ARTIFICIAL MICRORNA PRECURSOR AND IMPROVED MICRORNA EXPRESSION VECTOR CONTAINING THE SAME
20220127640 · 2022-04-28
Inventors
Cpc classification
C12N2310/533
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2760/18843
CHEMISTRY; METALLURGY
C12N15/1135
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2330/50
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
An isolated RNA molecule includes an artificial microRNA precursor comprising in the 5′.fwdarw.3′ direction: a first terminal oligonucleotide consisting of AGGCCR (SEQ ID NO: 1) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 1 are substituted; a passenger strand oligonucleotide; a first central oligonucleotide consisting of CYG (SEQ ID NO: 2); a second central oligonucleotide consisting of a nucleotide sequence having at least 70% homology with UUGAAUAKAAAU (SEQ ID NO: 3); a third central oligonucleotide consisting of YGG (SEQ ID NO: 4); a guide strand oligonucleotide; and a second terminal oligonucleotide consisting of UGGAYYK (SEQ ID NO: 5) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 5 are substituted.
Claims
1. A method for expressing natural or artificial miRNA, the method comprising: introducing an isolated RNA molecule into a cell, the isolated RNA molecule comprising an artificial microRNA precursor comprising in the 5′.fwdarw.3′ direction: a first terminal oligonucleotide; a passenger strand oligonucleotide; a first central oligonucleotide consisting of CYG (SEQ ID NO: 2), wherein Y is C or U; a second central oligonucleotide consisting of a nucleotide sequence having at least 70% homology with UUGAAUAKAAAU (SEQ ID NO: 3), wherein K is G or U; a third central oligonucleotide consisting of YGG (SEQ ID NO: 4), wherein Y is C or U; a guide strand oligonucleotide comprising the natural or artificial miRNA; and a second terminal oligonucleotide; wherein the guide strand oligonucleotide consists of 17 to 29 nucleotides having complementarity to a target sequence in an mRNA of a target gene; wherein the passenger strand oligonucleotide has a length identical to the length of the guide strand oligonucleotide or has a length one to three nucleotides shorter than the length of the guide strand oligonucleotide; wherein the first terminal oligonucleotide consists of AGGCCR (SEQ ID NO: 1) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 1 are substituted, wherein R is A or G; wherein the second terminal oligonucleotide consists of UGGAYYK (SEQ ID NO: 5) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 5 are substituted, wherein Y is C or U independently on each occurrence and K is G or U; wherein the first terminal oligonucleotide and the second terminal oligonucleotide pair to form a first structural stem region; wherein the passenger strand oligonucleotide and the guide strand oligonucleotide pair to form a double-stranded microRNA region; wherein the first central oligonucleotide and the third central oligonucleotide pair to form a second structural stem region; wherein the first structural stem region, the double-stranded microRNA region, and the second structural stem region together form a stem structure; and wherein the second central oligonucleotide forms a loop structure.
2. The method according to claim 1, wherein the double-stranded microRNA region comprises a mismatch or a bulge.
3. The method according to claim 1, wherein the isolated RNA molecule further comprises a spacer oligonucleotide consisting of 1 to 10 nucleotides between the first central oligonucleotide and the second central oligonucleotide or between the second central oligonucleotide and the third central oligonucleotide.
4. The method according to claim 1, wherein the isolated RNA molecule is introduced into a cell by an expression vector comprising the isolated RNA molecule or an RNA molecule consisting of a complementary sequence thereto, or a DNA molecule coding therefor.
5. The method according to claim 4, wherein the expression vector is an RNA virus vector.
6. The method according to claim 5, wherein the expression vector is a cytoplasmic RNA virus vector.
7. The method according to claim 6, wherein the expression vector is a Sendai virus vector.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
DESCRIPTION OF EMBODIMENTS
[0043] Hereinafter, the present invention will be described in detail; however, the present invention is not limited to embodiments described herein.
[0044] According to the first embodiment, the present invention is an isolated RNA molecule comprising an artificial microRNA precursor comprising in the 5′ 3′ direction: a first terminal oligonucleotide; a passenger strand oligonucleotide; a first central oligonucleotide consisting of CYG (SEQ ID NO: 2), wherein Y is C or U; a second central oligonucleotide consisting of a nucleotide sequence having at least 70% homology with UUGAAUAKAAAU (SEQ ID NO: 3), wherein K is G or U; a third central oligonucleotide consisting of YGG (SEQ ID NO: 4), wherein Y is C or U; a guide strand oligonucleotide; and a second terminal oligonucleotide; wherein the guide strand oligonucleotide consists of 17 to 29 nucleotides having complementarity to a target sequence in an mRNA of a target gene; wherein the passenger strand oligonucleotide has a length identical to the length of the guide strand oligonucleotide or has a length one to three nucleotides shorter than the length of the guide strand oligonucleotide; wherein the first terminal oligonucleotide consists of AGGCCR (SEQ ID NO: 1) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 1 are substituted, wherein R is A or G; wherein the second terminal oligonucleotide consists of UGGAYYK (SEQ ID NO: 5) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 5 are substituted, wherein Y is C or U independently on each occurrence and K is G or U; wherein the first terminal oligonucleotide and the second terminal oligonucleotide pair to form a first structural stem region; wherein the passenger strand oligonucleotide and the guide strand oligonucleotide pair to form a double-stranded microRNA region; wherein the first central oligonucleotide and the third central oligonucleotide pair to form a second structural stem region; wherein the first structural stem region, the double-stranded microRNA region, and the second structural stem region together form a stem structure; and wherein the second central oligonucleotide forms a loop structure.
[0045] In the present embodiment, “isolated” means that the RNA molecule according to the present embodiment is in a state purified so as to contain substantially no other nucleic acids; specifically, so that the RNA molecule according to the present embodiment has a purity of at least 90%, preferably at least 95%, and particularly preferably 99% or higher.
[0046] In the present embodiment, “artificial microRNA precursor” refers to an unnatural RNA molecule that mimics the structure of a known or wild-type microRNA (hereinafter, also referred to as “miRNA”) precursor and expresses natural or artificial miRNA or siRNA. The scope of the artificial miRNA precursor according to the present embodiment can include both pri-miRNA and pre-miRNA.
[0047] The artificial miRNA precursor according to the present embodiment includes, as a first component, a first structural stem region formed by pairing of a first terminal oligonucleotide and a second terminal oligonucleotide. Here, “pair(ing)” means formation of base pairs between two oligonucleotides, and these base pairs may include not only G:C and A:U but also wobble base pairs (G:U). In the present embodiments, the first structural stem region in the artificial miRNA precursor is based on the structures of mouse and human miR-367 precursors, and may be completely identical or substantially the same as the corresponding part of the structure of a mouse or human miR-367 precursor. “Substantially the same” means that nucleotide substitutions are included to a degree that does not affect the entire structure of the stem region (e.g., about one to three nucleotide substitutions).
[0048] Specifically, the first terminal oligonucleotide consists of AGGCCR (SEQ ID NO: 1) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 1 are substituted, and the second terminal oligonucleotide consists of UGGAYYK (SEQ ID NO: 5) or a nucleotide sequence in which one to three nucleotides in SEQ ID NO: 5 are substituted. Here, R is A or G in the nucleotides of SEQ ID NO: 1, and Y is C or U independently on each occurrence and K is G or U in the nucleotides of SEQ ID NO: 5. Positions and types of nucleotide substitutions are not particularly limited as long as the entire structure of the first structural stem region is retained. Preferably, the first terminal oligonucleotide may consist of AGGCCG (SEQ ID NO: 6) or AGGCCA (SEQ ID NO: 7), and the second terminal oligonucleotide may consist of UGGACCU (SEQ ID NO: 8) or UGGAUUG (SEQ ID NO: 9).
[0049] The artificial miRNA precursor according to the present embodiment includes, as a second component, a double-stranded microRNA region formed by pairing of a passenger strand oligonucleotide and the guide strand oligonucleotide. In double-stranded miRNA, “guide strand” refers to a strand that becomes mature miRNA (i.e., an antisense strand in siRNA), and “passenger strand” refers to a strand that is to be removed from double-stranded miRNA and decomposed (i.e., a sense strand in siRNA).
[0050] In the present embodiment, the guide strand oligonucleotide consists of 17 to 29 nucleotides, preferably 19 to 25 nucleotides, particularly preferably 21 to 23 nucleotides, and most preferably 22 nucleotides, having complementarity to a target sequence in an mRNA of a target gene. A target sequence in an mRNA of a target gene can be appropriately selected so that expression of the target gene can be specifically suppressed with an already established designing method for artificial miRNA/siRNA in the art.
[0051] To completely suppress expression of a target gene, it is preferable that the guide strand oligonucleotide according to the present embodiment consist of a sequence having perfect or complete (i.e., 100%) complementarity to the target sequence; to suppress expression of a target gene to a low to medium degree, it may be sufficient to use a sequence having complementarity to a degree that allows specific recognition of an mRNA of the target gene. Hence, it may be sufficient for the guide strand oligonucleotide according to the present embodiment to have at least 60%, 70%, 80%, 85%, 90%, 95%, 99%, or 100% sequence complementarity to a target sequence in an mRNA of a target gene. In other words, the guide strand oligonucleotide according to the present embodiment may have, for example, a sequence such that 10 or fewer, eight or fewer, six or fewer, five or fewer, four or fewer, three or fewer, two, or one nucleotide substituted in a sequence completely complementary to a target sequence in an mRNA of a target gene. Sequence complementarity can be calculated by using any calculation algorithm conventionally used in the art (e.g., NCBI BLAST).
[0052] In the present embodiment, the passenger strand oligonucleotide has a length identical to the length of the guide strand oligonucleotide or has a length one to three nucleotides shorter than the length of the guide strand oligonucleotide. Thus, it follows that if the guide strand oligonucleotide consists of 22 nucleotides, the passenger strand oligonucleotide consists of 19 to 22 nucleotides. In the present embodiment, it is preferable that the passenger strand oligonucleotide have 100% complementarity to the guide strand oligonucleotide; however, the passenger strand oligonucleotide may include, for example, one, two, three, four, or five mismatches or bulges, as long as the passenger strand oligonucleotide and the guide strand oligonucleotide can pair to form a double strand. The position of a mismatch or bulge may be arbitrary, and can be preferably a position corresponding to a mismatch or bulge in mouse and human miR-367 precursors, and specifically the 2-position, the 8-position, and/or the 9-position from the 5′ end of the guide strand oligonucleotide are/is preferred.
[0053] The artificial miRNA precursor according to the present embodiment includes, as a third component, a second structural stem region formed by pairing of a first central oligonucleotide consisting of CYG (SEQ ID NO: 2) and a third central oligonucleotide consisting of YGG (SEQ ID NO: 4). Here, Y is C or U independently in each occurrence in the nucleotides of SEQ ID NOs: 2 and 4. In the present embodiment, the second structural stem region in the artificial miRNA precursor is based on the structures of mouse and human miR-367 precursors, and it may be completely identical or substantially the same as the corresponding part of the structure of a mouse or human miR-367 precursor. Preferably, the first central oligonucleotide may consist of CUG (SEQ ID NO: 10), and the third central oligonucleotide may consist of UGG (SEQ ID NO: 11).
[0054] In the artificial miRNA precursor according to the present embodiment, the first structural stem region, the double-stranded miRNA region, and the second structural stem region together form a stem structure. Here, the stem structure may consist only of the first structural stem region, the double-stranded miRNA region, and the second structural stem region, or may include nucleotide insertions between the first structural stem region and the double-stranded miRNA region and/or between the double-stranded miRNA region and the second structural stem region to a degree that does not affect the entire stem structure. Specifically, a few (e.g., one, two, or three) nucleotide insertions may exist between the first terminal oligonucleotide and the passenger strand oligonucleotide, between the passenger strand oligonucleotide and the first central oligonucleotide, between the third central oligonucleotide and the guide strand oligonucleotide, and/or between the guide strand oligonucleotide and the second terminal oligonucleotide. In the present embodiment, it is preferable that the stem structure of the artificial miRNA precursor be composed only of the first structural stem region, the double-stranded miRNA region, and the second structural stem region directly linked together.
[0055] The artificial miRNA precursor according to the present embodiment includes, as a fourth component, a second central oligonucleotide consisting of a nucleotide sequence having at least 70% homology with UUGAAUAKAAAU (SEQ ID NO: 3). Here, K is G or U in the nucleotides of SEQ ID NO: 3. The second central oligonucleotide according to the present embodiment is based on the structures of mouse and human miR-367 precursors, and may be in any mode that allows formation of a loop structure similar to those of mouse and human miR-367 precursors. Thus, the second central oligonucleotide according to the present embodiment may consist of a nucleotide sequence having at least 70% or 80% homology with a nucleotide sequence consisting of UUGAAUAKAAAU (SEQ ID NO: 3), and may consist of a nucleotide sequence preferably having at least 90% or higher homology, particularly preferably having 100% homology, with SEQ ID NO: 3. In other words, the second central oligonucleotide according to the present embodiment may have a nucleotide sequence such that, for example, four or fewer, three or fewer, two, or one nucleotide is substituted, deleted, or inserted in a nucleotide sequence consisting of UUGAAUAKAAAU (SEQ ID NO: 3). Preferably, the second central oligonucleotide may consist of UUGAAUAGAAAU (SEQ ID NO: 12) or UUGAAUAUAAAU (SEQ ID NO: 13).
[0056] In the present embodiment, it is preferable that the first central oligonucleotide, the second central oligonucleotide, and the third central oligonucleotide be directly linked together; however, a spacer oligonucleotide consisting of 1 to 10 nucleotides, one to five nucleotides, or one to three nucleotides may be included between the first central oligonucleotide and the second central oligonucleotide, or between the second central oligonucleotide and the third central oligonucleotide. The spacer oligonucleotide may have any sequence, but it is preferable for the spacer oligonucleotide to have a sequence that does not form base pairs with the nucleotide sequence consisting of UUGAAUAKAAAU (SEQ ID NO: 3).
[0057] The isolated RNA molecule according to the present embodiment may be prepared with optional addition of a flanking sequence to the 5′ end and/or 3′ end of an artificial miRNA precursor designed according to the above description. Such a flanking sequence can be appropriately determined according to an expression vector into which the isolated RNA molecule is incorporated. The flanking sequence may include a sequence corresponding to the flanking sequence of a natural miR-367 precursor, and the length may be, for example, 1 to 100 nucleotides, 1 to 50 nucleotides, or 1 to 40 nucleotides, and may be preferably 15 to 25 nucleotides.
[0058] The isolated RNA molecule according to the present embodiment can be chemically synthesized or biosynthesized through a gene engineering procedure by using a method known in the art. For example, the isolated RNA molecule according to the present embodiment can be produced through preparation of template DNA followed by transcription thereof with RNA polymerase. The isolated RNA molecule according to the present embodiment may be composed totally of RNA or contain in part modified RNA. Examples of modified RNA include phosphorothioated RNA, boranophosphated RNA, 2′-O-methylated RNA, 2′-F RNA, and 2′,4′-BNA (also known as: LNA (Locked Nucleic Acid)).
[0059] Artificial miRNA/siRNA can be expressed by introducing the isolated RNA molecule according to the present embodiment or a DNA molecule encoding thereof into cells. Introduction of the RNA molecule or the DNA molecule into cells can be performed by using a well-known method in the art according to the type of cell, for example, by lipofection, microinjection, or electroporation.
[0060] Alternatively, artificial miRNA/siRNA can be expressed with a high efficiency by incorporating the isolated RNA molecule according to the present embodiment into various expression vectors, including cytoplasmic RNA virus vectors, and then introducing the result into a cell.
[0061] Hence, according to the second embodiment, the present invention is an expression vector comprising the above isolated RNA molecule, an RNA molecule consisting of a complementary sequence thereto, or a DNA molecule encoding the isolated RNA molecule or the RNA molecule.
[0062] The expression vector applicable in the present embodiment is not limited to particular types, and both virus vectors and nonviral vectors can be used. Examples of virus vectors include, but are not limited to, DNA virus vectors such as adenovirus vectors, adeno-associated virus vectors, and herpesvirus vectors, and RNA virus vectors such as retrovirus vectors, lentivirus vectors, bornavirus vectors, and paramyxovirus vectors. Examples of nonviral vectors include plasmid vectors such as pOL1 (produced in Examples below), pCI Mammalian Expression Vector (Promega Corporation), and pBApo-CMV DNA (Takara Bio Inc.), and episomal vectors such as pEBMulti-Hyg (FUJIFILM Corporation).
[0063] The expression vector according to the present embodiment is preferably an RNA virus vector, and more preferably a cytoplasmic RNA virus vector. The cytoplasmic RNA virus vector may be selected from, for example, paramyxovirus vectors such as Sendai virus vectors, alphavirus vectors such as Sindbis virus vectors, flavivirus vectors such as tick-borne encephalitis virus vectors, and vesiculovirus vectors such as vesicular stomatitis virus vectors. The expression vector according to the present embodiment can be particularly preferably a Sendai virus vector.
[0064] The expression vector according to the present embodiment can be prepared by operably linking the above isolated RNA molecule or an RNA molecule consisting of a complementary sequence thereto, or a DNA molecule encoding the isolated RNA molecule or the RNA molecule to the downstream of a promoter in an expression vector. One or more isolated RNA molecules, or DNA molecules coding therefor as defined above, may be introduced into a single expression vector. In the case in which the expression vector is a Sendai virus vector, for example, it is suitable to insert the above isolated RNA molecule between a gene-start signal and a gene-end signal, and 1 to 10, 1 to 5, 1 to 3, 2, or 1 isolated RNA molecule(s) as defined above inserted between a gene-start signal and a gene-end signal can be introduced into a single Sendai virus vector.
[0065] Introduction of the expression vector according to the present embodiment into cells can be performed by using a well-known method in the art according to the type of cells and expression vectors. For nonviral vectors, for example, introduction can be performed with lipofection, electroporation, or microinjection. For virus vectors, introduction can be performed by infecting cells with an appropriate titer or multiplicity of infection (MOI).
[0066] The isolated RNA molecule according to the first embodiment and the expression vector according to the second embodiment can express artificial miRNA/siRNA with a significantly higher efficiency than conventional artificial miRNA/siRNA expression systems, thus being useful.
EXAMPLES
[0067] The present invention will be further described with reference to Examples shown below. These by no means limit the present invention.
1. Expression of Various miRNAs from Sendai Virus Vector
(1-1) Production of miRNA Expression Vector
[0068] Various natural miRNA precursors were introduced into Sendai virus (SeV) vectors, and expression levels of miRNAs and gene knockdown effects were evaluated. The SeV vector used was a SeVdp vector (J. Biol. Chem., (2011), Vol. 286, No. 6, pp. 4760-4771). To the downstream of the P/C/V in the SeVdp vector, a selection marker blasticidin resistance gene (blasticidin S deaminase gene; prepared by PCR using a pCX4bsr plasmid (Proc. Natl. Acad. Sci. USA, (2003), Vol. 100, No. 23, pp. 13567-13572) as a template) and an expression marker EGFP gene (prepared by PCR using a pEGFP-1 plasmid (Takara Bio Inc.) as a template) were introduced, and an miR-124 gene or an miR-302-367 cluster was further introduced downstream thereto to prepare a miR-124 expression vector (SeV-124) and a miR-302-367 expression vector (SeV-302-367). The miR-124 gene and miR-302-367 cluster had been prepared by PCR using, as a template, a genomic DNA extracted from C57BL/6J mouse embryonic fibroblasts (MEF). A vector containing no miRNA gene (SeV-Ctrl) was prepared as a negative control.
[0069] In addition, a retrovirus vector into which the miR-302-367 cluster had been introduced (Retro-302-367) was prepared in the following procedure. The miR-302-367 cluster cloned from MEF was introduced into the BamHI and NotI sites of a pCX4pur plasmid (Proc. Natl. Acad. Sci. USA, (2003), Vol. 100, No. 23, pp. 13567-13572). HEK293T cells were transfected with the plasmid vector obtained together with pVPack-GP (Agilent Technologies) and pVPack-Ampho (Agilent Technologies) by using FuGENE HD (Promega Corporation). On day 3, the culture supernatant was collected and filtered through a 0.45-μm filter to prepare a miR-302-367 expression retrovirus vector.
(1-2) Quantification of Expression Levels of miRNA
[0070] HCT116 cells were infected with the SeV vector at MOI=5, cultured from the next day with supplementing the medium with 10 μg/ml blasticidin S, and cells stably retaining the SeV vector genome were selected. For the retrovirus vector, HCT116 cells were infected with 1×10.sup.9 copies of the vector in the presence of 4 μg/ml polybrene, cultured with supplementing the medium with 0.2 μg/ml puromycin on day 3, and cells stably expressing the miRNA introduced were selected. From the cells, total RNA was extracted by using the ISOGEN reagent (NIPPON GENE CO., LTD.), and RT-qPCR was carried out for each miRNA by using TaqMan MicroRNA Assays (Applied Biosystems). A TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) was used for the RT reaction, and TaqMan Universal PCR Master Mix II, no UNG (Applied Biosystems), was used for qPCR. The expression level of each miRNA was evaluated by using a ΔΔCt method in which the Cq (quantification cycle) value for each miRNA was normalized with the Cq value for RNU48 (endogenous control gene). The TaqMan MicroRNA Assays used for RT-qPCR are shown in the following.
TABLE-US-00001 TABLE 1 TaqMan MicroRNA Assays for RT-qPCR Name of miRNA Assay ID miR-124 001182 miR-302a 000529 miR-302b 000531 miR-302c 002558 miR-302d 000535 miR-367 000555 RNU48 001006
(1-3) Evaluation of Gene Knockdown Effect of miRNA
[0071] To evaluate the gene knockdown effect of each miRNA, a reporter vector was prepared by introducing a target sequence having complete complementarity to a miRNA into the 3′ untranslated region of the RLuc gene in the psiCHECK-2 vector (Promega Corporation) comprising a firefly luciferase (FLuc) gene and a Renilla luciferase (RLuc) gene. FLuc and RLuc are expressed from this reporter vector, and when gene knockdown is caused by a miRNA, only the expression of RLuc decreases. Therefore, the activity of RLuc corrected for the transfection efficiency of the reporter vector can be measured by calculating the relative values of RLuc/FLuc.
[0072] Cells prepared in (1-2) were transfected with the above reporter vector by using the Lipofectamine 2000 reagent (Thermo Fisher Scientific). About 22 to 25 hours thereafter, the activities of FLuc and RLuc were measured by using a Dual-Luciferase Reporter Assay System (Promega Corporation), and relative values of the RLuc activity (hereinafter, expressed as “RLuc/FLuc value”) were calculated. As a control, a vector incorporating a scramble sequence which is not targeted by a miRNA, in place of a target sequence for a miRNA, was prepared, and cells were transfected therewith to prepare negative control cells, for which luciferase activities were evaluated in the same manner. Scramble sequences were designed by using siRNA Wizard v3.1 Software (InvivoGen). The gene knockdown effect of each miRNA was evaluated based on the activity of a reporter luciferase RLuc by calculating the relative value of RLuc/FLuc in reporter vector-transfected cells when the RLuc/FLuc value in negative control cells was set to 1.0. The target sequences for miRNAs and the corresponding scramble sequences are shown in the following.
TABLE-US-00002 TABLE 2 Target sequences for miRNAs and corresponding scramble sequences Name of target SEQ sequence Nucleotide sequence ID NO 124-T GGCATTCACCGCGTGCCTTA 14 302a-T TCACCAAAACATGGAAGCACTTA 15 367-T TCACCATTGCTAAAGTGCAATT 16 Name of scramble SEQ sequence Nucleotide sequence ID NO 124-scrambleT GCGAGGTTCCCCTGTCTACA 17 302a-scrambleT GCAGTACACCACGTAAATCAAAT 18 367-scrambleT GCATTCATAATTCTCGGAACTA 19
[0073] The results are shown in
[0074] Expression levels of miR-302a, miR-302b, miR-302c, miR-302d, and miR-367 in human iPS cells (PLOS ONE, (2016), Vol. 11, No. 10, e0164720) were quantified in the same procedure as in (1-2), and compared with those in HCT116 cells into which SeV-302-367 had been introduced. The results are shown in
[0075] Furthermore, the expression levels of miR-302a, miR-302b, miR-302c, miR-302d, and miR-367 in the Retro-302-367-introduced HCT116 cells and those in the SeV-302-367-introduced HCT116 cells were compared. The results are shown in
[0076] These results suggested the possibility that the expression efficiency of miR-367 from the SeV vector was particularly high.
2. Gene Knockdown Effect of miR-367 Expressed from SeV-367
[0077] A SeV expression vector into which only an miR-367 precursor (
[0078] The results are shown in
[0079] 3. Expression of miR-124 from artificial miR-124 precursor based on miR-367 precursor Artificial miR-124 precursors (1) and (2) were designed as artificial miRNA precursors based on the secondary structure of the miR-367 precursor: artificial miR-124 precursor (1) was obtained by replacing the miR-367 sequence with an miR-124 sequence while the secondary structure of the miR-367 precursor was completely retained, and artificial miR-124 precursor (2) was obtained by further modifying artificial miR-124 precursor (1) not to include any mismatch/bulge in the double-stranded miR region while the structure of the miR-367 precursor was retained. The nucleotide sequences of artificial miR-124 precursors (1) and (2) are shown in Table 3, and the secondary structures are shown in
TABLE-US-00003 TABLE 3 Nucleotide sequences of artificial miR-124 precursors Name of SEQ artificial ID miR Nucleotide sequence NO Artificial AGGCCGUUGGCAUUCACCGUAUGCCUCACU 20 miR-124 GUUGAAUAGAAAUUGGUAAGGCACGCGGUG precursor (1) AAUGCCAAUGGACCU Artificial AGGCCGUUGGCAUUCACCGCGUGCCUUACU 21 miR-124 GUUGAAUAGAAAUUGGUAAGGCACGCGGUG precursor (2) AAUGCCAAUGGACCU
[0080] A SeV expression vector into which artificial miR-124 precursor (1) or artificial miR-124 precursor (2) had been incorporated was prepared using the same procedure as in (1-1), the expression vector was introduced into HCT116 cells in the same procedure as in (1-2), and the gene knockdown effects were evaluated in the same procedure as in (1-3).
[0081]
4. Target Gene Knockdown Effect of Artificial miRNA Expressed by Artificial miRNA Precursor Based on Pre-miR-367 (1)
[0082] Artificial miRNA precursors targeting the FLuc gene were produced based on the structures of various natural miRNA precursors in a procedure shown below, and the gene knockdown effects of FLuc-targeting artificial miRNAs expressed thereby were compared.
(4-1) Expression of Artificial miRNA from SeV Vector
[0083] FLuc-targeting artificial miRNA precursors mimicking their secondary structures were designed based on the structures of a miRNA precursor described in Non-Patent Document 1 (pre-miR-30), a miRNA precursor described in Non-Patent Document 2 (pre-miR-155), and mouse-derived natural miRNA precursors (pre-miR-367, pre-miR-124, and pre-miR-302a). A sequence completely complementary to a target sequence in an mRNA for FLuc, described by Elbashir et al. (Nature, (2001), Vol. 411, No. 6836, pp. 494-498), was used for the sequence of each artificial miRNA. The nucleotide sequences of the FLuc-targeting artificial miRNA precursors are shown in Table 4, and the secondary structures are shown in
TABLE-US-00004 TABLE 4 Nucleotide sequences of precursors Name of artificial miR Nucleotide sequence SEQ ID NO FLuc-targeting artificial miRNA AGGCCGUCACUUACGCUGAUCACUUCUACU 22 precursor (pie-mi R-367 structure) GUUGAAUAGAAAUUGGUCGAAGUACUCAGC GUAAGUGAUGGACCU FLuc-targeting artificial miRNA AUCAAGAUCAGAGACUCUGCUCUACCUUAC 23 precursor (pre-miR-124 structure) GCUAAGUCAUUCGGAUUUAAUGUCAUACAA UUCGAAGUACUCAGCGUAAGUGAGAGCGGA GCCUACGGCUGCACUUGAA FLuc-targeting artificial miRNA GCGCCACUUACGCUGAGUACUUCGAUAGUG 24 precursor (pre-mi R-30 structure) AAGCCACAGAUGUAUCGAAGUACUCAGCGU AAGUGAUGC FLuc-targeting artificial miRNA CUGUCGAAGUACUCAGCGUAAGUGAUUUUG 25 precursor (pre-miR-155 structure) GCCUCUGACUGAUCACUUUCCGAGUACUUU GACAG FLuc-targeting artificial miRNA CCACUCACCUACGCUGAUCACUUUGGCUUU precursor (pre-miR-302a structure) AGACCUAAGAAAGUCGAAGUACUCAGCGUA 26 AGUGAUUGG
[0084] SeV expression vectors, each incorporating any of the artificial miRNA precursors, were prepared using the same procedure as in (1-1), each expression vector was introduced into HCT116 cells using the same procedure as in (1-2), and selection was then carried out with blasticidin S. Furthermore, a pGL3-Control vector (Promega Corporation) comprising a sequence encoding FLuc, and a pRL-TK vector (Promega Corporation) comprising a sequence encoding RLuc were introduced into the cells by using the Lipofectamine 2000 reagent, and activities of FLuc and RLuc were measured about 24 hours thereafter, and relative values of FLuc activity (hereinafter, expressed as “FLuc/RLuc value”) were calculated. The gene knockdown effect of each artificial miRNA was evaluated by calculating the relative value of FLuc/RLuc in the cells introduced with the SeV expression vector incorporating each artificial miRNA when the FLuc/RLuc value was set to 1.0 in cells prepared in the same manner, except that SeV-Ctrl was used in place of a SeV expression vector incorporating the artificial miRNA precursor.
[0085] The results are shown in
(4-2) Expression of Artificial miRNA by Plasmid Vector
[0086] With use of a pOL1 plasmid in place of a SeV vector, plasmid vectors, each incorporating any of the artificial miRNA precursors shown in
[0087] The results are shown in
5. Target Gene Knockdown Effect of Artificial miRNA Expressed by Artificial miRNA Precursor Based on Pre-miR-367 (2)
[0088] On the basis of the structure of pre-miR-367, an artificial miRNA precursor mimicking the secondary structure thereof and targeting EGFP was produced, and the gene knockdown effect of the EGFP-targeting artificial miRNA expressed from a SeV vector incorporating the artificial miRNA precursor was evaluated. A sequence completely complementary to a target sequence in an mRNA for EGFP (NCBI: Pr008808666) was used for the sequence of the artificial miRNA. The nucleotide sequence of the EGFP-targeting artificial miRNA precursor is shown in Table 5, and the secondary structure is shown in
TABLE-US-00005 TABLE 5 Nucleotide sequence of precursor Name of artificial miR Nucleotide sequence SEQ ID NO EGFP-targeting artificial miRNA AGGCCGAGCGCACCAUCUUACUCAAGUACU 27 precursor (pre-miR-367 structure) GUUGAAUAGAAAUUGGUCCUUGAAGAAGAU GGUGCGCUUGGACCU
[0089] A SeV vector incorporating the EGFP-targeting artificial miRNA precursor, a hygromycin resistance gene (hygromycin B phosphotransferase gene, obtained by artificial gene synthesis (GenScript Biotech)), as a selection marker, and a Keima-Red gene (prepared by PCR using a phdKeima-Red-S1 plasmid (Medical & Biological Laboratories Co., Ltd.) as a template), as an expression marker, was prepared using the same procedure as in (1-1). The expression vector was introduced into HCT116 cells using the same procedure as in (1-2), the medium was supplemented with 100 μg/ml hygromycin B from the next day, and cells stably retaining the SeV vector genome were selected. Into the cells obtained, a pEGFP-N1 plasmid (Clontech Laboratories, Inc.) and an E2-Crimson expression plasmid were introduced by using the Lipofectamine 2000 reagent. The next day, fluorescence intensities of EGFP and E2-Crimson were measured by flow cytometry. In addition, measurement of fluorescence intensities was performed in the same manner, except that a SeV expression vector incorporating an FLuc-targeting artificial miRNA precursor was used in place of a SeV expression vector incorporating the EGFP-targeting artificial miRNA precursor (negative control). The gene knockdown effect of EGFP-targeting artificial miRNAs was evaluated by calculating the relative value of the fluorescence intensity of EGFP in E2-Crimson positive cells in the negative control as 1.0. The E2-Crimson expression plasmid had been produced by incorporating an E2-Crimson gene (E2-Crimson gene, prepared by PCR using pE2-Crimson (Clontech Laboratories, Inc.) as a template) downstream of a CMV promoter of pOL1.
[0090] The results are shown in
6. Target Gene Knockdown Effect of Artificial miRNA Expressed by Artificial miRNA Precursor Based on Pre-miR-367 (3)
[0091] On the basis of the structure of pre-miR-367, an artificial miRNA precursor mimicking the secondary structure thereof and targeting mouse p53 was produced, and the gene knockdown effect of the mouse p53-targeting artificial miRNA expressed from a SeV vector incorporating the artificial miRNA precursor was evaluated. A sequence completely complementary to a target sequence in an mRNA for mouse p53, the sequence described by Dirac and Bernards (J. Biol. Chem., (2003), Vol. 278, No. 14, pp. 11731-11734), was used for the sequence of the artificial miRNA. The nucleotide sequence of the mouse p53-targeting artificial miRNA precursor is shown in Table 6, and the secondary structure is shown in
TABLE-US-00006 TABLE 6 Nucleotide sequence of precursor Name of artificial miR Nucleotide sequence SEQ ID NO p53-targeting artificial miRNA AGGCCGCAAGUACAUGUGUCCUAGCUACCC 28 precursor (pre-miR-367 structure) (1) GUUGAAUAGAAAUUGGGGAGCUAUUACACA UGUACUUGUGGACCU
[0092] A SeV-p53-targeting artificial miRNA, being a SeV vector incorporating mouse p53-targeting miRNA precursor (1), a hygromycin resistance gene, and a Keima-Red gene, was prepared using the same procedure as in (1-1). The expression vector was introduced into HCT116 cells using the same procedure as in (1-2), the medium was supplemented with 100 μg/ml hygromycin B from the next day, and cells stably retaining the SeV vector genome were selected. Into the cells obtained, a reporter plasmid obtained by incorporating the mouse p53 target sequence into the 3′ untranslated region of the RLuc gene was introduced using the same procedure as in (1-3), and the gene knockdown effect was evaluated. The mouse p53 target sequence and the corresponding scramble sequence are shown in the following.
TABLE-US-00007 TABLE 7 p53 Target sequence and corresponding scramble sequence Name of target SEQ sequence Nucleotide sequence ID NO p53-T CAAGTACATGTGTAATAGCTCC 29 Name of scramble SEQ sequence Nucleotide sequence ID NO p53-scrambleT GCCTAATATACGATGGCTATCA 30
[0093] The results are shown in
[0094] Furthermore, artificial miRNA precursors targeting different sites in the mouse p53 mRNA were produced. The nucleotide sequences of mouse p53-targeting artificial miRNA precursors (2) and (3) are shown in Table 8.
TABLE-US-00008 TABLE 8 Nucleotide sequences of precursors Name of artificial miR Nucleotide sequence SEQ ID NO p53-targeting artificial miRNA AGGCCGUGGGACAGCCAAGGAUGUUACGCU 31 precursor (pre-miR-367 structure) (2) GUUGAAUAGAAAUUGGCAUAACAGACUUGG CUGUCCCAUGGACCU p53-targeting artificial miRNA AGGCCGCGGGUGGAAGGAACCUUGUAACCU 32 precursor (pre-miR-367 structure) (3) GUUGAAUAGAAAUUGGGAUACAAAUUUCCU UCCACCCGUGGACCU
[0095] SeV-p53-targeting artificial miRNA (1), SeV-p53-targeting artificial miRNA (2), and SeV-p53-targeting artificial miRNA (3), each being a SeV vector incorporating a mouse p53-targeting artificial miRNA precursor, a blasticidin resistance gene, and EGFP, were prepared using the same procedure as in (1-1). Each expression vector was introduced into HCT116 cells using the same procedure as in (1-2), the medium was supplemented with 10 μg/ml blasticidin from the next day, and cells stably retaining the SeV vector genome were selected. Into the cells obtained, a reporter plasmid obtained by incorporating the full-length open reading frame of mouse p53 into the 3′ untranslated region of the RLuc gene was introduced using the same procedure as in (1-3), and the gene knockdown effects were evaluated.
[0096] The results are shown in
7. Production of iPS Cells Using SeV-p53-Targeting Artificial miRNA Precursor
[0097] To produce iPS cells, c-MYC is typically introduced in addition to three reprogramming factors: KLF4, OCT4, and SOX2. However, c-MYC is an oncogene, and therefore, a problem arises of risk of promoting tumor formation. With regard to this, it has been reported that use of shRNA targeting p53 enables promotion of iPS cell induction (Nature, (2009), Vol. 460, No. 7259, pp. 1140-1144), and thus, whether iPS cells can be produced by expressing p53-targeting artificial miRNA from a SeV vector, instead of the c-MYC gene, was tested. A SeV vector incorporating a mouse p53-targeting artificial miRNA precursor, a KLF4 gene, an OCT4 gene, and a SOX2 gene was prepared in the same procedure as in (1-1). The KLF4 gene, OCT4 gene, and SOX2 gene had been obtained by artificial gene synthesis (GenScript Biotech). The genomic configurations of the SeV-(KOS) vector and SeV-(mip53/KOS) vector are shown in
[0098] SeV-(KOS) and SeV-(mip53/KOS) were introduced into MEF at MOI=5. The next day, cells into which a vector had been introduced (1×10.sup.4 cells) were placed on MEF treated with mitomycin C and were cultured in mouse ES medium. On day 14, immunostaining was performed by using an antibody against SSEA1 (eBioscience), a pluripotency marker. Cells into which a SeV vector, into which no foreign gene had been introduced (SeV-empty), were used as a negative control.
[0099] The results are shown in