Biomoletron for regulation stem cell differentiation

11718687 · 2023-08-08

Assignee

Inventors

Cpc classification

International classification

Abstract

A bioelectronic device for regulating stem cell differentiation, a method for differentiating stem cells using the same, and a method for manufacturing the bioelectronic device. According to the present invention, it is possible to effectively control the differentiation of stem cells at a single-cell level, and to simultaneously perform a free radical inhibition function.

Claims

1. A bioelectronic device for controlling stem cell differentiation, comprising: (a) a protein comprising the amino acid sequence of SEQ ID NO: 2 having a redox potential; (b) a first single strand DNA comprising the nucleic acid sequence of SEQ ID NO: 3 binding to the N-terminal of the protein having a redox potential; (c) a second single strand DNA comprising the nucleic acid sequence of SEQ ID NO: 4 complimentarily hybridizing with the first single strand DNA to form a double strand DNA; (d) a nanoparticle directly conjugated to a terminal of the second single strand DNA; and (e) (i) a cell-penetrating peptide and (ii) a differentiation-inducing factor, which are conjugated to the nanoparticle; wherein the cell-penetrating peptide is indirectly conjugated through a linker introduced to a surface of the nanoparticle, wherein the differentiation-inducing factor is indirectly conjugated through a linker introduced to a surface of the nanoparticle, wherein the differentiation-inducing factor is released from the nanoparticle by potential application, wherein the double strand DNA further comprises metal ions between mismatch nucleotide pairs, and wherein the number of mismatch nucleotide pairs is 1 to 10.

2. The bioelectronic device of claim 1, wherein the protein having a redox potential is directly immobilized to a substrate by having a cysteine residue introduced thereto.

3. The bioelectronic device of claim 1, wherein the protein having a redox potential further comprises, at the C-terminal thereof, a ligand having a binding ability to a cell membrane receptor protein.

4. The bioelectronic device of claim 3, wherein the ligand having a binding ability to a cell membrane receptor protein is at least one ligand selected from the group consisting of RGD(Arg-Gly-Asp) (SEQ ID NO: 8), RGDS(Arg-Gly-Asp-Ser) (SEQ ID NO: 9), RGDC(Arg-Gly-Asp-Cys) (SEQ ID NO: 10), RGDV(Arg-Gly-Asp-Val) (SEQ ID NO: 11), RGES(Arg-Gly-Glu-Ser) (SEQ ID NO: 12), RGDSPASSKP(Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Lys-Pro) (SEQ ID NO: 13), GRGDS(Gly-Arg-Gly-Asp-Ser) (SEQ ID NO: 14), GRADSP(Gly-Arg-Ala-Asp-Ser-Pro) (SEQ ID NO: 15), KGDS(Lys-Gly-Asp-Ser) (SEQ ID NO: 16), GRGDSP(Gly-Arg-Gly-Asp-Ser-Pro) (SEQ ID NO: 17), GRGDTP(Gly-Arg-Gly-Asp-Thr-Pro) (SEQ ID NO: 18), GRGES(Gly-Arg-Gly-Glu-Ser) (SEQ ID NO: 19), GRGDSPC(Gly-Arg-Gly-Asp-Ser-Pro-Cys) (SEQ ID NO: 20), GRGESP(Gly-Arg-Gly-Glu-Ser-Pro) (SEQ ID NO: 21), SDGR(Ser-Asp-Gly-Arg) (SEQ ID NO: 22), YRGDS(Tyr-Arg-Gly-Asp-Ser) (SEQ ID NO: 23), GQQHHLGGAKQAGDV (Gly-Gln-Gln-His-His-Leu-Gly-Gly-Ala-Lys-Gln-Ala-Gly-Asp-Val) (SEQ ID NO: 24), GPR(Gly-Pro-Arg) (SEQ ID NO: 25), GHK(Gly-His-Lys) (SEQ ID NO: 26), YIGSR(Tyr-Ile-Gly-Ser-Arg) (SEQ ID NO: 27), PDSGR(Pro-Asp-Ser-Gly-Arg) (SEQ ID NO: 28), CDPGYIGSR(Cys-Asp-Pro-Gly-Tyr-Ile-Gly-Ser-Arg) (SEQ ID NO: 29), LCFR(Leu-Cys-Phe-Arg) (SEQ ID NO: 30), EIL(Glu-Ile-Leu) (SEQ ID NO: 31), EILDV(Gludle-Leu-Asp-Val) (SEQ ID NO: 32), EILDVPST(Gludle-Leu-Asp-Val-Pro-Ser-Thr) (SEQ ID NO: 33), EILEVPST(Glu-Ile-Leu-Glu-Val-Pro-Ser-Thr) (SEQ ID NO: 34), LDV(Leu-Asp-Val) (SEQ ID NO: 35), and LDVPS(Leu-Asp-Val-Pro-Ser) (SEQ ID NO: 36).

5. The bioelectronic device of claim 1, wherein the protein having a redox potential has a free radical scavenging potential.

6. The bioelectronic device of claim 1, wherein the first single strand DNA indirectly binds to the N-terminal of the protein having a redox potential through a linker.

7. The bioelectronic device of claim 1, wherein the second single strand DNA is directly conjugated to the nanoparticle through a thiol group introduced to a terminal thereof.

8. The bioelectronic device of claim 1, wherein the differentiation-inducing factor is at least one factor selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, DNAzyme, peptide nucleic acid (PNA), antisense oligonucleotide, peptide, antibody, and aptamer.

9. The bioelectronic device of claim 1, wherein the bioelectronic device is integrated into a cell membrane by a ligand having a binding ability to a cell membrane receptor protein, the ligand being introduced to the C-terminal of the protein having a redox potential.

10. A method for controlling stem cell differentiation, the method comprising a step for contacting the bioelectronic device of claim 1 with a stem cell in a stem cell culture medium.

11. A method for fabricating a bioelectronic device for controlling stem cell differentiation, the method comprising: (a) providing a self-assembling protein comprising the amino acid sequence of SEQ ID NO: 2 having a redox potential on a substrate; (b) binding a first single strand DNA comprising the nucleic acid sequence of SEQ ID NO: 3 to the N-terminal of the protein having a redox potential; (c) hybridizing a second single strand DNA comprising the nucleic acid sequence of SEQ ID NO: 4 with the first single strand DNA to form a double strand DNA; (d) conjugating a nanoparticle to a terminal of the second single strand DNA; and (e) conjugating (i) a cell-penetrating peptide and (ii) a differentiation-inducing factor to a surface of the nanoparticle; wherein the cell-penetrating peptide is indirectly conjugated through a linker introduced to a surface of the nanoparticle, wherein the differentiation-inducing factor is indirectly conjugated through a linker introduced to a surface of the nanoparticle, wherein the differentiation-inducing factor is released from the nanoparticle by potential application, wherein the double strand DNA further comprises metal ions between mismatch nucleotide pairs, and wherein the number of mismatch nucleotide pairs is 1 to 10.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a schematic diagram of the design of a three-cysteine and C-terminal RGD-introduced azurin.

(2) FIG. 2 shows a schematic diagram of the fabrication procedure of a biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced azurin-ssDNA double layer).

(3) FIG. 3 shows a schematic diagram of the fabrication procedure of a biomoletron for controlling stem cell differentiation

(4) FIG. 4 shows a schematic diagram of the fabrication procedure of an Au/azurin/metal ion meditated-nucleotide pair for conductivity confirmation.

(5) FIG. 5 shows a schematic diagram of the fabrication procedure of a biomoletron top portion (bio-functional nanoparticle-csDNA conjugate).

(6) FIG. 6A shows the results of confirming the expression of recombinant azurin using electrophoresis.

(7) FIG. 6B shows the results of confirming the hydrogen peroxide scavenging potential of the recombinant azurin.

(8) FIG. 7A shows the result of confirming the conductivity of Au/azurin/metal ion meditated-nucleotide pair using cyclic voltammetry.

(9) FIG. 7b shows an increase in conductivity according to the number of metal ions of the Au/azurin/metal ion meditated-nucleotide pair.

(10) FIG. 8A shows electric release functions using cyclic voltammetry and fluorescence microscopy. FIG. 8A is a cyclic voltammetry graph before and after electric release.

(11) FIG. 8B shows electric release functions using cyclic voltammetry and fluorescence microscopy. FIG. 8B shows fluorescence images before and after electric release.

(12) FIG. 9 shows a surface of a biomoletron using flow surface plasmon resonance (flow SPR).

(13) FIG. 10A shows the results of confirming electric release system functions of a biomoletron. FIG. 10A shows the results of investigating and confirming a surface of a biomoletron using surface plasmon resonance before application of a potential (e) and after application of a potential of −0.5 V (f) and a potential of −1.0 V (g).

(14) FIG. 10B shows the results of confirming electric release system functions of a biomoletron. FIG. 10B is a graph using amperometric measurement upon application of a potential of −0.5 V.

(15) FIG. 10C shows the results of confirming electric release system functions of a biomoletron. FIG. 10C is a graph using amperometric measurement upon application of a potential of −1.0 V.

(16) FIG. 11A shows the results of confirming the cell membrane penetration of a biomoletron through three sequential experimental methods. FIG. 11a shows fluorescence images to confirm that a biomolecule was fabricated near a cell membrane, using a confocal microscope.

(17) FIG. 11B shows the results of confirming the cell membrane penetration of a biomoletron through three sequential experimental methods. FIG. 11B shows fluorescence images excluding a case of “no penetrating into cell membrane”.

(18) FIG. 11C shows the results of confirming the cell membrane penetration of a biomoletron through three sequential experimental methods. FIG. 11C shows fluorescence images excluding a case of “whole penetrating into cell membrane”.

(19) FIG. 12A shows the results of confirming biomoletron-based neural stem cell differentiation. FIG. 12a shows the results of confirming the differentiation of neural stem cells using immunostaining.

(20) FIG. 12B shows the results of confirming biomoletron-based neural stem cell differentiation. FIG. 12B shows the results of confirming the differentiation using detection quantitative PCR.

(21) Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

EXAMPLES

(22) Materials and Method

(23) Materials

(24) Azu W, Azu Cys1, Azu Cys2, Azu Cys3, Azu RGD primer pairs were purchased from Integrated DNA Technologies (USA). All chemical products (hydrogen peroxide (H.sub.2O.sub.2), sulfuric acid (H.sub.2SO.sub.4), ammonium hydroxide (NH.sub.4OH), silver nitrate (AgNO.sub.3)) were purchased from Sigma Aldrich (USA) and PDMS (poly-dimethylsiloxane) was purchased from Corning (USA). Reagent grades of isopropyl alcohol, anhydrous alcohol, distilled water, and phosphoric acid were used, and aluminum foil was purchased from Alpha (Korea). All aqueous solutions were prepared with purified water (18 MΩ.sup.cm) using Milli-Q system (Millipore, USA). Sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-SMCC) and dithiothreitol (DDT) were purchased from Thermo Scientific Pierce (USA). Ethyl acetate and phosphate buffered saline (PBS, pH 7.4, 10 mM) were purchased from Sigma Aldrich (USA).

(25) Genomic Engineering of Pseudomonas aeruginosa Azurin

(26) Genomic DNA was isolated from Pseudomonas aeruginosa using DNA purification kit (QIAZEN, USA). The forward primer was designed to contain the NdeI restriction site and the reverse primer was designed to contain the BamHI restriction site as follows:

(27) TABLE-US-00001 (SEQ ID NO: 37) Azu W F: 5′-CATATGCTACGTAAACTCGCTGCCGTA-3′ (SEQ ID NO: 38) Azu W R: 5′-GAATTCACTTCAGGGTCAGGGTGCCCT-3′.

(28) A gene (SEQ ID NO: 7) coding blue copper protein azurin from the genomic DNA of Pseudomonas aeruginosa and the designed primers were amplified by using polymerase chain reaction (PCR). PCR reaction products were purified using the DNA purification kit (QIAZEN, USA), and then digested with two restriction enzymes NdeI and BamHI (New England Biolabs, UK). The digested DNA fragments were ligated to pET-21a(+) vector (Novagen, Germany), which have already been treated with NdeI and BamHI, using a ligation kit (Takara, Japan). The plasmids containing the obtained azurin gene, the Azu Cys1 F, Azu Cys2 F, Azu Cys3 F, Azu RGD F and Azu Cys1 R, Azu Cys2 R, Azu Cys3 R, Azu RGD R primers, which were designed to induce site-specific mutation, and QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent Technologies, USA) were used to produce mutation, so that ATG was substituted with TGC, AAG was substituted with TGC, and CTG was substituted with TGC, that is, Met13Cys(M13C), Lys92Cys(K92C), and Leu39Cys(L39C), and that the RGD amino acids were inserted in the C-terminal. The azurin gene was mutated using site-specific mutation (FIG. 1). The mutated gene sequence was reconfirmed through sequencing.

(29) For subcloning, Escherichia coli DH5a was used. Herein, for use of site-specific mutation of the azurin gene, the primers of azurin protein were designed as shown in Table 1.

(30) TABLE-US-00002 TABLE 1 Primer name Forward sequence Reverse sequence Azu Cys1 5-CATCCAGGGTAACGACCAGTGCC 5-TGGCATTGGTGTTGAACTGGCACTG AGTTCAACACCAATGCCA-3 GTCGTTACCCTGGATG-3 (SEQ ID NO: 39) (SEQ ID NO: 40) Azu Cys2 5-GCTGATCGGCTCGGGCGAGTGCG 5-CGTCGAAGGTCACCGAGTCGCACTC ACTCGGTGACCTTCGACG-3 GCCCGAGCCGATCAGC-3 (SEQ ID NO: 41) (SEQ ID NO: 42) Azu Cys3 5-CCTGTCCCACCCCGGCAACTGCC 5-GGCCCATGACGTTCTTCGGGCAGTT CGAAGAACGTCATGGGCC-3 GCCGGGGTGGGACAGG-3 (SEQ ID NO: 43) (SEQ ID NO: 44) Azu RGD 5-GCGCTGATGAAGGGCACCCTGAC 5-TTTCGGGCTTTGTTAGCAGCCGGAT CCTGAAGCGCGGGGATTGAGGAT CCTCAATCCCCGCGCTTCAGGGTCA CCGGCTGCTAACAAAGCCCGAAA-3 GGGTGCCCTTCATCAGCGC-3 (SEQ ID NO: 45) (SEQ ID NO: 46)

(31) Expression and Purification of Recombinant Azurin Variants

(32) The plasmids containing modified azurin gene were transformed into E. coli BL21 (DE3). The transformed strains were grown to an OD of 0.6 at 37° C. in shake flasks containing 1 L of LB medium (0.5% yeast extract, 1.0% tryptophan, and 1.0% NaCl) with 50 mg/ml ampicillin. The expression was induced by adding isopropyl beta-D-thiogalactopyranoside (IPTG) to a final concentration of 0.839 mM. The transformed cells were grown for an additional 16 hr at 37° C. The cells were harvested by centrifugation at 5000 g for 15 minutes at 4° C. The cell paste was suspended in sucrose buffer (20% sucrose, 0.3 M Tris-HCl, pH 8.1, and 1 mM EDTA) and subjected to osmotic shock (0.5 mM MgCl.sub.2). Contaminating proteins were precipitated from the periplasmic preparation by decreasing the pH to 3.0, yielding azurin-containing supernatant. The three-cysteine and C-terminal RGD-introduced apo-azurin fractions (elution pH=5.2 and 5.4) were separated on a CM cellulose ion-exchange column with a pH gradient from 4.0 to 6.0 (50 mM sodium acetate). For the addition of copper ions into modified azurin proteins, 0.5 M CuSO4 was added. The three-cysteine and C-terminal RGD-introduced azurin proteins were separated by MWCO 5 k Amicon Ultra centrifugal filter (Millipore, USA).

(33) Preparation and Purification of Sulfo-SMCC Tagged ssDNA

(34) For the preparation of the three-cysteine and C-terminal RGD-introduced azurin-SMCC-DNA hybrid, the thiol group was modified at the 5′-end of the single strand DNA to be suitable for conjugation through sulfo-SMCC between recombinant azurin and ssDNA (single stranded DNA). ssDNA was provided from Bioneer (Korea), and was designed as follows:

(35) TABLE-US-00003 (SEQ ID NO: 3) ssDNA: 5′-CGCGCGCCGCTTTAGAGCGCGCGCGATTTCTGCATATATA-3′.

(36) The thiol-modified ssDNA (sulfhydryl-containing biomolecule) was reacted with sulfo-SMCC.

(37) More specifically, 1 ml of 5 μM thiol-modified ssDNA (40 mer) diluted with PBS buffer (pH 7.4) was prepared. For thiol-modified ssDNA activation, the thiol-modified ssDNA was additionally reduced by treatment with 100 μl of 1.0 N DTT at room temperature for 15 minutes, obtaining a free sulfhydryl group. Then, the saturated DTT was removed by adding 1 ml of ethyl acetate to the DNA solution. The reduced thiol-modified ssDNA was transferred to a hybridization buffer by using a desalting column (PD-10). During the preparation of free SH-DNA, 0.5 mg of sulfo-SMCC was added to 100 μl of tertiary distilled water, followed by reaction in a water bath at 50° C. for 10 minutes, thereby preparing 100 μl of 5 μM sulfo-SMCC. For conjugation of 1 ml of 5 μM free SH-DNA and 100 μ/L of 5 μM sulfo-SMCC, shaking was carried out in a refrigerator at 4° C. for 4 hours. Then, the sulfo-SMCC tagged ssDNA was purified, and unreacted materials were removed by ultrafiltration (MWCO 3 k Amicon Ultra centrifugal filter, Millipore, USA).

(38) Preparation of Biomoletron Bottom Portion (Three-Cysteine and C-Terminal RGD-Introduced Azurin-ssDNA Double Layer) (Part 1)

(39) Au substrates (Au (100 nm)/Cr (5 nm)/SiO.sub.2/Si wafer) diced into 5 mm×15 mm were purchased from National NanoFab Center (Korea). For the preparation of a working electrode of a biomoletron, gold (Au) working electrodes were massively prepared on the Si/SiO.sub.2 substrates. The prepared Au electrodes were washed with a piranha solution (30 vol % H.sub.2O.sub.2 and 70 vol % H.sub.2SO.sub.4) at 70° C. for 3 minutes. The gold electrodes were washed, repeatedly washed with ethanol and deionized water, and then dried under nitrogen streams. Then, 20 μl of the prepared 0.1 mg/ml solution of three-cysteine and C-terminal RGD-introduced azurin was allowed to stand on the Au surface for 4 hours for direct immobilization on the Au surface via the cysteine resides. After 4 hours, the resultant substrates were washed with tertiary distilled water and dried under nitrogen streams. The recombinant azurin-immobilized gold substrates were immersed in 20 μl of 5 μM solution of sulfo-SMCC tagged ssDNA for 2 hours. For the formation of the recombinant azurin/ssDNA double layer, a covalent bond between the amine group of the recombinant azurin and the sulfo group of the sulfo-SMCC tagged ssDNA was used. This procedure was carried out in a humidification chamber at 25° C. After 2 hours, the recombinant azurin/ssDNA double layer immobilized double layer was formed. For removal of unreacted sulfo-SMCC tagged ssDNA, the resultant substrates was washed with deionized water and dried under nitrogen gas (FIG. 3).

(40) Preparation and Purification of Biomoletron Top Portion (Bio-Functional Nanoparticle-csDNA Conjugate) (Part II)

(41) Au substrates (Au (10 nm)/Cr (12 nm)/SiO.sub.2/Si wafer) diced into 12 mm×35 mm were purchased from G-mek (Korea). For the preparation of the bio-functional nanoparticle-csDNA conjugate, 5′-end thiol-modified ssDNA 2 (single strand DNA 2) for conjugation to a metal plate and 5′-end thiol-modified csDNA 2 (complementary strand DNA 2) for conjugation to 5-nm gold nanoparticle were purchased from Bioneer (Korea), and primer sequences were designed as follows:

(42) TABLE-US-00004 (SEQ ID NO: 47) ssDNA 2: 5′-ATAAAAAAAACGCGGGGGTTCCGCG-3′ (SEQ ID NO: 48) csDNA 2: 5′-GCGCCCCCAAGGCGCAAAAATAAAA-3′

(43) The 5-nm gold nanoparticles were purchased from BBI International (UK), 5,5′-Bis(mercaptomethyl)-2,2-bipyridine, Cucibit [8] Uril (CB), N-hydroxysuccinimide (NHS), 1-ethyl-3-(−3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), and phosphate buffered saline (PBS, pH 7.4, 10 mM) were purchased from Sigma Aldrich (USA). A cell-penetrating peptide (CPP) for penetrating cell membranes, and peptides (peptide 1 (C-t NH.sub.2 group), peptide 2 (C-t Cys)) for preparing a bio-functional nanoparticle hybrid were synthesized, and designed as follows:

(44) TABLE-US-00005 CPP (CTAT): CGRKKRRQRRRPQ (SEQ ID NO: 49)  Peptide 1 (C-t NH.sub.2): TGG-NH.sub.2 (SEQ ID NO: 50) Peptide 2 (C-t Cys): WGGC. (SEQ ID NO: 51)

(45) The retinoic acid (RA) as a neural stem cell differentiation inducer was synthesized by Sigma Aldrich (USA), and siSOX9, one type of siRNA, was synthesized from the modification of a maleimide group at the 5′-end by Bioneer (Korea). siSOX9 was designed as follows:

(46) TABLE-US-00006 (SEQ ID NO: 5) siSOX9 antisense: 5′-Maleimide-AACGAGAGCGAGAAGAGACCC-3′  (SEQ ID NO: 6) siSOX9 sense: 5′-Maleimide-GGGUCUCUUCUCGCUCUCGUU-3′.

(47) The csDNA (complementary strand DNA), which is complementary to the biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced Azurin-ssDNA double layer) was purchased from Bioneer (Korea), and was designed as follows:

(48) TABLE-US-00007 (SEQ ID NO: 4) csDNA: 5′-TATATATGCAGAAATCCCCCCCCCTCTAAAGCGGCGCGCG-3′.

(49) For fabricating the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate), mungbean nuclease was purchased from New England Biolabs (USA).

(50) For the preparation of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate), peptide 1, RA, and EDC/NHS in eppendorf tube 1 and peptide 2, 5′-end maleimide-modified siSOX9 antisense, and siSOX9 sense in eppendorf tube 2 were reacted for 4 hours in a shaking incubator in a refrigerator at 4° C. The Au substrates diced into 12 mm×35 mm were washed with a base piranha solution (15 vol % H.sub.2O.sub.2, 15 vol % NH.sub.4OH, and 70 vol % H.sub.2O) at 70° C. for 3 minutes. Au electrodes were washed, repeatedly washed with ethanol and deionized water, dried under nitrogen streams, and then put on a 60×15 mm Petri dish. For the direct immobilization on the metal substrate, 3 ml of 10 mM PBS (pH 7.4) and 100 μl of 5 μM 5′-end thiol-modified ssDNA 2 were mixed, followed by standing for 2 hours. After 2 hours, the substrate was washed with tertiary distilled water, dried under nitrogen streams, and put on a 60×15 mm Petri dish. For complementary conjugation thereto, 3 ml of 10 mM PBS (pH 7.4) and 100 μl of 5 μM csDNA 2 were mixed, followed by immersion for 1 hour. After 1 hour, the resultant substrates were washed with tertiary distilled water, dried under nitrogen streams, and put on a 60×15 mm Petri dish. For the conjugation of the thiol-modified csDNA 2 and the 5-nm gold nanoparticle to the gold substrate, 3 ml of 10 mM PBS (pH 7.4) and 5 nm-sized gold nanoparticles were immobilized for 2 hours. After 2 hours, the resultant substrates were washed with tertiary distilled water, dried under nitrogen streams, and put on a 60×15 mm Petri dish. For making bio-functional nanoparticle-dsDNA hybrid 1, 3 ml of 10 mM PBS (pH 7.4) and 5,5′-bis(mercaptomethyl)-2,2-bipyridine and CPP (CTAT) at a molar ratio of 2:1 were mixed on the gold nanoparticle-dsDNA hybrid, followed by standing for 2 hours. After 2 hours, the resultant substrates were washed with tertiary distilled water, dried under nitrogen streams, and put on a 60×15 mm Petri dish. For the preparation of bio-functional nanoparticle-dsDNA hybrid 2, eppendorf tube 1, eppendorf tube 2, and Cucibit [8] Uril (CB), which have been reacted with 3 ml of 10 mM PBS (pH 7.4), were mixed at a molar ratio of 1:1:2, followed by standing for 2 hours. After 2 hours, the resultant substrates were washed with tertiary distilled water, dried under nitrogen streams, and put on a 60×15 mm Petri dish. For making bio-functional nanoparticle-dsDNA hybrid 3, 3 ml of 10 mM PBS (pH 7.4) and 10 units of mungbean nuclease dissolved in mungbean nuclease reaction buffer were conducted for 1 hour in an incubator at 37° C. After 1 hour, the solution in the Petri dish was collected in the eppendorf tubes. For the purification of only bio-functional nanoparticle-dsDNA hybrid 3 in the collected solution, 0.2 μm-syringe filter was, first, used to remove the agglomerated bio-functional nanoparticle-dsDNA hybrid 3. Unreacted materials were, second, removed through ultrafiltration (MWCO 50 k Amicon Ultra centrifugal filter, Millipore, USA). The bio-functional nanoparticle-dsDNA hybrid 3 separated after ultrafiltration was reacted with the biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced azurin-ssDNA double layer) and 20 μl of 5 μM complementary thiol-modified csDNA. For the purification of bio-functional nanoparticle-csDNA conjugate, unreacted materials were removed through ultrafiltration (MWCO 50 k Amicon Ultra centrifugal filter, Millipore, USA) (FIG. 3).

(51) Fabrication of Biomoletron (Parts III, IV, and V)

(52) For the fabrication of the biomoletron (Part III), 20 μl of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate) was allowed to stand for 1 hour by using the fact that ssDNA of the substrate with the biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced azurin-ssDNA double layer) is complementary to csDNA of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate). After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. For the fabrication of the biomoletron (Part V), the resultant substrate was immersed in 10 μl of 10 mM AgNO.sub.3 solution for 1 hour. The introduction of metal ions into DNA nucleotide pairs of the biomoletron increases the electron delivery efficiency from the gold substrate to the bio-functional nanoparticle.

(53) After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams (FIG. 3).

(54) Detection of Hydrogen Peroxide by Amperometric Measurement

(55) For use as a working electrode, 20 μl of 0.1 mg/ml solution of three-cysteine and C-terminal RGD-introduced azurin was directly immobilized to the Au substrate (Au(100 nm)/Cr(5 nm)/SiO.sub.2/Si wafer) of 5 mm×15 mm treated with a base piranha solution. The amperometric measurement was performed using the fabricated working electrode according to various concentrations of hydrogen peroxide. The amperometric measurement was performed by a 3-electrode system using Au/azurin substrate as a working electrode, platinum as a counter electrode, and Ag/AgCl/KCl.sub.sat as a reference electrode. To 5 ml of 10 mM PBS (pH 7.4), 20 μl of 100 μM hydrogen peroxide was consecutively added, and the current-time curve was recorded while the potential was set to 0V. During the measurement of current, the convection was moved with magnetic stirring at 600 rpm. The buffer solution added in the experiments was removed by high-purity nitrogen. The CHI 660A potentiostat equipped with general purpose electrochemical software was used in the experiments.

(56) Cyclic Voltammetry Experiments for Investigating Conductivity of Au/Azurin/Metal Ion-Mediated Nucleotide Pair

(57) 20 μl of the prepared 7 μM solution of three-cysteine and C-terminal RGD-introduced azurin was allowed to stand on a gold surface of the 5 mm×15 mm Au substrate (Au (100 nm)/Cr (5 nm)/SiO2/Si wafer) treated with the piranha solution for 4 hours for direct immobilization on the gold surface via the cysteine resides. After 4 hours, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. Thereafter, the recombinant azurin-immobilized gold substrate was immersed in 20 μl of 5 μM solution of sulfo-SMCC tagged ssDNA for 2 hours. After 2 hours, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. Thereafter, 20 μl of csDNA complementary to ssDNA of Au/azurin/ssDNA was allowed to stand for 1 hour. After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. For the fabrication of Au/azurin/metal ion-mediated nucleotide pair, the resultant substrate was immersed in 10 μl of 10 mM AgNO.sub.3 solution for 1 hour. After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. The fabricated chip was used as a working electrode. The present system is a conventional 3-electrode system composed of a working electrode, a counter electrode, and a reference electrode. Pt counter electrode and Ag/AgCl reference electrode were purchased from BSA (USA). Electrochemical experiments were conducted by CHI660A electrochemical workstation. All the electrochemical experiments were conducted in 10 mM PBS (pH 7.4) (FIG. 4).

(58) Electrochemical Experiments and Fluorescence Microscope for Confirmation of Electric Release Functions

(59) For electrochemical experiments and fluorescence microscopic assay, peptides (peptide 3, peptide 4(C-t FITC)) were synthesized, and designed as follows.

(60) Peptide 3: WGG

(61) Peptide 4(C-t FITC): WGG-FITC

(62) A chemical material complex with a thiol group was immobilized for 3 hours on the 5 mm×15 mm Au substrate (Au (100 nm)/Cr (5 nm)/SiO2/Si wafer) treated with the piranha solution. The chemical substance complex was composed of 5,5′-bis(mercaptomethyl)-2,2′-bipyridine, Cucibit [8] Uril (CB), and peptide 3, and prepared by a self-assembly method. After 3 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. The fabricated chip was used as a working electrode. Amperometric measurement and cyclic voltammetry were carried out using the fabricated working electrode. The present system is a conventional 3-electrode system composed of a working electrode, a counter electrode, and a standard electrode. Pt counter electrode and Ag/AgCl reference electrode were purchased from BSA (USA). Electrochemical experiments were conducted by CHI660A electrochemical workstation (CH Instrument, USA). All the electrochemical experiments were conducted in 10 mM PBS (pH 7.4) buffer solution. For fluorescence microscopic analysis, a chemical substance complex with a thiol group was immobilized for 3 hours on the 5 mm×15 mm Au substrate (Au (100 nm)/Cr (5 nm)/SiO2/Si wafer) treated with the piranha solution. The chemical substance complex was composed of 5,5′-bis(mercaptomethyl)-2,2′-bipyridine, Cucibit [8] Uril (CB), and peptide 4, and made by a self-assembly method. After 3 hours, the resultant substrate was washed with tertiary distilled water under nitrogen streams. The fabricated sample was examined by a fluorescence microscope (Nikon Eclipse Ti-U, USA).

(63) Biomoletron Surface Investigation Using Flow Surface Plasmon Resonance (Flow SPR).

(64) For the investigation of biofilms, a surface plasmon resonance instrument (Reichert SR7500DC Dual Channel System, USA) was used, and Scrubber2 (Reichert, USA) was used as data analysis software. The 12.5 mm×12.5 mm-sized gold substrate (Au (50 nm)/Cr (1 nm)/glass slide (0.95 mm)) was purchased from Reichert (USA), and treated with oil to reduce air and bubbles between gold and prism. Detailed experimental conditions of flow surface plasmon resonance are shown in Table 2 below.

(65) TABLE-US-00008 TABLE 2 Association time (sample Dissociation time Order Sample Concentration Flow rate injection) (buffer loading) 1. Ligand Recombinant 10 ug   20 ul/min 6 min 4 min 30 sec Azurin with RGD 2. Ligand Recombinant 15 ug   20 ul/min 6 min 25 min  Azurin with RGD 3. Analyte 1 ssDNA 5 uM 30 ul/min 5 min 5 min 4. Analyte 2 scDNA-Functional 5 uM 30 ul/min 4 min 3 min GNP complex 5. Analyte 2 scDNA-Functional 5 uM 30 ul/min 4 min 20 sec 4 min 30 sec GNP complex 6. Analyte 3 Metal Ion (Ag.sup.+) 5 uM 30 ul/min 5 min 5 min

(66) Confirmation of Biomoletron Release System Using Amperometric Measurement and Surface Plasmon Resonance (SPR)

(67) 40 μl of the prepared 7 μM solution of three-cysteine and C-terminal RGD-introduced azine was allowed to stand on a gold surface of the 12.5 mm×12.5 mm Au substrate (Au (50 nm)/Cr (1 nm)/glass slide (0.95 mm) treated with the piranha solution for 4 hours for direct immobilization on the surface of the gold substrate via the cysteine resides. After 4 hours, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. Thereafter, the recombinant azurin-immobilized gold substrate was immersed in 40 μl of 5 μM solution of sulfo-SMCC tagged ssDNA for 2 hours. After 2 hours, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. For the fabrication of the biomoletron (Part III), 40 μl of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate) was allowed to stand for 1 hour by using the fact that ssDNA of the substrate with the biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced azurin-ssDNA double layer) is complementary to csDNA of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate). After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen streams. For the fabrication of the biomoletron (Part V), the resultant substrate was immersed in 20 μl of 10 mM AgNO.sub.3 solution for 1 hour. After 1 hour, the resultant substrate was washed with tertiary distilled water and dried under nitrogen stream. The fabricated chip was used as a working electrode. The amperometric measurement was performed using the fabricated working electrode. All electrochemical experiments were conducted in 10 mM PBS (pH 7.4) buffer solution.

(68) For confirmation of the biomoletron release system, a surface plasmon resonance instrument (Reichert SR7500DC Dual Channel System, USA) was used, and Scrubber2 (Reichert, USA) was used as data analysis software. The 12.5 mm×12.5 mm-sized gold substrate (Au (50 nm)/Cr (1 nm)/glass slide (0.95 mm)) was purchased from Reichert (USA), and treated with oil to reduce air and bubbles between gold and prism.

(69) Fabrication of Biomoletron-Immobilized Working Electrode for Neural Stem Cells

(70) In the present invention, a general 3-elecrochemical system composed of a working electrode (Au), a counter electrode (Pt), and a reference electrode (Ag/AgCl) was introduced. Au substrates (Au (10 nm)/Cr (2 nm)/glass wafer) diced into 12 mm×35 mm were purchased from G-mek (Korea). This substrate was semi-transparent, whereby the cells on the electrode could be easily observed through an optical microscope. The electrode was washed by sonication in alcohol and distilled water for 5 min. Au substrates diced into 12 mm×35 mm were washed with a base piranha solution (15 vol % H.sub.2O.sub.2, 15 vol % NH.sub.4OH, and 70 vol % H.sub.2O) at 70° C. for 3 minutes. Au electrodes were washed, repeatedly washed with ethanol and deionized water, dried under nitrogen streams, and then put on a 90×15 mm Petri dish. For electrochemical measurement, a plastic chamber (Lab-Tek®, Thermo fisher scientific, USA) was fixed to the gold working electrode using polydimethylsiloxane (PDMS), thereby fabricating a 10 mm×20 mm×5 mm (width×length×height) cell chip chamber with a 10 mm×20 mm exposure region. 120 μl of the prepared 7 μM solution of three-cysteine and C-terminal RGD-introduced azine was allowed to stand on a gold surface of the fabricated cell chip chamer Au substrate for 4 hours for direct immobilization on the gold surface via the cysteine resides. After 4 hours, the resultant substrate was washed twice with 10 mM PBS(pH 7.4) buffer, followed by suction with Pasteur pipette. Thereafter, the recombinant azurin-immobilized cell chip chamber Au substrate was immersed in 120 μl of 5 μM solution of sulfo-SMCC tagged ssDNA for 2 hours. After 2 hours, the resultant substrate was twice washed with 10 mM PBS (pH 7.4) buffer, followed by suction with Pasteur pipette. 120 μl of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate) was allowed to stand for 1 hour by using the fact that ssDNA of the cell chip chamber Au substrate with the biomoletron bottom portion (three-cysteine and C-terminal RGD-introduced azurin-ssDNA double layer) is complementary to csDNA of the biomoletron top portion (bio-functional nanoparticle-csDNA conjugate). After 1 hour, the resultant substrate was twice washed with 10 mM PBS (pH 7.4) buffer, followed by suction with Pasteur pipette. For the fabrication of the biomoletron on the fabricated cell chip chamber Au substrate, the resultant substrate was immersed in 60 μl of 10 mM AgNO.sub.3 solution for 1 hour. After 1 hour, the resultant substrate was twice washed with 10 mM PBS (pH 7.4) buffer, followed by suction with Pasteur pipette.

(71) Culture and Differentiation of Neural Stem Cells in Biomoletron-Immobilized Working Electrode

(72) The biomoletron-immobilized cell chip chamber Au substrate was used as a working electrode. NE4C cells were purchased from ATCC (Rockville, USA). For cell culture, MEM alpha medium (Gibco, USA) containing 10% heat-inactivated fetal bovine serum (FBS, Gibco, USA) and 1% penicillin (Gibco, USA) was used. The cells were incubated at 37° C. in humidified 5% CO.sub.2 conditions. For differentiation of neural stem cells, a potential of −0.5 V was applied to the fabricated working electrode for 200 seconds using amperometric measurement. The medium was maintained for 3 days. Thereafter, the medium was replaced every two days. The cells were stained with tryptophan blue, and counted by haemocytomer.

(73) Confirmation of Biomoletron-Based Stem Cell Differentiation Through Immunostaining

(74) The cells were fixed with 4% paraformaldehyde, and then permeated with 0.1% Triton X-100. After blocking with TBS-T containing 3% bovine serum albumin (BSA), the cells were incubated using indicated primary antibodies. The cells were washed, and then incubated using either Cy2—(Jackson ImmunoResearch Laboratories) or Alexa 594—(Life Technologies) conjugated secondary antibodies. The nuclei were stained with DAPI. Images were analyzed using a fluorescence microscope (Nikon Eclipse Ti-U, USA), and the primary antibodies used were Nestin, βIII-tubulin (Abcam, USA).

(75) Confirmation of Biomoletron-Based Neural Stem Cell Differentiation Through RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

(76) RNA was obtained using RNA extraction kit (QIAGEN, USA), and then was synthesized into complementary DNA (cDNA) according to a method provided using the First Strand cDNA synthesis kit (Thermo Scientific, USA).

(77) RT-gPCR was conducted in Takara PCR thermal cycler (Takara, Japan), and gene-specific primers used in the present invention are clearly shown in table 3.

(78) TABLE-US-00009 TABLE 3 Gene Forward sequence Reverse sequence Oct 4 5-GAGGCTACAGGGACACCTTTC-3 5-GTGCCAAAGTGGGGACCT-3 (SEQ ID NO: 52) (SEQ ID NO: 53) NANOG 5-AAATTGGTGATGAAGATGTATTCG-3 5-GCAAAACAGAGCCAAAAACG-3 (SEQ ID NO: 54) (SEQ ID NO: 55) SOX2 5-TTCACATGTCCCAGCACTACCAGA-3 5-TCACATGTGTGAGAGGGGCAGTGTGC-3 (SEQ ID NO: 56) (SEQ ID NO: 57) PAX6 5-TGTCCAACGGATGTGTGAGT-3 5-TTTCCCAAGCAAAGATGGAC-3 (SEQ ID NO: 58) (SEQ ID NO: 59) Ngn2 5-ACATCTGGAGCCGCGTAG-3 5-CAGCAGCATCAGTACCTCCTCt-3 (SEQ ID NO: 60) (SEQ ID NO: 61) Math2 5-CGACACTCAGCCTGAAAAGAt-3 5-CAAACTTTCTGCACATCTGGG-3 (SEQ ID NO: 62) (SEQ ID NO: 62) ACTB 5-GTCCTCTCCCAAGTCCACAC-3 5-GGGAGACCAAAAGCCTTCAT-3 (SEQ ID NO: 64) (SEQ ID NO: 65)

(79) Results

(80) Confirmation of Expression and RGD Peptide Sequence-Introduced Recombinant Azurin and H.sub.2O.sub.2 Consumption Function Thereof

(81) FIG. 6 shows electrophoresis and hydrogen peroxide scavenging function of recombinant azurin. For direct immobilization with the integrin located on cell surfaces, the RGD peptide-modified gene was inserted to produce recombinant azurin, which was then confirmed by electrophoresis. The recombinant RGD peptide-introduced azurin was examined for a function of scavenging hydrogen peroxide, which is one of reactive oxygen species, using amperometric measurement.

(82) Confirmation of Conductivity of Au/Azurin/Metal Ion Mediated-Nucleotide Pair

(83) FIG. 7 shows an increase in conductivity according to the number of metal ions inserted. The metal-DNA was fabricated using a combination with specific metal ions, which can be inserted into sequence portions in which mismatches between DNA double strands are generated in the complementary binding of ssDNA and csDNA located on the cell surface, and an increase in conductivity according to the increase in the number of inserted metal ions was confirmed using the electrochemical method.

(84) Confirmation of Electric Release Functions

(85) FIG. 8 shows the confirmation of the electric release functions using cyclic voltammetry and fluorescence microscopy. As a result of examining the curves before and after a potential of −0.5 V was applied to the working electrode for 200 seconds using amperometric measurement, a change in curve was confirmed, indicating the release of peptide 3. The release of peptide 4 was confirmed through a fluorescence microscope, indicating an electric release function.

(86) Confirmation of Biomoletron Surface Verification Using Flow Surface Plasmon Resonance (Flow SPR).

(87) FIG. 9 shows a table regarding flow surface plasmon resonance data and experimental conditions. It was confirmed from the data that the nano-thin film structure of a biomoletron was favorably. The nano-thin film structure means a multi-layered structure of the biomoletron. 1st layer: gold substrate, 2nd layer: azurin protein, 3rd layer: sulfo-SMCC tagged ssDNA, 4th layer: biomoletron top portion (bio-functional nanoparticle-csDNA conjugate, 5th layer: AgNO.sub.3

(88) It is shown that the RU value increases as the number of layers in the nano-thin film structure increases. The results confirmed that the nano-thin film structure of the biomoletron was well formed.

(89) Confirmation of Electric Release System Function of Biomoletron

(90) FIG. 10 shows surface plasmon resonance data for confirming the electric release system function of the biomoletron. In order to investigate the electric release system function of the fabricated three-cysteine and C-terminal RGD peptide-introduced biomoletron nano-thin film structure, amperometric measurement was introduced. The voltage was applied to the biomoletron nano-thin film structure at −0.5 V and −1 V to investigate the electric release system of the functional complex for cell differentiation using SPR. From the results that the SPR angle was reduced after the application of −0.5 V and −1 V compared with that before the application of the voltages, it was confirmed that the electric release system of the functional complex for cell differentiation of the newly fabricated RGD-introduced biomoletron was favorably operated.

(91) Confirmation of Cell Penetration of Biomoletron

(92) FIG. 11 shows cell penetration of a biomoletron through sequential experimental methods. It can be seen from the confocal microscopic data of FIG. 11a that the biomoletron was fabricated near the cell membrane and that there are three possible cases (no penetrating into cell membrane, whole penetrating into cell membrane, and partial penetrating into cell membrane). The fluorescence microscopic data in FIG. 11b show that the FITC entered the cell, and thus the case of “no penetrating into cell membrane” was excluded. The confocal microscopic data in FIG. 11c show that the protein (RGD azurin), which corresponds to a portion of the biomoletron, attached to only the cell surface (integrin), and thus the case of “whole penetrating into cell membrane” was excluded. It can be seen that only the case of “partial penetrating into cell membrane”, which is targeted by the present inventors, was ultimately possible.

(93) Confirmation of Biomoletron-Based Neural Stem Cell Differentiation

(94) FIG. 12 shows the results of confirming biomoletron-based neural stem cell differentiation using immunostaining and detection quantitative PCR. FIG. 12a confirmed βIII-tubulin, a stem cell differentiation marker, according to the concentrations of RA and siSOX9 using immunostaining. The biomoletron-based stem cell differentiation was confirmed using detection quantitative PCR (FIG. 12a). It was confirmed that after 14 days of culture, the bands of the stem cell differentiation markers pax6, Ngn2, and Math2 were observed, indicating favorable differentiation.

(95) Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.