GENETICALLY ENGINEERED YEAST YARROWIA LIPOLYTICA AND METHODS FOR PRODUCING BIO-BASED GLYCOLIC ACID
20220127648 · 2022-04-28
Inventors
Cpc classification
Y02W10/40
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y101/0104
CHEMISTRY; METALLURGY
C07K2319/07
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides a method for genetically engineering Yarrowia lipolytica host cell for producing glycolic acid from organic wastes. A subject genetically engineered Y. lipolytica cell comprises the disrupted native genes encoding malate synthase, heterologous enzyme of glyoxylate reductase targeted in the different cellular compartments including mitochondria, peroxisome and cytosol, and a mutant NADP.sup.+-dependent malate dehydrogenase. The pathway with a theoretical yield as high as that 1 g of acetic acid can be converted to 1.27 g of glycolic acid without carbon loss was engineered for glycolic acid production. The methods particularly include process for production of volatile fatty acids (VFAs) mainly comprised of acetic acid from organic waste, and then use of resultant VFAs for biosynthesis of glycolic acid by recombinant Y. lipolytica.
Claims
1. A system for biosynthesis of glycolic acid, comprising a first expression cassette comprising a polynucleotide encoding glyoxylate reductase operably linked to an expression control sequence and a second expression cassette comprising a polynucleotide encoding a NADP.sup.+-dependent malate dehydrogenase operably linked to an expression control sequence.
2-4. (canceled)
5. The system of claim 1, wherein the glyoxylate reductase comprises Glyoxylate Reductase 1 (GLYR1).
6. The system of claim 5, wherein the GLYR1 comprises Arabidopsis thaliana GLYR1.
7. The system of claim 5, wherein the GLYR1 comprises SEQ ID NO: 17.
8. (canceled)
9. The system of claim 1, wherein the NADP+-dependent malate dehydrogenase comprises SEQ ID NO: 22.
10. The system of claim 1, wherein the glyoxylate reductase and/or the NADP+-dependent malate dehydrogenase comprises a mitochondria targeting signal and/or a peroxisome targeting signal.
11-12. (canceled)
13. The system of claim 10, wherein the mitochondria targeting signal is a leading sequence from COX4 (YALI0F03567 g) or a leading sequence from OGDC1 (YALI0E33517 g).
14. (canceled)
15. The system of claim 10, wherein the mitochondria targeting signal comprises SEQ ID NO: 19.
16-17. (canceled)
18. The system of claim 10, wherein the peroxisome targeting signal is a 33-amino acid peroxisome targeting signal from isocitrate lyase (ICL1).
19. (canceled)
20. The system of claim 1, wherein the expression control sequence comprises a promoter that is functional in a yeast cell and/or a terminator that is functional in a yeast cell.
21. The system of claim 20, wherein the promoter comprises a Tef promoter.
22. (canceled)
23. The system of claim 20, wherein the terminator comprises xpr2.
24. The system of claim 1, wherein the expression cassette is included in a yeast transformation vector.
25-26. (canceled)
27. The system of claim 1, further comprising a gene cassette comprising a polynucleotide encoding an isocitrate lyase enzyme operably linked to an expression control sequence, a gene cassette comprising a polynucleotide encoding a citrate synthase operably linked to an expression control sequence, or a combination thereof.
28. (canceled)
29. The system of claim 1, further comprising a gene deletion cassette for deletion of a malate synthase gene.
30. The system of claim 1, comprising a gene deletion cassette for deletion of malate synthase 1 (ms1) and a gene deletion cassette for deletion malate synthase 2 (ms2).
31. A recombinant yeast cell comprising a knockout of at least one malate synthase gene selected from malate synthase 1 (ms1) and malate synthase 2 (ms2).
32-40. (canceled)
41. A recombinant yeast cell transformed with the system of claim 1, wherein the recombinant yeast cell produces an increased level of glycolic acid, relative to a control yeast cell.
42-49. (canceled)
50. A method of producing a recombinant yeast cell, the method comprising: introducing into a yeast cell a system of claim 1 to produce a recombinant yeast cell; culturing the recombinant yeast cell under conditions sufficient to allow development of a yeast cell culture comprising a plurality of recombinant yeast cells; screening the recombinant yeast cells for expression of a polypeptide encoded by the system; and selecting from the yeast cell culture a recombinant yeast cell that expressed the polypeptide.
51-60. (canceled)
61. A method of producing volatile fatty acids (VFAs) from organic waste, the method comprising inoculating a culture medium with an anaerobic sludge and culturing the anaerobic sludge with the organic waste under anaerobic culture conditions sufficient to convert the organic waste into VFAs.
62-66. (canceled)
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
DETAILED DESCRIPTION
[0065] In various embodiments, the present disclosure provides systems and methods for biosynthesis of glycolic acid. In particular, the system comprises at least one expression cassette comprising a polynucleotide encoding a glycolic acid biosynthesis enzyme operably linked to an expression control sequence. Also provided are recombinant yeast cells (e.g., transformed with a system disclosed herein).
[0066] As used herein, a polynucleotide or polypeptide is “recombinant” when it is artificial or engineered, or derived from an artificial or engineered protein or nucleic acid. For example, a polynucleotide that is inserted into a vector or any other heterologous location, e.g , in a genome of a recombinant organism, such that it is not associated with nucleotide sequences that normally flank the polynucleotide as it is found in nature is a recombinant polynucleotide. A polypeptide expressed in vitro or in vivo from a recombinant polynucleotide is an example of a recombinant polypeptide. Likewise, a polynucleotide sequence that does not appear in nature, for example, a variant of a naturally occurring gene is recombinant.
[0067] “Variant” protein is intended to mean a protein derived from the protein by deletion truncation at the 5′ and/or 3′ end) and/or a deletion or addition of one or more amino acids at one or more internal sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed are biologically active, that is they continue to possess the desired biological activity of the native protein.
[0068] As used herein, “heterologous” in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.
[0069] The term “stably incorporated” in cell or explant refers to the integration of the polynucleotide into the genomic DNA of the cell.
[0070] “Operably linked” is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (i.e., a promoter) is a functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or noncontiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional coding sequence/gene to be co-transformed into the organism. Alternatively, the additional coding sequences/gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of a coding polynucleotide of interest or active variant or fragment thereof to be under the transcriptional regulation of the regulatory regions (e.g., promoter). The expression cassette may additionally contain selectable marker genes.
[0071] “Expression cassette” refers a polynucleotide encoding a polypeptide of interest operably linked to at least one polynucleotide encoding an expression control sequence. The expression cassette can include in the 5′-3′ direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), polynucleotide encoding a polypeptide of interest or active variant or fragment thereof, and a transcriptional and translational termination region (i.e., termination region) functional in yeast. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide or active variant or fragment thereof may be native:/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide of or active variant or fragment thereof may be heterologous to the host cell or to each other.
[0072] “Gene deletion cassette” refers a polynucleotide that, when expressed in a host cell, causes deletion of at least a portion of a gene of interest, such that the gene is not expressed. A gene deletion cassette may include a region of homology to a sequence upstream of a gene of interest, followed by a first repeat sequence (e.g., hisG or loxP), followed by a marker (e.g., ura3) followed by a second repeat sequence, followed by a region of homology to a sequence downstream of the gene to be deleted. In some embodiments the gene deletion cassette includes loxP repeat sequences and a ura3 marker.
[0073] “Transformation” as used herein refers to the uptake of DNA (e.g., in the form of an expression cassette) into a yeast cell.
[0074] “Yeast transformation vector” as used herein refers to a DNA molecule used as a vehicle of delivery foreign genetic material into a yeast cell. An expression cassette may be a component of a vector (e.g., a yeast transformation vector), and multiple expression cassettes may be present together in a single vector. For example, a vector may encode multiple proteins of interest (e.g., two glycolic acid biosynthesis enzymes or a single glycolic acid biosynthesis enzyme and a selectable marker or screenable marker).
[0075] “Expression control sequence” refers to a segment of a nucleic acid molecule which is capable of increasing or decreasing the expression of a polypeptide encoded by the expression cassette. Examples of expression control regions include promoters, transcriptional regulatory regions, and translational termination regions.
[0076] The termination region may be native with the transcriptional initiation region, may be native with the operably linked polynucleotide or active variant or fragment thereof, may be native with the yeast cell, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the polynucleotide or active fragment or variant thereof, the yeast cell, or any combination thereof. Examples of terminators functional in yeast can be found, for example, in Curran et al., Metab Eng. 2013 September: 19:88-97.
[0077] The expression cassettes may additionally contain 5′ leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5′ noncoding region) (Elroy-Stein et al. (1989) Prov. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus) (Virology 154:9-20), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94.
[0078] Promoters include constitutive and regulated promotes. Examples of promoters functional in yeast can be found, for example, in Peng et al., Microb Cell Fact (2015) 14:91.
[0079] A “control” or “control yeast” or “control yeast cell” provides a reference point for measuring changes in phenotype of the subject yeast cell, and may be any suitable yeast cell. A control yeast cell may comprise, for example: (a) a wild-type or native yeast cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject yeast cell; (b) yeast cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); or (c) the subject yeast cell itself, under conditions in which the gene of interest (e.g., the gene encoding a glycolic acid biosynthesis enzyme) is not expressed.
[0080] Various methods can be used to introduce a sequence of interest into a yeast cell. “Introducing” is intended to mean presenting to the yeast cell the polynucleotide or polypeptide in such a manner that the sequence gains access to the yeast cell. The methods of disclosed herein do not depend on a particular method for introducing a sequence into yeast, only that the polynucleotide or polypeptides gains access to the yeast cell. Methods for introducing polynucleotide or polypeptides into yeast cells are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus or virus-like element-mediated methods.
[0081] In the present description, the term “about” means +20% of the indicated range, value, or structure, unless otherwise indicated. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms “include” and “have” are used synonymously, which terms and variants thereof are intended to be construed as non-limiting. The term “comprise” means the presence of the stated features, integers, steps, or components as referred to in the claims, but that it does not preclude the presence or addition of one or more other features, integers, steps, components, or groups thereof.
[0082] The present disclosure relates to a non-conventional yeast which is genetically engineered to produce glycolic acid. The genetically engineered yeast strain can be used for production of glycolic acid from the common substrates such as glucose and glycerol, a novel substrate acetic acid exerting a toxic effect to other microorganisms, and raw material of organic waste (
[0083] In one embodiment, a non-conventional yeast Y. lipolytica has been genetically engineered for the production of glycolic acid. As a Generally Recognized As Safe (GRAS) organism, Y. lipolytica has been widely used for industrial production of a suite of chemicals such as lipid mainly consisting of triacylglycerol (TAG) and lipid-derived molecules such as eicosapentaenoic acid (EPA) (Markham and Alper 2018). Non-lipid compounds such as lycopene can also be produced by genetic engineering of Y. lipolytica. Another benefit to using yeast is the avoidance of bacteriophage attacks which could impede glycolic acid production at industrial levels.
[0084] In one embodiment, the host Y. lipolytica can use acetic acid and other carboxylic adds for the growth and glycolic add production (
[0085] In one embodiment, the theoretical yield of a pathway is one mole glycolic acid per mole acetic acid as shown in Table 1. In this designed pathway, two heterologous genes encoding glyoxylate reductase (GR) and a mutant NADP.sup.+-dependent malate dehydrogenase (MDH) from S. coelicolor A3(2) (Ge, Song et al. 2014) need to be introduced into Y. lipolytica for producing glycolic acid from acetic acid through the glyoxylate shunt and TCA cycles (Salusjärvi, Havukainen et al. 2019) (
TABLE-US-00001 TABLE 1 Calculation of efficiency for production of glycolic acid from acetic acid Equation Reaction (1) Acetate + ATP + CoA = Acetyl-CoA + AMP + 2 Pi (2) Acetyl-CoA + Oxaloacetate + H.sub.2O = Citrate + CoA (3) Isocitrate = Glyoxylate + Succinate (4) Glyoxylate + NADPH + H.sup.+ = Glycolate + NADP.sup.+ (5) Succinate + FAD.sup.2+ = Fumarate + FADH.sub.2 + 2H.sup.+ (6) Malate + NADP.sup.+ = Oxoacetate + NADPH + H.sup.+ (7) FADH.sub.2 + O.sub.2 + 2 (H.sup.+ + ADP + Pi) = 2 ATP + H.sub.2O + FAD.sup.2+ (8) Acetate (C.sub.2H.sub.4O.sub.2) + O.sub.2 + 2 H.sup.+ = Glycolate (C.sub.2H.sub.4O.sub.3) + H.sub.2O + FAD.sup.2+
[0086] As indicated in Table 1, glycolic acid can be produced from acetate with a theoretical yield of 1.27 g/g by the designed pathway. This yield is much higher than the theoretical yields of other carbon sources are used as the substrates for biosynthesis of glycolic acid, such as glucose (0.84 gig) and xylose (0,84 gig through glyoxylate shunt, 0.51 gig through D-xylulose-1-phosphate) (Salusjärvi, Havukainen et al. 2019). The invention overcomes the low yield barrier in glycolic acid production.
[0087] The starting strain for genetic engineering was Y. lipolytica Polf (ATCC MYA-2613), which can be obtained from American Type Culture Collection (ATCC). Y. lipolytica Polf is a leucine and uracil-auxotrophic strain, so both leu2 and ura3 from its parent strain, wild-type Y. lipolytica ATCC 20460 can be used as selectable markers for efficient detection and selection of transformants on the selective agar plates lacking leucine and uracil, respectively. To accomplish genetic engineering of the yeast, the chemicals, culture media, kits, plasmids, restriction endonucleases products, and PCR enzymes and reagents are available from the public resources and commercial inventories. The procedures for gene cloning that are now standard in molecular biology (Green and Sambrook 2012), and the specific steps related to genetic engineering of the yeast have been disclosed in embodiment and examples,
[0088] In one embodiment, genetic engineering of Y. lipolytica has been carried out for glycolic acid production and further improvement for biosynthesis of target. For genetic engineering of microorganisms especially eukaryotic cells, the considerations include the complexity of native pathways, the existence of organelle organization, and requirement of specific genetic tools such as expression vectors for targeting the enzymes into cellular compartments.
[0089] In one embodiment, to express an enzyme in a yeast compartment, a functional signal peptide was used to target the protein to a specific organelle, such as the mitochondrial matrix. N-terminal leading sequences from putative mitochondrial enzymes, cytochrotne c oxidase subunit IV (COX4, YALI0F03567 g) and 2-oxoglutarate dehydrogenase E1 component (OGDC1, YALI0E33517 g) were tested, and their capability to drive the expression of a reporter protein, enhanced green fluorescent protein (EGFP) in yeast mitochondria was verified (
[0090] In one embodiment, Y. lipolytica has been genetically engineered by employment of the strategy of pathway compartmentalization. In yeast, the reactions of the glyoxylate shunt and TCA cycle are highly connected, involving in different cellular compartments including cytosol, peroxisomes and the mitochondria. The strains Y. lipolytica expressing gene GLYR1 from A. thaliana encoding glyoxylate reductase 1 were constructed for glycolic acid production, but the expressed enzymes were present in the different cellular organelles including mitochondria, peroxisome and cytosol of these strains. The strain expressing GLYR1 in mitochondria could produce 3.53 g/L of glycolic acid in shaking flask from 40 g/L of glucose in 4 days, which was higher than the contents of glycolic acid produced by the strains expressing the enzyme in peroxisome and cytosol (
[0091] In one embodiment, additional genes have been expressed to further improve glycolic acid production by Y. lipolytica. Co-expression of the genes aceA encoding isocitrate lyase and OA encoding citrate synthase from E. coil in Y. lipolytica strain bearing GLYR1 enabled production of glycolic acid at 4.29 g/L after 96 h cultivation on 40 g/L glucose (
[0092] In one embodiment, Y. lipolytica is capable of robust growth under stress conditions of both low pH and high pH. For use of glucose as substrate for production of glycolic acid, pH of the fermentation broth decreased from 6.0 to 2.0 due to secretion of organic acids to supernatant by the cells. For use of acetic acid as substrate for production of glycolic acid, pH increased from 7.0 to 9.45 during cultivation mainly due to utilization of acetic acid. Although a buffer solution can be used for fermentation or acid/base can be added to adjust pH, fermentation without pH control can reduce the risk of contamination and further save use of acid/base.
[0093] In one embodiment, VFAs were produced from organic wastes such as food waste by a modified AD process. AD is a commonly accepted process for converting organic wastes to bioenergy in the form of biogas (CH.sub.4 and CO.sub.2). The AD process involves a mixed culture of symbiotic bacteria that mediate the degradation of organic matter ultimately to CH.sub.4, CO.sub.2, and mineralized nutrients. A typical AD process of solids wastes involves multiple steps: disintegration of the waste breaks down the initial solid biomass into separate components; hydrolysis converts relatively large organic compounds, lipids, carbohydrates, and proteins to long chain fatty acids, monosaccharides, and amino acids, respectively; acidogenesis converts VFAs other than acetate, such as propionate and butyrate, to acetic acid and hydrogen; methanogenesis, the last and rate-limiting step in AD, uses formic acid, acetic acid, methanol, and hydrogen as energy sources by various methanogens to generate CH.sub.4 and CO.sub.2 (Agler, Wrenn et al. 2011). VFA production can be improved by enhancing the hydrolysis and acidogenesis rates through physical or chemical pretreatments, addition of enzymes, pH control, redox potential and inoculum optimization, In addition, the chemical 2-bromoethanosulfophate is often added to inhibit methanogenesis.
[0094] In one embodiment, a novel hyperthermophilic AD operating at 60-80° C. for production of VFAs from waste streams (
[0095] In one embodiment, the technology for production of glycolic acid from organic waste is developed by integrating two processes: (1) converting complex waste materials into a group of simple molecules, VFAs mainly consisting of acetic acid, through acidogenesis in AD, and (2) converting the resultant VFAs to the target products in a separate bioreactor or flask by a metabolically engineered yeast strain (
[0096] In one embodiment, the novel bio-based glycolic acid technology takes advantage of both the anaerobic microbial consortia's capacity for handling complex waste, and engineered cell factories for biosynthesis of the target molecule. According to the various embodiments disclosed herein, this opportunity is addressed by providing a cost-effective route to convert these negative or low-value wastes to high value bioproduct (
EXAMPLES
Example 1
[0097] Deletion of Genes MS1 and MS2 Encoding Malate Synthase in Y. Lipolytica
[0098] The procedure for deletion of genes in Y. lipolytica has been provided in
Step 1: Clone 5′ and 3′ Arms from Targeted Gene and Transform Yeast with Linearized Plasmid
[0099] A 2.03-kb DNA fragment of ura3 flanked by loxP sites was obtained by PCR by using primers ura3-F1 (SEQ ID NO 1) and ura3-R1 (SEQ ID NO 2), and genome DNA of Y. lipolytica ATCC 20460 as the template. The PCR product was then cloned into plasmid pGEM-T easy purchased from Promega Corporation according to manufacturer's manual. The resultant plasmid pURA3loxp can be used to generate the vector for disruption of the gene in Y. lipolytica Polf and its derivatives (
[0100] By using genome DNA of Y. lipolytica as the template, the homologous 5′ flank of the targeted gene ms1 with size of 0.97 kb was amplified by PCR with the primers ms1-up1 (SEQ ID NO 3) and ms1-up2 (SEQ ID NO 4), and then inserted into the digested plasmid pURA3loxp after digestion with endonucleases ApaI and XbaI. The resultant plasmid containing the homologous 5′ flank of ns1 was designated pURA3-ms1up. Similarly, 1.17-kb 3′ arm of ms1 was obtained by PCR with primers ms1-do1 (SEQ ID NO 5) and ms1-Do2 (SEQ ID NO 6), and then the digested PCR product was cloned into the sites of SpeI and NdeI in pURA3-ms1up. The resultant plasmid, pURA3-ms1updo contained both 5′ and 3′ arms from ins 1 (
TABLE-US-00002 TABLE 2 Primers used for deletion of genes ms1 and ms2 SEQ ID Primer Sequence NO ura3-F1 TCTAGAATAACTTCGTATAATGTATGCTATAC 1 GAAGTTATGACTGGCCAAACTGATCTCAAG ura3-R1 ATAACTTCGT ATAGCATACA TTATACGAAG 2 TTATATGGTG TCTGTTTTCT ACGTGT MS1-up1 AGGGCGAATTGGGCCCGACGTC 3 AGCACGTTCGATCTAGCA MS1-up2 CCATGCTTAGTTACAATGCTTA 4 GCCGATCTAAAAGTGGAG MS1-Do1 GCATACAATGGTAAGCAATCGC 5 TAGGTGGGATGACGAAGA MS1-Do2 GGAGCTCTCCCATATGGTCGAC 6 TCCATGTCACAGTTTCGC MS1-testF CAAGGGCATCAAACTAGCTG 7 MS1-testR GTTTAACACAGCCAGATGGG 8 MS2-up1 AGGGCGAATTGGGCCCGACGTC 9 CTATTGTTCGATTCGGCG MS2-up2 CCATGCTTAG TTACAATGCT TA 10 TGTGCAGGTACAACGGAA MS2-Do1 GCATACAATGGTAAGCAATCGC 11 AAGCTCTAAGCGCGATGT MS2-Do2 GGAGCTCTCC CATATGGTCG AC 12 TGATTCTGTCGCCCAACT MS2-testF CCATATGATTCTGTGCCTGC 13 MS2-testR CGAGGAGTATCCTTCCACCA 14 uar3-testE TCCTGGAGGCAGAAGAACTT 15 uar3-testR AGCCCTTCTG ACTCACGTAT 16
Step 2: Verify Homologues Recombination by PCR Diagnosis
[0101] The single colonies on the selective agar plates were picked up and cultivated in culture tube containing 2 ml of YPD media at 28° C. and a shaking speed of 200 rpm in a shaker. At the same time, the colonies were replicated on YPD plates. The recipe of YPD medium was 10 g/L of yeast extract (Difco), 20 g/L of peptone (Difco), and 20 g/L of glucose, and YPD agar plates were made by adding 15 glL agar (Difco).
[0102] After cultivation for two days, the culture was used to extract genomic DNA by using the following protocols. The 1.5 ml cells were harvested by centrifugation at 10,000 g for 5 min, After discarding the supernatant, the cells were suspended in 500 μL of lysis solution containing 200 mM lithium acetate and 1% SDS. The mixture of cells and lysis solution was incubated for 10 minutes at 70° C. to break down the cell wall. The same volume (500 μL) of Phenol: Chloroform: Isoamyl Alcohol (25:24:1, v/v) (Thermo Fisher Scientific) was added into the mixture, and then centrifuged at 13,000 g for 5 minutes after vortex. After centrifugation, 400 ul of aqueous phase (upper phase) was transferred to a new 1.5-ml Eppendorf tube, and two volumes of ethanol (800 ul) were added into the new tube. After mixing, the tubes were kept at −20 DC for 2 hours in a freezer for precipitation of genomic DNA. The samples were centrifuged at 13,000 g for 10 minutes to obtain the genomic DNA. One ml of 70% ethanol was added to the DNA pellet and centrifuged at 13,000 g for 10 minutes to wash DNA. After discarding the washing solution and drying for 10 minutes at room temperature, DNA pellet was dissolved with 50 μL of H.sub.2O or TE buffer (10 mM Tris and 1 mM EDTA, pH 8.0). The extracted genome DNA was used as a template for PCR to verify the deletion of ins/with primer pairs of ms1-testF/uar3-testR (SEQ ID NO 16) and msl-testR/uar3-testF (SEQ ID NO 15) (
Step 3: Transform Yeast With Plasmid pYlexp1-cre to Remove Marker uar3, and Eliminate Plasmid pYlexp1-cre
[0103] The single colony of Y. lipolytica with deleted ms1 gene was cultivated in 20 ml YPD media at 28° C. for 24 hours. The yeast culture was harvested, and transformed with pYlexp1-cre bearing Cre recombinase gene by using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Irvine, Calif.). Yeast transformants were grown at 28° C. on selective agar plates, which was composed of 20 g/L of glucose, 6.7 g/L of yeast nitrogen base without amino acids, and 2.0 g/L of complete supplement of amino acids lacking leucine (Drop-out Mix Synthetic Minus Leucine, United States Biological) and 15 giL agar. After three days of cultivation at 28° C., the visible colonies were picked up and inoculated into 2-ml YPD media in culture tubes. After culture for 36 hours at 28° C. with a shaking speed at 200 rpm, the cells were plated onto YPD agar plates. The single colonies were then tested for their growth on the selective agar plates lacking either uracil (Drop-out Mix Synthetic Minus Uracil) or leucine (Drop-out Mix Synthetic Minus Leucine) plates. No growth of the strains on both selective agar plates indicates the removal of ura3 marker gene and plasmid pYlexp1-cre curing. The single knockout Δms1 was used for the next round of gene deletion to develop double knockout Δms1Δms2 without ura3 (strain GLO9) by using the same protocol involving step 1-step 3. The strain GLO9 was tested for its growth on glucose and acetic acid, and further engineered by expression of GLYR1 from A. thaliana for glycolic acid production.
Example 2
Expression of GLYR1 From A. Thaliana in Y. Lipolytica GLO9 for Glycolic Acid Production
[0104] The Y. hpoiytica codon-optimized gene encoding GLYR1 from A. thaliana was synthesized (SEQ ID NO 17). The C E terminal tripeptide, □SRE from GLYR1 was removed during gene synthesis. At the same time, C-terminal 33-amino acid from isocitrate lyase (ICL1, YALI0C16885 g) for peroxisomal localization was fused with GLYR1, and the restriction sites of AAGCTT (for HindIII) and CCCGGG (for SmaI) were introduced into both ends of DNA fragment during synthesis.
[0105] To express gene in Y lipolytica, expression vector pYlexp1 containing a functional 0.20-kb Tef promoter and 0.58-kb xpr2 terminator was constructed (Blazeck, Liu et al, 2011). The plasmid pYlexp1 can replicate in both Y. lipolytica and E. coli because it contains yeast replication origin ORI1001, centromere (CEN) and selection marker leu2 from pS116-Cen1-1(227) (Yamane, Sakai et al. 2008) (
[0106] The gene encoding GLYR1 from A. thaliana was expressed in the different organelles by using the developed expression vectors, The vector pYlmit1-GLYR1 was constructed to express GLYR1 in yeast mitochondria by insertion of GLYR1 gene into plasmid pYlmiti of the cleavage sites of Pstl and Smal (
Example 3
Expression of Additional Genes to Improve Glycolic Acid Production
[0107] The 1.30-kb DNA fragment of ace4 encoding isocitrate lyase (ecj JW3975) from E. coil was amplified by PCR with primers EcAceA-F1 (SEQ ID NO 20) and. EcAceA-R1 (SEQ ID NO 21) by using genome DNA of E. coil K12 MG1655. The sequences of EcAceA-F1 and EcAceA-R1 are listed below.
TABLE-US-00003 EcAceAF1: GGCGCACTGCAGATGAAAACCCGTACACAACAAA EcAceAR1: GCAATTCCCGGGTTAGAACTGCGATTCTTCAGTGGA
[0108] The PCR product was digested with PstI and SmaI, and inserted into the digested plasmid pYlmit1 to generate pYlmit1-AceA. In plasmid pYlmit1-AceA, expression of AceA was fused with signal peptide of Cox4, so AceA. could be translocated into yeast mitochondria. Similarly, pYlmit2-G1tA was constructed to express gliA encoding citrate synthase (ecj:JW0710) from E. coli, and the expressed enzyme was present in mitochondria because of the signal peptide from OGDC used for targeting to cellular compartment. The plasmid pYlmitl-AceA was digested Xbal and SpeI, and then 2.95-kb DNA fragment containing expression cassette of AceA was recovered (
[0109] Malate dehydrogenase (MDH) from Streptomyces coelicolor A3(2) was engineered to alter its co-factor preference with NADP.sup.+ instead of NAD.sup.+. The gene mut-MDII was synthesized with codon optimization of Y. lipolytica (SEQ ID NO 22), and mut-MDH was cloned by using mitochondrial expression vector pYlmit1. Expression of cassette of/mut-MDH was integrated into Y. lipolytica expressing GLYR.1 from A. thaliana in mitochondria to form the strain GLO20. The strains including GLO10, GLO16 and GLO020 were used for production of glycolic acid.
Example 4
Production of Glycolic Acid From Glucose and Acetic Acid By Y. Lipolytica
[0110] The culture media was composed of 2.5 g/L peptone, 6.7 g/L YNB without amino acids, and acetic acid or glucose as carbon source. For the media containing acetic acid, pH of the media was adjusted to 7.0 by using NaOH. The cultivation for production of glycolic acid was implemented in 250-mL flask containing 50 ml culture media, at 28° C. and 200 rpm without pH control.
[0111] By measurement of absorbance at 600 nm (OD.sub.600) of the culture every 12 hours, the growth of GLO9 and the control strain, Polf was quantified (
[0112] To test the strains for glycolic acid production, samples of the culture were collected for measurement of glycolic acid. One mL culture was centrifuged at 13000 rpm, and the supernatant was used for determination of residual glucose or acetic acid in the medium and produced glycolic acid. The concentration of glucose, acetic acid and glycolic acid was quantified by using the external standard method with high-performance liquid chromatography (HPLC).
[0113] As shown in
[0114] Because the strain expressing mitochondrial GLYR1 showed a better performance for glycolic acid production from both glucose and acetic acid, it was further genetically modified to improve glycolic acid production. As shown in
[0115] The strains GLO10, GLO15 and GLO16 were also used for production of glycolic acid by using acetic acid as carbon source (
Example 5
Treatment of Food Waste for Production of VFA and Use of Resultant VFA for Production of Glycolic Acid
[0116] A novel AD was developed as a part of this disclosure for efficient VFA production from waste through arresting methanogenesis and accelerating acidogenesis. The anaerobic sludge inoculum was obtained from a primary sedimentation tank at the wastewater treatment plant (WWTP) in Pullman, Wash. The sludge was transferred into sterile bottles purged with nitrogen gas to ensure anaerobic conditions, and then stored at 37 □ for one week to minimize the degradation of organic compounds in the sludge.
[0117] The food waste was collected from a student cafeteria at Washington State University in Pullman, Wash., USA. The food waste was mixed with rice, noodles, meat, and all kinds of vegetables and fruits. The characteristics of seed sludge and food waste are shown in table 3.
TABLE-US-00004 TABLE 3 Characteristics of sludge and food waste Parameter Food waste Inoculum Total Solids (TS) (%) 28.52 ± 0.3 1.52 ± 0.1 Volatile Solids (VS) (%) 26.66 ± 0.3 1.10 ± 0.1 VS/TS (%) 93.47 ± 0.1 72.46 ± 0.1 pH — 7.5
[0118] The VFA production process was conducted in a 7.5-L fermenter (NBS Bioflo-110) with a 5-L working volume. The mixed liquor was designed to contain 15% total solid of 2,500 g food waste and 2,500 g anaerobic sludge. The confine medium was purged with nitrogen for 20 min and capped tightly with butyl rubber to maintain anaerobic conditions. AD process was carried out by control of temperature (60-80° C.), agitation speed at 300 rpm, pH at 7.0, and without aeration. As shown in
[0119] After centrifugation at 13,000 g for 15 minutes, the liquid phase was separated from the product of food waste digestion. The effluent enriched with VFA was used to culture strain GLO20. The media contained around 42 g/L acetic acid generated from food waste, 2.5 g/L peptone and 6.7 g/L YNB without amino acids. As shown in
REFERENCES
Patent Citations
[0120] Philippe Soucaille. Glycolic acid production by fermentation from renewable resources. Pub. No.: WO/2007/141316, International Application No.: PCT/EP2007/055625, Publication Date: Dec. 13, 2007, International Filing Date: Jun. 7, 2007
[0121] Philippe Soucaille. Method for producing high amount of glycolic acid by fermentation. Pub. No.: WO12010/108909, International Application No.: PCT/EP2010/053758, Publication Date: Sep. 30, 2010, InternationalFiling Date: Mar. 23, 2010
[0122] Gregory Stephanopoulos, Zheng-Jun Li, Brian Pereira. Microbial production of renewable glycolate. Pub. No.: US 2017/0121717 A1, Publication Date: Apr. 5, 2017
[0123] Outi KOIVISTOINEN, Joosu. KUIVANEN, Peter Richard, Merja Penttild. Eukaryotic cell and method for producing glycolic acid. International Publication Number: WO 2013/050659 A1, International Publication Date: Apr. 11, 2013
Non-Patent Citations
[0124] Agler, M. T., B. A. Wrenn, S. H. Zinder and L. T. Angenent (2011). Waste to bioproduct conversion with undefined mixed cultures: the carboxylate platform. Trends in Biotechnology 29(2): 70-78.
[0125] Blazeck, J., L. Liu, H. Redden and H. Alper (2011). Tuning gene expression in Yarrowia hpolytica by a hybrid promoter approach. Applied and Environmental Microbiology 77(22): 7905-7914.
[0126] Deng, Y., N. Ma, K. Zhu, Y. Mao, X. Wei and Y. Zhao (2018). Balancing the carbon flux distributions between the TCA cycle and glyoxylate shunt to produce glycolate at high yield and titer in Escherichia coli. Metabolic engineering 46: 28-34.
[0127] Ge, Y., P. Song, Z. Cao, P. Wang and G. Zhu (2014). Alteration of coenzyme specificity of malate dehydrogenase from Streptomyces coelicolor A3 (2) by site-directed mutagenesis. J Genet. Mol. Res 13: 5758-5766.
[0128] Green Michael R, Sambrook Joseph (2012). Molecular Cloning: Laboratory Manual (Fourth Edition) Cold Spring Harbor Laboratory Press
[0129] Li, W., J. Chen, C.-X. Liu, Q.-P. Yuan and Z.-J. Li (2019). Microbial production of glycolate from acetate by metabolically engineered Escherichia coli. J Journal of biotechnology 291: 41-45.
[0130] Markham, K. A. and H. S. Alper (2018). Synthetic biology expands the industrial potential of Yarrowia lipolytica. Trends in Biotechnology 36(10): 1085-1095.
[0131] Salusjärvi, L, S. Havukainen, O. Koivistoinen and M. Toivari (2019). Biotechnological production of glycolic acid and ethylene glycol: current state and perspectives. Applied Microbiology and Biotechnology 103(6): 2525-2535.
[0132] Yamane, T., H. Sakai, K. Nagahama, T. Ogawa, M. Matsuoka (2008). Dissection of centromeric DNA from yeast Yarrowia lipolytica and identification of protein-binding site required for plasmid transmission. Journal of Bioscience and Bioengineering 105(6): 571-578.