6 0.556 1478 0.000132 0.00599 Staphyloxanthin 125908.3 208397.6 −0.727 3264 0.000174 0.00716 Piperidine 536820.9 366827.8 0.549 1501 0.000196 0.00722 Leu-Ser-Ser-Tyr 194085.5 88714.9 1.129 1509 0.000224 0.00722 L-Urobilin 31844915.4 58134193.3 −0.868 3249 0.000224 0.00722 L-Phenylalanine 2052003.6 1343878.1 0.611 1513 0.000239 0.00722 Ala-Leu-Trp-Pro 323939 638393.1 −0.979 3238 0.000269 0.0074 3-Feruloyl-1,5-quinolactone 524541.4 876281.8 −0.74 3236 0.000278 0.0074 PG(P-16:0/14:0) 426308.9 798780.6 −0.906 3223 0.000343 0.00832 3-deoxy-D-galactose 226693.6 145983.2 0.635 1536 0.000349 0.00832 MG(20:3(8Z,11Z,14Z)/0:0/0:0) 89430.2 214373.1 −1.261 3215 0.000391 0.00857 Mesobilirubinogen 696662.3 251218.8 1.472 1544 0.000397 0.00857 L-Alanine 1429957.1 1081997.7 0.402 1548 0.000424 0.00872 Tyrosine 533603.6 368180.1 0.535 1564 0.000546 0.0106 PG(O-30:1) 140723.9 291063.6 −1.048 3192 0.000564 0.0106 beta-Pinene 171.8 276.9 −0.689 3187 0.00061 0.011 2,4,8-Eicosatrienoic acid isobutylamide 53648.9 167764.9 −1.645 3170.5 0.000787 0.0135 Glutarylglycine 1561150.4 2367236.8 −0.601 3169 0.000805 0.0135 [PR] gamma-Carotene/beta,psi-Carotene 39594.5 55014.4 −0.475 3155 0.000996 0.0161 Neuromedin B (1-3) 1195664.8 414438.1 1.529 1610 0.00111 0.0173 Heptane-1-thiol 435910.8 336879.8 0.372 1613 0.00116 0.0174 Violaxanthin 688839.8 991237.9 −0.525 3143 0.00119 0.0174 Isolimonene 6.8 19 −1.492 3138 0.00128 0.0182 Ile-Lys-Cys-Gly 422439.2 241750.4 0.805 1625 0.00138 0.0187 His-Met-Val-Val 377162.4 223544.7 0.755 1626 0.0014 0.0187 Allyl caprylate 9.6 7.7 0.326 1632 0.00153 0.0196 Hydroxyprolyl-Tryptophan 323127 123183.6 1.391 1633 0.00156 0.0196 Dodecanedioic acid 671845.4 956268.6 −0.509 3122 0.00162 0.0199 2-O-Benzoyl-D-glucose 220717.8 469968.1 −1.09 3119 0.0017 0.0199 2-Ethylsuberic acid 384419 749840 −0.964 3118 0.00172 0.0199 D-Urobilin 1792754.5 301418.7 2.572 1641.5 0.00176 0.0199 20-hydroxy-E4-neuroprostane 125388 208519 −0.734 3113 0.00185 0.02 PG(O-31:1) 525453.8 924227.6 −0.815 3113 0.00185 0.02 Anigorufone 754382 1783246.9 −1.241 3110 0.00193 0.0203 Nonyl acetate 13.1 8.2 0.677 1658 0.00223 0.0229 L-Arginine 32851.3 72856.2 −1.149 3095 0.00239 0.0239 PG(P-32:1) 164475.2 226435.7 −0.461 3094 0.00242 0.0239 Glu-Ala-Gln-Ser 375851.9 273805.4 0.457 1668 0.00256 0.0247 PG(31:0) 160964.6 277244.2 −0.784 3087 0.00267 0.0252 Cucurbitacin I 793831.5 470668 0.754 1683 0.00316 0.0275 Arg-Lys-Phe-Val 479994 2477823.7 −2.368 3075 0.00316 0.0275 Genipinic acid 269618.2 535154 −0.989 3072.5 0.00327 0.0275 Hexoses 63587.8 102387.4 −0.687 3072.5 0.00327 0.0275 Lys-Phe-Phe-Phe 144955.5 76014.5 0.931 1686 0.00329 0.0275 PI(41:2) 523352.3 289816 0.853 1686 0.00329 0.0275 D-galactal 236791 433511.6 −0.872 3071 0.00334 0.0275 Traumatic acid 235655 352893.3 −0.583 3066 0.00357 0.0287 Adenine 312165.1 445818.4 −0.514 3065 0.00362 0.0287 PC(22:2(13Z,16Z)/15:0) 249100.9 131882.9 0.917 1695 0.00372 0.0287 2-Phenylethyl beta-D-glucopyranoside 330200 576025.7 −0.803 3061 0.00382 0.0287 PG(37:2) 208672.4 309558.5 −0.569 3060 0.00387 0.0287 Glycerol tributanoate 1818865.6 790191.7 1.203 1699 0.00393 0.0287 Arg-Leu-Pro-Arg 1113239.6 805486.6 0.467 1699 0.00393 0.0287 2-O-p-Coumaroyl-D-glucose 177559.4 309984.6 −0.804 3057 0.00403 0.029 3,4-Dihydroxyphenyllactic acid methyl ester 172842.1 321573.9 −0.896 3055 0.00414 0.0293 PG(P-28:0) 70315.5 138650.1 −0.98 3054 0.0042 0.0293 PG(34:0) 80115.9 135649.9 −0.76 3050 0.00443 0.0298 L-Lysine 391680.5 290959.3 0.429 1710 0.00455 0.0298 Ribitol 139100.6 308432.9 −1.149 3048 0.00455 0.0298 LysoPE(18:2(9Z,12Z)/0:0) 41861 70972.6 −0.762 3048 0.00455 0.0298 PA(20:4(5Z,8Z,11Z,14Z)e/2:0) 117279.2 179176 −0.611 3046 0.00467 0.0298 5-Dehydroshikimate 270282 486194.1 −0.847 3046 0.00467 0.0298 Threoninyl-Isoleucine 302458.5 194748 0.635 1715 0.00486 0.0301 L-Methionine 296185.5 228939.8 0.372 1717 0.00499 0.0301 PS(26:0)) 3551762.1 1704565.8 1.059 1717 0.00499 0.0301 alpha-Pinene 92.1 215.6 −1.227 3041 0.00499 0.0301 Fenchene 12.1 26.4 −1.124 3039 0.00512 0.0305 Glu-Ile-Ile-Phe 171216.3 125559 0.447 1721 0.00526 0.0305 Gln-Phe-Phe-Phe 367594.4 170906.7 1.105 1721 0.00526 0.0305 Ursodeoxycholic acid 12666176 6449124.1 0.974 1726 0.00561 0.0318 PC(34:2) 112528.4 208697.3 −0.891 3032 0.00561 0.0318 3,17-Androstanediol glucuronide 469180.9 755540.9 −0.687 3031 0.00569 0.0318 Pyridoxamine 56652.2 41022 0.466 1730.5 0.00595 0.0324 [ST hydrox] (25R)-3alpha,7alpha-dihydroxy- 319975.1 229268.9 0.481 1732 0.00607 0.0324 5beta-cholestan-27-oyl taurine PA(42:2) 1782124.8 686161.8 1.377 1732 0.00607 0.0324 [FA (16:0)] 2-bromo-hexadecanal 515055.9 256899.2 1.004 1733 0.00615 0.0324 3,6-Dihydro-4-(4-methyl-3-pentenyl)-1,2- 479922.9 701686.5 −0.548 3025 0.00615 0.0324 dithiin 3-Methylcrotonylglycine 161596.9 287502.4 −0.831 3024 0.00623 0.0324 xi-7-Hydroxyhexadecanedioic acid 48647.5 70410.5 −0.533 3020 0.00656 0.0337 Camphene 7.7 17.7 −1.192 3017 0.00681 0.0345 2-Hydroxy-3-carboxy-6-oxo-7-methylocta- 375469 560318.7 −0.578 3014 0.00708 0.0345 2,4-dienoate 7C-aglycone 1658154.1 2581551 −0.639 3014 0.00708 0.0345 1-(3-Aminopropyl)-4-aminobutanal 1007823.6 194401.6 2.374 1744 0.00708 0.0345 Benzyl isobutyrate 79.6 152.6 −0.938 3014 0.00708 0.0345 (S)-(E)-8-(3,6-Dimethyl-2-heptenyl)-4′,5,7- 213117.3 551116.6 −1.371 3010 0.00745 0.0346 trihydroxyflavanone 1,3-di-(5Z,8Z,11Z,14Z,17Z- 100264.5 212921.2 −1.087 3010 0.00745 0.0346 eicosapentaenoyl)-2-hydroxy-glycerol (d5) SM(d18:0/18:0) 80949.8 49417.7 0.712 1748 0.00745 0.0346 L-Homoserine 292067.7 226802.4 0.365 1749 0.00754 0.0346 17beta-(Acetylthio)estra-1,3,5 (10)-trien-3-ol 630945.8 1067932 −0.759 3009 0.00754 0.0346 acetate [ST (2:0)] 5beta-Chola-3,11-dien-24-oic 695679.3 320859.8 1.116 1750 0.00764 0.0346 Acid PG(33:2) 75974.9 50361.9 0.593 1750 0.00764 0.0346 PE(22:4(7Z,10Z,13Z,16Z)/P-16:0) 81995.8 100782 −0.298 3006 0.00783 0.0351 Protoporphyrinogen IX 255656.7 187102.1 0.45 1756 0.00824 0.0366 alpha-Tocopherol succinate 47245.3 108160.8 −1.195 3001 0.00834 0.0367 Methyl (9Z)-6′-oxo-6,5′-diapo-6-carotenoate 899831 218922.6 2.039 1760 0.00866 0.037 PG(16:1(9Z)/16:1(9Z)) 103173.2 74458 0.471 1760 0.00866 0.037 PC(o-22:1(13Z)/20:4(8Z,11Z,14Z,17Z)) 52447 106165.5 −1.017 2998 0.00866 0.037 PG(31:2) 136942.9 86564.2 0.662 1761 0.00877 0.0371 alpha-phellandrene 61.7 199.1 −1.69 2992 0.00933 0.0391 [PS (12:0/13:0)] 1-dodecanoyl-2-tridecanoyl- 7612945.4 10637361.3 −0.483 2991 0.00945 0.0393 sn-glycero-3-phosphoserine (ammonium salt) Glu-Asp-Asp 340635.1 461045.6 −0.437 2989 0.00968 0.0399 PG(33:1) 215737.5 257078.3 −0.253 2984 0.0103 0.0416 PA(O-20:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)) 235161.1 348850.6 −0.569 2984 0.0103 0.0416 [FA oxo(19:0)] 18-oxo-nonadecanoic acid 191012.9 264717.7 −0.471 2979 0.0109 0.0438 PG(16:1(9Z)/18:0) 714625.3 987020.3 −0.466 2978 0.0111 0.0438 Leu-Val 450170.2 278770.9 0.691 1781 0.0112 0.0438 demethylmenaquinone-6 576044.2 696566.9 −0.274 2977 0.0112 0.0438 PC(o-16:1(9Z)/14:1(9Z)) 400429.2 269886.5 0.569 1782 0.0113 0.0439 PG(P-32:0) 306573.5 512926.2 −0.743 2974 0.0116 0.0444 (24E)-3beta,15alpha,22S-Triacetoxylanosta- 390549.4 641541.7 −0.716 2973 0.0118 0.0444 7,9(11),24-trien-26-oic acid PA(33:5) 2066319.8 1269332.8 0.703 1785 0.0118 0.0444 LysoPC(0:0/18:0) 210818 418649.1 −0.99 2970 0.0122 0.0457 Ile-Arg-Ile 56540.6 70311.6 −0.314 2968 0.0125 0.0464 Lauryl acetate 3.3 4.8 −0.525 2967 0.0126 0.0466 Glu-Glu-Gly-Tyr 292531 208064.8 0.492 1793 0.013 0.0473 3-(Methylthio)-1-propanol 215.9 162 0.414 1794 0.0131 0.0475 (−)-(E)-1-(4-Hydroxyphenyl)-7-phenyl-6- 1827847.9 2763203.9 −0.596 2962 0.0134 0.0479 hepten-3-ol Dimethyl benzyl carbinyl butyrate 5.4 12.7 −1.232 2962 0.0134 0.0479 Methyl 2,3-dihydro-3,5-dihydroxy-2-oxo-3- 1058511.5 1884600.2 −0.832 2960 0.0137 0.0486 indoleacetic acid Metabolomic analysis performed on 139 samples (IBS: n = 78 and Control: n = 61) Median concentration represented as arbitary unit (A.U.) Log2FC, log2 fold change between the groups

    TABLE-US-00010 TABLE 9a Wilcox Rank Sum Statistical analysis is bile acids (BAs) between the subgroups of IBS, as defined by the Rome Criteria Primary Secondary Sulfated Conjugated Subgroup Total BAs BAs BAs BAs UDCA BAs Tauro/glyco Control 7.11 (0.285) 5.038 (4.446) 94.962 (4.446) 8.336 (6.14) 47.186 (22.212) 13.374 (9.323) 1.932 (1.521) IBS-C 7.22 (0.322) 5.216 (4.271) 94.784 (4.271) 9.028 (9.923) 55.094 (21.022) 14.244 (12.293) 2.247 (2.568) IBS-D 7.37 (0.31) * 3.593 (4.117) 96.407 (4.117) 4.126 (3.507) * 67.022 (15.419) ** 7.719 (6.03) * 1.77 (1.649) IBS-M 7.18 (0.345) 4.127 (3.121) 95.873 (3.121) 9.603 (10.878) 51.007 (22.764) 13.73 (11.995) 2.624 (3.051) Statistical analysis was performed on 139 samples (IBS: n = 78 and Control: n = 61) Significance after p value adjustment (Benjamini-Hochberg), was observed only in Control vs IBS-D. * p-adj < 0.05, ** p-adj < 0.01. Total bile acids are represented as mean of log10 values. Others bile acid categories are presented as a percentage of the total bile acids. Taur/Glyco ratio was calculated as ratio of taurine- and glyco-conjugated BAs (without log10 transformation).

    TABLE-US-00011 TABLE 9b Spearman correlation analysis between bile acids (Bas) and secondary BA synthesis pathways Pathway Total BAs Primary BAs Secondary BAs Sulfated BAs UDCA Conjugated BAs ursodeoxycholate biosynthesis (PWY_7588) 0.258* 0.007 0.26* −0.113 0.298** −0.133 glycocholate metabolism (PWY_6518) 0.362** −0.045 0.37** −0.125 0.42** −0.156 Statistical analysis was performed on 135 samples (IBS: n = 78 and Control: n = 57) Significance after p value adjustment (Benjamini-Hochberg), was observed only in Control vs IBS-D. * p-adj < 0.05, ** p-adj < 0.01. Total bile acids are represented as mean of log10 values. Others bile acid categories are presented as a percentage of the total bile acids (without Log10 transformation).

    TABLE-US-00012 TABLE 10 Descriptive statistics of control and IBS subjects studied Control (n = 65) IBS (n = 80) Age range, years |mean) 19-65 (45) 17-66 |39) Sex |male/female) 16/49 15/65 BMI Class, n |%) Normal 25 (58) 31 |39) Obese Class I 11 (17) 14 |18) Obese Class II 3 (5) 5 (6) Obese Class III 1 (2) 3 (4) Overweight 21 (22) 22 |22) Underweight 3 (3) 3 (4) HADS: Anxiety, n |%) Normal |0-10) 59 (91) 58 |73) Abnormal |11-21) 6 (9) 22 |28) HADS: Depression, n (%) Normal |0-10) 64 (98) 70 |88) Abnormal |11-21) 1 (2) 10 |13) Bristol Stool Score, n (%) Normal 54 (83) 18 |23) Constipated 8 (12) 22 |28) Diarrhoea 3 (5) 42 |50) IBS subtype, n |%) IBS-C 30 |38) IBS-D N/A 21 |36) IBS-M 29 |36) SeHCAT assayed, n (%) 9 (14) 46 |56) Dietary group |FFQ), n |%) Omnivore 63 (97) 74 |93) Vegetarian 1 (2) 2 (3) Pescatarian 1 (2) 1 (1) Gluten-free 0 (0) 4 (5) Drinks alcohol, n |%) Current 54 (83) 57 |71) Previous 0 (0) 1 (1) Never 10 (15) 22 |28) Smoker, n (%) Current 10* (15) 14* |18) Previous 13 (20) 18 |23) Never 42 (65) 48 |60) *1 subject in each group smoked e-cigarettes N/A, not applicable

    TABLE-US-00013 TABLE 11 16S OTU Machine learning LASSO and Random Forest (RF) statistics LASSO RF lambda AUC Sens Spec mtry AUC Sens Spec 0.1 0.757 0.883 0.469 1 0.851 0.924 0.542 Ten-fold cross-validation Ten-fold cross-validation Reference Reference Prediction IBS Healthy Prediction IBS Healthy IBS 68.8 34.0 IBS 72.1 29.3 Healthy  9.2 30.0 Healthy  5.9 34.7 Accuracy (average) 0.6958 Accuracy (average) 0.7521 RF Ranking Rank # Ranking Phylum Class Order Family Genus 1 100 Firmicutes Clostridia Clostridiales Lachnospiraceae 2 87.5 Firmicutes 3 82.1 Firmicutes Clostridia Clostridiales Ruminococcaceae Butyricicoccus 4 66.3 Firmicutes Clostridia Clostridiales Lachnospiraceae 5 62.4 Firmicutes Clostridia Clostridiales 6 57.2 Firmicutes Clostridia Clostridiales Ruminococcaceae 7 43.7 Firmicutes Clostridia Clostridiales Ruminococcaceae 8 30.8 Firmicutes 9 15.1 Firmicutes Clostridia Clostridiales Ruminococcaceae 10 0 Firmicutes Clostridia Clostridiales Lachnospiraceae Analysis had 2 classes: Control and IBS and included 139 samples (IBS: n = 80 and Control: n = 59) Coriobacteriaceae Metrics reported are the average values from 10 repeats of 10-fold Cross Validation. Taxonomy classified using the RDP classfier, database version 2.10.1.

    TABLE-US-00014 TABLE 12 16S OTU Machine learning LASSO and Random Forest (RF) statistics sequence information Rank # Ranking Phylym Class Order Family Genus Sequence  1 100 Firmicutes Clostridia Clostridiales Lachno- CCTACGGGGGGCAGCAGTGGGGAATATTG spiraceae CACAATGGGGGAAACCCTGATGCAGCGAC GCCGCGTGAGTGAAGAAGTATTTCGGTAT GTAAAGCTCTATCAGCAGGGAAGAAAATG ACGGTACCTGACTAAGAAGCCCCGGCTAA CTACGTGGCCAGCAGCCGCGGTAATACGT AGGGGGCAAGCGTTATCCGGATTTACTGG GTGTAAAGGGAGCGTAGGTGGTATGGCAA GTCAGAGGTGAAAACCCAGGGCTTAACCT TGGGATTGCCTTTGAAACTGTCAGACTAG AGTGCAGGAGGGGTAAGTGGAATTCCTAG TGTAGCGGTGAAATGCGTAGATATTAGGA GGAACACCAGTGGCGAAGGCGGCTTACTG GACTGTAACTGACACTGAGGCTCGAAAGC GTGGGGAGCAAACAGGATTAGATACCCGA GTAGTC (SEQ ID No: 1)  2 87.5 Firmicutes CCTACGGGGGGCTGCAGTGGGGAATATTG GGCAATGGAGGAAACTCTGACCCAGCAAC GCCGCGTGGAGGAAGAAGTTTTCGGATCG TAAACTCCTGTCCTTGGAGACGAGTAGAA GACGGTATCCAAGGAGGAAGCCCCGGCTA ACTACGTGCCAGCAGCCGCGGTAATACGT AGGGGGCAAGCGTTGTCCGGAATAATTGG GCGTAAAGGGCGCGTAGGCGGCTCGGTAA GTCTGGAGTGAAAGTCCTGCTTTTAAGGT GGGAATTGCTTTGGATACTGTCGGGCTTG AGTGCAGGAGAGGTTAGTGGAATTCCCAG TGTAGCGGTGAAATGCGTAGAGATTGGGA GGAACACCAGTGGCGAAGGCGACTAACTG GACTGTAACTGACGCTGAGGCGCGAAAGT GTGGGGAGCAAACAGGATTAGATACCCCA GTAGTC (SEQ ID No: 2)  3 82.1 Firmicutes Clostridia Clostridiales Ruminoco- Buty- CCTACGGGGGGCTGCAGTGGGGAATATTG ccaceae ricico- CGCAATGGGGGAAACCCTGACGCAGCAAC ccus GCCGCGTGATTGAAGAAGGCCTTCGGGTT GTAAAGATCTTTAATCAGGGACGAAACAT GACGGTACCTGAAGAATAAGCTCCGGCTA ACTACGTGCCAGCAGCCGCGGTAATACGT AGGGAGCAAGCGTTATCCGGATTTACTGG GTGTAAAGGGCGCGCAGGCGGGCCGGCAA GTTGGAAGTGAAATCCGGGGGCTTAACCC CCGAACTGCTTTCAAAACTGCTGGTCTTG AGTGATGGAGAGGCAGGCGGAATTCCGTG TGTAGCGGTGAAATGCGTAGATATACGGA GGAACACCAGTGGCGAAGGCGGCCTGCTG GACATTAACTGACGCTGAGGCGCGAAAGC GTGGGGAGCAAACAGGATTAGATACCCCT GTAGTC (SEQ ID No: 3)  4 66.3 Firmicutes Clostridia Clostridiales Lachno- CCTACGGGTGGCTGCAGTGGGGAATATTG spiraceae CACAATGGGGGAAACCCTGATGCAGCAAC GCCGCGTGAGTGAAGAAGTATTTCGGTAT GTAAAGCTCTATCAGCAGGAAAGAAAATG ACGGTACCTGACTAAGAAGCCCCGGCTAA CTACGTGCCAGCAGCCGCGGTAATACGTA GGGGGCAAGCGTTATCCGGATTTACTGGG TGTAAAGGGAGCGTAGACGGTGAGGCAAG TCTGAAGTGAAATGCCGGGGCTCAACCCC GGAACTGCTTTGGAAACTGTCGTACTAGA GTGTCGGAGGGGTAAGCGGAATTCCTAGT GTAGCGGTGAAATGCGTAGATATTAGGAG GAACACCAGTGGCGAAGGCGGCTTGCTGG ACTGTAACTGACACTGAGGCTCGAAAGCG TGGGGAGCAAACAGGATTAGATACCCTTG TAGTC (SEQ ID No: 4)  5 62.4 Firmicutes Clostridia Clostridiales CCTACGGGGGGCAGCAGTCGGGAATATTG CGCAATGGAGGAAACTCTGACGCAGTGAC GCCGCGTATAGGAAGAAGGTTTTCGGATT GTAAACTATTGTCGTTAGGGAAGATACAA GACAGTACCTAAGGAGGAAGCTCCGGCTA ACTACGTGCCAGCAGCCGCGGTAATACGT AGGGAGCAAGCGTTATCCGGATTTATTGG GTGTAAAGGGTGCGTAGACGGGACAACAA GTTAGTTGTGAAATCCCTCGGCTTAACTG AGGAACTGCAACTAAAACTATTGTTCTTG AGTGTTGGAGAGGAAAGTGGAATTCCTAG TGTAGCGGTGAAATGCGTAGATATTAGGA GGAACACCGGTGGCGAAGGCGACTTTCTG GACAATAACTGACGTTGAGGCACGAAAGT GTGGGGAGCAAACAGGATTAGATACCCCA GTAGTC (SEQ ID No: 5)  6 57.2 Firmicutes Clostridia Clostridiales Ruminoco- CCTACGGGGGGCTGCAGTGGGGAATATTG ccaceae GGCAATGGGCGAAAGCCTGACCCAGCAAC GCCGCGTGAAGGAAGAAGGTCTTCGGATT GTAAACTTCTTTTATGAGGGACGAAGGAA GTGACGGTACCTCATGAATAAGCCACGGC TAACTACGTGCCAGCAGCCGCGGTAATAC GTAGGTGGCAAGCGTTGTCCGGATTTACT GGGTGTAAAGGGCGCGTAGGCGGGATGGC AAGTCAGATGTGAAATCCATGGGCTCAAC CCATGAACTGCATTTGAAACTGTCGTTCT TGAGTATCGGAGAGGCAAGCGGAATTCCT AGTGTAGCGGTGAAATGCGTAGATATTAG GAGGAACACCAGTGGCGAAGGCGGCTTGC TGGACGACAACTGACGCTGAGGCGCGAAA GCGTGGGGAGCAAACAGGATTAGATACCC CTGTAGTC (SEQ ID No: 6)  7 43.7 Firmicutes Clostridia Clostridiales Ruminoco- CCTACGGGGGGCTGCAGTGGGGGATATTG ccaceae CACAATGGGGGAAACCCTGATGCAGCAAC GCCGCGTGAGGGAAGAAGGTTTTCGGATT GTAAACCTCTGTCCTCAGGGAAGATAATG ACGGTACCTGAGGAGGAAGCTCCGGCTAA CTACGTGCCAGCAGCCGCGGTAATACGTA GGGAGCAAGCGTTGTCCGGATTTACTGGG TGTAAAGGGTGCGTAGGCGGGATATCAAG TCAGACGTGAAATCCATCGGCTTAACTGA TGAACTGCGTTTGAAACTGGTATTCTTGA GTGAGTCAGAGGCAGGCGGAATTCCCGGT GTAGCGGTGAAATGCGTAGAGATCGGGAG GAACACCAGTGGCGAAGGCGGCCTGCTGG GGCTTAACTGACGCTGAGGCACGAAAGCG TGGGGAGCAAACAGGATTAGATACCCGAG TAGTC (SEQ ID No: 7)  8 30.8 Firmicutes CCTACGGGGGGCTGCAGTGGGGAATATTG GGCAATGGAGGGAACTCTGACCCAGCAAT GCCGCGTGAGTGAAGAAGGTTTTCGGATT GTAAAACTCTTTAAGCAGGGACGAAGAAA GTGACGGTACCTGCAGAATAAGCATCGGC TAACTACGTGCCAGCAGCCGCGGTAATAC GTAGGATGCAAGCGTTATCCGGAATGACT GGGCGTAAAGGGTGCGTAGGCGGTAAATC AAGTTGGCAGCGTAATTCCGGGGCTTAAC TCCGGAACTACTGCCAAAACTGGTGAACT AGAGTGTGTCAGGGGTAAGTGGAATTCCT AGTGTAGCGGTGGAATGCGTAGATATTAG GAGGAACACCGGAGGCGAAAGCGACTTAC TGGGGCACAACTGACGCTGAGGCACGAAA GCGTGGGGAGCAAACAGGATTAGATACCC CGGTAGTC (SEQ ID No: 8)  9 15.1 Firmicutes Clostridia Clostridiales Ruminoco- CCTACGGGAGGCAGCAGTGGGGGATATTG ccaceae CACAATGGAGGAAACTCTGATGCAGCAAC GCCGCGTGAGGGAAGAAGGATTTCGGTTT GTAAACCTCTGTCTTCGGTGACGAAATGA CGGTAGCCGAGGAGGAAGCTCCGGCTAAC TACGTGCCAGCAGCCGCGGTAATACGTAG GGAGCAAGCGTTGTCCGGAATTACTGGGT GTAAAGGGTGCGTAGGTGGGACTGCAAGT CAGGTGTGAAAACGGTCGGCTCAACCGAT CGCCTGCACTTGAAACTGTGGTTCTTGAG TGAAGTAGAGGTAGGCGGAATTCCCGGTG TAGCGGTGAAATGCGTAGAGATCGGGAGG AACACCAGTGGCGAAGGCGGCCTACTGGG CTTTAACTGACGCTGAGGCACGAAAGCAT GGGTAGCAAACAGGATTAGATACCCCGGT AGTC (SEQ ID No: 9) 10 0 Firmicutes Clostridia Clostridiales Lachno- CCTACGGGGGGCTGCAGTGGGGAATATTG spiraceae CACAATGGGGGAAACCCTGATGCAGCGAC GCCGCGTGAGCGAAGAAGTATTTCGGTAT GTAAAGCTCTATCAGCAGGGAAGATAATG ACGGTACCTGACTAAGAAGCCCCGGCTAA ATACGTGCCAGCAGCCGCGGTAATACGTA GGGAGCAAGCGTTATCCGGATTTATTGGG TGTAAAGGGTGCGTAGACGGGACAACAAG TTAGTTGTGAAATCCCTCGGCTTAACTGA GGAACTGCAACTAAAACTATTGTTCTTGA GTGTTGGAGAGGAAAGTGGAATTCCTAGT GTAGCGGTGAAATGCGTAGATATTAGGAG GAACACCGGTGGCGAAGGCGGCCTACTGG GCACCAACTGACGCTGAGGCTCGAAAGTG TGGGTAGCAAACAGGATTAGATACCCTAG TAGTC (SEQ ID No: 10)

    TABLE-US-00015 TABLE 13 Fecal Metabolomics Machine learning with alternative pipeline is predictive of IBS versus Control LASSO Optimisation Random Forest Optimisation Model Performance AUC 0.683 (0.139) 0.909 (0.084) 0.686 (0.132) Sensitivity 0.624 (0.177) 0.903 (0.108) 0.737 (0.181) Specificity 0.608 (0.202) 0.706 (0.188) 0.476 (0.122) 10-fold Cross Validation Predicted IBS Predicted Control IBS 59 21 Control 33 30 Rank Random Forest # Metabolite ID LASSO coefficients feature importance 1 L-Phenylalanine −0.788 88.34 2 Adenosine 0.345 78.31 3 MG(20:3(8Z, 11Z, 14Z)/0:0/0:0) 0.33 64.62 4 L-Alanine −0.752 56.24 5 3,6-Dimethoxy-19-norpregna-1,3,5,7,9-pentaen-20-one 0.292 53.14 6 Glu-Ile-Ile-Phe −0.569 49.57 7 Glu-Ala-Gln-Ser −0.948 48.99 8 2,4,8-Eicosatrienoic acid isobutylamide 0.179 43.67 9 Piperidine −0.161 38.43 10 Staphyloxanthin 0.251 37.03 11 beta-Carotinal 0.368 35.35 12 Hexoses 0.107 35.21 13 Ile-Arg-Ile 0.663 35.06 14 11-Deoxocucurbitacin I −0.141 34.94 15 1-(Malonylamino)cyclopropanecarboxylic acid 0.353 31.96 16 PG(37:2) 0.908 31.75 17 [PR] gamma-Carotene/beta.psi-Carotene 0.122 31.31 18 20-hydroxy-E4-neuroprostane 0.126 29.99 19 Ethylphenyl acetate 0.185 29.86 20 Dodecanedioic acid 0.089 28.24 21 Ile-Lys-Cys-Gly −0.12 27.87 22 Tuberoside 0.873 27.39 23 D-galactal 0.223 26.84 24 3,6-Dihydro-4-(4-methyl-3-pentenyl)-1,2-dithiin 0.146 21.83 25 demethylmenaquinone-6 0.079 20.51 26 L-Arginine 0.071 20.33 27 PC(o-16:1(9Z)/14:1(9Z)) −0.09 19.9 28 Mesobilirubinogen −0.155 19.84 29 Traumatic acid 0.172 19.82 30 alpha-Tocopherol succinate 0.123 18.74 31 3-Methylcrotonylglycine 0.182 18.39 32 (S)-(E)-8-(3,6-Dimethyl-2-heptenyl)-4′,5,7-trihydroxyflavanone 0.072 18.03 33 xi-7-Hydroxyhexadecanedioic acid 0.031 17.96 34 beta-Pinene 0.025 16.94 35 Leu-Ser-Ser-Tyr −0.041 16.69 36 Orotic acid −0.143 16.59 37 Heptane-1-thiol −0.047 15.82 38 Glu-Asp-Asp 0.038 15.43 39 LysoPE(18:2(9Z,12Z)/0:0) 0.02 15.28 40 LysoPE(22:0/0:0) 0.282 15.14 41 Creatine 0.209 15.03 42 Inosine 0.027 13.46 43 SM(d32:2) −0.077 13.19 44 Arg-Leu-Val-Cys 0.043 12.52 45 PS(O-18:0/15:0) −0.229 12.45 46 Pyridoxamine −0.105 11.89 47 N-Heptanoylglycine 0.045 11.53 48 Hematoporphyrin IX −0.161 11.4 49 3beta,5beta-Ketotriol −0.096 10.59 50 2-Phenylpropionate 0.026 10 51 trans-2-Heptenal 0.014 9.63 52 LysoPC(0:0/18:0) 0.028 9.08 53 Linoleoyl ethanolamide −0.025 8.93 54 LysoPE(24:0/0:0) 0.044 8.8 55 2-Methyl-3-hydroxyvaleric acid −0.119 8.58 56 Quasiprotopanaxatriol 0.162 8.56 57 N-oleoyl isoleucine 0.059 8.49 58 (-)-(E)-1-(4-Hydroxyphenyl)-7-phenyl-6-hepten-3-ol 0.028 8.44 59 [FA hydroxy(4:0)] N-(3S-hydroxy-butanoyl)-homoserine lactone 0.024 8.43 60 Riboflavin cyclic-4′,5′-phosphate 0.092 8 61 Arg-Lys-Trp-Val −0.626 7.86 62 PC(20:1(11Z)/P-16:0) 0.033 7.8 63 3,5-Dihydroxybenzoic acid 0.083 7.67 64 Tyrosine −0.012 7.43 65 2,3-Epoxymenaquinone 0.005 7.02 66 His-Met-Val-Val −0.018 6.86 67 PI(41:2) −0.021 6.84 68 Phenol −0.018 6.74 69 3,3′-Dithiobis[2-methylfuran] −0.053 6.73 70 Ala-Leu-Trp-Pro 0 6.7 71 1,2,3-Tris(1-ethoxyethoxy)propane −0.051 6.48 72 Vanilpyruvic acid −0.052 6.43 73 2-Hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate 0.035 6.2 74 Secoeremopetasitolide B 0.023 5.77 75 2-O-Benzoyl-D-glucose 0.033 5.65 76 Ile-Leu-Phe-Trp 0.094 5.49 77 (R)-lipoic acid 0.036 5.18 78 PA(20:4(5Z,8Z,11Z,14Z)e/2:0) 0.013 5.15 79 PE(P-16:0e/0:0) 0.003 5.15 80 Benzyl isobutyrate 0.001 5.04 81 Hexyl 2-furoate −0.099 5.04 82 Trp-Ala-Ser 0.012 4.95 83 LysoPC(15:0) −0.093 4.72 84 4-Hydroxycrotonic acid −0.007 4.72 85 3-Feruloyl-1,5-quinolactone 0.05 4.6 86 Furfuryl octanoate 0.178 4.44 87 PC(22:2(13Z,16Z)/15:0) −0.006 4.26 88 (-)-1-Methylpropyl 1-propenyl disulfide −0.021 4.07 89 PC (36:6) 0.073 4.05 90 Leucyl-Glycine −0.096 3.96 91 CE(16:2) 0.041 3.81 92 Triterpenoid 0 3.79 93 Violaxanthin 0.002 3.79 94 [FA hydroxy(17:0)] heptadecanoic acid −0.059 3.6 95 2-Hydroxyundecanoate 0.077 3.6 96 Chorismate −0.003 3.52 97 delta-Dodecalactone 0.161 3.34 98 3-O-Protocatechuoylceanothic acid 0.058 3.31 99 PG(16:1(9Z)/16:1(9Z)) −0.004 3.17 100 p-Cresol sulfate −0.003 3.15 101 Quercetin 3′-sulfate 0.02 3.03 102 PS(26:0)) −0.02 2.94 103 Ala-Leu-Phe-Trp 0.016 2.93 104 L-Glutamic acid 5-phosphate −0.003 2.87 105 N,2,3-Trimethyl-2-(1-methylethyl)butanamide −0.058 2.86 106 Isoamyl isovalerate −0.06 2.85 107 n-Dodecane −0.029 2.81 108 PC(14:1(9Z)/14:1(9Z)) −0.089 2.8 109 Lucyoside Q 0.007 2.76 110 Endomorphin-1 −0.017 2.51 111 3-Hydroxy-10′-apo-b,y-carotenal 0.013 2.5 112 Pyrroline hydroxycarboxylic acid 0.014 2.39 113 S-Propyl 1-propanesulfinothioate 0.019 2.38 114 N-Methylindolo[3,2-b]-5alpha-cholest-2-ene −0.007 2.31 115 Tocopheronic acid 0.05 2.26 116 1-(2,4,6-Trimethoxyphenyl)-1,3-butanedione 0.018 2.24 117 Homogentisic acid 0.011 2.22 118 LysoPE(18:1(9Z)/0:0) 0.008 2.19 119 N-stearoyl valine 0.009 2.17 120 trans-Carvone oxide 0.07 2.14 121 1,1′-Thiobis-1-propanethiol 0.002 2.14 122 2-(Ethylsulfonylmethyl)phenyl methylcarbamate 0.076 2.05 123 menaquinone-4 0.004 2.04 124 Benzeneacetamide-4-O-sulphate 0.01 2 125 N5-acetyl-N5-hydroxy-L-ornithine 0.001 1.98 126 Succinic acid 0 1.97 127 Asn-Lys-Val-Pro 0.083 1.92 128 LysoPC(14:1(9Z)) 0.003 1.88 129 Phenol glucuronide −0.015 1.71 130 2-methyl-Butanoic acid, 2-methylbutyl ester 0.01 1.67 131 3-O-Caffeoyl-1-O-methylquinic acid 0.004 1.66 132 [FA hydroxy(24:0)] 3-hydroxy-tetracosanoic acid 0.01 1.63 133 N-(2-hydroxyhexadecanoyl)-sphinganine-1-phospho-(1'-myo-inositol) 0.146 1.56 134 gamma-Dodecalactone 0.117 1.54 135 PA(22:1(11Z)/0:0) −0.074 1.49 136 Butyl butyrate 0.025 1.44 137 TG(20:5(5Z,8Z,11Z,14Z,17Z)/18:1(9Z)/22:5(7Z,10Z,13Z,16Z,19Z))[iso6] −0.035 1.38 138 Clausarinol 0.03 1.36 139 4-Methyl-2-pentanone 0.006 1.31 140 Trigonelline 0.02 1.18 141 Arg-Val-Pro-Tyr 0.008 1.17 142 2,3-Methylenesuccinic acid 0.016 1.04 143 Serinyl-Threonine 0.005 1.04 144 Lycoperoside D −0.009 1.03 145 Geraniol 0.012 1 146 1-18:2-lysophosphatidylglycerol 0.098 0.89 147 omega-6-Hexadecalactone, Ambrettolide 0.031 0.83 148 gamma-Glutamyl-S-methylcysteinyl-beta-alanine 0.008 0.79 149 FA oxo(22:0) 0.005 0.53 150 D-Ribose −0.021 0.53 151 LysoPC(17:0) 0.036 0.47 152 PA(O-36:4) 0.02 0.38 153 C19 Sphingosine-1-phosphate −0.018 0.34 154 4-Hydroxy-5-(dihydroxyphenyl)-valeric acid-O-methyl-O-sulphate 0.016 0.29 155 PE(14:1(9Z)/14:0) 0.015 0.28 156 Citronellyl tiglate 0.052 0.27 157 Ethyl methylphenylglycidate (isomer 1) −0.038 0.24 158 N-Acetyl-leu-leu-tyr 0.003 0 158 PS(O-34:3) −0.002 0 LASSO and Random Forest (RF) statistics of metabolites predictive of IBS versus Control; Analysis had 2 classes: Control and IBS and included 143 samples (IBS: n = 80 and Control: n = 63); Metrics reported are the mean and the standard deviation of values from Cross Validation.

    TABLE-US-00016 TABLE 14 Strain level (CAG) Machine learning is predictive of IBS versus Control LASSO Random Forest Model Optimisation Optimisation Performance AUC 0.754 (0.146) 0.897 (0.09)  0.814 (0.134) Sensitivity 0.814 (0.162) 0.95 (0.074) 0.875 (0.102) Specificity 0.525 (0.241) 0.57 (0.205) 0.497 (0.217) 10-fold Cross Validation Predicted IBS Predicted Control IBS 70 10 Control 30 29 LASSO Random Forest Rank # CAG ID coefficients feature importance 1 unclassified_00060 0.001381 60.04 2 unclassified_13382 0.068289 57.19 3 Ambiguous_02465 0.010803 55.91 4 unclassified_10544 0.030574 43.01 5 unclassified_01797 0.020433 42.42 6 unclassified_01214 0.001162 40.69 7 unclassified_04033 0.008943 40.54 8 Ambiguous_00664 0.001472 39.75 9 unclassified_07453 0.027742 39.38 10 unclassified_09604 0.025831 38.55 11 unclassified_04421 0.018453 37.31 12 unclassified_02178 0.014262 33.23 13 unclassified_04275 0.022114 32.93 14 unclassified_00992 0.003028 32.52 15 unclassified_08180 0.03671 32.5 16 unclassified_02378 0.00303 30.66 17 unclassified_14410 0.028182 28.63 18 unclassified_14848 0.00442 28.44 19 Escherichia_coli_08281 0.007697 26.73 20 unclassified_01723 0.002795 25.28 21 unclassified_01973 0.003755 23.46 22 unclassified_07490 0.017293 23.05 23 unclassified_04642 0.010974 22.99 24 unclassified_12490 0.041094 22.65 25 unclassified_04705 0.004598 22.01 26 unclassified_01929 0.013678 21.88 27 unclassified_04761 0.025652 21.43 28 unclassified_13688 0.010278 20.66 29 Clostridium_spp_04742 0.005228 19.73 30 Streptococcus_spp_01624 0.001426 19.23 31 unclassified_12615 0.036959 18.59 32 unclassified_10766 0.05376 17.8 33 unclassified_11165 0.035285 17.52 34 unclassified_00496 0.001305 17.34 35 unclassified_07581 0.007595 15.91 36 unclassified_10074 0.012338 15.41 37 unclassified_01227 0.000621 13.73 38 unclassified_01850 0.004519 13.48 39 unclassified_01534 0.001799 12.87 40 unclassified_00657 0.001686 12.77 41 unclassified_03784 0.012933 12.67 42 Streptococcus_anginosus_14524 0.01304 12.16 43 unclassified_04216 0.003356 12.02 44 Parabacteroides_johnsonii_04505 0.007269 11.48 45 unclassified_02737 0.0006 10.34 46 Streptococcus_gordonii_00694 0.00061 10.11 48 Ambiguous_00350 0.011386 10 49 Ambiguous_01019 0.008179 10 50 unclassified_00612 0.004216 10 51 Clostridium_spp_00680 0.003678 10 52 Ambiguous_00176 0.002303 10 53 Ambiguous_00008 0.000835 10 47 Ambiguous_01504 0.000006 10 54 unclassified_07058 0.001504 9.82 55 Clostridium_spp_11230 0.002081 9.47 56 Ambiguous_01105 0.002674 9.4 57 unclassified_02000 0.003605 9.28 58 unclassified_01034 0.005573 9.27 59 unclassified_06517 0.041237 8.95 60 Clostridium_bolteae_00697 0.001039 8.78 61 Turicibacter_sanguinis_07698 0.041323 8.57 62 unclassified_04716 0.004963 8.29 63 unclassified_06120 0.023365 8.22 64 Clostridiales_bacterium_1_7_47FAA_00444 0.000169 8.15 65 unclassified_00404 0.004334 8.15 66 Ambiguous_06054 0.000061 8.14 67 Clostridium_spp_09935 0.008296 8.09 68 unclassified_03271 0.001025 8 69 Ambiguous_03591 0.007581 7.86 70 unclassified_11816 0.030684 7.6 71 Ambiguous_03760 0.004159 7.52 72 Clostridiales_bacterium_1_7_47FAA_00369 0.000864 7.46 73 unclassified_04974 0.003624 7.35 74 Streptococcus_anginosus_02750 0.000721 6.82 75 unclassified_08690 0.003226 6.72 76 unclassified_06706 0.00206 6.56 77 Paraprevotella_xylaniphila_07441 0.00209 6.41 78 unclassified_04992 0.005196 6.09 79 unclassified_08989 0.011704 6.08 80 unclassified_02911 0.002799 6 81 unclassified_02952 0.006054 5.87 82 unclassified_00342 0.000084 5.49 83 Eubacterium_sp_3_1_31_00679 0.001407 5.12 84 Lachnospiraceae_bacterium_5_1_57FAA_01560 0.000291 5 85 Escherichia_coli_01241 0.000114 4.84 86 unclassified_02624 0.002928 4.72 87 Clostridiaceae_bacterium_JC118_03657 0.005134 4.58 88 unclassified_09127 0.001119 4.5 89 unclassified_05532 0.000001 4.48 90 unclassified_09184 0.005517 4.45 91 Bacteroides_spp_03730 0.000523 4.4 92 Paraprevotella_xylaniphila_08998 0.002821 4.3 93 unclassified_03065 0.001211 4.27 94 Ambiguous_01649 0.000779 4.26 95 Streptococcus_mutans_09018 0.005574 4.26 96 Ambiguous_13545 0.00493 4.22 97 unclassified_08505 0.004519 4.12 98 Escherichia_coli_00201 0.000672 3.9 99 unclassified_03041 0.004803 3.78 100 unclassified_05056 0.007699 3.77 101 unclassified_01365 0.000379 3.38 102 Bacteroides_plebeius_08099 0.009286 3.37 103 Ambiguous_05609 0.008937 3.32 104 unclassified_05684 0.00422 3.25 105 unclassified_02242 0.002019 3.21 106 Clostridium_clostridioforme_06211 0.061218 3.16 107 Klebsiella_pneumoniae_01817 0.012099 2.92 108 Clostridium_hathewayi_06002 0.000291 2.87 109 Ambiguous_03727 0.000144 2.8 110 Bacteroides_fragilis_14807 0.011963 2.71 111 unclassified_01340 0.001622 2.66 112 unclassified_08925 0.000758 2.57 113 unclassified_08324 0.000257 2.48 114 Prevotella_disiens_10832 0.004206 2.48 115 Clostridium_leptum_11975 0.002101 2.35 116 unclassified_01283 0.004063 2.09 117 Pseudoflavonifractor_capillosus_03569 0.000849 2.06 118 unclassified_12165 0.006268 2.02 119 unclassified_07203 0.000139 1.84 120 Bacteroides_intestinalis_14747 0.001208 1.73 121 unclassified_08104 0.000055 1.6 122 unclassified_14839 0.000932 1.54 123 Enterococcus_faecalis_01189 0.00061 1.52 124 Streptococcus_infantis_14065 0.00542 1.24 125 Lachnospiraceae_bacterium_1_4_56FAA_13504 0.000698 1.09 126 Alistipes_shahii_15132 0.000646 1.04 127 Clostridium_spp_10114 0.000481 1.03 128 unclassified_13766 0.000045 0.94 129 Ambiguous_06549 0.00035 0.73 130 unclassified_14263 0.00382 0.7 131 Eubacterium_sp_3_1_31_05331 0.001123 0.55 132 Clostridium_asparagiforme_06161 0.000488 0.4 133 Streptococcus_mutans_07592 0.000826 0.33 134 unclassified_12188 0.003405 0.26 135 Clostridium_symbiosum_14754 0.002328 0.17 136 Streptococcus_sanguinis_11557 0.001 0 LASSO and Random Forest (RF) statistics of CAGs predictive of IBS versus Control Analysis had 2 classes: Control and IBS and included 139 samples (IBS: n = 80 and Control: n = 59) Metrics reported are the mean and the standard deviation of values from Cross Validation. Taxonomy is assigned where greater than 60% of the gene families are associated with a genus level. LASSO coefficients are absolute values for the CAG dataset

    TABLE-US-00017 TABLE 15 Number of samples used in analysis of IBS subtypes 16S Shotgun Fecal Urine Genus Species Metabolomics Metabolomics Number of Samples 138 135 139 138

    TABLE-US-00018 TABLE 16 Permuational MANOVA results for beta diversity analysis 16S Shotgun Fecal Urine Genus Species Metabolomics Metabolomics IBS-1 subgroup vs 0.0006 0.006 0.0012 0.906 IBS-2 subgroup IBS-1 subgroup vs 0.0006 0.006 0.006 0.006 IBS-3 subgroup IBS-2 subgroup vs 0.0006 0.006 0.002 0.774 IBS-3 subgroup IBS-1 subgroup vs 0.0006 0.006 0.001 0.006 Healthy IBS-2 subgroup vs 0.0006 0.006 0.012 1 Healthy IBS-3 subgroup vs 1 1 0.059 0.006 Healthy All values are adjusted p-values using Bonferroni correction

    TABLE-US-00019 TABLE 21a Urine metabolomics machine learning with alternative pipeline is predictive of IBS versus Control: metabolites present at higher levels in controls LASSO Random Forest Model Optimisation Optimisation Performance AUC 1 (0) 0.999 (0.001) 1 (0) Sensitivity 0.992 (0.027) 1 (0) 1 (0) Specificity 0.881 (0.142) 0.976 (0.064) 0.969 (0.066) 10-fold Cross Validation Predicted IBS Predicted Control IBS 80 0 Control 2 61 AUC (Prediction Rank # Metabolite ID of/higher in Controls) 1 Tricetin 3′-methyl ether 7,5′- 0.86 diglucuronide 2 Alloathyriol 0.86 3 Torasemide 0.85 4 (−)-Epigallocatechin sulfate 0.8 5 Tetrahydrodipicolinate 0.78 6 Silicic acid 0.75 7 Delphinidin 3-(6″-O-4-malyl- 0.75 glucosyl)-5-glucoside 8 Creatinine 0.75 9 L-Arginine 0.74 10 Leucyl-Methionine 0.74 11 Gln-Met-Pro-Ser 0.73 12 Ala-Asn-Cys-Gly 0.72 13 Isoleucyl-Proline 0.71 14 3,4-Methylenesebacic acid 0.71 15 (4-Hydroxybenzoyl)choline 0.71 16 Diazoxide 0.7 17 (1S,3R,4S)-3,4-Dihydroxycyclohexane- 0.69 1-carboxylate 18 2-Hydroxypyridine 0.69 19 Ala-Lys-Phe-Cys 0.69 20 3-Methyldioxyindole 0.68 21 N-Carboxyacetyl-D-phenylalanine 0.68 22 Urea 0.67 23 Ferulic acid 4-sulfate 0.67 24 3-Indolehydracrylic acid 0.67 25 Demethyloleuropein 0.67 26 5′-Guanosyl-methylene-triphosphate 0.67 27 Linalyl formate 0.67 28 4-Methoxyphenylethanol sulfate 0.67 29 Allyl nonanoate 0.66 30 D-Galactopyranosyl-(1−>3)-D- 0.66 galactopyranosyl-(1−>3)-L-arabinose 31 Met-Met-Thr-Trp 0.66 32 Cys-Pro-Pro-Tyr 0.66 33 methylphosphonate 0.66 34 2-Phenylethyl octanoate 0.66 35 Hippuric acid 0.65 36 Glutarylcarnitine 0.65 37 Cys-Phe-Phe-Gln 0.65 LASSO and Random Forest (RF) statistics of metabolites predictive of IBS versus Control Analysis had 2 classes: Control and IBS and included 143 samples (IBS: n = 80 and Control: n = 63) Metrics reported are the mean and the standard deviation of values from Cross Validation. Data used was log10 transformed. For all the external cross validation folds, lasso did not return more than 5 features. Therefore, all the trained models are based on random forest with all the features. Metabolites presented are the most predictive as defined by a AUC of greater than 0.65 when tested on the full dataset (applied as a feature selection methodology).

    TABLE-US-00020 TABLE 21b Urine metabolomics machine learning with alternative pipeline is predictive of IBS versus Control: metabolites present at higher levels in IBS LASSO Random Forest Model Optimisation Optimisation Performance AUC 1 (0) 0.999 (0.001) 1 (0) Sensitivity 0.992 (0.027) 1 (0) 1 (0) Specificity 0.881 (0.142) 0.976 (0.064) 0.969 (0.066) 10-fold Cross Validation Predicted IBS Predicted Control IBS 80 0 Control 2 61 AUC (Prediction Rank # Metabolite ID of/higher in IBS) 1 A 80987 1 2 Medicagenic acid 3-O-b-D- 1 glucuronide 3 N-Undecanoylglycine 0.99 4 Ala-Leu-Trp-Gly 0.98 5 Gamma-glutamyl-Cysteine 0.92 6 Butoctamide hydrogen succinate 0.91 7 (−)-Epicatechin sulfate 0.89 8 1,4,5-Trimethyl-naphtalene 0.86 9 Trp-Ala-Pro 0.83 10 Dodecanedioylcarnitine 0.77 11 1,6,7-Trimethylnaphthalene 0.76 12 Sumiki's acid 0.76 13 Phe-Gly-Gly-Ser 0.75 14 2-hydroxy-2-(hydroxymethyl)- 0.73 2H-pyran-3(6H)-one 15 5-((2-iodoacetamido)ethyl)-1- 0.72 aminonapthalene sulfate 16 Thiethylperazine 0.72 17 dCTP 0.71 18 Dimethylallylpyrophosphate/ 0.71 Isopentenyl pyrophosphate 19 Asp-Met-Asp-Pro 0.7 20 3,5-Di-O-galloyl-1,4- 0.7 galactarolactone 21 Decanoylcarnitine 0.69 22 [FA (18:0)] N-(9Z- 0.67 octadecenoyl)-taurine 23 UDP-4-dehydro-6-deoxy-D-glucose 0.66 24 Delphinidin 3-O-3″,6″- 0.66 O-dimalonylglucoside 25 Osmundalin 0.65 26 Cysteinyl-Cysteine 0.65 LASSO and Random Forest (RF) statistics of metabolites predictive of IBS versus Control Analysis had 2 classes: Control and IBS and included 143 samples (IBS: n = 80 and Control: n = 63) Metrics reported are the mean and the standard deviation of values from Cross Validation. Data used was log10 transformed. For all the external cross validation folds, lasso did not return more than 5 features. Therefore, all the trained models are based on random forest with all the features. Metabolites presented are the most predictive as defined by a AUC of greater than 0.65 when tested on the full dataset (applied as a feature selection methodology).