Sulphonamides and compositions thereof for treating conditions associated with NLRP activity
11718631 · 2023-08-08
Assignee
Inventors
- Shankar Venkatraman (Lansdale, PA)
- Shomir Ghosh (Brookline, MA)
- William R. Roush (Jupiter, FL)
- Dong-Ming SHEN (Boston, MA, US)
- Jason Katz (Newton, MA)
- Hans Martin Seidel (Concord, MA)
Cpc classification
C07D409/12
CHEMISTRY; METALLURGY
C07D231/12
CHEMISTRY; METALLURGY
C07D307/54
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
C07D277/30
CHEMISTRY; METALLURGY
International classification
C07D231/12
CHEMISTRY; METALLURGY
C07D277/30
CHEMISTRY; METALLURGY
C07D307/54
CHEMISTRY; METALLURGY
C07D409/12
CHEMISTRY; METALLURGY
Abstract
In one aspect, compounds of Formula AA, or a pharmaceutically acceptable salt thereof, are featured: wherein the variables shown in Formula AA can be as defined anywhere herein. Compounds AA are modulators of NLRP1 and/or NLRP3 ##STR00001##
Claims
1. A compound, selected from the group consisting of the compounds below: TABLE-US-00013 Compound Structure 101
2. A pharmaceutical composition comprising a compound or salt as claimed in claim 1 and one or more pharmaceutically acceptable excipients.
Description
DETAILED DESCRIPTION
(1) In some embodiments, provided herein is a compound of Formula AA
(2) ##STR00005##
or a pharmaceutically acceptable salt thereof,
wherein
m=0, 1, or 2;
n=0, 1, or 2;
p=0, 1, or 2;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Y is selected from a bond, —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—, and C.sub.2-3 alkynylene;
Y.sup.1 is selected from O, S, SO.sub.2, NR.sup.15, CR.sup.16OH, CR.sup.16NR.sup.8, C(O)NR.sup.15, and C(O);
each occurrence of o is selected from 0 and 1, and wherein at least one o in —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o- or —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o— is 1;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13, and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl optionally substituted with halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(3) In some embodiments, provided herein is a compound of Formula AA
(4) ##STR00006##
or a pharmaceutically acceptable salt thereof,
wherein
m=0, 1, or 2;
n=0, 1, or 2;
p=0, 1, or 2;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, —NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.0, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.1R.sup.9;
Y is selected from a bond, —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—, and C.sub.2-3 alkynylene;
Y.sup.1 is selected from O, S, SO.sub.2, NR.sup.15, CR.sup.16OH, CR.sup.16NR.sup.8, C(O)NR.sup.15, and C(O);
each occurrence of o is selected from 0 and 1, and wherein at least one o in —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o- or —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o— is 1;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
wherein when Y is Y.sup.1 and Y.sup.1 is C(O), then Z is bonded to Y from a C ring member;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.1CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.42, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13, and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl optionally substituted with halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(5) In some embodiments, provided herein is a compound of Formula AA
(6) ##STR00007##
or a pharmaceutically acceptable salt thereof,
wherein
m=0, 1, or 2
n=0, 1, or 2
p=0, 1 or 2
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Y is selected from a bond, O, S, SO.sub.2, NR.sup.15, CO, C.sub.2 alkynylene, and CR.sup.16R.sup.17;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.3, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(7) In some embodiments, provided herein is a compound of Formula AA
(8) ##STR00008##
or a pharmaceutically acceptable salt thereof,
wherein
m=0, 1, or 2
n=0, 1, or 2
p=0, 1 or 2
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.3)NR.sup.11R.sup.12, CONR.sup.1R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.1R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Y is selected from a bond, O, S, SO.sub.2, NR.sup.15, CO, and CR.sup.16R.sup.17;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.0, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.14, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.1 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(9) In some embodiments, provided herein is a compound of Formula AA
(10) ##STR00009##
or a pharmaceutically acceptable salt thereof,
wherein
m=0, 1, or 2
n=0, 1, or 2
p=0, 1 or 2
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.1CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Y is selected from a bond, O, S, SO.sub.2, NR.sup.15, CO, and CR.sup.16R.sup.17;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.9 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9; each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(11) In some embodiments, provided herein is a compound of Formula AA
(12) ##STR00010##
or a pharmaceutically acceptable salt thereof,
wherein
m=1 or 2;
n=1;
p=0, 1, or 2;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
wherein one pair of R.sup.1 and R.sup.2 is on adjacent atoms, and taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
wherein when m is 2, then the R.sup.1 that is not taken together with an adjacent R.sup.2 and the atoms connecting them to form a ring is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.2, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
Y is selected from a bond, —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—, and C.sub.2-3 alkynylene;
Y.sup.1 is selected from O, S, SO.sub.2, NR.sup.5, CR.sup.16OH, CR.sup.16NR.sup.8, C(O)NR.sup.15, and C(O);
each occurrence of o is selected from 0 and 1, and wherein at least one o in —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o- or —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o— is 1;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, (C═NR.sup.3)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13, and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl optionally substituted with halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.7 is selected from H and C.sub.1-C.sub.6 alkyl.
(13) In some embodiments, provided herein is a compound of Formula AA
(14) ##STR00011##
or a pharmaceutically acceptable salt thereof,
wherein
m=1 or 2;
n=1;
p=0, 1, or 2;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
wherein one pair of R.sup.1 and R.sup.2 is on adjacent atoms, and taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
wherein when m is 2, then the R.sup.1 that is not taken together with an adjacent R.sup.2 and the atoms connecting them to form a ring is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.1 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
Y is selected from a bond, O, S, SO.sub.2, NR.sup.15, or CR.sup.16R.sup.17;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl optionally substituted with C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.15 is selected from H and C.sub.1-C.sub.6 alkyl;
R.sup.16 is selected from H and C.sub.1-C.sub.6 alkyl; and
R.sup.17 is selected from H and C.sub.1-C.sub.6 alkyl.
(15) In some embodiments, the compound of Formula AA is a compound of formula AA-I
(16) ##STR00012##
or a pharmaceutically acceptable salt thereof.
(17) In some embodiments of a compound of Formula AA-I,
(18) m=0, 1, or 2;
(19) n=0, 1, or 2;
(20) p=0, 1, or 2;
(21) wherein
(22) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(23) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.5 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.1R.sup.2, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.1R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.1 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; and
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(24) In some embodiments of a compound of Formula AA-I,
(25) m=0, 1, or 2;
(26) n=0, 1, or 2;
(27) p=0, 1, or 2;
(28) wherein
(29) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(30) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.1R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.1CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.1R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.1R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; and
each of R.sup.1 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(31) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(32) m=0, 1, or 2;
(33) n=0, 1, or 2;
(34) p=0, 1, or 2;
(35) wherein
(36) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(37) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and NR.sup.8R.sup.9,
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, and C.sub.6-C.sub.10 aryl,
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6cycloalkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; and
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(38) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(39) m=0, 1, or 2;
(40) n=0, 1, or 2;
(41) p=0, 1, or 2;
(42) wherein
(43) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(44) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and NR.sup.8R.sup.9,
Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, and C.sub.6-C.sub.10 aryl,
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.9 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; and
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(45) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(46) m=0 or 1;
(47) n=0 or 1;
(48) p=0, 1, or 2;
(49) wherein
(50) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(51) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
(52) wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and NR.sup.8R.sup.9,
(53) Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl, wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl,
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2; and
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.6 cycloalkyl.
(54) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(55) m=0 or 1;
(56) n=0 or 1;
(57) p=0, 1, or 2;
(58) wherein
(59) A is a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, or a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl;
(60) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
(61) wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and NR.sup.8R.sup.9,
(62) Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl,
each X is independently N or CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, and N(C.sub.1-C.sub.6 alkyl).sub.2; and
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(63) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(64) m=1;
(65) n=0;
(66) p=0 or 2;
(67) wherein
(68) A is a phenyl;
(69) R.sup.1 is (dimethylamino)methyl;
(70) Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy, wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl,
each X is CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is hydrogen; and
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.6 cycloalkyl.
(71) In some embodiments of a compound of Formula AA or a compound of Formula AA-I,
(72) m=1;
(73) n=0;
(74) p=0 or 2;
(75) wherein
(76) A is a phenyl;
(77) R.sup.1 is (dimethylamino)methyl;
(78) Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl;
or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl,
each X is CR.sup.6;
each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy,
wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl;
each of R.sup.4 and R.sup.5 is hydrogen; and
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(79) In some embodiments, when Y is Y.sup.1 and Y.sup.1 is C(O), then Z is bonded to Y from a C ring member;
(80) In some embodiments the variables shown in the formulae herein are as follows:
(81) The Variables m and n
(82) In some embodiments m=0, 1, or 2.
(83) In some embodiments m=0 or 1.
(84) In some embodiments m=1 or 2.
(85) In some embodiments m=0.
(86) In some embodiments m=1.
(87) In some embodiments m=2.
(88) In some embodiments n=0, 1, or 2.
(89) In some embodiments n=0 or 1.
(90) In some embodiments n=1 or 2.
(91) In some embodiments n=0.
(92) In some embodiments n=1.
(93) In some embodiments n=2.
(94) In some embodiments, m=0 and n=0.
(95) In some embodiments, m=1 and n=0.
(96) In some embodiments, m=1 and n=1.
(97) In some embodiments, m=1 or 2; and n=1 or 2.
(98) In certain embodiments of the foregoing, the sum of m and n is 2 or 3.
(99) In some embodiments, m=1; and n=1 or 2.
(100) In some embodiments, m=1 or 2; and n=1.
(101) In some embodiments, m=2; and n=1.
(102) The Ring a and Substitutions on the Ring A
(103) In some embodiments, A is a 5-10-membered (e.g., 5-6-membered) monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 (e.g., C.sub.6) monocyclic or bicyclic aryl, such as phenyl.
(104) In some embodiments, A is a 5-10-membered (e.g., 5-6-membered) monocyclic or bicyclic heteroaryl.
(105) In some embodiments, A is a 5-membered heteroaryl (e.g., pyrazolyl, thiophenyl, thiazolyl, and imidazolyl).
(106) In some embodiments, A is a C.sub.6-C.sub.10 monocyclic or bicyclic aryl.
(107) In some embodiments, A is phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.
(108) In some embodiments, A is furanyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(109) In some embodiments, A is thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(110) In some embodiments, A is pyrrolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(111) In some embodiments, A is imidazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(112) In some embodiments, A is oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(113) In some embodiments, A is thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(114) In some embodiments, A is isooxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(115) In some embodiments, A is isothiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(116) In some embodiments, A is pyrazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(117) In some embodiments, A is triazolyl (e.g., 1,2,3-triazolyl or 1,2,4-triazolyl) optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(118) In some embodiments, A is pyridyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(119) In some embodiments, A is pyrimidinyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(120) In some embodiments, A is pyrazinyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(121) In some embodiments, A is pyridazinyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(122) In some embodiments, A is triazinyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.
(123) In some embodiments, A is phenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(124) In some embodiments, A is furanyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(125) In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(126) In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(127) In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(128) In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(129) In some embodiments, A is pyridyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.
(130) In some embodiments, A is phenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(131) In some embodiments, A is furanyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(132) In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(133) In some embodiments, A is pyrrolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(134) In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(135) In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(136) In some embodiments, A is isooxazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(137) In some embodiments, A is isothiazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(138) In some embodiments, A is imidazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(139) In some embodiments, A is triazolyl (e.g., 1,2,3-triazolyl or 1,2,4-triazolyl) substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(140) In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(141) In some embodiments, A is pyridyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(142) In some embodiments, A is pyrimidyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(143) In some embodiments, A is pyrazinyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(144) In some embodiments, A is pyridazinyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(145) In some embodiments, A is triazinyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.
(146) In some embodiments, A is one of the rings disclosed hereinbelow, wherein in each case the bond that is shown as being broken by the wavy line connects A to the S(O).sub.2NHC(O)CR.sup.4R.sup.5 moiety of Formula AA.
(147) In some embodiments, the optionally substituted ring A is
(148) ##STR00013##
(149) In some embodiments, the optionally substituted ring A is
(150) ##STR00014##
(151) In some embodiments, the optionally substituted ring A is
(152) ##STR00015##
(153) In some embodiments, the optionally substituted ring A is
(154) ##STR00016##
(155) In some embodiments, the optionally substituted ring A is
(156) ##STR00017##
(157) In some embodiments, the optionally substituted ring A is
(158) ##STR00018##
(159) In some embodiments, the optionally substituted ring A is
(160) ##STR00019##
(161) In some embodiments, the optionally substituted ring A is
(162) ##STR00020##
(163) In some embodiments, the optionally substituted ring A is
(164) ##STR00021##
(165) In some embodiments, the optionally substituted ring A is
(166) ##STR00022##
(167) In some embodiments, the optionally substituted ring A is
(168) ##STR00023##
(169) In some embodiments, the optionally substituted ring A is
(170) ##STR00024##
(171) In some embodiments, the optionally substituted ring A is
(172) ##STR00025##
(173) In some embodiments, the optionally substituted ring A is
(174) ##STR00026##
(175) In some embodiments, the substituted ring A is
(176) ##STR00027##
(177) In some embodiments, the optionally substituted ring A is
(178) ##STR00028##
(179) In some embodiments, the substituted ring A is
(180) ##STR00029##
(181) In some embodiments, the optionally substituted ring A is
(182) ##STR00030##
(183) In some embodiments, the optionally substituted ring A is
(184) ##STR00031##
(185) In some embodiments, the optionally substituted ring A is
(186) ##STR00032##
(187) In some embodiments, the substituted ring A is
(188) ##STR00033##
(189) In some embodiments, the optionally substituted ring A is
(190) ##STR00034##
(191) In some embodiments, the optionally substituted ring A is
(192) ##STR00035##
(193) In some embodiments, the optionally substituted ring A is
(194) ##STR00036##
(195) In some embodiments, the optionally substituted ring A is
(196) ##STR00037##
(197) In some embodiments, the substituted ring A is
(198) ##STR00038##
(199) In some embodiments, the substituted ring A is
(200) ##STR00039##
(201) In some embodiments, the substituted ring A is
(202) ##STR00040##
(203) In some embodiments, the optionally substituted ring A is
(204) ##STR00041##
(205) In some embodiments, the optionally substituted ring A is
(206) ##STR00042##
(207) In some embodiments, the optionally substituted ring A is
(208) ##STR00043##
(209) In some embodiments, the optionally substituted ring A is S
(210) ##STR00044##
(211) In some embodiments, the optionally substituted ring A is
(212) ##STR00045##
(213) In some embodiments, the optionally substituted ring A is
(214) ##STR00046##
(215) In some embodiments, the optionally substituted ring A is
(216) ##STR00047##
(217) In some embodiments, the optionally substituted ring A is
(218) ##STR00048##
(219) In some embodiments, the optionally substituted ring A is
(220) ##STR00049##
(221) In some embodiments, the optionally substituted ring A is
(222) ##STR00050##
(223) In some embodiments, the optionally substituted ring A is
(224) ##STR00051##
(225) In some embodiments, the optionally substituted ring A is
(226) ##STR00052##
(227) In some embodiments, the optionally substituted ring A is
(228) ##STR00053##
(229) In some embodiments, the optionally substituted ring A is
(230) ##STR00054##
(231) In some embodiments, the optionally substituted ring A is
(232) ##STR00055##
(233) In some embodiments, the optionally substituted ring A is
(234) ##STR00056##
(235) In some embodiments, the optionally substituted ring A is
(236) ##STR00057##
(237) In some embodiments, the optionally substituted ring A is
(238) ##STR00058##
(239) In some embodiments, the optionally substituted ring A is
(240) ##STR00059##
(241) In some embodiments, the optionally substituted ring A is
(242) ##STR00060##
(243) In some embodiments, the optionally substituted ring A is
(244) ##STR00061##
(245) In some embodiments, the optionally substituted ring A is
(246) ##STR00062##
(247) In some embodiments, the optionally substituted ring A is
(248) ##STR00063##
(249) In some embodiments, the optionally substituted ring A is
(250) ##STR00064##
(251) In some embodiments, the optionally substituted ring A is
(252) ##STR00065##
(253) In some embodiments, the optionally substituted ring A is
(254) ##STR00066##
(255) In some embodiments, the optionally substituted ring A is
(256) ##STR00067##
(257) In some embodiments, the optionally substituted ring A is
(258) ##STR00068##
(259) In some embodiments, the optionally substituted ring A is
(260) ##STR00069##
(261) In some embodiments, the optionally substituted ring A is
(262) ##STR00070##
(263) In some embodiments, the optionally substituted ring A is
(264) ##STR00071##
(265) In some embodiments, the optionally substituted ring A is
(266) ##STR00072##
(267) In some embodiments, the optionally substituted ring A is
(268) ##STR00073##
(269) In some embodiments, the optionally substituted ring A is
(270) ##STR00074##
(271) In some embodiments, the optionally substituted ring A is
(272) ##STR00075##
(273) In some embodiments, the optionally substituted ring A is
(274) ##STR00076##
(275) In some embodiments, the optionally substituted ring A is
(276) ##STR00077##
(277) In some embodiments, the optionally substituted ring A is
(278) ##STR00078##
(279) In some embodiments, the optionally substituted ring A is
(280) ##STR00079##
(281) In some embodiments, the optionally substituted ring A is
(282) ##STR00080##
(283) In some embodiments, the optionally substituted ring A is
(284) ##STR00081##
(285) In some embodiments, the optionally substituted ring A is
(286) ##STR00082##
(287) In some embodiments, the optionally substituted ring A is
(288) ##STR00083##
(289) In some embodiments, the optionally substituted ring A is
(290) ##STR00084##
(291) In some embodiments, the optionally substituted ring A is
(292) ##STR00085##
(293) In some embodiments, the optionally substituted ring A is
(294) ##STR00086##
(295) In some embodiments, the optionally substituted ring A is
(296) ##STR00087##
(297) In some embodiments, the optionally substituted ring A is
(298) ##STR00088##
(299) In some embodiments, the optionally substituted ring A is
(300) ##STR00089##
(301) In some embodiments, the optionally substituted ring A is
(302) ##STR00090##
(303) In some embodiments, the optionally substituted ring A is
(304) ##STR00091##
(305) In some embodiments, the optionally substituted ring A is
(306) ##STR00092##
(307) In some embodiments, the optionally substituted ring A is
(308) ##STR00093##
(309) In some embodiments, the optionally substituted ring A is
(310) ##STR00094##
(311) In some embodiments, the optionally substituted ring A is
(312) ##STR00095##
(313) In some embodiments, the optionally substituted ring A is
(314) ##STR00096##
(315) In some embodiments, the optionally substituted ring A is
(316) ##STR00097##
(317) In some embodiments, the optionally substituted ring A is
(318) ##STR00098##
(319) In some embodiments, the optionally substituted ring A is
(320) ##STR00099##
(321) In some embodiments, the optionally substituted ring A is
(322) ##STR00100##
(323) In some embodiments, the optionally substituted ring A is
(324) ##STR00101##
(325) In some embodiments, the optionally substituted ring A is
(326) ##STR00102##
(327) In some embodiments, the optionally substituted ring A is
(328) ##STR00103##
(329) In some embodiments, the optionally substituted ring A is
(330) ##STR00104##
(331) In some embodiments, the optionally substituted ring A is
(332) ##STR00105##
(333) In some embodiments, the optionally substituted ring A is
(334) ##STR00106##
(335) In some embodiments, the substituted ring A is
(336) ##STR00107##
(337) In some embodiments, the substituted ring A is
(338) ##STR00108##
(339) In some embodiments, the substituted ring A is
(340) ##STR00109##
(341) In some embodiments, the substituted ring A is
(342) ##STR00110##
(343) In some embodiments, the substituted ring A is
(344) ##STR00111##
(345) In some embodiments, the substituted ring A is
(346) ##STR00112##
(347) In some embodiments, the substituted ring A is
(348) ##STR00113##
(349) In some embodiments, the substituted ring A is
(350) ##STR00114##
(351) In some embodiments, the substituted ring A is
(352) ##STR00115##
(353) In some embodiments, the substituted ring A is
(354) ##STR00116##
(355) In some embodiments, the substituted ring A is
(356) ##STR00117##
(357) In some embodiments, the substituted ring A is
(358) ##STR00118##
(359) In some embodiments, the substituted ring A is
(360) ##STR00119##
(361) In some embodiments, the substituted ring A is
(362) ##STR00120##
(363) In some embodiments, the substituted ring A is
(364) ##STR00121##
(365) In some embodiments, the optionally substituted ring A is
(366) ##STR00122##
(367) In some embodiments, the optionally substituted ring A is
(368) ##STR00123##
(369) In some embodiments, the optionally substituted ring A is
(370) ##STR00124##
(371) In some embodiments, the optionally substituted ring A is
(372) ##STR00125##
(373) In some embodiments, the optionally substituted ring A is
(374) ##STR00126##
(375) In some embodiments, the optionally substituted ring A is
(376) ##STR00127##
(377) In some embodiments, the optionally substituted ring A is
(378) ##STR00128##
(379) In some embodiments, the optionally substituted ring A is
(380) ##STR00129##
(381) In some embodiments, the optionally substituted ring A is
(382) ##STR00130##
(383) In some embodiments, the optionally substituted ring A is
(384) ##STR00131##
(385) In some embodiments, the optionally substituted ring A is
(386) ##STR00132##
(387) In some embodiments, the optionally substituted ring A is
(388) ##STR00133##
(389) In some embodiments, the optionally substituted ring A is
(390) ##STR00134##
(391) In some embodiments, the optionally substituted ring A is
(392) ##STR00135##
(393) In some embodiments, the optionally substituted ring A is
(394) ##STR00136##
(395) In some embodiments, the optionally substituted ring A is
(396) ##STR00137##
(397) In some embodiments, the optionally substituted ring A is
(398) ##STR00138##
(399) In some embodiments, the optionally substituted ring A is
(400) ##STR00139##
(401) In some embodiments, the optionally substituted ring A is
(402) ##STR00140##
(403) In some embodiments, the optionally substituted ring A is
(404) ##STR00141##
(405) In some embodiments, the optionally substituted ring A is
(406) ##STR00142##
(407) In some embodiments, the optionally substituted ring A is
(408) ##STR00143##
(409) In some embodiments, the optionally substituted ring A is
(410) ##STR00144##
(411) In some embodiments, the optionally substituted ring A is
(412) ##STR00145##
(413) In some embodiments, the optionally substituted ring A is
(414) ##STR00146##
(415) In some embodiments, the optionally substituted ring A is
(416) ##STR00147##
(417) In some embodiments, the optionally substituted ring A is selected from the group consisting of:
(418) ##STR00148##
(419) In some embodiments, the optionally substituted ring A is selected from the group consisting of:
(420) ##STR00149##
The groups R.sup.1 and R.sup.2
(421) In some embodiments, R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.1R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(422) In some embodiments,
(423) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.1R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(424) In some embodiments,
(425) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(426) In some embodiments,
(427) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(428) In some embodiments,
(429) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(430) In some embodiments,
(431) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.1R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(432) In some embodiments,
(433) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(434) In some embodiments,
(435) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is unsubstituted; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(436) In some embodiments,
(437) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is unsubstituted; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(438) In some embodiments,
(439) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.
(440) In some embodiments,
(441) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(442) In some embodiments,
(443) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(444) In some embodiments, at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(445) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form one monocyclic or bicyclic C.sub.4-C.sub.2 carbocyclic ring or one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3-to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(446) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form one monocyclic or bicyclic C.sub.6-C.sub.8 carbocyclic ring or one monocyclic or bicyclic 5-to-8-membered heterocyclic ring containing 1 heteroatom or heteroatomic group independently selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(447) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.6-C.sub.8 carbocyclic ring or a monocyclic or bicyclic 5-to-8-membered heterocyclic ring containing 1 heteroatom or heteroatomic group independently selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(448) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.6-C.sub.8 carbocyclic ring or a monocyclic or bicyclic 5-to-8-membered heterocyclic ring containing 2 heteroatoms and/or heteroatomic groups each independently selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(449) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(450) ##STR00150##
wherein each represents a point of attachment to Ring A and wherein the
(451) ##STR00151##
moiety is optionally substituted as described elsewhere herein.
(452) In certain embodiments, the bottom in the
(453) ##STR00152##
moiety represents a point of attachment to a ring nitrogen atom in Ring A.
(454) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(455) ##STR00153##
wherein each represents a point of attachment to Ring A.
(456) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(457) ##STR00154##
wherein each represents a point of attachment to Ring A.
(458) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(459) ##STR00155##
wherein each represents a point of attachment to Ring A.
(460) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(461) ##STR00156##
wherein each represents a point of attachment to Ring A.
(462) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(463) ##STR00157##
wherein each represents a point of attachment to Ring A.
(464) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(465) ##STR00158##
wherein each represents a point of attachment to Ring A.
(466) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(467) ##STR00159##
wherein each represents a point of attachment to Ring A.
(468) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(469) ##STR00160##
wherein each represents a point of attachment to Ring A.
(470) In certain embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(471) ##STR00161##
wherein each represents a point of attachment to Ring A.
(472) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(473) ##STR00162##
wherein each represents a point of attachment to Ring A.
(474) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(475) ##STR00163##
wherein each represents a point of attachment to Ring A and wherein the
(476) ##STR00164##
moiety is optionally substituted as described elsewhere herein.
(477) In certain embodiments (where Ring A contains one or more nitrogen atoms), the bottom in the
(478) ##STR00165##
moiety represents a point of attachment to a ring nitrogen atom in Ring A.
(479) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(480) ##STR00166##
wherein each represents a point of attachment to Ring A and wherein the
(481) ##STR00167##
moiety is optionally substituted as described elsewhere herein.
(482) In certain embodiments (where Ring A contains one or more nitrogen atoms), the bottom in the
(483) ##STR00168##
moiety represents a point of attachment to a ring nitrogen atom in Ring A.
(484) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(485) ##STR00169##
wherein each represents a point of attachment to Ring A and wherein the
(486) ##STR00170##
moiety is optionally substituted as described elsewhere herein.
(487) In certain embodiments (where Ring A contains one or more nitrogen atoms), the bottom in the
(488) ##STR00171##
moiety represents a point of attachment to a ring nitrogen atom in Ring A.
(489) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(490) ##STR00172##
wherein each represents a point of attachment to Ring A and wherein the
(491) ##STR00173##
moiety is optionally substituted as described elsewhere herein.
(492) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(493) ##STR00174##
wherein each represents a point of attachment to Ring A and wherein the
(494) ##STR00175##
moiety is optionally substituted as described elsewhere herein.
(495) In some embodiments, one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together, forms:
(496) ##STR00176##
wherein each represents a point of attachment to Ring A and wherein the
(497) ##STR00177##
moiety is optionally substituted as described elsewhere herein.
(498) In certain embodiments (where Ring A contains one or more nitrogen atoms), the bottom in the
(499) ##STR00178##
moiety represents a point of attachment to a ring nitrogen atom in Ring A.
(500) In some embodiments,
(501) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, S(O)C.sub.1-C.sub.6 alkyl, 5- to 10-membered heteroaryl, and 3- to 7-membered heterocycloalkyl,
(502) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.
(503) In some embodiments, m=1; n=0; and
(504) R.sup.1 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.
(505) In some embodiments, m=1; n=0; and
(506) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl,
(507) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.
(508) In some embodiments, m=1; n=1; and
(509) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl;
wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.
(510) In some embodiments, m=1; n=1; and,
(511) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl,
(512) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.
(513) In some embodiments, m=1; n=1; and
(514) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(515) In some embodiments, m=1; n=1; and
(516) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(517) In some embodiments, m=1; n=1; and
(518) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(519) In some embodiments, m=1; n=1; and
(520) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(521) In some embodiments, m=1 or 2; n=1; and
(522) one pair of R.sup.1 and R.sup.2 is on adjacent atoms, and taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
(523) In certain embodiments of the foregoing (when m is 2), the R.sup.1 that is not taken together with an adjacent R.sup.2 and the atoms connecting them to form a ring is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, C(O)-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3-to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, C.sub.3-C.sub.7cycloalkyl and 3- to 7-membered heterocycloalkyl.
(524) In some embodiments, m=1; n=1; and
(525) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(526) In some embodiments, m=1; n=1; and
(527) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
(528) In some embodiments, m=1; n=1; and
(529) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
Particular Embodiments Wherein m=1 and n=0:
(530) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.
(531) In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl.
(532) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl.
(533) In some embodiments, R.sup.1 is methyl.
(534) In some embodiments, R.sup.1 is isopropyl.
(535) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with hydroxy at the carbon directly connected to ring A.
(536) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl.
(537) In some embodiments, R.sup.1 is hydroxymethyl.
(538) In some embodiments, R.sup.1 is 1-hydroxyethyl.
(539) In some embodiments, R.sup.1 is 2-hydroxyethyl.
(540) In some embodiments, R.sup.1 is 1-hydroxy-2-propyl.
(541) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy.
(542) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl.
(543) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl substituted with hydroxy at the carbon directly connected to ring A.
(544) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl.
(545) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl.
(546) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl.
(547) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl.
(548) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy.
(549) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl.
(550) In some embodiments, R.sup.1 is morpholinyl (e.g., 4-morpholinyl).
(551) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl.
(552) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl substituted with hydroxy at the carbon directly connected to ring A.
(553) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo.
(554) In some embodiments, R.sup.1 is COCH.sub.3.
(555) In some embodiments, R.sup.1 is COCH.sub.2CH.sub.3.
(556) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more oxo.
(557) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more oxo.
(558) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.
(559) In some embodiments, R.sup.1 is 2-methoxy-2-propyl.
(560) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.
(561) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.
(562) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9.
(563) In some embodiments, R.sup.1 is (dimethylamino)methyl.
(564) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.
(565) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.
(566) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkyl optionally substituted with one or more hydroxy.
(567) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkoxy.
(568) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkoxy.
(569) In some embodiments, R.sup.1 is halo.
(570) In some embodiments, R.sup.1 is fluoro.
(571) In some embodiments, R.sup.1 is chloro.
(572) In some embodiments, R.sup.1 is CN.
(573) In some embodiments, R.sup.1 is NO.sub.2.
(574) In some embodiments, R.sup.1 is COC.sub.1-C.sub.6 alkyl.
(575) In some embodiments, R.sup.1 is CO—C.sub.6-C.sub.10 aryl.
(576) In some embodiments, R.sup.1 is CO-5- to 10-membered heteroaryl.
(577) In some embodiments, R.sup.1 is CO.sub.2C.sub.1-C.sub.6 alkyl.
(578) In some embodiments, R.sup.1 is CO.sub.2C.sub.3-C.sub.8 cycloalkyl.
(579) In some embodiments, R.sup.1 is OCOC.sub.1-C.sub.6 alkyl.
(580) In some embodiments, R.sup.1 is OCOC.sub.6-C.sub.10 aryl.
(581) In some embodiments, R.sup.1 is OCO(5- to 10-membered heteroaryl).
(582) In some embodiments, R.sup.1 is OCO(3- to 7-membered heterocycloalkyl).
(583) In some embodiments, R.sup.1 is C.sub.6-C.sub.10 aryl.
(584) In some embodiments, R.sup.1 is phenyl.
(585) In some embodiments, R.sup.1 is 5- to 10-membered heteroaryl.
(586) In some embodiments, R.sup.1 is pyridyl (e.g., 4-pyridyl).
(587) In some embodiments, R.sup.1 is pyrazolyl (e.g., 1-pyrazolyl).
(588) In some embodiments, R.sup.1 is NH.sub.2.
(589) In some embodiments, R.sup.1 is NHC.sub.1-C.sub.6 alkyl.
(590) In some embodiments, R.sup.1 is N(C.sub.1-C.sub.6 alkyl).sub.2.
(591) In some embodiments, R.sup.1 is CONR.sup.8R.sup.9.
(592) In some embodiments, R.sup.1 is SF.sub.5.
(593) In some embodiments, R.sup.1 is SC.sub.1-C.sub.6 alkyl,
(594) In some embodiments, R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(595) In some embodiments, R.sup.1 is S(O.sub.2)CH.sub.3.
(596) In some embodiments, R.sup.1 is S(O.sub.2)NR.sup.11R.sup.12.
(597) In some embodiments, R.sup.1 is S(O.sub.2)N(CH.sub.3).sub.2.
(598) In some embodiments, R.sup.1 is S(O)C.sub.1-C.sub.6 alkyl.
(599) In some embodiments, R.sup.1 is S(O)CH.sub.3.
(600) In some embodiments, R.sup.1 is attached to a carbon of an aryl ring A.
(601) In some embodiments, R.sup.1 is attached to a carbon of a heteroaryl ring A.
(602) In some embodiments, R.sup.1 is attached to a nitrogen of a heteroaryl ring A.
(603) Particular Embodiments Wherein m=1 and n=1:
(604) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.
(605) In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl.
(606) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl.
(607) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl.
(608) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl.
(609) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl.
(610) In some embodiments, R.sup.1 is hydroxymethyl and R.sup.2 is methyl.
(611) In some embodiments, R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl.
(612) In some embodiments, R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl.
(613) In some embodiments, R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl.
(614) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl.
(615) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl.
(616) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl.
(617) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl.
(618) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl.
(619) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5.
(620) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SC.sub.1-C.sub.6 alkyl.
(621) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(622) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)CH.sub.3.
(623) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.
(624) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro.
(625) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro.
(626) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.
(627) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl.
(628) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl.
(629) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl.
(630) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl.
(631) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.
(632) In some embodiments, R.sup.1 is morpholinyl, and R.sup.2 is methyl.
(633) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl.
(634) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.
(635) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro.
(636) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro.
(637) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl.
(638) In some embodiments, R.sup.1 is COCH.sub.3, and R.sup.2 is methyl.
(639) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.
(640) In some embodiments, R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl.
(641) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl.
(642) In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl.
(643) In some embodiments, R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl.
(644) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl.
(645) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl.
(646) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl.
(647) In some embodiments, R.sup.2 is hydroxymethyl and R.sup.1 is methyl.
(648) In some embodiments, R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl.
(649) In some embodiments, R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl.
(650) In some embodiments, R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl.
(651) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R is C.sub.6-C.sub.10 aryl.
(652) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl.
(653) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R is 5- to 10-membered heteroaryl.
(654) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl.
(655) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl.
(656) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5.
(657) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SC.sub.1-C.sub.6 alkyl.
(658) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(659) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3.
(660) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.
(661) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro.
(662) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro.
(663) In some embodiments, R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.
(664) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl.
(665) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl.
(666) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl.
(667) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl.
(668) In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.
(669) In some embodiments, R.sup.2 is morpholinyl, and R.sup.1 is methyl.
(670) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl.
(671) In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.
(672) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro.
(673) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro.
(674) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl.
(675) In some embodiments, R.sup.2 is COCH.sub.3, and R.sup.1 is methyl.
(676) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.
(677) In some embodiments, R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.
(678) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl.
(679) In some embodiments, R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(680) In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of an aryl ring A.
(681) In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of a heteroaryl ring A.
(682) In some embodiments, R.sup.1 is attached to a carbon and R.sup.2 is attached to a nitrogen of a heteroaryl ring A.
(683) In some embodiments, R.sup.2 is attached to a carbon and R.sup.1 is attached to a nitrogen of a heteroaryl ring A.
(684) In some embodiments, R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(685) In some embodiments, R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form one monocyclic or bicyclic C.sub.6-C.sub.8 carbocyclic ring or one monocyclic or bicyclic 5-to-8-membered heterocyclic ring containing 1 heteroatom or heteroatomic group independently selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(686) In some embodiments, R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form a monocyclic or bicyclic C.sub.6-C.sub.8 carbocyclic ring or a monocyclic or bicyclic 5-to-8-membered heterocyclic ring containing 1 heteroatom or heteroatomic group independently selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(687) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(688) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.
(689) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(690) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.
(691) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.
(692) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(693) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(694) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(695) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(696) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2. In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(697) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(698) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(699) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(700) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(701) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(702) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(703) In some embodiments, R.sup.1 and R.sup.2 are different.
(704) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a carbonyl group.
(705) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.
(706) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.
(707) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a sulfur atom.
(708) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a carbonyl group.
(709) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.
(710) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.
(711) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a sulfur atom.
(712) In some embodiments, R.sup.1 and R.sup.2 are the same.
(713) In some embodiments, R.sup.1 is para or meta to R.sup.2.
(714) In some embodiments, R.sup.1 is para or ortho to R.sup.2.
(715) In some embodiments, R.sup.1 is ortho or meta to R.sup.2. In some embodiments, R.sup.1 is para to R.sup.2.
(716) In some embodiments, R.sup.1 is meta to R.
(717) In some embodiments, R.sup.1 is ortho to R.sup.2.
(718) The Variable p
(719) In some embodiments p=0, 1, or 2.
(720) In some embodiments p=0.
(721) In some embodiments p=1.
(722) In some embodiments p=2.
(723) The ring
(724) ##STR00179##
and the variable X
(725) In some embodiments of ring
(726) ##STR00180##
each X is N.
(727) In some embodiments of ring
(728) ##STR00181##
each X is CR.sup.6.
(729) In some embodiments of ring
(730) ##STR00182##
one X is N; and the other X is CR.sup.6.
(731) In some embodiments of ring
(732) ##STR00183##
the ring is
(733) ##STR00184##
(734) In some embodiments of
(735) ##STR00185##
each X is CR.sup.6 and p is 0, 1 or 2.
(736) In some embodiments of
(737) ##STR00186##
each X is CR.sup.6 and p is 1.
(738) In some embodiments of
(739) ##STR00187##
each X is CR.sup.6 and p is 2.
(740) In some embodiments of
(741) ##STR00188##
one X is N, one X is CR.sup.6, and p is 0, 1 or 2.
(742) In some embodiments of
(743) ##STR00189##
each X is N and p is 0, 1 or 2.
(744) In some embodiments of
(745) ##STR00190##
is
(746) ##STR00191##
(747) In some embodiments of
(748) ##STR00192##
is
(749) ##STR00193##
(e.g. X═N).
(750) In some embodiments of
(751) ##STR00194##
is
(752) ##STR00195##
The groups R.sup.6 and R.sup.7
(753) In some embodiments,
(754) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(755) In some embodiments,
(756) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.9 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(757) In some embodiments,
(758) each R.sup.6 is independently selected from hydrogen C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(759) In some embodiments,
(760) each R.sup.6 is independently selected from hydrogen C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.1R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.1R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(761) In some embodiments,
(762) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(763) In some embodiments,
(764) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(765) In some embodiments,
(766) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(767) In some embodiments,
(768) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are unsubstituted;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,
wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(769) In some embodiments,
(770) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.1R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(771) In some embodiments,
(772) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(773) In some embodiments,
(774) R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
(775) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(776) In some embodiments,
(777) R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
(778) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(779) In some embodiments,
(780) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
(781) In some embodiments,
(782) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, OH, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.7 cycloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.1R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
(783) In some embodiments,
(784) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
(785) wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, C.sub.6-C.sub.10 aryl;
(786) In some embodiments,
(787) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy, wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl.
(788) In some embodiments,
(789) each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl (e.g., 2-propyl), C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy (e.g., methoxy), halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl, wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl.
(790) In some embodiments,
(791) each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl (e.g., 2-propyl) or C.sub.1-C.sub.6 alkoxy (e.g., methoxy),
(792) wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl.
(793) In some embodiments,
(794) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl (2-propyl), C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy (e.g., methoxy), halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, NH.sub.2, OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, and C.sub.3-C.sub.7 cycloalkyl,
(795) wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl (e.g., phenyl).
(796) In some embodiments,
(797) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl (2-propyl) and C.sub.1-C.sub.6 alkoxy (e.g., methoxy),
(798) wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl (e.g., phenyl).
(799) In some embodiments,
(800) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy,
(801) wherein the C.sub.1-C.sub.6 alkoxy is optionally substituted with one or more C.sub.6-C.sub.10 aryl.
(802) In some embodiments,
(803) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(804) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo;
(805) and
(806) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(807) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
(808) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.
(809) In some embodiments, one X is CR.sup.6; p=0; and
(810) R.sup.6 is selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.
(811) In some embodiments, both X are CR.sup.6; p=0; and
(812) each R.sup.6 is selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(813) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.
(814) In some embodiments, one X is CR.sup.6; p=0; and
(815) R.sup.6 is selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(816) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.
(817) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(818) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
and
each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl) and NHCO(3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
(819) In some embodiments, both X are CR.sup.6; p=1; and
(820) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
(821) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(822) In some embodiments, both X are CR.sup.6; p=1; and
(823) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
(824) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(825) In some embodiments, both X are CR.sup.6; p=2; and
(826) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.1R.sup.9, and 4- to 6-membered heterocycloalkyl,
(827) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9,
(828) In some embodiments, both X are CR.sup.6; p=2; and
(829) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
(830) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(831) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(832) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(833) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
(834) and
(835) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(836) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
(837) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.
(838) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(839) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(840) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo;
(841) and
(842) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(843) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.
(844) In some embodiments, both X are N; p=1 or 2; and
(845) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(846) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
(847) and
(848) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(849) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo, or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.
(850) In some embodiments, both X are N; p=1 or 2; and
(851) each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(852) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo;
(853) and
(854) each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,
(855) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.
(856) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(857) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(858) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(859) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(860) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(861) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(862) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(863) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(864) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(865) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
(866) In some embodiments, one or both X are CR.sup.6; p=1 or 2; and
(867) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
(868) In some embodiments, both X are CR.sup.6; p=2; and
(869) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein each carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, CO.sub.0C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(870) In some embodiments, both X are CR.sup.6; p=2; and
(871) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein each carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(872) In some embodiments, both X are CR.sup.6; p=2; and
(873) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(874) In some embodiments, both X are CR.sup.6; p=2; and
(875) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(876) In some embodiments, both X are CR.sup.6; p=2; and
(877) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
(878) In some embodiments, both X are CR.sup.6; p=2; and
(879) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
Particular Embodiments Wherein One X is CR.sup.6; p=0:
(880) In some embodiments, R.sup.6 is hydrogen.
(881) In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl.
(882) In some embodiments, R.sup.6 is isopropyl.
(883) In some embodiments, R.sup.6 is ethyl.
(884) In some embodiments, R.sup.6 is Methyl.
(885) In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(886) In some embodiments, R.sup.6 is trifluoromethyl.
(887) In some embodiments, R.sup.6 is trifluoromethoxy.
(888) In some embodiments, R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.
(889) In some embodiments, R.sup.6 is cyclopropyl.
(890) In some embodiments, R.sup.6 is halo.
(891) In some embodiments, R.sup.6 is chloro.
(892) In some embodiments, R.sup.6 is fluoro.
(893) In some embodiments, R.sup.6 is cyano.
(894) In some embodiments, R.sup.6 is attached to a carbon of an aryl ring B.
(895) In some embodiments, R.sup.6 is attached to a carbon of a heteroaryl ring B.
(896) In some embodiments, R.sup.6 is attached to a nitrogen of a heteroaryl ring B.
(897) Particular Embodiments Wherein One or Both X are CR.sup.6; p=1 or 2:
(898) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.
(899) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.
(900) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is methyl.
(901) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is isopropyl.
(902) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is isopropyl.
(903) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(904) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is trifluoromethyl.
(905) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.
(906) In some embodiments, at least one R.sup.6 is hydrogen and at least one R.sup.7 is cyclopropyl.
(907) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is cyclopropyl.
(908) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is halo.
(909) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is chloro.
(910) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is fluoro.
(911) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is chloro.
(912) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is chloro.
(913) In some embodiments, one X is CR.sup.6; p=.sup.1; R.sup.6 is hydrogen; and R.sup.7 is fluoro.
(914) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is fluoro.
(915) In some embodiments, both X are CR.sup.6; p=2; R.sup.6 is hydrogen; and R.sup.7 is fluoro.
(916) In some embodiments, both X are CR.sup.6; p=2; R.sup.6 is hydrogen; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.
(917) In some embodiments, both X are CR.sup.6; p=3; R.sup.6 is hydrogen; two R.sup.7 are fluoro; and one R.sup.7 is chloro.
(918) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is fluoro.
(919) In some embodiments, both X are CR.sup.6; p=1; one R.sup.6 is hydrogen; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.
(920) In some embodiments, both X are CR.sup.6; p=1; one R.sup.6 is hydrogen; the other R.sup.6 is isopropyl; and
(921) R.sup.7 is chloro.
(922) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is cyano.
(923) In some embodiments, at least one R.sup.6 is hydrogen and at least one R.sup.7 is cyano.
(924) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is cyano.
(925) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is hydrogen; and R.sup.7 is cyano.
(926) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.
(927) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(928) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is methoxy.
(929) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen, and R.sup.7 is methoxy.
(930) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is hydrogen, and R.sup.7 is methoxy.
(931) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.
(932) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is trifluoromethoxy.
(933) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is difluoromethoxy.
(934) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.
(935) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen, and R.sup.7 is trifluoromethyl.
(936) In some embodiments, at least one R.sup.6 is hydrogen, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.
(937) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is hydrogen, and R.sup.7 is trifluoromethoxy.
(938) In some embodiments, one X is CR.sup.6; p=2; R.sup.6 is hydrogen; and R.sup.7 is chloro.
(939) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is hydrogen.
(940) In some embodiments, both X are CR.sup.6; p=2; R.sup.7 is isopropyl; and R.sup.6 is hydrogen.
(941) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is ethyl; and R.sup.6 is hydrogen.
(942) In some embodiments, one X is CR.sup.6; p=2; one R.sup.7 is isopropyl; the other R.sup.7 is trifluoromethyl; and R.sup.6 is hydrogen.
(943) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is hydrogen.
(944) In some embodiments, one X is CR.sup.6; p=2; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is hydrogen.
(945) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.
(946) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.
(947) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is methyl.
(948) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is isopropyl.
(949) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is isopropyl.
(950) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(951) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is trifluoromethyl.
(952) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.
(953) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyclopropyl.
(954) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl.
(955) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is halo.
(956) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is halo.
(957) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is chloro.
(958) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is fluoro.
(959) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is chloro.
(960) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is chloro.
(961) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is fluoro.
(962) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is fluoro.
(963) In some embodiments, both X are CR.sup.6; p=2; R.sup.6 is isopropyl; and R.sup.7 is fluoro.
(964) In some embodiments, both X are CR.sup.6; p=2; R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.
(965) In some embodiments, both X are CR.sup.6; p=3; R.sup.6 is isopropyl; two R.sup.7 are fluoro; and one R.sup.7 is chloro.
(966) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is ethyl; and R.sup.7 is fluoro.
(967) In some embodiments, both X are CR.sup.6; p=1; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.
(968) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is cyano.
(969) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyano.
(970) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyano.
(971) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyano.
(972) In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.
(973) In some embodiments, at least one R.sup.6 is cyclopropyl, and at least one R.sup.7 is cyclopropyl.
(974) In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is halo.
(975) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is halo.
(976) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is chloro.
(977) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is fluoro.
(978) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is chloro.
(979) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro.
(980) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.
(981) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(982) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is methoxy.
(983) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is isopropyl, and R.sup.7 is methoxy.
(984) In some embodiments, both X are CR.sup.6; p=1; R.sup.6 is isopropyl, and R.sup.7 is methoxy.
(985) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.
(986) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is trifluoromethoxy.
(987) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is difluoromethoxy.
(988) In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.
(989) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethyl.
(990) In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.
(991) In some embodiments, at least one R.sup.6 is chloro, and at least one R.sup.7 is trifluoromethoxy.
(992) In some embodiments, one X is CR.sup.6; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethoxy.
(993) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.7 is halo.
(994) In some embodiments, one X is CR.sup.6; p=2; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro.
(995) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.
(996) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is methyl.
(997) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(998) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is trifluoromethyl.
(999) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.
(1000) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyclopropyl.
(1001) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl.
(1002) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is halo.
(1003) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is halo.
(1004) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is chloro.
(1005) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is fluoro.
(1006) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is chloro.
(1007) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is chloro.
(1008) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is fluoro.
(1009) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is fluoro.
(1010) In some embodiments, both X are CR.sup.6; p=2; R.sup.7 is isopropyl; and R.sup.6 is fluoro.
(1011) In some embodiments, both X are CR.sup.6; p=2; R.sup.7 is isopropyl; one R.sup.6 is fluoro; and the other R.sup.6 is cyano.
(1012) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is ethyl; and R.sup.6 is fluoro.
(1013) In some embodiments, one X is CR.sup.6; p=.sup.2; one R.sup.7 is isopropyl; the other R.sup.7 is trifluoromethyl; and R.sup.6 is chloro.
(1014) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is cyano.
(1015) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyano.
(1016) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyano.
(1017) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyano.
(1018) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.
(1019) In some embodiments, at least one R.sup.7 is cyclopropyl, and at least one R.sup.6 is cyclopropyl.
(1020) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is halo.
(1021) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is halo.
(1022) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is chloro.
(1023) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is fluoro.
(1024) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is chloro.
(1025) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro.
(1026) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.
(1027) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy.
(1028) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is methoxy.
(1029) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is isopropyl, and R.sup.6 is methoxy.
(1030) In some embodiments, both X are CR.sup.6; p=1; R.sup.7 is isopropyl, and R.sup.6 is methoxy.
(1031) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.
(1032) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is trifluoromethoxy.
(1033) In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.
(1034) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethyl.
(1035) In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkoxy.
(1036) In some embodiments, at least one R.sup.7 is chloro, and at least one R.sup.6 is trifluoromethoxy.
(1037) In some embodiments, one X is CR.sup.6; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethoxy.
(1038) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.6 is halo.
(1039) In some embodiments, one X is CR.sup.6; p=2; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.
(1040) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1041) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.
(1042) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1043) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.
(1044) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.
(1045) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1046) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1047) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1048) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1049) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1050) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1051) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.D, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1052) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.0, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1053) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1054) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1055) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1056) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1057) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2,
(1058) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,
(1059) wherein the ring is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group.
(1060) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1061) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1062) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1063) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.
(1064) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1065) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1066) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1067) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring.
(1068) In some embodiments, both X are CR.sup.6; p=.sup.2 or 3; and
(1069) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aromatic carbocyclic ring.
(1070) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1071) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.1R.sup.9.
(1072) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1073) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1074) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1075) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1076) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1077) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1078) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1079) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1080) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1081) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1082) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1083) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1084) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1085) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1086) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1087) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH NR.sup.13S, S(O), and S(O).sub.2.
(1088) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1089) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1090) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1091) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2.
(1092) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1093) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.
(1094) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1095) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.5 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2,
(1096) In some embodiments, both X are CR.sup.6; p=2 or 3; and
(1097) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,
wherein one of the two rings is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group, and the other of the two rings is fused to the B ring at the 5- and 6-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group.
(1098) In some embodiments, both X are CR.sup.6; p=2; and
(1099) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.
(1100) In some embodiments, both X are CR.sup.6; p=2; and
(1101) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is halo (e.g., C.sub.1 or F).
(1102) In some embodiments, both X are CR.sup.6; p=2; and
(1103) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is CN.
(1104) Particular embodiments wherein one or both X are CR.sup.6; p=1 or 2:
(1105) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.
(1106) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.
(1107) In some embodiments, at least one R.sup.7 is methyl.
(1108) In some embodiments, at least one R.sup.7 is isopropyl.
(1109) In some embodiments, p=1; and R.sup.7 is isopropyl.
(1110) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(1111) In some embodiments, at least one R.sup.7 is trifluoromethyl.
(1112) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.
(1113) In some embodiments, at least one R.sup.7 is cyclopropyl.
(1114) In some embodiments, p=1; and R.sup.7 is cyclopropyl.
(1115) In some embodiments, at least one R.sup.7 is halo.
(1116) In some embodiments, at least one R.sup.7 is chloro.
(1117) In some embodiments, at least one R.sup.7 is fluoro.
(1118) In some embodiments, p=1; and R.sup.7 is chloro.
(1119) In some embodiments, p=1; and R.sup.7 is fluoro.
(1120) In some embodiments, p=2; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.
(1121) In some embodiments, at least one R.sup.7 is cyano.
(1122) In some embodiments, p=1; and R.sup.7 is cyano.
(1123) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.
(1124) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(1125) In some embodiments, at least one R.sup.7 is methoxy.
(1126) In some embodiments, p=1; and R.sup.7 is methoxy.
(1127) In some embodiments, at least one R.sup.7 is trifluoromethoxy.
(1128) In some embodiments, at least one R.sup.7 is difluoromethoxy.
(1129) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.
(1130) In some embodiments, p=1; and R.sup.7 is trifluoromethyl.
(1131) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.
(1132) In some embodiments, p=1; and R.sup.7 is trifluoromethoxy.
(1133) In some embodiments, p=2; and R.sup.7 is chloro.
(1134) In some embodiments, p=2; and R.sup.7 is isopropyl.
(1135) In some embodiments, p=1; and R.sup.7 is ethyl.
(1136) In some embodiments, p=2; one R.sup.7 is isopropyl; and the other R.sup.7 is trifluoromethyl.
(1137) In some embodiments, p=1; and R.sup.7 is cyclopropyl.
(1138) In some embodiments, p=.sup.2; and R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(1139) In some embodiments, p=2; and R.sup.7 is fluoro.
(1140) Particular embodiments wherein one or both X are N; p=1 or 2: In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.
(1141) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.
(1142) In some embodiments, at least one R.sup.7 is methyl.
(1143) In some embodiments, at least one R.sup.7 is isopropyl.
(1144) In some embodiments, p=1; and R.sup.7 is isopropyl.
(1145) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.
(1146) In some embodiments, at least one R.sup.7 is trifluoromethyl.
(1147) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.
(1148) In some embodiments, at least one R.sup.7 is cyclopropyl.
(1149) In some embodiments, p=1; and R.sup.7 is cyclopropyl.
(1150) In some embodiments, at least one R.sup.7 is halo.
(1151) In some embodiments, at least one R.sup.7 is chloro.
(1152) In some embodiments, at least one R.sup.7 is fluoro.
(1153) In some embodiments, p=1; and R.sup.7 is chloro.
(1154) In some embodiments, p=1; and R.sup.7 is fluoro.
(1155) In some embodiments, p=2; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.
(1156) In some embodiments, at least one R.sup.7 is cyano.
(1157) In some embodiments, p=1; and R.sup.7 is cyano.
(1158) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.
(1159) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(1160) In some embodiments, at least one R.sup.7 is methoxy.
(1161) In some embodiments, p=1; and R.sup.7 is methoxy.
(1162) In some embodiments, at least one R.sup.7 is trifluoromethoxy.
(1163) In some embodiments, at least one R.sup.7 is difluoromethoxy.
(1164) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.
(1165) In some embodiments, p=1; and R.sup.7 is trifluoromethyl.
(1166) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.
(1167) In some embodiments, p=1; and R.sup.7 is trifluoromethoxy.
(1168) In some embodiments, p=2; and R.sup.7 is chloro.
(1169) In some embodiments, p=2; and R.sup.7 is isopropyl.
(1170) In some embodiments, p=1; and R.sup.7 is ethyl.
(1171) In some embodiments, p=2; one R.sup.7 is isopropyl; and the other R.sup.7 is trifluoromethyl.
(1172) In some embodiments, p=1; and R.sup.7 is cyclopropyl.
(1173) In some embodiments, p=2; and R.sup.7 is C.sub.1-C.sub.6 alkoxy.
(1174) In some embodiments, p=2; and R.sup.7 is fluoro.
(1175) The Group Y
(1176) In some embodiments, Y is selected from a bond, O, S, SO.sub.2, NR.sup.15, or CR.sup.16R.sup.17.
(1177) In some embodiments, Y is selected from a bond, —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, and —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—.
(1178) In some embodiments, Y is a bond.
(1179) In some embodiments, Y is O.
(1180) In some embodiments, Y is S.
(1181) In some embodiments, Y is SO.sub.2.
(1182) In some embodiments, Y is NR.sup.15.
(1183) In some embodiments, Y is NH.
(1184) In some embodiments, Y is CR.sup.16R.sup.17.
(1185) In some embodiments, Y is CH.sub.2.
(1186) In some embodiments, Y is —CH(CH.sub.3)—.
(1187) In some embodiments, Y is selected from —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, and —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—.
(1188) In some embodiments, Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-.
(1189) In certain embodiments when Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, Y is —Y.sup.1.
(1190) In certain embodiments when Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, Y is —(C.sub.1-C.sub.3 alkyl)-. As a non-limiting example, Y is CH.sub.2CH.sub.2.
(1191) In certain embodiments when Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-, Y is —(Y.sup.1)—(C.sub.1-C.sub.3 alkyl)-.
(1192) In some embodiments, Y is C.sub.2-3 alkynylene.
(1193) In some embodiments, Y is C.sub.2 alkynylene.
(1194) In some embodiments, Y is —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—.
(1195) The group Y.sup.1
(1196) In some embodiments, Y.sup.1 is selected from O, S, SO.sub.2, NR.sup.15, and C(O).
(1197) In some embodiments, Y.sup.1 is selected from O, S, SO.sub.2, and NR.sup.15.
(1198) In some embodiments, Y.sup.1 is selected from CR.sup.16OH and CR.sup.16NR.sup.B.
(1199) In certain embodiments of the foregoing, Y.sup.1 is CR.sup.16OH (e.g., Y.sup.1 is CHOH).
(1200) In some embodiments, Y.sup.1 is O.
(1201) In some embodiments, Y.sup.1 is S.
(1202) In some embodiments, Y.sup.1 is SO.sub.2.
(1203) In some embodiments, Y.sup.1 is NR.sup.15 (e.g., NH).
(1204) In some embodiments, Y.sup.1 is C(O).
(1205) In some embodiments, Y.sup.1 is C(O)NR.sup.15 (e.g., C(O)NH).
(1206) The Variable o
(1207) In some embodiments, each occurrence of o is selected from 0 and 1, and wherein at least one o in —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o- or —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o— is 1;
(1208) In some embodiments (where Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-), one occurrence of o is 0 and the other occurrence of o is 1.
(1209) In some embodiments (where Y is —(Y.sup.1).sub.o—(C.sub.1-C.sub.3 alkyl).sub.o-), one occurrence of o is 1 and the other occurrence of o is 1. In some embodiments (where Y is —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—), one occurrence of o is 1 and the remaining occurrences of o are 0.
(1210) In some embodiments (where Y is —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—), two occurrences of o are 1 and the other occurrence of o is 0.
(1211) In some embodiments (where Y is —(CR.sup.16R.sup.17).sub.o—(Y.sup.1).sub.o—(CR.sup.16R.sup.17).sub.o—), each occurrence of o is 1.
(1212) The Group Z
(1213) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1214) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocyclic ring, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1215) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.3-C.sub.10 monocyclic or bicyclic cycloalkyl, a C.sub.2-C.sub.6 alkenyl, and a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1216) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, a 5-10-membered monocyclic or bicyclic heterocycloalkyl, a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1217) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1218) In some embodiments, Z is 5-10-membered monocyclic or bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, hydroxy, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1219) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1220) In some embodiments, Z is 5-10-membered monocyclic or bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1221) In some embodiments, Z is 5-10-membered monocyclic or bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1222) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heterocycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.1R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9.
(1223) In some embodiments, Z is selected from a 5-10-membered monocyclic or bicyclic heterocycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9.
(1224) In some embodiments, Z is a 5-10-membered monocyclic or bicyclic heterocycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1225) In some embodiments, Z is a 5-10-membered monocyclic or bicyclic heterocycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, hydroxy, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1226) In some embodiments, Z is 3,4-dihydropyrrole, tetrahydropyran, pyrrolidine, or tetrahydrofuran, wherein Z is optionally substituted with C.sub.1-C.sub.6 alkyl, hydroxy, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1227) In some embodiments, Z is chromanyl, isoindoline, isochromanyl, 1,2,3,6-tetrahydropyridyl, dihydroisobenzofuran, or methylenedioxyphenyl, wherein Z is optionally substituted with C.sub.1-C.sub.6 alkyl, hydroxy, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1228) In some embodiments, Z is selected from a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1229) In some embodiments, Z is selected from a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.1R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3-to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1230) In some embodiments, Z is a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1231) In some embodiments, Z is phenyl, naphthyl, or methylenedioxyphenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1232) In some embodiments, Z is dihydroindene or 1,2,3,4-tetrahydronaphthalene, wherein Z is optionally substituted with C.sub.1-C.sub.6 alkyl, hydroxy, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, and C.sub.6-C.sub.10 aryl.
(1233) In some embodiments, Z is selected from a C.sub.3-C.sub.11 monocyclic or bicyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1234) In some embodiments, Z is selected from a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1235) In some embodiments, Z is selected from a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3-to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1236) In some embodiments, Z is a C.sub.6-C.sub.10 monocyclic or bicyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1237) In some embodiments, Z is cycloalkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1238) In some embodiments, Z is a 5-10-membered monocyclic or bicyclic heterocyclic ring wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1239) In some embodiments, Z is a 5-10-membered monocyclic or bicyclic heterocyclic ring wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1240) In some embodiments, Z is selected from a C.sub.2-C.sub.6 alkenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9.
(1241) In some embodiments, Z is selected from a C.sub.2-C.sub.6 alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SO.sub.2NR.sup.8R.sup.9, NR.sup.11SO.sub.2NR.sup.11R.sup.12, NR.sup.11CO.sub.2R.sup.12, NR.sup.11CONR.sup.11R.sup.12, NR.sup.11SO.sub.2R.sup.12, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1242) In some embodiments, Z is selected from a C.sub.2-C.sub.6 (e.g., C.sub.2-C.sub.3) alkynyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl or NR.sup.8R.sup.9.
(1243) In some embodiments, Z is selected from pyrazolyl, thiazolyl, pyridinyl, pyrimidinyl, quinolinyl, isoquinolinyl, benzofuranyl, benzothiophenyl, indazolyl, quinoxalinyl, quinozolinyl, tetrahydropyridinyl, piperidinyl, pyrrolidinyl, piperazinyl, phenyl, naphthyl, methylenedioxyphenyl, cycloalkenyl (e.g., cyclopentenyl or cyclohexenyl), cycloalkyl (e.g., cyclopropyl, cyclopentyl, or cyclohexyl), C═C, or alkenyl.
(1244) In some embodiments, Z is selected from pyrazolyl, pyridinyl, pyrimidinyl, piperidinyl, piperazinyl, phenyl, naphthyl, methylenedioxyphenyl, cycloalkenyl, or alkenyl.
(1245) In some embodiments, Z is phenyl, naphthyl, or methylenedioxyphenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1246) In some embodiments, Z is pyrimidine, benzothiophene, indazole, quinoxaline, quinazoline benzofuran, or isoquinoline, wherein Z is optionally substituted with C.sub.1-C.sub.6 alkyl, hydroxyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 haloalkoxy, oxo, C(O)OH, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.3-C.sub.10 cycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1247) In some embodiments, Z is chromanyl or methylenedioxyphenyl, wherein Z is optionally substituted with one or more halo.
(1248) In certain embodiments of the foregoing, Z is methylenedioxyphenyl which is optionally substituted with one or more halo (e.g., C.sub.1 or Br).
(1249) In some embodiments, Z is a 5-6 partially saturated monocyclic heterocyclic ring wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1250) In certain embodiments of the foregoing, Z is
(1251) ##STR00196##
each of which is optionally substituted (e.g., unsubstituted) as described elsewhere herein.
(1252) In some embodiments, Z is a 9-10 partially saturated bicyclic heterocyclic ring wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1253) In certain embodiments of the foregoing, Z is
(1254) ##STR00197##
each of which is optionally substituted (e.g., unsubstituted) as described elsewhere herein.
(1255) In some embodiments, Z is 5-6-membered monocyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1256) In some embodiments, Z is selected from 3-pyrazolyl, 4-pyrazolyl, 5-pyrazolyl, 3-pyridinyl, 4-pyridinyl, 5-pyrimidinyl, 2-pyrimidinyl, 8-quinolinyl, 5-indolyl, 5-pyrimidin-2-one, 4-thiazolyl, 5-thiazolyl, 4-isoxazolyl, 2-furyl, 5-(1,2,3,6-tetrahydropyridin)-yl, 1-cyclopentenyl, or vinyl.
(1257) In some embodiments, Z is pyrazolyl.
(1258) In some embodiments, Z is 3-pyrazolyl.
(1259) In some embodiments, Z is 4-pyrazolyl.
(1260) In some embodiments, Z is 5-pyrazolyl.
(1261) In some embodiments, Z is thiazolyl.
(1262) In some embodiments, Z is 4-thiazolyl.
(1263) In some embodiments, Z is 5-thiazolyl.
(1264) In some embodiments, Z is furyl.
(1265) In some embodiments, Z is 2-furyl.
(1266) In some embodiments, Z is thiophenyl.
(1267) In some embodiments, Z is 2-thiophenyl.
(1268) In some embodiments, Z is selected from pyrazolyl, pyridinyl, and pyrimidinyl.
(1269) In some embodiments, Z is selected from 3-pyrazolyl, 4-pyrazolyl, 5-pyrazolyl, 3-pyridinyl, 4-pyridinyl, 5-pyrimidinyl, 2-pyrimidinyl, 3-pyrazolyl, 4-pyrazolyl, 5-pyrazolyl, 3-pyridinyl, 4-pyridinyl, 5-pyrimidinyl, 2-pyrimidinyl, 8-quinolinyl, 5-indolyl, 5-pyrimidin-2-one, 4-thiazolyl, 5-thiazolyl, 4-isoxazolyl, and 2-furyl.
(1270) In some embodiments, Z is 9-10-membered bicyclic heteroaryl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1271) In some embodiments, Z is selected from isoquinolinyl, quinolinyl, qunioxalinyl, quinozalinyl, indazolyl, benzofuranyl, and benzothiophenyl, each of which is optionally substituted as described elsewhere herein.
(1272) In certain embodiments, Z is isoquinolinyl or quinolinyl.
(1273) In certain embodiments, Z is quinoxalinyl or quinozalinyl.
(1274) In certain embodiments, Z is indazolyl.
(1275) In certain embodiments, Z is benzofuranyl or benzothiophenyl.
(1276) In some embodiments, Z is selected from a 5-6-membered monocyclic heterocycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9.
(1277) In some embodiments, Z is selected from piperidine (e.g., 5-(1,2,3,6-tetrahydropyridin)-yl), and piperazine.
(1278) In some embodiments, Z is tetrahydrofuranyl.
(1279) In some embodiments, Z is tetrahydropyranyl.
(1280) In some embodiments, Z is selected from phenyl, naphthyl, and methylenedioxyphenyl.
(1281) In some embodiments, Z is phenyl, naphthyl, or methylenedioxyphenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1282) In some embodiments, Z is phenyl.
(1283) In some embodiments, Z is phenyl, naphthyl, or methylenedioxyphenyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1284) In some embodiments, Z is phenyl.
(1285) In certain embodiments when Z is phenyl, Z is substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl and halo.
(1286) In some embodiments, Z is phenyl which is optionally substituted or fused as described elsewhere herein.
(1287) In some embodiments, Z is phenyl optionally substituted with one or more substituents each independently selected from halo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, CN, C(O)OH, C.sub.1-C.sub.6haloalkyl, C.sub.1-C.sub.6 haloalkoxy, and NR.sup.8R.sup.9.
(1288) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected halo.
(1289) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected C.sub.1-C.sub.6 alkyl.
(1290) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected C.sub.1-C.sub.6 alkoxy.
(1291) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected CN.
(1292) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected C(O)OH.
(1293) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected C.sub.1-C.sub.6 haloalkyl.
(1294) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected C.sub.1-C.sub.6 haloalkoxy.
(1295) In certain embodiments, Z is phenyl optionally substituted with one or more independently selected NR.sup.8R.sup.9.
(1296) In some embodiments, Z is phenyl which is fused to a five-to-seven-membered carbocyclic ring. As non-limiting examples of the foregoing, Z is:
(1297) ##STR00198##
(1298) In some embodiments, Z is phenyl which is fused to a five-to-seven-membered heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1299) In some embodiments, Z is naphthyl.
(1300) In some embodiments, Z is methylenedioxyphenyl (e.g., methylenedioxyphenyl substituted with 2 halo (e.g., F)).
(1301) In some embodiments, Z is cycloalkenyl (e.g., cyclopentenyl, e.g., 1-cyclopentenyl).
(1302) In some embodiments, Z is selected from alkenyl (e.g., vinyl).
(1303) In some embodiments, Z is a C.sub.5-C.sub.6 monocyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1304) In certain embodiments of the foregoing, Z is a cyclohexyl or cyclopentyl, each of which is optionally substituted as described above.
(1305) In some embodiments, Z is a C.sub.5-C.sub.6 monocyclic cycloalkyl, wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, NR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein Z is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1306) In certain embodiments of the foregoing, Z is a cyclohexyl or cyclopentyl, each of which is optionally substituted as described above.
(1307) In some embodiments, Z is a C.sub.5-C.sub.6 monocyclic cycloalkyl which is fused to a 6-membered carbocyclic ring.
(1308) In certain embodiments of the foregoing, Z is
(1309) ##STR00199##
each of which is optionally substituted as described elsewhere herein.
(1310) In some embodiments, Z is C.sub.2-C.sub.6 alkynyl.
(1311) In certain embodiments of the foregoing, Z is C═C.
(1312) In some embodiments, Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, C.sub.6-C.sub.10 aryloxy, hydroxy, oxo, CN, halo, COOC.sub.1-C.sub.6 alkyl, C(O)OH, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl,
(1313) In some embodiments, Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl,
(1314) In some embodiments, Z is substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryloxy, CN, halo, COOC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, 3- to 7-membered heterocycloalkyl, and CONR.sup.8R.sup.9, and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that Z is substituted with is optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9, or C.sub.6-C.sub.10 aryl.
(1315) In some embodiments, Z is optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl.
(1316) In some embodiments, Z is optionally substituted with one or more C.sub.1-C.sub.6 alkoxy (e.g., methoxy) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl.
(1317) In some embodiments, Z is optionally substituted with one or more C.sub.1-C.sub.6 haloalkyl.
(1318) In some embodiments, Z is optionally substituted with one or more C.sub.1-C.sub.6 haloalkoxy.
(1319) In some embodiments, Z is optionally substituted with one or more C.sub.6-C.sub.10 aryloxy (e.g., phenoxy).
(1320) In some embodiments, Z is optionally substituted with one or more CN.
(1321) In some embodiments, Z is optionally substituted with one or more oxo.
(1322) In some embodiments, Z is optionally substituted with one or more halo (e.g., F, Cl).
(1323) In some embodiments, Z is optionally substituted with one or more COOC.sub.1-C.sub.6 alkyl (e.g., CO.sub.2t-Bu).
(1324) In some embodiments, Z is optionally substituted with one or more C(O)OH.
(1325) In some embodiments, Z is optionally substituted with one or more S(O.sub.2)C.sub.1-C.sub.6 alkyl (e.g., S(O.sub.2)methyl).
(1326) In some embodiments, Z is optionally substituted with one or more 3- to 7-membered heterocycloalkyl (e.g., morpholinyl).
(1327) In some embodiments, Z is optionally substituted with one or more CONR.sup.8R.sup.9 (e.g., unsubstituted amido).
(1328) In some embodiments, Z is optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl.
(1329) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a C.sub.1-C.sub.6 alkoxy (e.g., methoxy) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl.
(1330) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a C.sub.6-C.sub.10 aryloxy (e.g., phenoxy).
(1331) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a CN.
(1332) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a halo (e.g., F, Cl).
(1333) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a COOC.sub.1-C.sub.6 alkyl (e.g., CO.sub.2t-Bu).
(1334) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a S(O.sub.2)C.sub.1-C.sub.6 alkyl (e.g., S(O.sub.2)methyl).
(1335) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a 3- to 7-membered heterocycloalkyl (e.g., morpholinyl).
(1336) In some embodiments, Z is optionally substituted with two or more substituents, wherein at least one of the substituents is a CONR.sup.8R.sup.9 (e.g., unsubstituted amido).
(1337) In some embodiments, Z is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl).
(1338) In some embodiments, Z is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy (e.g., methoxy) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl).
(1339) In some embodiments, Z is phenyl optionally substituted with one or more C.sub.6-C.sub.10 aryloxy (e.g., phenoxy).
(1340) In some embodiments, Z is phenyl optionally substituted with one or more CN.
(1341) In some embodiments, Z is phenyl optionally substituted with one or more halo (e.g., F, Cl). In some embodiments, Z is 3,4-dichlorophenyl.
(1342) In some embodiments, Z is phenyl optionally substituted with one or more COOC.sub.1-C.sub.6 alkyl (e.g., CO.sub.2t-Bu).
(1343) In some embodiments, Z is phenyl optionally substituted with one or more S(O.sub.2)C.sub.1-C.sub.6 alkyl (e.g., S(O.sub.2)methyl).
(1344) In some embodiments, Z is phenyl optionally substituted with one or more 3- to 7-membered heterocycloalkyl (e.g., morpholinyl).
(1345) In some embodiments, Z is phenyl optionally substituted with one or more CONR.sup.1R.sup.9 (e.g., unsubstituted amido).
(1346) In some embodiments, Z is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) and with one or more halo (e.g., F, Cl).
(1347) The Groups R.sup.4 and R.sup.5
(1348) In some embodiments, each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(1349) In some embodiments, R.sup.4 is hydrogen.
(1350) In some embodiments, R.sup.5 is hydrogen.
(1351) In some embodiments, each of R.sup.4 and R.sup.1 is hydrogen.
(1352) In some embodiments, R.sup.4 is C.sub.1-C.sub.6 alkyl.
(1353) In some embodiments, R.sup.5 is C.sub.1-C.sub.6 alkyl.
(1354) In some embodiments, each of R.sup.4 and R.sup.1 is C.sub.1-C.sub.6 alkyl,
(1355) In some embodiments, R.sup.4 is hydrogen and R.sup.5 is C.sub.1-C.sub.6 alkyl.
(1356) In some embodiments, R.sup.4 is hydrogen and R.sup.5 is C.sub.1-C.sub.6 alkyl, and the carbon bonded to R.sup.4 and R.sup.5 has ( ) stereochemistry.
(1357) In some embodiments, R.sup.4 is hydrogen and R.sup.5 is C.sub.1-C.sub.6 alkyl, and the carbon bonded to R.sup.4 and R.sup.5 has (R) stereochemistry.
(1358) The group R.sup.10 In some embodiments, R.sup.10 is C.sub.1-C.sub.6 alkyl.
(1359) In some embodiments, R.sup.10 is methyl.
(1360) In some embodiments, R.sup.10 is ethyl.
(1361) The groups R.sup.8 and R.sup.9
(1362) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to.
(1363) In some embodiments, each of RB and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.3, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or RB and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to.
(1364) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is hydrogen,
(1365) In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is C.sub.1-C.sub.6 alkyl.
(1366) In some embodiments, each RB at each occurrence is hydrogen and each R.sup.9 at each occurrence is methyl.
(1367) In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is ethyl.
(1368) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is methyl.
(1369) In some embodiments, each of RB and R.sup.9 at each occurrence is ethyl.
(1370) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is C.sub.3-C.sub.6 cycloalkyl (e.g., cyclopropyl).
(1371) In some embodiments, RB at each occurrence is C.sub.3-C.sub.6 cycloalkyl (e.g., cyclopropyl); and R.sup.9 at each occurrence is hydrogen.
(1372) In some embodiments, R.sup.8 at each occurrence is C(O).sub.2R.sup.13 (e.g., C(O).sub.2.sup.tBu); and R.sup.9 at each occurrence is hydrogen.
(1373) In some embodiments, RB and R.sup.9 taken together with the nitrogen they are attached to form a 3-membered ring.
(1374) In some embodiments, RB and R.sup.9 taken together with the nitrogen they are attached to form a 4-membered ring.
(1375) In some embodiments, RB and R.sup.9 taken together with the nitrogen they are attached to form a 5-membered ring.
(1376) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more oxygen atoms in addition to the nitrogen they are attached to.
(1377) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more nitrogen atoms in addition to the nitrogen they are attached to.
(1378) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 7-membered ring.
(1379) The Group R.sup.13
(1380) In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkyl optionally substituted with halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
(1381) In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkyl substituted with halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, or 5-to 10-membered heteroaryl. In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkyl.
(1382) In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkoxy.
(1383) In some embodiments, R.sup.13 is methyl.
(1384) In some embodiments, R.sup.13 is ethyl.
(1385) In some embodiments, R.sup.13 is C.sub.6-C.sub.10 aryl.
(1386) In some embodiments, R.sup.13 is phenyl.
(1387) In some embodiments, R.sup.13 is 5- to 10-membered heteroaryl.
(1388) The Groups R.sup.11 and R.sup.12
(1389) In some embodiments, each of R.sup.1 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.
(1390) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is hydrogen,
(1391) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is C.sub.1-C.sub.6 alkyl.
(1392) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is methyl.
(1393) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is ethyl.
(1394) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is methyl.
(1395) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is ethyl.
(1396) In some embodiments of the compound of formula AA,
(1397) A is
(1398) ##STR00200##
and R.sup.1 is selected from:
C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1399) In some embodiments of the compound of formula AA,
(1400) A is
(1401) ##STR00201##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1402) In some embodiments of the compound of formula AA,
(1403) A is
(1404) ##STR00202##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1405) In some embodiments of the compound of formula AA,
(1406) A is
(1407) ##STR00203##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1408) In some embodiments of the compound of formula AA,
(1409) A is
(1410) ##STR00204##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1411) In some embodiments of the compound of formula AA,
(1412) A is
(1413) ##STR00205##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1414) In some embodiments of the compound of formula AA,
(1415) A is
(1416) ##STR00206##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1417) In some embodiments of the compound of formula AA,
(1418) A is
(1419) ##STR00207##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1420) In some embodiments of the compound of formula AA,
(1421) A is
(1422) ##STR00208##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1423) In some embodiments of the compound of formula AA,
(1424) A is
(1425) ##STR00209##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1426) In some embodiments of the compound of formula AA,
(1427) A is
(1428) ##STR00210##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1429) In some embodiments of the compound of formula AA,
(1430) A is
(1431) ##STR00211##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1432) In some embodiments of the compound of formula AA,
(1433) A is
(1434) ##STR00212##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1435) In some embodiments of the compound of formula AA,
(1436) A is
(1437) ##STR00213##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1438) In some embodiments of the compound of formula AA,
(1439) A is
(1440) ##STR00214##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1441) In some embodiments of the compound of formula AA,
(1442) A is
(1443) ##STR00215##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1444) In some embodiments of the compound of formula AA,
(1445) A is
(1446) ##STR00216##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1447) In some embodiments of the compound of formula AA,
(1448) A is
(1449) ##STR00217##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1450) In some embodiments of the compound of formula AA,
(1451) A is
(1452) ##STR00218##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1453) In some embodiments of the compound of formula AA,
(1454) A is
(1455) ##STR00219##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1456) In some embodiments of the compound of formula AA,
(1457) A is
(1458) ##STR00220##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1459) In some embodiments of the compound of formula AA,
(1460) A is,
(1461) ##STR00221##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1462) In some embodiments of the compound of formula AA,
(1463) A is
(1464) ##STR00222##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
(1465) In some embodiments of the compound of formula AA,
(1466) A is
(1467) ##STR00223##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1468) In some embodiments of the compound of formula AA,
(1469) A is
(1470) ##STR00224##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2NR.sup.8R.sup.9.
(1471) In some embodiments of the compound of formula AA,
(1472) A is
(1473) ##STR00225##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1474) In some embodiments of the compound of formula AA,
(1475) A is
(1476) ##STR00226##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
(1477) In some embodiments of the compound of formula AA,
(1478) A is
(1479) ##STR00227##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1480) In some embodiments of the compound of formula AA,
(1481) A is
(1482) ##STR00228##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
(1483) In some embodiments of the compound of formula AA,
(1484) A is
(1485) ##STR00229##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1486) In some embodiments of the compound of formula AA,
(1487) A is
(1488) ##STR00230##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
(1489) In some embodiments of the compound of formula AA,
(1490) A is
(1491) ##STR00231##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is
(1492) ##STR00232##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
(1493) In some embodiments of the compound of formula AA,
(1494) A is
(1495) ##STR00233##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is
(1496) ##STR00234##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
(1497) In some embodiments of the compound of formula AA,
(1498) A is
(1499) ##STR00235##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1500) In some embodiments of the compound of formula AA,
(1501) A is
(1502) ##STR00236##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
A is
(1503) ##STR00237##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is
(1504) ##STR00238##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)C.sub.1-C.sub.6 alkyl; and SO.sub.2 NR.sup.8R.sup.9.
A is
(1505) ##STR00239##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
(1506) In some embodiments of the compound of formula AA,
(1507) A is
(1508) ##STR00240##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1509) In some embodiments of the compound of formula AA,
(1510) A is
(1511) ##STR00241##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1512) In some embodiments, of the compound of formula AA,
(1513) A is
(1514) ##STR00242##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1515) In some embodiments, of the compound of formula AA,
(1516) A is
(1517) ##STR00243##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1518) In some embodiments, of the compound of formula AA,
(1519) A is
(1520) ##STR00244##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1521) In some embodiments, of the compound of formula AA,
(1522) A is
(1523) ##STR00245##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1524) In some embodiments, of the compound of formula AA,
(1525) A is
(1526) ##STR00246##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1527) In some embodiments, of the compound of formula AA,
(1528) A is
(1529) ##STR00247##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1530) In some embodiments, of the compound of formula AA,
(1531) A is
(1532) ##STR00248##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.3 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1533) In some embodiments, of the compound of formula AA,
(1534) A is
(1535) ##STR00249##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1536) In some embodiments, of the compound of formula AA,
(1537) A is
(1538) ##STR00250##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1539) In some embodiments, of the compound of formula AA,
(1540) A is
(1541) ##STR00251##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.3 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1542) In some embodiments, of the compound of formula AA,
(1543) A is
(1544) ##STR00252##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1545) In some embodiments, of the compound of formula AA,
(1546) A is
(1547) ##STR00253##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1548) In some embodiments, of the compound of formula AA,
(1549) A is
(1550) ##STR00254##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.3 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1551) In some embodiments, of the compound of formula AA,
(1552) A is
(1553) ##STR00255##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.3 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1554) In some embodiments, of the compound of formula AA,
(1555) A is
(1556) ##STR00256##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.3 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.3 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.3 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1557) In some embodiments, of the compound of formula AA,
(1558) A is
(1559) ##STR00257##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1560) In some embodiments, of the compound of formula AA,
(1561) A is
(1562) ##STR00258##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1563) In some embodiments, of the compound of formula AA,
(1564) A is
(1565) ##STR00259##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.3 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1566) In some embodiments, of the compound of formula AA,
(1567) A is
(1568) ##STR00260##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is SO.sub.2NR.sup.8R.sup.9.
(1569) In some embodiments, of the compound of formula AA,
(1570) A is
(1571) ##STR00261##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.3 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.3 is methyl.
(1572) In some embodiments, of the compound of formula AA,
(1573) A is
(1574) ##STR00262##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SO.sub.2NR.sup.8R.sup.9; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1575) In some embodiments, of the compound of formula AA,
(1576) A is
(1577) ##STR00263##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1578) In some embodiments, of the compound of formula AA,
(1579) A is
(1580) ##STR00264##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1581) In some embodiments, of the compound of formula AA,
(1582) A is
(1583) ##STR00265##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1584) In some embodiments, of the compound of formula AA,
(1585) A is
(1586) ##STR00266##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.
(1587) In some embodiments, of the compound of formula AA,
(1588) A is
(1589) ##STR00267##
and R.sup.1 and R.sup.2 are one of the following combinations: R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; R.sup.1 is hydroxymethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; R.sup.1 is morpholinyl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; R.sup.2 is hydroxymethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; R.sup.2 is morpholinyl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.
(1590) In some embodiments of the compound of Formula AA,
(1591) A is
(1592) ##STR00268## and R.sup.1 and R.sup.2, taken together forms
(1593) ##STR00269## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1594) ##STR00270## moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1595) In some embodiments of the compound of Formula AA,
(1596) A is
(1597) ##STR00271## and R.sup.1 and R.sup.2, taken together forms
(1598) ##STR00272## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1599) ##STR00273## moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1600) In some embodiments of the compound of Formula AA,
(1601) A is,
(1602) ##STR00274## and R.sup.1 and R.sup.2, taken together forms
(1603) ##STR00275## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1604) ##STR00276## moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1605) In some embodiments of the compound of Formula AA,
(1606) A is
(1607) ##STR00277## and R.sup.1 and R.sup.2, taken together forms
(1608) ##STR00278## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1609) ##STR00279## moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1610) In some embodiments of the compound of Formula AA,
(1611) A is
(1612) ##STR00280## and R.sup.1 and R.sup.2, taken together forms
(1613) ##STR00281## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1614) ##STR00282## moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1615) In some embodiments of the compound of Formula AA,
(1616) A is
(1617) ##STR00283## and R.sup.1 and R.sup.2, taken together forms
(1618) ##STR00284## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1619) ##STR00285## moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1620) In some embodiments of the compound of Formula AA,
(1621) A is
(1622) ##STR00286## and R.sup.1 and R.sup.2, taken together forms
(1623) ##STR00287## wherein the
(1624) ##STR00288## moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1625) In some embodiments of the compound of Formula AA,
(1626) A is
(1627) ##STR00289## and R.sup.1 and R.sup.2, taken together forms
(1628) ##STR00290## wherein the
(1629) ##STR00291## moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1630) In some embodiments of the compound of Formula AA,
(1631) A is
(1632) ##STR00292## and R.sup.1 and R.sup.2, taken together forms
(1633) ##STR00293## wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1634) ##STR00294##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1635) In some embodiments of the compound of Formula AA,
(1636) A is
(1637) ##STR00295## and R.sup.1 and R.sup.2, taken together forms
(1638) ##STR00296##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1639) ##STR00297##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1640) In some embodiments of the compound of Formula AA,
(1641) A is
(1642) ##STR00298## and R.sup.1 and R.sup.2, taken together forms
(1643) ##STR00299## wherein the
(1644) ##STR00300##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1645) In some embodiments of the compound of Formula AA,
(1646) A is
(1647) ##STR00301## and R.sup.1 and R.sup.2, taken together forms
(1648) ##STR00302## wherein the
(1649) ##STR00303##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1650) In some embodiments of the compound of Formula AA,
(1651) A is
(1652) ##STR00304## and R.sup.1 and R.sup.2, taken together forms
(1653) ##STR00305##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1654) ##STR00306##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1655) In some embodiments of the compound of Formula AA,
(1656) A is
(1657) ##STR00307## and R.sup.1 and R.sup.2, taken together forms
(1658) ##STR00308##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1659) ##STR00309##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1660) In some embodiments of the compound of Formula AA,
(1661) A is
(1662) ##STR00310## and R.sup.1 and R.sup.2, taken together forms
(1663) ##STR00311##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1664) ##STR00312##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1665) In some embodiments of the compound of Formula AA,
(1666) A is
(1667) ##STR00313## and R.sup.1 and R.sup.2, taken together forms
(1668) ##STR00314##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1669) ##STR00315##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1670) In some embodiments of the compound of Formula AA,
(1671) A is
(1672) ##STR00316## and R.sup.1 and R.sup.2, taken together forms
(1673) ##STR00317##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2 wherein the
(1674) ##STR00318##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1675) In some embodiments of the compound of Formula AA,
(1676) A is
(1677) ##STR00319## and R.sup.1 and R.sup.2, taken together forms
(1678) ##STR00320##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1679) ##STR00321##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1680) In some embodiments of the compound of Formula AA,
(1681) A is
(1682) ##STR00322## and R.sup.1 and R.sup.2, taken together forms
(1683) ##STR00323## wherein the
(1684) ##STR00324##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1685) In some embodiments of the compound of Formula AA,
(1686) A is
(1687) ##STR00325## and R.sup.1 and R.sup.2, taken together forms
(1688) ##STR00326## wherein the
(1689) ##STR00327##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1690) In some embodiments of the compound of Formula AA,
(1691) A is
(1692) ##STR00328## and R.sup.1 and R.sup.2, taken together forms
(1693) ##STR00329##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1694) ##STR00330##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1695) In some embodiments of the compound of Formula AA,
(1696) A is
(1697) ##STR00331## and R.sup.1 and R.sup.2, taken together forms
(1698) ##STR00332##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1699) ##STR00333##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1700) In some embodiments of the compound of Formula AA,
(1701) A is
(1702) ##STR00334## and R.sup.1 and R.sup.2, taken together forms
(1703) ##STR00335## wherein the
(1704) ##STR00336##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1705) In some embodiments of the compound of Formula AA,
(1706) A is
(1707) ##STR00337## and R.sup.1 and R.sup.2, taken together forms
(1708) ##STR00338## wherein the
(1709) ##STR00339##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1710) In some embodiments of the compound of Formula AA,
(1711) A is
(1712) ##STR00340## and R.sup.1 and R.sup.2, taken together forms
(1713) ##STR00341##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1714) ##STR00342##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1715) In some embodiments of the compound of Formula AA,
(1716) A is
(1717) ##STR00343## and R.sup.1 and R.sup.2, taken together forms
(1718) ##STR00344##
wherein the asterisk represents point of attachment to the nitrogen that is attached to R.sup.2, wherein the
(1719) ##STR00345##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1720) In some embodiments of the compound of Formula AA,
(1721) A is
(1722) ##STR00346## and R.sup.1 and R.sup.2, taken together forms
(1723) ##STR00347## wherein the
(1724) ##STR00348##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1725) In some embodiments of the compound of Formula AA,
(1726) A is
(1727) ##STR00349## and R.sup.1 and R.sup.2, taken together forms
(1728) ##STR00350## wherein the
(1729) ##STR00351##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1730) In some embodiments of the compound of Formula AA,
(1731) A is
(1732) ##STR00352## and R.sup.1 and R.sup.2, taken together forms
(1733) ##STR00353## wherein the
(1734) ##STR00354##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1735) In some embodiments of the compound of Formula AA,
(1736) A is
(1737) ##STR00355## and R.sup.1 and R.sup.2, taken together forms
(1738) ##STR00356## wherein the
(1739) ##STR00357##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1740) In some embodiments of the compound of Formula AA,
(1741) A is
(1742) ##STR00358## and R.sup.1 and R.sup.2, taken together forms
(1743) ##STR00359## wherein the
(1744) ##STR00360##
moiety is optionally substituted with one or more substituents independently selected from halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy NR.sup.8R.sup.9, and 3- to 10-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from halo, C.sub.1-C.sub.6 alkoxy, oxo, and NR.sup.8R.sup.9.
(1745) In some embodiments of the compound of Formula AA,
(1746) A is
(1747) ##STR00361## and R.sup.1 and R.sup.2, taken together forms
(1748) ##STR00362## wherein the
(1749) ##STR00363##
moiety is optionally substituted with one or more substituents independently selected from F, oxo, methyl, ethyl, methoxy, isopropoxy, methylamino, azetidinyl, wherein the methyl, ethyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from F, methoxy, oxo, and methylamino.
(1750) In some embodiments of the compound of formula AA,
(1751) ##STR00364##
is
(1752) ##STR00365##
and R.sup.6 is selected from: hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.
(1753) In some embodiments of the compound of formula AA,
(1754) ##STR00366##
is
(1755) ##STR00367##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.
(1756) In some embodiments of the compound of formula AA,
(1757) ##STR00368##
is
(1758) ##STR00369##
and R.sup.6 is selected from: hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.
(1759) In some embodiments of the compound of formula AA,
(1760) ##STR00370##
is
(1761) ##STR00371##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.
(1762) In some embodiments, of the compound of formula AA,
(1763) ##STR00372##
is
(1764) ##STR00373##
and the two R.sup.7 are one of the following combinations: One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; One R.sup.7 is C.sub.1-C.sub.6 alkyl and the other R.sup.7 is C.sub.1-C.sub.6 alkyl; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is halo; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is cyano; One R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.7 is halo; One R.sup.7 is cyclopropyl and the other R.sup.7 is halo; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.1-C.sub.6 alkoxy; One R.sup.7 is C.sub.1-C.sub.6 alkyl, and the other R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; One R.sup.7 is halo, and the other R.sup.7 is C.sub.1-C.sub.6 haloalkyl; One R.sup.7 is halo, and the other R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; One R.sup.7 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.7 is halo; One R.sup.7 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.7 is chloro; One R.sup.7 is hydrogen; and the other R.sup.7 is hydrogen; One R.sup.7 is hydrogen; and the other R.sup.7 is halo; One R.sup.7 is hydrogen; and the other R.sup.7 is chloro; or One R.sup.7 is hydrogen; and the other R.sup.7 is cyano.
(1765) In some embodiments, of the compound of formula AA,
(1766) ##STR00374##
is
(1767) ##STR00375##
and the two R.sup.6 are one of the following combinations: One R.sup.7 is isopropyl; and the other R.sup.7 is methyl; One R.sup.7 is isopropyl; and the other R.sup.7 is n-propyl; One R.sup.7 is isopropyl; and the other R.sup.7 is isopropyl; One R.sup.7 is isopropyl; and the other R.sup.7 is trifluoromethyl; One R.sup.7 is isopropyl; and the other R.sup.7 is cyclopropyl; One R.sup.7 is isopropyl; and the other R.sup.7 is chloro; One R.sup.7 is isopropyl; and the other R.sup.7 is fluoro; One R.sup.7 is ethyl; and the other R.sup.7 is fluoro; One R.sup.7 is isopropyl; and the other R.sup.7 is cyano; One R.sup.7 is cyclopropyl; and the other R.sup.7 is cyclopropyl; One R.sup.7 is cyclopropyl; and the other R.sup.7 is chloro; One R.sup.7 is cyclopropyl; and the other R.sup.7 is fluoro; One R.sup.7 is isopropyl; and the other R.sup.7 is methoxy; One R.sup.7 is isopropyl; and the other R.sup.7 is methoxy; or One R.sup.7 is isopropyl; and the other R.sup.7 is trifluoromethoxy.
(1768) In some embodiments, of the compound of formula AA,
(1769) ##STR00376##
is
(1770) ##STR00377##
and the two R.sup.6 are one of the following combinations: One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl and the other R.sup.6 is C.sub.1-C.sub.6 alkyl; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is cyano; One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is halo; One R.sup.6 is cyclopropyl and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkyl; One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is chloro; One R.sup.6 is hydrogen; and the other R.sup.6 is hydrogen; One R.sup.6 is hydrogen; and the other R.sup.6 is halo; One R.sup.6 is hydrogen; and the other R.sup.6 is chloro; One R.sup.6 is hydrogen; and the other R.sup.6 is cyano; or One R.sup.6 is hydrogen; and the other R.sup.6 is fluoro.
(1771) In some embodiments, of the compound of formula AA,
(1772) ##STR00378##
is
(1773) ##STR00379##
and the two R.sup.6 are one of the following combinations: One R.sup.6 is isopropyl; and the other R.sup.6 is methyl; One R.sup.6 is isopropyl; and the other R.sup.6 is n-propyl; One R.sup.6 is isopropyl; and the other R.sup.6 is isopropyl; One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethyl; One R.sup.6 is isopropyl; and the other R.sup.6 is cyclopropyl; One R.sup.6 is isopropyl; and the other R.sup.6 is chloro; One R.sup.6 is isopropyl; and the other R.sup.6 is fluoro; One R.sup.6 is ethyl; and the other R.sup.6 is fluoro; One R.sup.6 is isopropyl; and the other R.sup.6 is cyano; One R.sup.6 is cyclopropyl; and the other R.sup.6 is cyclopropyl; One R.sup.6 is cyclopropyl; and the other R.sup.6 is chloro; One R.sup.6 is cyclopropyl; and the other R.sup.6 is fluoro; One R.sup.6 is isopropyl; and the other R.sup.6 is methoxy; or One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethoxy.
(1774) In some embodiments, of the compound of formula AA,
(1775) ##STR00380##
is
(1776) ##STR00381##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo. R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is hydrogen, and R.sup.7 is halo; R.sup.6 is hydrogen, and R.sup.7 is cyano; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; or R.sup.6 is hydrogen, and R.sup.7 is chloro.
(1777) In some embodiments, of the compound of formula AA,
(1778) ##STR00382##
is
(1779) ##STR00383##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.1 is chloro; and R.sup.6 is trifluoromethoxy; R.sup.6 is hydrogen, and R.sup.7 is methyl; R.sup.6 is hydrogen, and R.sup.7 is isopropyl; R.sup.6 is hydrogen, and R.sup.7 is trifluoromethyl; R.sup.6 is hydrogen, and R.sup.7 is cyclopropyl; R.sup.6 is hydrogen, and R.sup.7 is fluoro; R.sup.6 is hydrogen, and R.sup.7 is methoxy; or R.sup.6 is hydrogen, and R.sup.7 is trifluoromethoxy.
(1780) In some embodiments, of the compound of formula AA,
(1781) ##STR00384##
is
(1782) ##STR00385##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is hydrogen, and R.sup.7 is halo; R.sup.6 is hydrogen, and R.sup.7 is cyano; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; or R.sup.6 is hydrogen, and R.sup.7 is chloro.
(1783) In some embodiments, of the compound of formula AA,
(1784) ##STR00386##
is
(1785) ##STR00387##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxyl; R.sup.6 is hydrogen, and R.sup.7 is methyl; R.sup.6 is hydrogen, and R.sup.7 is isopropyl; R.sup.6 is hydrogen, and R.sup.7 is trifluoromethyl; R.sup.6 is hydrogen, and R.sup.1 is cyclopropyl; R.sup.6 is hydrogen, and R.sup.7 is fluoro; R.sup.6 is hydrogen, and R.sup.7 is methoxy; or R.sup.6 is hydrogen, and R.sup.7 is trifluoromethoxy.
(1786) In some embodiments, of the compound of formula AA,
(1787) ##STR00388##
is
(1788) ##STR00389##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is hydrogen, and R.sup.7 is halo; each R.sup.6 is hydrogen, and R.sup.7 is cyano; each R.sup.6 is hydrogen, and R.sup.1 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is hydrogen, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; or each R.sup.6 is hydrogen, and R.sup.7 is chloro.
(1789) In some embodiments, of the compound of formula AA,
(1790) ##STR00390##
is
(1791) ##STR00391##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and R.sup.7 is methyl; each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and R.sup.7 is chloro; each R.sup.6 is isopropyl; and R.sup.7 is fluoro; each R.sup.6 is ethyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is methoxy; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and R.sup.6 is methyl; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; each R.sup.6 is hydrogen, and R.sup.7 is methyl; each R.sup.6 is hydrogen, and R.sup.7 is isopropyl; each R.sup.6 is hydrogen, and R.sup.7 is trifluoromethyl; each R.sup.6 is hydrogen, and R.sup.7 is cyclopropyl; each R.sup.6 is hydrogen, and R.sup.7 is fluoro; each R.sup.6 is hydrogen, and R.sup.7 is methoxy; or each R.sup.6 is hydrogen, and R.sup.7 is trifluoromethoxy.
(1792) In some embodiments, of the compound of formula AA,
(1793) ##STR00392##
is
(1794) ##STR00393##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is hydrogen, and each R.sup.7 is independently halo; R.sup.6 is hydrogen, and R.sup.7 is cyano; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; or R.sup.6 is hydrogen, and R.sup.7 is chloro.
(1795) In some embodiments, of the compound of formula AA,
(1796) ##STR00394##
is
(1797) ##STR00395##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and each R.sup.7 is methyl; R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and each R.sup.7 is chloro; R.sup.6 is isopropyl; and each R.sup.7 is fluoro; R.sup.6 is ethyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is cyano; R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is methoxy; R.sup.6 is isopropyl; and each R.sup.7 is methoxy; R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and R.sup.6 is methyl; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and R.sup.6 is chloro; each R.sup.7 is ethyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is methoxy; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; R.sup.6 is hydrogen, and each R.sup.7 is methyl; R.sup.6 is hydrogen, and each R.sup.7 is isopropyl; R.sup.6 is hydrogen, and each R.sup.7 is trifluoromethyl; R.sup.6 is hydrogen, and each R.sup.7 is cyclopropyl; R.sup.6 is hydrogen, and each R.sup.7 is fluoro; R.sup.6 is hydrogen, and each R.sup.7 is methoxy; or R.sup.6 is hydrogen, and each R.sup.7 is trifluoromethoxy.
(1798) In some embodiments, of the compound of formula AA,
(1799) ##STR00396##
is
(1800) ##STR00397##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; Two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is hydrogen, and each R.sup.7 is independently halo; each R.sup.6 is hydrogen, and R.sup.7 is cyano; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is hydrogen, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is hydrogen, and R.sup.7 is chloro; or one R.sup.6 is hydrogen, and one R.sup.6 and one R.sup.7, on adjacent atoms, taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring.
(1801) In some embodiments, of the compound of formula AA,
(1802) ##STR00398##
is
(1803) ##STR00399##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; each R.sup.6 is hydrogen, and each R.sup.7 is methyl; each R.sup.6 is hydrogen, and each R.sup.7 is isopropyl; each R.sup.6 is hydrogen, and each R.sup.7 is trifluoromethyl; each R.sup.6 is hydrogen, and each R.sup.7 is cyclopropyl; each R.sup.6 is hydrogen, and each R.sup.7 is fluoro; each R.sup.6 is hydrogen, and each R.sup.7 is methoxy; each R.sup.6 is hydrogen, and each R.sup.7 is trifluoromethoxy; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring. In some embodiments, each of R.sup.1 and R.sup.2 is independently selected from the group consisting of C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, or NR.sup.8R.sup.9; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; CO—C.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO(5- to 10-membered heteroaryl); OCO(3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)NR.sup.11R.sup.12; S(O)C.sub.1-C.sub.6 alkyl; and S(O.sub.2)C.sub.1-C.sub.6 alkyl. In some embodiments, R.sup.1 is selected from the group consisting of 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12. In some embodiments, R.sup.2 is selected from the group consisting of fluoro, chloro, cyano, methyl; methoxy; ethoxy; isopropyl; 1-hydroxy-2-methylpropan-2-yl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; COCH.sub.3; COPh; 2-methoxy-2-propyl; (dimethylamino)methyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12. In some embodiments,
(1804) ##STR00400## is
(1805) ##STR00401## and each R.sup.6 is independently selected from the group consisting of: hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5-to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl. In some embodiments,
(1806) ##STR00402## is
(1807) ##STR00403## and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, and C.sub.3-C.sub.7 cycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, or oxo. In some embodiments,
(1808) ##STR00404## is
(1809) ##STR00405## wherein each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form a C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments,
(1810) ##STR00406## is
(1811) ##STR00407## wherein each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form a C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments,
(1812) ##STR00408## is
(1813) ##STR00409## wherein each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1814) In some embodiments,
(1815) ##STR00410##
is
(1816) ##STR00411## wherein each R.sup.6 is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl; CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO(5- to 10-membered heteroaryl), NHCO(4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO(5- to 10-membered heteroaryl), OCO(3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1817) In some embodiments of
(1818) ##STR00412##
in Formula AA, each X is CR.sup.6, p is 0, 1 or 2, and Z is: 5-10-membered heteroaryl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl; or C.sub.6-C.sub.10 aryl, wherein Z is (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1819) In some embodiments of
(1820) ##STR00413##
in Formula AA, each X is CR.sup.6, p is 2, and Z is: 5-10-membered heteroaryl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl; or C.sub.6-C.sub.10 aryl, wherein Z is (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1821) In some embodiments of
(1822) ##STR00414##
in Formula AA, each X is CR.sup.6, p is 0, 1 or 2, and Z is: 5-10-membered heteroaryl optionally substituted with one or more C.sub.1-C.sub.6 alkyl or COOC.sub.1-C.sub.6 alkyl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl optionally substituted with COOC.sub.1-C.sub.6 alkyl; C.sub.6-C.sub.10 aryl (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1823) In some embodiments of
(1824) ##STR00415##
in Formula AA, each X is CR.sup.6, p is 2, and Z is: 5-10-membered heteroaryl optionally substituted with one or more C.sub.1-C.sub.6 alkyl or COOC.sub.1-C.sub.6 alkyl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl optionally substituted with COOC.sub.1-C.sub.6 alkyl; C.sub.6-C.sub.10 aryl (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1825) In some embodiments of
(1826) ##STR00416##
in Formula AA, each X is CR.sup.6, p is 2;
is: 5-10-membered heteroaryl optionally substituted with one or more C.sub.1-C.sub.6 alkyl or COOC.sub.1-C.sub.6 alkyl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl optionally substituted with COOC.sub.1-C.sub.6 alkyl; C.sub.6-C.sub.10 aryl (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; and
Y is C.sub.2 alkynylene.
(1827) In some embodiments of
(1828) ##STR00417##
in Formula AA-I, each X is CR.sup.6, p is 0, 1 or 2, and Z is: 5-10-membered heteroaryl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl; or C.sub.6-C.sub.10 aryl, wherein Z is (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1829) In some embodiments of
(1830) ##STR00418##
in Formula AA-I, each X is CR.sup.6, p is 2, and Z is: 5-10-membered heteroaryl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl; or C.sub.6-C.sub.10 aryl, wherein Z is (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, COOC.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1831) In some embodiments of
(1832) ##STR00419##
in Formula AA-I, each X is CR.sup.6, p is 0, 1 or 2, and Z is: 5-10-membered heteroaryl optionally substituted with one or more C.sub.1-C.sub.6 alkyl or COOC.sub.1-C.sub.6 alkyl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl optionally substituted with COOC.sub.1-C.sub.6 alkyl; C.sub.6-C.sub.10 aryl (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
(1833) In some embodiments of
(1834) ##STR00420##
in Formula AA-I, each X is CR.sup.6, p is 2, and Z is: 5-10-membered heteroaryl optionally substituted with one or more C.sub.1-C.sub.6 alkyl or COOC.sub.1-C.sub.6 alkyl; C.sub.5-C.sub.6 cycloalkyl; 5-6-membered heterocycloalkyl optionally substituted with COOC.sub.1-C.sub.6 alkyl; C.sub.6-C.sub.10 aryl (i) optionally substituted with one or more halo, CN, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryloxy, CONR.sup.8R.sup.9, C.sub.1-C.sub.6 alkoxy optionally substituted with phenyl, or C.sub.1-C.sub.6 alkyl optionally substituted with hydroxyl or with NR.sup.8R.sup.9, and (ii) optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen.
Non-Limiting Combinations and Formulas
(1835) In some embodiments, the compound of Formula AA is a compound of Formula AA-II:
(1836) ##STR00421##
(1837) In some embodiments, the compound of Formula AA is a compound of Formula AA-II(i):
(1838) ##STR00422## wherein A is an aromatic heteroaryl;
(1839) X.sup.1 is selected from the group consisting of CR.sup.1, CH, NR.sup.1, NH, N, O, and S; X.sup.2 is selected from the group consisting of CR.sup.2, CH, NR.sup.2, NH, N, O, and S; X.sup.3 is selected from the group consisting of CR.sup.1, CH, NR.sup.1, NH, N, O, and S; X.sup.4 is selected from the group consisting of CR.sup.2, CH, NR.sup.2, NH, N, O, and S; wherein at least one of X.sup.1, X.sup.2, X.sup.3, and X.sup.4 is other than CR.sup.1 and CR.sup.2; wherein one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1840) In certain embodiments of the compound of Formula AA-II(i), Y is a bond.
(1841) In certain other embodiments of the compound of Formula AA-II(i), Y is O or S.
(1842) In some embodiments of the compound of Formula AA-II(i),
(1843) ##STR00423##
is
(1844) ##STR00424##
X.sup.1 and X.sup.4 are each independently selected from N and CH; and the R.sup.1 and R.sup.2 that the asterisks are closest to are taken together with the atoms connecting them to form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.1a cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1845) In some embodiments of the compound of Formula AA-II(i),
(1846) ##STR00425##
is
(1847) ##STR00426##
(1848) X.sup.1 and X.sup.4 are each independently selected from N and CH;
(1849) X.sup.5 is selected from O, NH, CH.sub.2, and CHR.sup.30;
(1850) X.sup.6 is selected from CH.sub.2, NR.sup.31, and C(O);
(1851) X.sup.7 is selected from a bond, O, CH.sub.2, CH.sub.2CH.sub.2, CHR.sup.32a, and CHR.sup.32aR.sup.32b;
(1852) X.sup.8 is selected from CH.sub.2 and C(O);
(1853) R.sup.30 is C.sub.1-C.sub.6 alkyl (e.g., methyl);
(1854) R.sup.31 is C.sub.1-C.sub.6 alkyl (e.g., ethyl) optionally substituted with C.sub.1-C.sub.6 alkoxy (e.g., methoxy; and
(1855) R.sup.32a and R.sup.32b are each independently selected from hydroxy, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9 (e.g., methoxycarbamoylmethyl), C.sub.1-C.sub.6 alkoxy (e.g., methoxy or isopropoxy), NR.sup.8R.sup.9 (e.g., methylamino or dimethylamino), and 3- to 10-membered heterocycloalkyl (e.g., azetidinyl) optionally substituted with halo (e.g., fluoro) or C.sub.1-C.sub.6 alkoxy (e.g., methoxy), or, alternatively, R.sup.32a and R.sup.32b are taken together with the atoms connecting them to form a C.sub.3-C.sub.6 carbocyclic ring (e.g., cyclopropyl).
(1856) In certain embodiments of foregoing, X.sup.1 is N; and X.sup.4 is CH.
(1857) In some embodiments of the compound of Formula AA-II(i),
(1858) ##STR00427##
is
(1859) ##STR00428##
and the R.sup.1 and R.sup.2 that the asterisks are closest to are taken together with the atoms connecting them to form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1860) In some embodiments of the compound of Formula AA-II(i),
(1861) ##STR00429##
is
(1862) ##STR00430##
and the R.sup.1 and R.sup.2 that the asterisks are closest to are taken together with the atoms connecting them to form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.1R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.1R.sup.9.
(1863) In some embodiments of the compound of Formula AA-II(i),
(1864) ##STR00431##
is
(1865) ##STR00432##
X.sup.1 is selected from N and S, and the R.sup.1 and R.sup.2 that the asterisks are closest to are taken together with the atoms connecting them to form a monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or a monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, —NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1866) In some embodiments of the compound of Formula AA-II(i), the R.sup.1 and R.sup.2 that the asterisks are closest to are taken together with the atoms connecting them to form C.sub.5-C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 heteroatom and/or heteroatomic group selected from O, NH, and NR.sup.13, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from, oxo, methyl, ethyl, isopropyl, methoxy, isopropoxy, and azetidinyl, wherein the methyl, ethyl, isopropyl, methoxy, isopropoxy, and azetidinyl are optionally substituted with one or more substituents selected from hydroxy, fluoro, methoxy, and NR.sup.8R.sup.9; wherein R.sup.8 and R.sup.9 are each independently selected from H, methyl, and CO.sub.2R.sup.13; and wherein R.sup.13 is selected from methyl and difluoromethyl.
(1867) In some embodiments of the compound of Formula AA-II(i), R.sup.6 is selected from hydrogen and halo (e.g., fluoro); each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl (e.g., isopropyl, isobutyl, or n-propyl) and C.sub.3-C.sub.10 cycloalkyl (e.g., cyclopropyl); X is selected from N and CR.sup.6; Y is selected from a bond, O, S, and CR.sup.16R.sup.17 (e.g., 2-ethyl); and Z is selected from 5-10-membered monocyclic or bicyclic heteroaryl (e.g., pyrimidinyl (e.g., 2-pyrimidinyl or 4-pyrimidinyl) or thiazolyl), a 5-10-membered monocyclic or bicyclic heterocyclic ring (e.g., chromanyl or methylenedioxyphenyl), a C.sub.6-C.sub.10 monocyclic or bicyclic aryl (e.g., phenyl), wherein Z is optionally substituted with one or more substituents independently selected from C.sub.1-C.sub.6 alkyl (e.g., methyl), halo (e.g., fluoro or chloro), and C.sub.3-C.sub.10 cycloalkyl (e.g., cyclopropyl).
(1868) In some embodiments of the compound of Formula AA-II(i), R.sup.6 is selected from hydrogen and fluoro; each R.sup.7 is independently selected from isopropyl, isobutyl, n-propyl, and cyclopropyl; X is selected from N and CR.sup.6; Y is selected from a bond, O, S, and 2-ethyl; and Z is selected from pyrimidinyl, thiazolyl, chromanyl, methylenedioxyphenyl, and phenyl, wherein Z is optionally substituted with one or more substituents independently selected from methyl, fluoro, chloro, and cyclopropyl.
(1869) In some embodiments, the optionally substituted ring A is
(1870) ##STR00433##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1871) In some embodiments, the optionally substituted ring A is
(1872) ##STR00434##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1873) In some embodiments, the substituted ring A is
(1874) ##STR00435##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1875) In some embodiments, the optionally substituted ring A is
(1876) ##STR00436##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1877) In some embodiments, the optionally substituted ring A is
(1878) ##STR00437##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1879) In some embodiments, the substituted ring A is
(1880) ##STR00438##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1881) In some embodiments, the optionally substituted ring A is
(1882) ##STR00439##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1883) In some embodiments, the optionally substituted ring A is
(1884) ##STR00440##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1885) In some embodiments, the optionally substituted ring A is
(1886) ##STR00441##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1887) In some embodiments, the substituted ring A is
(1888) ##STR00442##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1889) In some embodiments, the substituted ring A is
(1890) ##STR00443##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1891) In some embodiments, the substituted ring A is
(1892) ##STR00444##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1893) In some embodiments, the optionally substituted ring A is
(1894) ##STR00445##
and
R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the optionally substituted ring A is
(1895) ##STR00446##
and
or one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1896) In some embodiments, the substituted ring A is
(1897) ##STR00447##
and
R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1898) In some embodiments, the optionally substituted ring A is
(1899) ##STR00448##
and
or one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1900) In some embodiments, the substituted ring A is
(1901) ##STR00449##
and
R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.1R.sup.9.
(1902) In some embodiments, the optionally substituted ring A
(1903) ##STR00450##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1904) In some embodiments, the optionally substituted ring A is
(1905) ##STR00451##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1906) In some embodiments, the optionally substituted ring A is
(1907) ##STR00452##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1908) In some embodiments, the optionally substituted ring A is
(1909) ##STR00453##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.1R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1910) In some embodiments, the substituted ring A is
(1911) ##STR00454##
and
one pair of R.sup.1 and R.sup.2, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1912) In some embodiments, the substituted ring A is
(1913) ##STR00455##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, —NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1914) In some embodiments, the substituted ring A is
(1915) ##STR00456##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1916) In some embodiments, the substituted ring A is
(1917) ##STR00457##
and
R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, —NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1918) In some embodiments, the substituted ring A is
(1919) ##STR00458##
and
R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1920) In some embodiments, the substituted ring A is
(1921) ##STR00459##
and
one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one monocyclic or bicyclic C.sub.4-C.sub.12 carbocyclic ring or at least one monocyclic or bicyclic 5-to-12-membered heterocyclic ring containing 1-3 heteroatoms and/or heteroatomic groups independently selected from O, N, NH, NR.sup.13, S, S(O), and S(O).sub.2, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxy, OC.sub.3-C.sub.10 cycloalkyl, NR.sup.8R.sup.9, ═NR.sup.10, CN, COOC.sub.1-C.sub.6 alkyl, OS(O.sub.2)C.sub.6-C.sub.10 aryl, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, S(O.sub.2)C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.10 cycloalkyl, and 3- to 10-membered heterocycloalkyl are optionally substituted with one or more substituents selected from hydroxy, halo, C.sub.1-C.sub.6 alkyl optionally substituted with NR.sup.8R.sup.9, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, C.sub.3-C.sub.10 cycloalkyl, C.sub.1-C.sub.6 alkoxy, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
(1922) Unless otherwise indicated, when a disclosed compound is named or depicted by a structure without specifying the stereochemistry and has one or more chiral centers, it is understood to represent all possible stereoisomers of the compound.
(1923) It is understood that the combination of variables in the formulae herein is such that the compounds are stable.
(1924) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1A:
(1925) TABLE-US-00001 TABLE 1A Compound Structure 101
(1926) or a pharmaceutically acceptable salt thereof.
(1927) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1B:
(1928) TABLE-US-00002 TABLE 1B Compound Structure 101
(1929) or a pharmaceutically acceptable salt thereof.
(1930) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1C:
(1931) TABLE-US-00003 TABLE 1C Compound Structure 201
(1932) or a pharmaceutically acceptable salt thereof.
(1933) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1D:
(1934) TABLE-US-00004 TABLE 1D Com- Structure pound # 301
(1935) or a pharmaceutically acceptable salt thereof.
(1936) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1C and/or Table 1D.
(1937) Pharmaceutical Compositions and Administration
(1938) General
(1939) In some embodiments, a chemical entity (e.g., a compound that modulates (e.g., antagonizes) NLRP1 or NLRP3 or both NLRP1 and NLRP3, or a pharmaceutically acceptable salt, and/or hydrate, and/or cocrystal, and/or drug combination thereof) is administered as a pharmaceutical composition that includes the chemical entity and one or more pharmaceutically acceptable excipients, and optionally one or more additional therapeutic agents as described herein.
(1940) In some embodiments, the chemical entities can be administered in combination with one or more conventional pharmaceutical excipients. Pharmaceutically acceptable excipients include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α-tocopherol polyethylene glycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens, poloxamers or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, tris, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium-chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, and wool fat. Cyclodextrins such as α-, β, and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl-p-cyclodextrins, or other solubilized derivatives can also be used to enhance delivery of compounds described herein. Dosage forms or compositions containing a chemical entity as described herein in the range of 0.005% to 100% with the balance made up from non-toxic excipient may be prepared. The contemplated compositions may contain 0.001%-100% of a chemical entity provided herein, in one embodiment 0.1-95%, in another embodiment 75-85%, in a further embodiment 20-80%. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 22.sup.nd Edition (Pharmaceutical Press, London, U K. 2012).
(1941) Routes of Administration and Composition Components
(1942) In some embodiments, the chemical entities described herein or a pharmaceutical composition thereof can be administered to subject in need thereof by any accepted route of administration. Acceptable routes of administration include, but are not limited to, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal. In certain embodiments, a preferred route of administration is parenteral (e.g., intratumoral).
(1943) Compositions can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified. The preparation of such formulations will be known to those of skill in the art in light of the present disclosure.
(1944) The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
(1945) The carrier also can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
(1946) Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.
(1947) Intratumoral injections are discussed, e.g., in Lammers, et al., “Effect of Intratumoral Injection on the Biodistribution and the Therapeutic Potential of HPMA Copolymer-Based Drug Delivery Systems” Neoplasia. 2006, 10, 788-795.
(1948) Pharmacologically acceptable excipients usable in the rectal composition as a gel, cream, enema, or rectal suppository, include, without limitation, any one or more of cocoa butter glycerides, synthetic polymers such as polyvinylpyrrolidone, PEG (like PEG ointments), glycerine, glycerinated gelatin, hydrogenated vegetable oils, poloxamers, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol Vaseline, anhydrous lanolin, shark liver oil, sodium saccharinate, menthol, sweet almond oil, sorbitol, sodium benzoate, anoxid SBN, vanilla essential oil, aerosol, parabens in phenoxyethanol, sodium methyl p-oxybenzoate, sodium propyl p-oxybenzoate, diethylamine, carbomers, carbopol, methyloxybenzoate, macrogol cetostearyl ether, cocoyl caprylocaprate, isopropyl alcohol, propylene glycol, liquid paraffin, xanthan gum, carboxy-metabisulfite, sodium edetate, sodium benzoate, potassium metabisulfite, grapefruit seed extract, methyl sulfonyl methane (MSM), lactic acid, glycine, vitamins, such as vitamin A and E and potassium acetate.
(1949) In certain embodiments, suppositories can be prepared by mixing the chemical entities described herein with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum and release the active compound. In other embodiments, compositions for rectal administration are in the form of an enema.
(1950) In other embodiments, the compounds described herein or a pharmaceutical composition thereof are suitable for local delivery to the digestive or GI tract by way of oral administration (e.g., solid or liquid dosage forms.).
(1951) Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the chemical entity is mixed with one or more pharmaceutically acceptable excipients, such as sodium citrate or dicalcium phosphate and/or: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
(1952) In one embodiment, the compositions will take the form of a unit dosage form such as a pill or tablet and thus the composition may contain, along with a chemical entity provided herein, a diluent such as lactose, sucrose, dicalcium phosphate, or the like; a lubricant such as magnesium stearate or the like; and a binder such as starch, gum acacia, polyvinylpyrrolidine, gelatin, cellulose, cellulose derivatives or the like. In another solid dosage form, a powder, marume, solution or suspension (e.g., in propylene carbonate, vegetable oils, PEG's, poloxamer 124 or triglycerides) is encapsulated in a capsule (gelatin or cellulose base capsule). Unit dosage forms in which one or more chemical entities provided herein or additional active agents are physically separated are also contemplated; e.g., capsules with granules (or tablets in a capsule) of each drug; two-layer tablets; two-compartment gel caps, etc. Enteric coated or delayed release oral dosage forms are also contemplated.
(1953) Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives that are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, phenol and ascorbic acid.
(1954) In certain embodiments the excipients are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. For various oral dosage form excipients such as tablets and capsules sterility is not required. The USP/NF standard is usually sufficient.
(1955) In certain embodiments, solid oral dosage forms can further include one or more components that chemically and/or structurally predispose the composition for delivery of the chemical entity to the stomach or the lower GI; e.g., the ascending colon and/or transverse colon and/or distal colon and/or small bowel. Exemplary formulation techniques are described in, e.g., Filipski, K. J., et al., Current Topics in Medicinal Chemistry, 2013, 13, 776-802, which is incorporated herein by reference in its entirety.
(1956) Examples include upper-GI targeting techniques, e.g., Accordion Pill (Intec Pharma), floating capsules, and materials capable of adhering to mucosal walls.
(1957) Other examples include lower-GI targeting techniques. For targeting various regions in the intestinal tract, several enteric/pH-responsive coatings and excipients are available. These materials are typically polymers that are designed to dissolve or erode at specific pH ranges, selected based upon the GI region of desired drug release. These materials also function to protect acid labile drugs from gastric fluid or limit exposure in cases where the active ingredient may be irritating to the upper GI (e.g., hydroxypropyl methylcellulose phthalate series, Coateric (polyvinyl acetate phthalate), cellulose acetate phthalate, hydroxypropyl methylcellulose acetate succinate, Eudragit series (methacrylic acid-methyl methacrylate copolymers), and Marcoat). Other techniques include dosage forms that respond to local flora in the GI tract, Pressure-controlled colon delivery capsule, and Pulsincap.
(1958) Ocular compositions can include, without limitation, one or more of any of the following: viscogens (e.g., Carboxymethylcellulose, Glycerin, Polyvinylpyrrolidone, Polyethylene glycol); Stabilizers (e.g., Pluronic (triblock copolymers), Cyclodextrins); Preservatives (e.g., Benzalkonium chloride, ETDA, SofZia (boric acid, propylene glycol, sorbitol, and zinc chloride; Alcon Laboratories, Inc.), Purite (stabilized oxychloro complex; Allergan, Inc.)).
(1959) Topical compositions can include ointments and creams. Ointments are semisolid preparations that are typically based on petrolatum or other petroleum derivatives. Creams containing the selected active agent are typically viscous liquid or semisolid emulsions, often either oil-in-water or water-in-oil. Cream bases are typically water-washable, and contain an oil phase, an emulsifier and an aqueous phase. The oil phase, also sometimes called the “internal” phase, is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol; the aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant. The emulsifier in a cream formulation is generally a nonionic, anionic, cationic or amphoteric surfactant. As with other carriers or vehicles, an ointment base should be inert, stable, nonirritating and non-sensitizing.
(1960) In any of the foregoing embodiments, pharmaceutical compositions described herein can include one or more one or more of the following: lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]-based or poly anhydride-based nanoparticles or microparticles, and nanoporous particle-supported lipid bilayers.
(1961) Dosages
(1962) The dosages may be varied depending on the requirement of the patient, the severity of the condition being treating and the particular compound being employed. Determination of the proper dosage for a particular situation can be determined by one skilled in the medical arts. The total daily dosage may be divided and administered in portions throughout the day or by means providing continuous delivery.
(1963) In some embodiments, the compounds described herein are administered at a dosage of from about 0.001 mg/Kg to about 500 mg/Kg (e.g., from about 0.001 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 150 mg/Kg; from about 0.01 mg/Kg to about 100 mg/Kg; from about 0.01 mg/Kg to about 50 mg/Kg; from about 0.01 mg/Kg to about 10 mg/Kg; from about 0.01 mg/Kg to about 5 mg/Kg; from about 0.01 mg/Kg to about 1 mg/Kg; from about 0.01 mg/Kg to about 0.5 mg/Kg; from about 0.01 mg/Kg to about 0.1 mg/Kg; from about 0.1 mg/Kg to about 200 mg/Kg; from about 0.1 mg/Kg to about 150 mg/Kg; from about 0.1 mg/Kg to about 100 mg/Kg; from about 0.1 mg/Kg to about 50 mg/Kg; from about 0.1 mg/Kg to about 10 mg/Kg; from about 0.1 mg/Kg to about 5 mg/Kg; from about 0.1 mg/Kg to about 1 mg/Kg; from about 0.1 mg/Kg to about 0.5 mg/Kg).
(1964) Regimens
(1965) The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weeks, once every two weeks, once a month).
(1966) In some embodiments, the period of administration of a compound described herein is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In an embodiment, a therapeutic compound is administered to an individual for a period of time followed by a separate period of time. In another embodiment, a therapeutic compound is administered for a first period and a second period following the first period, with administration stopped during the second period, followed by a third period where administration of the therapeutic compound is started and then a fourth period following the third period where administration is stopped. In an aspect of this embodiment, the period of administration of a therapeutic compound followed by a period where administration is stopped is repeated for a determined or undetermined period of time. In a further embodiment, a period of administration is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.
(1967) Methods of Treatment
(1968) In some embodiments, methods for treating a subject having condition, disease or disorder in which a decrease or increase in NLRP1 or NLRP3 or both NLRP1 and NLRP3 activity (e.g., an increase, e.g., NLRP1/3 signaling) contributes to the pathology and/or symptoms and/or progression of the condition, disease or disorder are provided, comprising administering to a subject an effective amount of a chemical entity described herein (e.g., a compound described generically or specifically herein or a pharmaceutically acceptable salt thereof or compositions containing the same).
(1969) Indications
(1970) In some embodiments, the condition, disease or disorder is selected from: inappropriate host responses to infectious diseases where active infection exists at any body site, such as septic shock, disseminated intravascular coagulation, and/or adult respiratory distress syndrome; acute or chronic inflammation due to antigen, antibody and/or complement deposition; inflammatory conditions including arthritis, cholangitis, colitis, encephalitis, endocarditis, glomerulonephritis, hepatitis, myocarditis, pancreatitis, pericarditis, reperfusion injury and vasculitis, immune-based diseases such as acute and delayed hypersensitivity, graft rejection, and graft-versus-host disease; auto-immune diseases including Type 1 diabetes mellitus and multiple sclerosis. For example, the condition, disease or disorder may be an inflammatory disorder such as rheumatoid arthritis, osteoarthritis, septic shock, COPD and periodontal disease.
(1971) In some embodiments, the condition, disease or disorder is an autoimmune diseases. Non-limiting examples include rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, inflammatory bowel diseases (IBDs) comprising Crohn disease (CD) and ulcerative colitis (UC), which are chronic inflammatory conditions with polygenic susceptibility. In certain embodiments, the condition is an inflammatory bowel disease. In certain embodiments, the condition is Crohn's disease, autoimmune colitis, iatrogenic autoimmune colitis, ulcerative colitis, colitis induced by one or more chemotherapeutic agents, colitis induced by treatment with adoptive cell therapy, colitis associated by one or more alloimmune diseases (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), radiation enteritis, collagenous colitis, lymphocytic colitis, microscopic colitis, and radiation enteritis. In certain of these embodiments, the condition is alloimmune disease (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), celiac disease, irritable bowel syndrome, rheumatoid arthritis, lupus, scleroderma, psoriasis, cutaneous T-cell lymphoma, uveitis, and mucositis (e.g., oral mucositis, esophageal mucositis or intestinal mucositis).
(1972) In some embodiments, the condition, disease or disorder is selected from major adverse cardiovascular events such as cardiovascular death, non-fatal myocardial infarction and non-fatal stroke in patients with a prior hear attack and inflammatory atherosclerosis (see for example, NCT01327846).
(1973) In some embodiments, the condition, disease or disorder is selected from metabolic disorders such as type 2 diabetes, atherosclerosis, obesity and gout, as well as diseases of the central nervous system, such as Alzheimer's disease and multiple sclerosis and Amyotrophic Lateral Sclerosis and Parkinson disease, lung disease, such as asthma and COPD and pulmonary idiopathic fibrosis, liver disease, such as NASH syndrome, viral hepatitis and cirrhosis, pancreatic disease, such as acute and chronic pancreatitis, kidney disease, such as acute and chronic kidney injury, intestinal disease such as Crohn's disease and Ulcerative Colitis, skin disease such as psoriasis, musculoskeletal disease such as scleroderma, vessel disorders, such as giant cell arteritis, disorders of the bones, such as Osteoarthritis, osteoporosis and osteopetrosis disorders eye disease, such as glaucoma and macular degeneration, diseased caused by viral infection such as HIV and AIDS, autoimmune disease such as Rheumatoid Arthritis, Systemic Lupus Erythematosus, Autoimmune Thyroiditis, Addison's disease, pernicious anemia, cancer and aging.
(1974) In some embodiments, the condition, disease or disorder is a cardiovascular indication. In some embodiments, the condition, disease or disorder is myocardial infraction. In some embodiments, the condition, disease or disorder is stroke.
(1975) In some embodiments, the condition, disease or disorder is obesity.
(1976) In some embodiments, the condition, disease or disorder is Type 2 Diabetes.
(1977) In some embodiments, the condition, disease or disorder is NASH.
(1978) In some embodiments, the condition, disease or disorder is Alzheimer's disease.
(1979) In some embodiments, the condition, disease or disorder is gout.
(1980) In some embodiments, the condition, disease or disorder is SLE.
(1981) In some embodiments, the condition, disease or disorder is rheumatoid arthritis.
(1982) In some embodiments, the condition, disease or disorder is IBD.
(1983) In some embodiments, the condition, disease or disorder is multiple sclerosis.
(1984) In some embodiments, the condition, disease or disorder is COPD.
(1985) In some embodiments, the condition, disease or disorder is asthma.
(1986) In some embodiments, the condition, disease or disorder is scleroderma.
(1987) In some embodiments, the condition, disease or disorder is pulmonary fibrosis.
(1988) In some embodiments, the condition, disease or disorder is age related macular degeneration (AMD).
(1989) In some embodiments, the condition, disease or disorder is cystic fibrosis.
(1990) In some embodiments, the condition, disease or disorder is Muckle Wells syndrome.
(1991) In some embodiments, the condition, disease or disorder is familial cold autoinflammatory syndrome (FCAS).
(1992) In some embodiments, the condition, disease or disorder is chronic neurologic cutaneous and articular syndrome.
(1993) In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; acute myeloid leukemia (AML) chronic myeloid leukemia (CML); gastric cancer; and lung cancer metastasis.
(1994) In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; gastric cancer; and lung cancer metastasis.
(1995) In some embodiments, the indication is MDS.
(1996) In some embodiments, the indication is non-small lung cancer in patients carrying mutation or overexpression of NLRP3.
(1997) In some embodiments, the indication is ALL in patients resistant to glucocorticoids treatment.
(1998) In some embodiments, the indication is LCH.
(1999) In some embodiments, the indication is multiple myeloma.
(2000) In some embodiments, the indication is promyelocytic leukemia.
(2001) In some embodiments, the indication is gastric cancer.
(2002) In some embodiments, the indication is lung cancer metastasis.
(2003) Combination Therapy
(2004) This disclosure contemplates both monotherapy regimens as well as combination therapy regimens.
(2005) In some embodiments, the methods described herein can further include administering one or more additional therapies (e.g., one or more additional therapeutic agents and/or one or more therapeutic regimens) in combination with administration of the compounds described herein.
(2006) In certain embodiments, the second therapeutic agent or regimen is administered to the subject prior to contacting with or administering the chemical entity (e.g., about one hour prior, or about 6 hours prior, or about 12 hours prior, or about 24 hours prior, or about 48 hours prior, or about 1 week prior, or about 1 month prior).
(2007) In other embodiments, the second therapeutic agent or regimen is administered to the subject at about the same time as contacting with or administering the chemical entity. By way of example, the second therapeutic agent or regimen and the chemical entity are provided to the subject simultaneously in the same dosage form. As another example, the second therapeutic agent or regimen and the chemical entity are provided to the subject concurrently in separate dosage forms.
(2008) In still other embodiments, the second therapeutic agent or regimen is administered to the subject after contacting with or administering the chemical entity (e.g., about one hour after, or about 6 hours after, or about 12 hours after, or about 24 hours after, or about 48 hours after, or about 1 week after, or about 1 month after).
(2009) Patient Selection
(2010) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism.
(2011) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 where polymorphism is a gain of function
(2012) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism found in CAPS syndromes.
(2013) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is VAR_014104 (R262W)
(2014) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is a natural variant reported in http://www.uniprot.org/uniprot/Q96P20
(2015) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1 activity, such as an indication related NLRP1 polymorphism.
(2016) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1 activity, such as an indication related to NLRP1 where polymorphism is a gain of function
(2017) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1 activity, such as an indication related NLRP1 polymorphism found in vitiligo Vitiligo-Associated Autoimmune Disease.
(2018) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1 activity, such as an indication related where NLRP1 polymorphism is VAR_033239 (L155H)
(2019) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1 activity, such as an indication related where NLRP1 polymorphism is a natural variant reported in http://www.uniprot.org/uniprot/Q9C000
(2020) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP1/3 activity, such as an indication related to point mutation of NLRP1/3 signaling.
(2021) Anti-TNFα Agents
(2022) The term “anti-TNFα agent” refers to an agent which directly or indirectly blocks, down-regulates, impairs, inhibits, impairs, or reduces TNFα activity and/or expression. In some embodiments, an anti-TNFα agent is an antibody or an antigen-binding fragment thereof, a fusion protein, a soluble TNFα receptor (a soluble tumor necrosis factor receptor superfamily member 1A (TNFR1) or a soluble tumor necrosis factor receptor superfamily 1B (TNFR2)), an inhibitory nucleic acid, or a small molecule TNFα antagonist. In some embodiments, the inhibitory nucleic acid is a ribozyme, small hairpin RNA, a small interfering RNA, an antisense nucleic acid, or an aptamer.
(2023) Exemplary anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression can, e.g., inhibit or decrease the expression level of TNFα or a receptor of TNFα (TNFR1 or TNFR2) in a cell (e.g., a cell obtained from a subject, a mammalian cell), or inhibit or reduce binding of TNFα to its receptor (TNFR1 and/or TNFR2) and/or. Non-limiting examples of anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression include an antibody or fragment thereof, a fusion protein, a soluble TNFα receptor (e.g., a soluble TNFR1 or soluble TNFR2), inhibitory nucleic acids (e.g., any of the examples of inhibitory nucleic acids described herein), and a small molecule TNFα antagonist.
(2024) Exemplary anti-TNFα agents that can indirectly block, down-regulate, impair, inhibitreduce TNFα activity and/or expression can, e.g., inhibit or decrease the level of downstream signaling of a TNFα receptor (e.g., TNFR1 or TNFR2) in a mammalian cell (e.g., decrease the level and/or activity of one or more of the following signaling proteins: AP-1, mitogen-activated protein kinase kinase kinase 5 (ASK1), inhibitor of nuclear factor kappa B (IKK), mitogen-activated protein kinase 8 (JNK), mitogen-activated protein kinase (MAPK), MEKK 1/4, MEKK 4/7, MEKK 3/6, nuclear factor kappa B (NF-κB), mitogen-activated protein kinase kinase kinase 14 (NIK), receptor interacting serine/threonine kinase 1 (RIP), TNFRSFIA associated via death domain (TRADD), and TNF receptor associated factor 2 (TRAF2), in a cell), and/or decrease the level of TNFα-induced gene expression in a mammalian cell (e.g., decrease the transcription of genes regulated by, e.g., one or more transcription factors selected from the group of activating transcription factor 2 (ATF2), c-Jun, and NF-κB). A description of downstream signaling of a TNFα receptor is provided in Wajant et al., Cell Death Differentiation 10:45-65, 2003 (incorporated herein by reference). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) a signaling component downstream of a TNFα-induced gene (e.g., any TNFα-induced gene known in the art), a TNFα receptor (e.g., any one or more of the signaling components downstream of a TNFα receptor described herein or known in the art), or a transcription factor selected from the group of NF-κB, c-Jun, and ATF2.
(2025) In other examples, such indirect anti-TNFα agents can be a small molecule inhibitor of a protein encoded by a TNFα-induced gene (e.g., any protein encoded by a TNFα-induced gene known in the art), a small molecule inhibitor of a signaling component downstream of a TNFα receptor (e.g., any of the signaling components downstream of a TNFα receptor described herein or known in the art), and a small molecule inhibitor of a transcription factor selected from the group of ATF2, c-Jun, and NF-κB.
(2026) In other embodiments, anti-TNFα agents that can indirectly block, down-regulate, impair, or reduce one or more components in a cell (e.g., a cell obtained from a subject, a mammalian cell) that are involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., one or more components selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, interleukin 1 receptor associated kinase 1 (IRAK), JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, PKR, p38, AKT serine/threonine kinase 1 (rac), raf kinase (raf), ras, TRAF6, TTP). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, LBP, MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP). In other examples, an indirect anti-TNFα agents is a small molecule inhibitor of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP).
(2027) Antibodies
(2028) In some embodiments, the anti-TNFα agent is an antibody or an antigen-binding fragment thereof (e.g., a Fab or a scFv). In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to TNFα. In some embodiments, an antibody or antigen-binding fragment described herein binds specifically to any one of TNFα, TNFR1, or TNFR2. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to a TNFα receptor (TNFR1 or TNFR2).
(2029) In some embodiments, the antibody can be a humanized antibody, a chimeric antibody, a multivalent antibody, or a fragment thereof. In some embodiments, an antibody can be a scFv-Fc, a VHH domain, a VNAR domain, a (scFv)2, a minibody, or a BiTE.
(2030) In some embodiments, an antibody can be a crossmab, a diabody, a scDiabody, a scDiabody-CH3, a Diabody-CH3, a DutaMab, a DT-IgG, a diabody-Fc, a scDiabody-HAS, a charge pair antibody, a Fab-arm exchange antibody, a SEEDbody, a Triomab, a LUZ-Y, a Fcab, a kλ-body, an orthogonal Fab, a DVD-IgG, an IgG(H)-scFv, a scFv-(H)IgG, an IgG(L)-scFv, a scFv-(L)-IgG, an IgG (L,H)-Fc, an IgG(H)-V, a V(H)-IgG, an IgG(L)-V, a V(L)-IgG, an KIH IgG-scFab, a 2scFv-IgG, an IgG-2scFv, a scFv4-Ig, a Zybody, a DVI-IgG, a nanobody, a nanobody-HSA, a DVD-Ig, a dual-affinity re-targeting antibody (DART), a triomab, a kih IgG with a common LC, an ortho-Fab IgG, a 2-in-1-IgG, IgG-ScFv, scFv2-Fc, a bi-nanobody, tanden antibody, a DART-Fc, a scFv-HAS-scFv, a DAF (two-in-one or four-in-one), a DNL-Fab3, knobs-in-holes common LC, knobs-in-holes assembly, a TandAb, a Triple Body, a miniantibody, a minibody, a TriBi minibody, a scFv-CH3 KIH, a Fab-scFv, a scFv-CH-CL-scFv, a F(ab′)2-scFV2, a scFv-KIH, a Fab-scFv-Fc, a tetravalent HCAb, a scDiabody-Fc, a tandem scFv-Fc, an intrabody, a dock and lock bispecific antibody, an ImmTAC, a HSAbody, a tandem scFv, an IgG-IgG, a Cov-X-Body, and a scFv1-PEG-scFv2.
(2031) Non-limiting examples of an antigen-binding fragment of an antibody include an Fv fragment, a Fab fragment, a F(ab′)2 fragment, and a Fab′ fragment. Additional examples of an antigen-binding fragment of an antibody is an antigen-binding fragment of an antigen-binding fragment of an IgA (e.g., an antigen-binding fragment of IgA1 or IgA2) (e.g., an antigen-binding fragment of a human or humanized IgA, e.g., a human or humanized IgA1 or IgA2); an antigen-binding fragment of an IgD (e.g., an antigen-binding fragment of a human or humanized IgD); an antigen-binding fragment of an IgE (e.g., an antigen-binding fragment of a human or humanized IgE); an IgG (e.g., an antigen-binding fragment of IgG1, IgG2, IgG3, or IgG4) (e.g., an antigen-binding fragment of a human or humanized IgG, e.g., human or humanized IgG1, IgG2, IgG3, or IgG4); or an antigen-binding fragment of an IgM (e.g., an antigen-binding fragment of a human or humanized IgM).
(2032) Non-limiting examples of anti-TNFα agents that are antibodies that specifically bind to TNFα are described in Ben-Horin et al., Autoimmunity Rev. 13(1):24-30, 2014; Bongartz et al., JAMA 295(19):2275-2285, 2006; Butler et al., Eur. Cytokine Network 6(4):225-230, 1994; Cohen et al., Canadian J. Gastroenterol. Hepatol. 15(6):376-384, 2001; Elliott et al., Lancet 1994; 344: 1125-1127, 1994; Feldmann et al., Ann. Rev. Immunol. 19(1):163-196, 2001; Rankin et al., Br. J. Rheumatol. 2:334-342, 1995; Knight et al., Molecular Immunol. 30(16):1443-1453, 1993; Lorenz et al., J. Immunol. 156(4):1646-1653, 1996; Hinshaw et al., Circulatory Shock 30(3):279-292, 1990; Ordas et al., Clin. Pharmacol. Therapeutics 91(4):635-646, 2012; Feldman, Nature Reviews Immunol. 2(5):364-371, 2002; Taylor et al., Nature Reviews Rheumatol. 5(10):578-582, 2009; Garces et al., Annals Rheumatic Dis. 72(12):1947-1955, 2013; Palladino et al., Nature Rev. Drug Discovery 2(9):736-746, 2003; Sandborn et al., Inflammatory Bowel Diseases 5(2):119-133, 1999; Atzeni et al., Autoimmunity Reviews 12(7):703-708, 2013; Maini et al., Immunol. Rev. 144(1):195-223, 1995; Wanner et al., Shock 11(6):391-395, 1999; and U.S. Pat. Nos. 6,090,382; 6,258,562; and 6,509,015).
(2033) In certain embodiments, the anti-TNFα agent can include or is golimumab (Golimumab™), adalimumab (Humira™), infliximab (Remicade™), CDP571, CDP 870, or certolizumab pegol (Cimzia™). In certain embodiments, the anti-TNFα agent can be a TNFα inhibitor biosimilar. Examples of approved and late-phase TNFα inhibitor biosimilars include, but are not limited to, infliximab biosimilars such as Flixabi™ (SB2) from Samsung Bioepis, Inflectra® (CT-P13) from Celltrion/Pfizer, GS071 from Aprogen, Remsima™, PF-06438179 from Pfizer/Sandoz, NI-071 from Nichi-Iko Pharmaceutical Co., and ABP 710 from Amgen; adalimumab biosimilars such as Amgevita® (ABP 501) from Amgen and Exemptia™ from Zydus Cadila, BMO-2 or MYL-1401-A from Biocon/Mylan, CHS-1420 from Coherus, FKB327 from Kyowa Kirin, and BI 695501 from Boehringer Ingelheim; Solymbic®, SB5 from Samsung Bioepis, GP-2017 from Sandoz, ONS-3010 from Oncobiologics, M923 from Momenta, PF-06410293 from Pfizer, and etanercept biosimilars such as Erelzi™ from Sandoz/Novartis, Brenzys™ (SB4) from Samsung Bioepis, GP2015 from Sandoz, TuNEX® from Mycenax, LBECO101 from LG Life, and CHS-0214 from Coherus.
(2034) In some embodiments of any of the methods described herein, the anti-TNFα agent is selected from the group consisting of: adalimumab, certolizumab, etanercept, golimumab, infliximabm, CDP571, and CDP 870.
(2035) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a dissociation constant (K.sub.D) of less than 1×10.sup.−5 M (e.g., less than 0.5×10.sup.−5 M, less than 1×10.sup.−6 M, less than 0.5×10.sup.−6 M, less than 1×10.sup.−7 M, less than 0.5×10.sup.−7 M, less than 1×10.sup.−8 M, less than 0.5×10.sup.−8 M, less than 1×10.sup.−9 M, less than 0.5×10.sup.−9 M, less than 1×10.sup.−10 M, less than 0.5×10.sup.−10 M, less than 1×10.sup.−11 M, less than 0.5×10.sup.−11 M, or less than 1×10.sup.−12 M), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
(2036) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.D of about 1×10.sup.−12 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, about 1×10.sup.−9 M, about 0.5×10.sup.−9 M, about 1×10.sup.−10 M, about 0.5×10.sup.−10 M, about 1×10.sup.−11 M, or about 0.5×10.sup.−11 M (inclusive); about 0.5×10.sup.−11 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, about 1×10.sup.−9 M, about 0.5×10.sup.−9 M, about 1×10.sup.−10 M, about 0.5×10.sup.−10 M, or about 1×10.sup.−11 M (inclusive); about 1×10.sup.−11 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, about 1×10.sup.−9 M, about 0.5×10.sup.−9 M, about 1×10.sup.−10 M, or about 0.5×10.sup.−10 M (inclusive); about 0.5×10.sup.−10 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, about 1×10.sup.−9 M, about 0.5×10.sup.−9 M, or about 1×10.sup.−10 M (inclusive); about 1×10.sup.−10 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, about 1×10.sup.−9 M, or about 0.5×10.sup.−9 M (inclusive); about 0.5×10.sup.−9 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, about 0.5×10.sup.−8 M, or about 1×10.sup.−9 M (inclusive); about 1×10.sup.−9 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, about 1×10.sup.−8 M, or about 0.5×10.sup.−8 M (inclusive); about 0.5×10.sup.−8 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, about 0.5×10.sup.−7 M, or about 1×10.sup.−8 M (inclusive); about 1×10.sup.−8 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7 M, or about 0.5×10.sup.−7 M (inclusive); about 0.5×10.sup.−7 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, or about 1×10.sup.−7 M (inclusive); about 1×10.sup.−7 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, about 1×10.sup.−6 M, or about 0.5×10.sup.−6 M (inclusive); about 0.5×10.sup.−6 M to about 1×10.sup.−5 M, about 0.5×10.sup.−5 M, or about 1×10.sup.−6 M (inclusive); about 1×10.sup.−6 M to about 1×10.sup.−5 M or about 0.5×10.sup.−5 M (inclusive); or about 0.5×10.sup.−5 M to about 1×10.sup.−5 M (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
(2037) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.off of about 1×10.sup.−6 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10.sup.−4 s.sup.−1, about 0.5×10.sup.−4 s.sup.−1, about 1×10.sup.−5 s.sup.−1, or about 0.5×10.sup.−5 s.sup.−1 (inclusive); about 0.5×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.1, about 1×10.sup.−4 s.sup.−1, about 0.5×10.sup.−4 s.sup.−1, or about 1×10.sup.−5 s.sup.−1 (inclusive); about 1×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10.sup.−4 s.sup.−1, or about 0.5×10.sup.−4 s.sup.−1 (inclusive); about 0.5×10.sup.−4 s.sup.−1 to about 1×10.sup.−1 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, or about 1×10.sup.−1 s.sup.1 (inclusive); about 1×10.sup.−1 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, or about 0.5×10.sup.−3 s.sup.−1 (inclusive); or about 0.5×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
(2038) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.on of about 1×10.sup.2 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5 M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, about 0.5×10.sup.4 M.sup.−1 s.sup.−1, about 1×10.sup.3 M.sup.−1 s.sup.−1, or about 0.5×10.sup.3 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.3 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5 M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, about 0.5×10.sup.4 M.sup.−1 s.sup.−1, or about 1×10.sup.3 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.3 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5 M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, or about 0.5×10.sup.4 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5 M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, or about 1×10.sup.4 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5 M.sup.−1 s.sup.−1, or about 0.5×10.sup.5 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.5 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, or about 1×10.sup.5 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.5 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, or about 0.5×10.sup.6 M.sup.−1 s.sup.−1 (inclusive); or about 0.5×10.sup.6 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
(2039) Fusion Proteins
(2040) In some embodiments, the anti-TNFα agent is a fusion protein (e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG) (see, e.g., Deeg et al., Leukemia 16(2):162, 2002; Peppel et al., J. Exp. Med. 174(6):1483-1489, 1991) or a soluble TNFR (e.g., TNFR1 or TNFR2) that binds specifically to TNFα. In some embodiments, the anti-TNFα agent includes or is a soluble TNFα receptor (e.g., Bjornberg et al., Lymphokine Cytokine Res. 13(3):203-211, 1994; Kozak et al., Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1):R23-R29, 1995; Tsao et al., Eur Respir J. 14(3):490-495, 1999; Watt et al., J Leukoc Biol. 66(6):1005-1013, 1999; Mohler et al., J. Immunol. 151(3):1548-1561, 1993; Nophar et al., EMBO J. 9(10):3269, 1990; Piguet et al., Eur. Respiratory J. 7(3):515-518, 1994; and Gray et al., Proc. Natl. Acad. Sci. U.S.A. 87(19):7380-7384, 1990). In some embodiments, the anti-TNFα agent includes or is etanercept (Enbrel™) (see, e.g., WO 91/03553 and WO 09/406,476, incorporated by reference herein). In some embodiments, the anti-TNFα agent inhibitor includes or is r-TBP-I (e.g., Gradstein et al., J. Acquir. Immune Defic. Syndr. 26(2): 111-117, 2001).
(2041) Inhibitory Nucleic Acids
(2042) Inhibitory nucleic acids that can decrease the expression of AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA expression in a mammalian cell include antisense nucleic acid molecules, i.e., nucleic acid molecules whose nucleotide sequence is complementary to all or part of a AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (e.g., complementary to all or a part of any one of SEQ ID NOs: 1-37).
(2043) TABLE-US-00005 Human TNFα CDS (SEQ ID NO: 1) ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAA GAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTT CCTGATCGTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGG CCCCCAGAGGGAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGC AGTCAGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAA CCCTCAAGCTGAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGG CCAATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTAC CTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCTCCACCCATGTGCTC CTCACCCACACCATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCCTC TCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGGGGCTGAGGCCAAGCC CTGGTATGAGCCCATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACT CAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTA CTTTGGGATCATTGCCCTGTGA Human TNFR1 CDS (SEQ ID NO: 2) ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCACTGGTGCTCCTGGAGCTGTTG GTGGGAATATACCCCTCAGGGGTTATTGGACTGGTCCCTCACCTAGGGGACAGGGA GAAGAGAGATAGTGTGTGTCCCCAAGGAAAATATATCCACCCTCAAAATAATTCGA TTTGCTGTACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGG GGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAAC CACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGA GATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGT ACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCA ATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCAT GCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGC CTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGA CTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCC TCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCAT TGTTTGTGGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAACTACTACTA AGCCCCTGGCCCCAAACCCAAGCTTCAGTCCCACTCCAGGCTTCACCCCCACCCTGG GCTTCAGTCCCGTGCCCAGTTCCACCTTCACCTCCAGCTCCACCTATACCCCCGGTGA CTGTCCCAACTTTGCGGCTCCCCGCAGAGAGGTGGCACCACCCTATCAGGGGGCTGA CCCCATCCTTGCGACAGCCCTCGCCTCCGACCCCATCCCCAACCCCCTTCAGAAGTG GGAGGACAGCGCCCACAAGCCACAGAGCCTAGACACTGATGACCCCGCGACGCTGT ACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAGGAATTCGTGCGGCGCCTA GGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAACGGGCGCTGCCTGCG CGAGGCGCAATACAGCATGCTGGCGACCTGGAGGCGGCGCACGCCGCGGCGCGAG GCCACGCTGGAGCTGCTGGGACGCGTGCTCCGCGACATGGACCTGCTGGGCTGCCT GGAGGACATCGAGGAGGCGCTTTGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTC TTCTCAGATGA Human TNFR2 CDS (SEQ ID NO: 3) ATTCTTCCCCTGGTGGCCATGGGACCCAGGTCAATGTCACCTGCATCGTGAACGTCT GTAGCAGCTCTGACCACAGCTCACAGTGCTCCTCCCAAGCCAGCTCCACAATGGGA GACACAGATTCCAGCCCCTCGGAGTCCCCGAAGGACGAGCAGGTCCCCTTCTCCAA GGAGGAATGTGCCTTTCGGTCACAGCTGGAGACGCCAGAGACCCTGCTGGGGAGCA CCGAAGAGAAGCCCCTGCCCCTTGGAGTGCCTGATGCTGGGATGAAGCCCAGTTAA Human TRADD CDS (SEQ ID NO: 4) ATGGCAGCTGGGCAAAATGGGCACGAAGAGTGGGTGGGCAGCGCATACCTGTTTGT GGAGTCCTCGCTGGACAAGGTGGTCCTGTCGGATGCCTACGCGCACCCCCAGCAGA AGGTGGCAGTGTACAGGGCTCTGCAGGCTGCCTTGGCAGAGAGCGGCGGGAGCCCG GACGTGCTGCAGATGCTGAAGATCCACCGCAGCGACCCGCAGCTGATCGTGCAGCT GCGATTCTGCGGGCGGCAGCCCTGTGGCCGCTTCCTCCGCGCCTACCGCGAGGGGGC GCTGCGCGCCGCGCTGCAGAGGAGCCTGGCGGCCGCGCTCGCCCAGCACTCGGTGC CGCTGCAACTGGAGCTGCGCGCCGGCGCCGAGCGGCTGGACGCTTTGCTGGCGGAC GAGGAGCGCTGTTTGAGTTGCATCCTAGCCCAGCAGCCCGACCGGCTCCGGGATGA AGAACTGGCTGAGCTGGAGGATGCGCTGCGAAATCTGAAGTGCGGCTCGGGGGCCC GGGGTGGCGACGGGGAGGTCGCTTCGGCCCCCTTGCAGCCCCCGGTGCCCTCTCTGT CGGAGGTGAAGCCGCCGCCGCCGCCGCCACCTGCCCAGACTTTTCTGTTCCAGGGTC AGCCTGTAGTGAATCGGCCGCTGAGCCTGAAGGACCAACAGACGTTCGCGCGCTCT GTGGGTCTCAAATGGCGCAAGGTGGGGCGCTCACTGCAGCGAGGCTGCCGGGCGCT GCGGGACCCGGCGCTGGACTCGCTGGCCTACGAGTACGAGCGCGAGGGACTGTACG AGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGCCGCCGCGCCACG CTGCAGCGCCTGGTGGAGGCACTCGAGGAGAACGAGCTCACCAGCCTGGCAGAGGA CTTGCTGGGCCTGACCGATCCCAATGGCGGCCTGGCCTAG Human TRAF2 CDS (SEQ ID NO: 5) ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTC TCCAAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAG AAACGTCCTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTG CCTGGCCAGCATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGG CATATATGAAGAAGGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGC TGCCCGCAGGGAGGTGGAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCT GGAAGGGGACCCTGAAAGAATACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATG CTGACCGAATGTCCCGCGTGCAAAGGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCA CCTGGAGCACGAGTGCCCGGAGAGAAGCCTGAGCTGCCGGCATTGCCGGGCACCCT GCTGCGGAGCAGACGTGAAGGCGCACCACGAGGTCTGCCCCAAGTTCCCCTTAACT TGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAGAAGTTTCAGGACCACGTCAA GACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCCATCGGCTGCCTCGAGAC GGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTGCGGGAGCACCTG GCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGACCAGAGCCA CGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCCACTT TTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAG CAAGGTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACT TGGAGCAGAAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGG AAGATCTCAGACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGC CATCTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTAT CTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGT GATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCT TAATGCTGCTCGACCAGAATAACCGGGAGCACGTGATTGACGCCTTCAGGCCCGAC GTGACTTCATCCTCTTTTCAGAGGCCAGTCAACGACATGAACATCGCAAGCGGCTGC CCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGAT GCCATCTTCATCAAGGCCATTGTGGACCTGACAGGGCTCTAA Human AP-1 CDS (SEQ ID NO: 6) ATGGAAACACCCTTCTACGGCGATGAGGCGCTGAGCGGCCTGGGCGGCGGCGCCAG TGGCAGCGGCGGCAGCTTCGCGTCCCCGGGCCGCTTGTTCCCCGGGGCGCCCCCGAC GGCCGCGGCCGGCAGCATGATGAAGAAGGACGCGCTGACGCTGAGCCTGAGTGAGC AGGTGGCGGCAGCGCTCAAGCCTGCGGCCGCGCCGCCTCCTACCCCCCTGCGCGCC GACGGCGCCCCCAGCGCGGCACCCCCCGACGGCCTGCTCGCCTCTCCCGACCTGGG GCTGCTGAAGCTGGCCTCCCCCGAGCTCGAGCGCCTCATCATCCAGTCCAACGGGCT GGTCACCACCACGCCGACGAGCTCACAGTTCCTCTACCCCAAGGTGGCGGCCAGCG AGGAGCAGGAGTTCGCCGAGGGCTTCGTCAAGGCCCTGGAGGATTTACACAAGCAG AACCAGCTCGGCGCGGGCGCGGCCGCTGCCGCCGCCGCCGCCGCCGCCGGGGGGCC CTCGGGCACGGCCACGGGCTCCGCGCCCCCCGGCGAGCTGGCCCCGGCGGCGGCCG CGCCCGAAGCGCCTGTCTACGCGAACCTGAGCAGCTACGCGGGCGGCGCCGGGGGC GCGGGGGGCGCCGCGACGGTCGCCTTCGCTGCCGAACCTGTGCCCTTCCCGCCGCCG CCACCCCCAGGCGCGTTGGGGCCGCCGCGCCTGGCTGCGCTCAAGGACGAGCCACA GACGGTGCCCGACGTGCCGAGCTTCGGCGAGAGCCCGCCGTTGTCGC CCATCGACATGGACACGCAGGAGCGCATCAAGGCGGAGCGCAAGCGGCTGCGCAA CCGCATCGCCGCCTCCAAGTGCCGCAAGCGCAAGCTGGAGCGCATCTCGCGCCTGG AAGAGAAAGTGAAGACCCTCAAGAGTCAGAACACGGAGCTGGCGTCCACGGCGAG CCTGCTGCGCGAGCAGGTGGCGCAGCTCAAGCAGAAAGTCCTCAGCCACGTCAACA GCGGCTGCCAGCTGCTGCCCCAGCACCAGGTGCCCGCGTACTGA Human ASK1 CDS (SEQ ID NO: 7) ATGAGCACGGAGGCGGACGAGGGCATCACTTTCTCTGTGCCACCCTTCGCCCCCTCG GGCTTCTGCACCATCCCCGAGGGCGGCATCTGCAGGAGGGGAGGAGCGGCGGCGGT GGGCGAGGGCGAGGAGCACCAGCTGCCACCGCCGCCGCCGGGCAGTTTCTGGAACG TGGAGAGCGCCGCTGCCCCTGGCATCGGTTGTCCGGCGGCCACCTCCTCGAGCAGTG CCACCCGAGGCCGGGGCAGCTCTGTTGGCGGGGGCAGCCGACGGACCACGGTGGCA TATGTGATCAACGAAGCGAGCCAAGGGCAACTGGTGGTGGCCGAGAGCGAGGCCCT GCAGAGCTTGCGGGAGGCGTGCGAGACAGTGGGCGCCACCCTGGAACCCTGCATTT TGGGAAACTCGACTTTGGAGAAACCACCGTGCTGGACCGCTTTTACAATGCAGATAT TGCGGTGGTGGAGATGAGCGATGCCTTCCGGCAGCCGTCCTTGTTTTACCACCTTGG GGTGAGAGAAAGTTTCAGCATGGCCAACAACATCATCCTCTACTGCGATACTAACTC GGACTCTCTGCAGTCACTGAAGGAAATCATTTGCCAGAAGAATACTATGTGCACTGG GAACTACACCTTTGTTCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGA CAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTCT TGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAAGGTGGCACAA GCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATCAGGAAAGCTCGT AATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGT AGATAATATCGAAGTCTTGACAGCAGATATTGTCATAAATCTGTTACTTTCCTACAG AGATATCCAGGACTATGATTCTATTGTGAAGCTGGTAGAGACTTTAGAAAAACTGCC AACCTTTGATTTGGCCTCCCATCACCATGTGAAGTTTCATTATGCATTTGCACTGAAT AGGAGAAATCTCCCTGGTGACAGAGCAAAAGCTCTTGATATTATGATTCCCATGGTG CAAAGCGAAGGACAAGTTGCTTCAGATATGTATTGCCTAGTTGGTCGAATCTACAAA GATATGTTTTTGGACTCTAATTTCACGGACACTGAAAGCAGAGACCATGGAGCTTCT TGGTTCAAAAAGGCATTTGAATCTGAGCCAACACTACAGTCAGGAATTAATTATGCG GTCCTCCTCCTGGCAGCTGGACACCAGTTTGAATCTTCCTTTGAGCTCCGGAAAGTT GGGGTGAAGCTAAGTAGTCTTCTTGGTAAAAAGGGAAACTTGGAAAAACTCCAGAG CTACTGGGAAGTTGGATTTTTTCTGGGGGCCAGCGTCCTAGCCAATGACCACATGAG AGTCATTCAAGCATCTGAAAAGCTTTTTAAACTGAAGACACCAGCATGGTACCTCAA GTCTATTGTAGAGACAATTTTGATATATAAGCATTTTGTGAAACTGACCACAGAACA GCCTGTGGCCAAGCAAGAACTTGTGGACTTTTGGATGGATTTCCTGGTCGAGGCCAC AAAGACAGATGTTACTGTGGTTAGGTTTCCAGTATTAATATTAGAACCAACCAAAAT CTATCAACCTTCTTATTTGTCTATCAACAATGAAGTTGAGGAAAAGACAATCTCTAT TTGGCACGTGCTTCCTGATGACAAGAAAGGTATACATGAGTGGAATTTTAGTGCCTC TTCTGTCAGGGGAGTGAGTATTTCTAAATTTGAAGAAAGATGCTGCTTTCTTTATGTG CTTCACAATTCTGATGATTTCCAAATCTATTTCTGTACAGAACTTCATTGTAAAAAGT TTTTTGAGATGGTGAACACCATTACCGAAGAGAAGGGGAGAAGCACAGAGGAAGG AGACTGTGAAAGTGACTTGCTGGAGTATGACTATGAATATGATGAAAATGGTGACA GAGTCGTTTTAGGAAAAGGCACTTATGGGATAGTCTACGCAGGTCGGGACTTGAGC AACCAAGTCAGAATTGCTATTAAGGAAATCCCAGAGAGAGACAGCAGATACTCTCA GCCCCTGCATGAAGAAATAGCATTGCATAAACACCTGAAGCACAAAAATATTGTCC AGTATCTGGGCTCTTTCAGTGAGAATGGTTTCATTAAAATCTTCATGGAGCAGGTCC CTGGAGGAAGTCTTTCTGCTCTCCTTCGTTCCAAATGGGGTCCATTAAAAGACAATG AGCAAACAATTGGCTTTTATACAAAGCAAATACTGGAAGGATTAAAATATCTCCATG ACAATCAGATAGTTCACCGGGACATAAAGGGTGACAATGTGTTGATTAATACCTAC AGTGGTGTTCTCAAGATCTCTGACTTCGGAACATCAAAGAGGCTTGCTGGCATAAAC CCCTGTACTGAAACTTTTACTGGTACCCTCCAGTATATGGCACCAGAAATAATAGAT AAAGGACCAAGAGGCTACGGAAAAGCAGCAGACATCTGGTCTCTGGGCTGTACAAT CATTGAAATGGCCACAGGAAAACCCCCATTTTATGAACTGGGAGAACCACAAGCAG CTATGTTCAAGGTGGGAATGTTTAAAGTCCACCCTGAGATCCCAGAGTCCATGTCTG CAGAGGCCAAGGCATTCATACTGAAATGTTTTGAACCAGATCCTGACAAGAGAGCC TGTGCTAACGACTTGCTTGTTGATGAGTTTTTAAAAGTTTCAAGCAAAAAGAAAAAG ACACAACCTAAGCTTTCAGCTCTTTCAGCTGGATCAAATGAATATCTCAGGAGTATA TCCTTGCCGGTACCTGTGCTGGTGGAGGACACCAGCAGCAGCAGTGAGTACGGCTC AGTTTCACCCGACACGGAGTTGAAAGTGGACCCCTTCTCTTTCAAAACAAGAGCCAA GTCCTGCGGAGAAAGAGATGTCAAGGGAATTCGGACACTCTTTTTGGGCATTCCAGA TGAGAATTTTGAAGATCACAGTGCTCCTCCTTCCCCTGAAGAAAAAGATTCTGGATT CTTCATGCTGAGGAAGGACAGTGAGAGGCGAGCTACCCTTCACAGGATCCTGACGG AAGACCAAGACAAAATTGTGAGAAACCTAATGGAATCTTTAGCTCAGGGGGCTGAA GAACCGAAACTAAAATGGGAACACATCACAACCCTCATTGCAAGCCTCAGAGAATT TGTGAGATCCACTGACCGAAAAATCATAGCCACCACACTGTCAAAGCTGAAACTGG AGCTGGACTTCGACAGCCATGGCATTAGCCAAGTCCAGGTGGTACTCTTTGGTTTTC AAGATGCTGTCAATAAAGTTCTTCGGAATCATAACATCAAGCCGCACTGGATGTTTG CCTTAGACAGTATCATTCGGAAGGCGGTACAGACAGCCATTACCATCCTGGTTCCAG AACTAAGGCCACATTTCAGCCTTGCATCTGAGAGTGATACTGCTGATCAAGAAGACT TGGATGTAGAAGATGACCATGAGGAACAGCCTTCAAATCAAACTGTCCGAAGACCT CAGGCTGTCATTGAAGATGCTGTGGCTACCTCAGGCGTGAGCACGCTCAGTTCTACT GTGTCTCATGATTCCCAGAGTGCTCACCGGTCACTGAATGTACAGCTTGGAAGGATG AAAATAGAAACCAATAGATTACTGGAAGAATTGGTTCGGAAAGAGAAAGAATTACA AGCACTCCTTCATCGAGCTATTGAAGAAAAAGACCAAGAAATTAAACACCTGAAGC TTAAGTCCCAACCCATAGAAATTCCTGAATTGCCTGTATTTCATCTAAATTCTTCTGG CACAAATACTGAAGATTCTGAACTTACCGACTGGCTGAGAGTGAATGGAGCTGATG AAGACACTATAAGCCGGTTTTTGGCTGAAGATTATACACTATTGGATGTTCTCTACT ATGTTACACGTGATGACTTAAAATGCTTGAGACTAAGGGGAGGGATGCTGTGCACA CTGTGGAAGGCTATCATTGACTTTCGAAACAAACAGACTTGA Human CD14 CDS (SEQ ID NO: 8) ATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCG ACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTC TCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTG GAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGA CGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCA CAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAG CGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATG CCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAAC GTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCC AGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACA GGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGG CGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCT AGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGG CGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACC GTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTG TCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCT CGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGG TGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCC ACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGG TGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAA Human ERK1 CDS (SEQ ID NO: 9) ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGG GGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGAC GTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGT CAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCC CCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGC GCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGG AAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAG TTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATC CTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCC TCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCC CGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACG CGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCAT CGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTC CCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGGGCTCCCCA TCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTACCTACAGTCT CTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGACTCCAAA GCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACAGTG GAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCC AGTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGC GGCTGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAG GCCCCCTAG Human ERK2 CDS (SEQ ID NO: 10) ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGCAGGTGTT CGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTACGGCA TGGTGTGCTCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCAAGAAAATCA GCCCCTTTGAGCACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAAAAATCTTA CTGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACC ATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTA CAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCA GATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAA GCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCT GGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGC CACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTC CATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCAT CTTTCCAGGGAAGCATTATCTTGACCAGCTGAACCACATTTTGGGTATTCTTGGATCC CCATCACAAGAAGACCTGAATTGTATAATAAATTTAAAAGCTAGGAACTATTTGCTT TCTCTTCCACACAAAAATAAGGTGCCATGGAACAGGCTGTTCCCAAATGCTGACTCC AAAGCTCTGGACTTATTGGACAAAATGTTGACATTCAACCCACACAAGAGGATTGA AGTAGAACAGGCTCTGGCCCACCCATATCTGGAGCAGTATTACGACCCGAGTGACG AGCCCATCGCCGAAGCACCATTCAAGTTCGACATGGAATTGGATGACTTGCCTAAGG AAAAGCTCAAAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGATACAGA TCTTAA Human IKK CDS (SEQ ID NO: 11) ATGTTTTCAGGGGGGTGTCATAGCCCCGGGTTTGGCCGCCCCAGCCCCGCCTTCCCC GCCCCGGGGAGCCCGCCCCCTGCCCCGCGTCCCTGCCGACAGGAAACAGGTGAGCA GATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGCCCCCGGAACCGAGAGCGGTGGT GCCTGGAGATCCAGATCATGAGAAGGCTGACCCACCCCAATGTGGTGGCTGCCCGA GATGTCCCTGAGGGGATGCAGAACTTGGCGCCCAATGACCTGCCCCTGCTGGCCATG GAGTACTGCCAAGGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGAACTGCTG TGGTCTGCGGGAAGGTGCCATCCTCACCTTGCTGAGTGACATTGCCTCTGCGCTTAG ATACCTTCATGAAAACAGAATCATCCATCGGGATCTAAAGCCAGAAAACATCGTCCT GCAGCAAGGAGAACAGAGGTTAATACACAAAATTATTGACCTAGGATATGCCAAGG AGCTGGATCAGGGCAGTCTTTGCACATCATTCGTGGGGACCCTGCAGTACCTGGCCC CAGAGCTACTGGAGCAGCAGAAGTACACAGTGACCGTCGACTACTGGAGCTTCGGC ACCCTGGCCTTTGAGTGCATCACGGGCTTCCGGCCCTTCCTCCCCAACTGGCAGCCC GTGCAGTGGCATTCAAAAGTGCGGCAGAAGAGTGAGGTGGACATTGTTGTTAGCGA AGACTTGAATGGAACGGTGAAGTTTTCAAGCTCTTTACCCTACCCCAATAATCTTAA CAGTGTCCTGGCTGAGCGACTGGAGAAGTGGCTGCAACTGATGCTGATGTGGCACC CCCGACAGAGGGGCACGGATCCCACGTATGGGCCCAATGGCTGCTTCAAGGCCCTG GATGACATCTTAAACTTAAAGCTGGTTCATATCTTGAACATGGTCACGGGCACCATC CACACCTACCCTGTGACAGAGGATGAGAGTCTGCAGAGCTTGAAGGCCAGAATCCA ACAGGACACGGGCATCCCAGAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTG GCGTTGATCCCCGATAAGCCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGAG GGCCACACATTGGACATGGATCTTGTTTTTCTCTTTGACAACAGTAAAATCACCTAT GAGACTCAGATCTCCCCACGGCCCCAACCTGAAAGTGTCAGCTGTATCCTTCAAGAG CCCAAGAGGAATCTCGCCTTCTTCCAGCTGAGGAAGGTGTGGGGCCAGGTCTGGCA CAGCATCCAGACCCTGAAGGAAGATTGCAACCGGCTGCAGCAGGGACAGCGAGCCG CCATGATGAATCTCCTCCGAAACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGG CTTCCATGTCTCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGA TTGACCTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATAAACTG CTGCTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGGGCGGGAGAACGA AGTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAGACCGACATTGTGGACTTAC AGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTGGACGACCTAGAGGAGCA AGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGACCAGCGAACTGAG GGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGCTTCGAGAA GAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAGAAGG CGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGATGAG AAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTGGAATCTCCTGAA GATTGCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAGCCCGGATAGCATGAATGC CTCTCGACTTAGCCAGCCTGGGCAGCTGATGTCTCAGCCCTCCACGGCCTCCAACAG CTTACCTGAGCCAGCCAAGAAGAGTGAAGAACTGGTGGCTGAAGCACATAACCTCT GCACCCTGCTAGAAAATGCCATACAGGACACTGTGAGGGAACAAGACCAGAGTTTC ACGGCCCTAGACTGGAGCTGGTTACAGACGGAAGAAGAAGAGCACAGCTGCCTGGA GCAGGCCTCATGA Human IκB CDS (SEQ ID NO: 12) ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGG GCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGA AAGACGAGGAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCC GCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGG GACTCGTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTG ATCCGCCAGGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCA GACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCT GGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCCCTACACCT TGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGACTCAGTCCTGCACCAC CCCGCACCTCCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCTACA CTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCT GATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGAC CTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGA GTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAAGCACCCGG ATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTGCCAGAGAG TGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAGGACG AGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGA Human IRAK CDS (SEQ ID NO: 13) ATGGCCGGGGGGCCGGGCCCGGGGGAGCCCGCAGCCCCCGGCGCCCAGCACTTCTT GTACGAGGTGCCGCCCTGGGTCATGTGCCGCTTCTACAAAGTGATGGACGCCCTGGA GCCCGCCGACTGGTGCCAGTTCGCCGCCCTGATCGTGCGCGACCAGACCGAGCTGC GGCTGTGCGAGCGCTCCGGGCAGCGCACGGCCAGCGTCCTGTGGCCCTGGATCAAC CGCAACGCCCGTGTGGCCGACCTCGTGCACATCCTCACGCACCTGCAGCTGCTCCGT GCGCGGGACATCATCACAGCCTGGCACCCTCCCGCCCCGCTTCCGTCCCCAGGCACC ACTGCCCCGAGGCCCAGCAGCATCCCTGCACCCGCCGAGGCCGAGGCCTGGAGCCC CCGGAAGTTGCCATCCTCAGCCTCCACCTTCCTCTCCCCAGCTTTTCCAGGCTCCCAG ACCCATTCAGGGCCTGAGCTCGGCCTGGTCCCAAGCCCTGCTTCCCTGTGGCCTCCA CCGCCATCTCCAGCCCCTTCTTCTACCAAGCCAGGCCCAGAGAGCTCAGTGTCCCTC CTGCAGGGAGCCCGCCCCTTTCCGTTTTGCTGGCCCCTCTGTGAGATTTCCCGGGGC ACCCACAACTTCTCGGAGGAGCTCAAGATCGGGGAGGGTGGCTTTGGGTGCGTGTA CCGGGCGGTGATGAGGAACACGGTGTATGCTGTGAAGAGGCTGAAGGAGAACGCTG ACCTGGAGTGGACTGCAGTGAAGCAGAGCTTCCTGACCGAGGTGG AGCAGCTGTCCAGGTTTCGTCACCCAAACATTGTGGACTTTGCTGGCTACTGTGCTC AGAACGGCTTCTACTGCCTGGTGTACGGCTTCCTGCCCAACGGCTCCCTGGAGGACC GTCTCCACTGCCAGACCCAGGCCTGCCCACCTCTCTCCTGGCCTCAGCGACTGGACA TCCTTCTGGGTACAGCCCGGGCAATTCAGTTTCTACATCAGGACAGCCCCAGCCTCA TCCATGGAGACATCAAGAGTTCCAACGTCCTTCTGGATGAGAGGCTGACACCCAAG CTGGGAGACTTTGGCCTGGCCCGGTTCAGCCGCTTTGCCGGGTCCAGCCCCAGCCAG AGCAGCATGGTGGCCCGGACACAGACAGTGCGGGGCACCCTGGCCTACCTGCCCGA GGAGTACATCAAGACGGGAAGGCTGGCTGTGGACACGGACACCTTCAGCTTTGGGG TGGTAGTGCTAGAGACCTTGGCTGGTCAGAGGGCTGTGAAGACGCACGGTGCCAGG ACCAAGTATCTGAAAGACCTGGTGGAAGAGGAGGCTGAGGAGGCTGGAGTGGCTTT GAGAAGCACCCAGAGCACACTGCAAGCAGGTCTGGCTGCAGATGCCTGGGCTGCTC CCATCGCCATGCAGATCTACAAGAAGCACCTGGACCCCAGGCCCGGGCCCTGCCCA CCTGAGCTGGGCCTGGGCCTGGGCCAGCTGGCCTGCTGCTGCCTGCACCGCCGGGCC AAAAGGAGGCCTCCTATGACCCAGGTGTACGAGAGGCTAGAGAAGCTGCAGGCAGT GGTGGCGGGGGTGCCCGGGCATTCGGAGGCCGCCAGCTGCATCCCCCCTTCCCCGC AGGAGAACTCCTACGTGTCCAGCACTGGCAGAGCCCACAGTGGGGCTGCTCCATGG CAGCCCCTGGCAGCGCCATCAGGAGCCAGTGCCCAGGCAGCAGAGCAGCTGCAGAG AGGCCCCAACCAGCCCGTGGAGAGTGACGAGAGCCTAGGCGGCCTCTCTGCTGCCC TGCGCTCCTGGCACTTGACTCCAAGC TGCCCTCTGGACCCAGCACCCCTCAGGGAGGCCGGCTGTCCTCAGGGGGACACGGC AGGAGAATCGAGCTGGGGGAGTGGCCCAGGATCCCGGCCCACAGCCGTGGAAGGA CTGGCCCTTGGCAGCTCTGCATCATCGTCGTCAGAGCCACCGCAGATTATCATCAAC CCTGCCCGACAGAAGATGGTCCAGAAGCTGGCCCTGTACGAGGATGGGGCCCTGGA CAGCCTGCAGCTGCTGTCGTCCAGCTCCCTCCCAGGCTTGGGCCTGGAACAGGACAG GCAGGGGCCCGAAGAAAGTGATGAATTTCAGAGCTGA Human JNK CDS (SEQ ID NO: 14) ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTAC ATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAG GAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGC TAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTT CTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCAC AGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAA ATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCT ATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACT TAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCG GTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCT ACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTTGACATT TGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGT ACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCT GAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAA ATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCA GAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGT AATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAA TGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCA GTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAA GTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCC TTTAGGTGCAGCAGTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAA TGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCT AGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGA Human LBP CDS (SEQ ID NO: 15) ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGCTTACGTCC ACCCCAGAGGCTCTGGGTGCCAACCCCGGCTTGGTCGCCAGGATCACCGACAAGGG ACTGCAGTATGCGGCCCAGGAGGGGCTATTAGCTCTGCAGAGTGAGCTGCTCAGGA TCACGCTGCCTGACTTCACCGGGGACTTGAGGATCCCCCACGTCGGCCGTGGGCGCT ATGAGTTCCACAGCCTGAACATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGAGGC CTGTCCCTGGCCAGGGCCTGAGTCTCAGCA TCTCCGACTCCTCCATCCGGGTCCAGGGCAGGTGGAAGGTGCGCAAGTCATTCTTCA AACTACAGGGCTCCTTTGATGTCAGTGTCAAGGGCATCAGCATTTCGGTCAACCTCC TGTTGGGCAGCGAGTCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTG ACATCGCTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCTCT TCCACAACCAGATTGAGTCCAAGTTCCAGAAAGTACTGGAGAGCAGGATTTGCGAA ATGATCCAGAAATCGGTGTCCTCCGATCTACAGCCTTATCTCCAAACTCTGCCAGTT ACAACAGAGATTGACAGTTTCGCCGACATTGATTATAGCTTAGTGGAAGCCCCTCGG GCAACAGCCCAGATGCTGGAGGTGATGTTTAAGGGTGAAATCTTTCATCGTAACCAC CGTTCTCCAGTTACCCTCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAA ATGGTCTACTTTGCCATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCATG AGGAAGGATATCTGAACTTCTCCATCACAGATGACATGATACCGCCTGACTCTAATA TCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACGGTTAGCCAGGCTCTACC CCAACATGAACCTGGAACTCCAGGGATCAGTGCCCTCTGCTCCGCTCCTGAACTTCA GCCCTGGGAATCTGTCTGTGGACCCCTATATGGAGATAGATGCCTTTGTGCTCCTGC CCAGCTCCAGCAAGGAGCCTGTCTTCCGGCTCAGTGTGGCCA CTAATGTGTCCGCCACCTTGACCTTCAATACCAGCAAGATCACTGGGTTCCTGAAGC CAGGAAAGGTAAAAGTGGAACTGAAAGAATCCAAAGTTGGACTATTCAATGCAGAG CTGTTGGAAGCGCTCCTCAACTATTACATCCTTAACACCCTCTACCCCAAGTTCAAT GATAAGTTGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGCTCTACGAC CTTGGGCTGCAGATCCATAAGGACTTCCTGTTCTTGGGTGCCAATGTCCAATACATG AGAGTTTGA Human MEK1 CDS (SEQ ID NO: 16) ATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGACGGCTCTGC AGTTAACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTTGCAGAAGAAGCTGG AGGAGCTAGAGCTTGATGAGCAGCAGCGAAAGCGCCTTGAGGCCTTTCTTACCCAG AAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGG GGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCA TGGCCAGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATA AGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGT GCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCT CTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGT TAGCATTGCTGTAATAAAAGGCCTGACATATCTGAGGGAGAAGCACAAGATCATGC ACAGAGATGTCAAGCCCTCCAACATCCTAGTCAACTCCCGTGGGGAGATCAAGCTCT GTGACTTTGGGGTCAGCGGGCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGGC ACAAGGTCCTACATGTCGCCAGAAAGACTCCAGGGGACTCATTACTCTGTGCAGTCA GACATCTGGAGCATGGGACTGTCTCTGGTAGAGATGGCGGTTGGGAGGTATCCCATC CCTCCTCCAGATGCCAAGGAGCTGGAGCTGATGTTTGGGTGCCAGGTGGAAGGAGA TGCGGCTGAGACCCCACCCAGGCCAAGGACCCCCGGGAGGCCCCTTAGCTCATACG GAATGGACAGCCGACCTCCCATGGCAATTTTTGAGTTGTTGGATTACATAGTCAACG AGCCTCCTCCAAAACTGCCCAGTGGAGTGTTCAGTCTGGAATTTCAAGATTTTGTGA ATAAATGCTTAATAAAAAACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATGGTT CATGCTTTTATCAAGAGATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTGC TCCACCATCGGCCTTAACCAGCCCAGCACACCAACCCATGCTGCTGGCGTCTAA Human MEK2 CDS (SEQ ID NO: 17) ATGCTGGCCCGGAGGAAGCCGGTGCTGCCGGCGCTCACCATCAACCCTACCATCGC CGAGGGCCCATCCCCTACCAGCGAGGGCGCCTCCGAGGCAAACCTGGTGGACCTGC AGAAGAAGCTGGAGGAGCTGGAACTTGACGAGCAGCAGAAGAAGCGGCTGGAAGC CTTTCTCACCCAGAAAGCCAAGGTCGGCGAACTCAAAGACGATGACTTCGAAAGGA TCTCAGAGCTGGGCGCGGGCAACGGCGGGGTGGTCACCAAAGTCCAGCACAGACCC TCGGGCCTCATCATGGCCAGGAAGCTGATCCACCTTGAGATCAAGCCGGCCATCCG GAACCAGATCATCCGCGAGCTGCAGGTCCTGCACGAATGCAACTCGCCGTACATCG TGGGCTTCTACGGGGCCTTCTACAGTGACGGGGAGATCAGCATTTGCATGGAACACA TGGACGGCGGCTCCCTGGACCAGGTGCTGAAAGAGGCCAAGAGGATTCCCGAGGAG ATCCTGGGGAAAGTCAGCATCGCGGTTCTCCGGGGCTTGGCGTACCTCCGAGAGAA GCACCAGATCATGCACCGAGATGTGAAGCCCTCCAACATCCTCGTGAACTCTAGAG GGGAGATCAAGCTGTGTGACTTCGGGGTGAGCGGCCAGCTCATCGACTCCATGGCC AACTCCTTCGTGGGCACGCGCTCCTACATGGCTCCGGAGCGGTTGCAGGGCACA CATTACTCGGTGCAGTCGGACATCTGGAGCATGGGCCTGTCCCTGGTGGAGCTGGCC GTCGGAAGGTACCCCATCCCCCCGCCCGACGCCAAAGAGCTGGAGGCCATCTTTGG CCGGCCCGTGGTCGACGGGGAAGAAGGAGAGCCTCACAGCATCTCGCCTCGGCCGA GGCCCCCCGGGCGCCCCGTCAGCGGTCACGGGATGGATAGCCGGCCTGCCATGGCC ATCTTTGAACTCCTGGACTATATTGTGAACGAGCCACCTCCTAAGCTGCCCAACGGT GTGTTCACCCCCGACTTCCAGGAGTTTGTCAATAAATGCCTCATCAAGAACCCAGCG GAGCGGGCGGACCTGAAGATGCTCACAAACCACACCTTCATCAAGCGGTCCGAGGT GGAAGAAGTGGATTTTGCCGGCTGGTTGTGTAAAACCCTGCGGCTGAACCAGCCCG GCACACCCACGCGCACCGCCGTGTGA Human MEK3 CDS (SEQ ID NO: 18) ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACTCCCGGAC CTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAGGCTGATGACTTGGTGACCAT CTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCACGCCCAGA GCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAACTCACAGGAGCAG AAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACT GTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTC ATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACAAT TCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCT GCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAA CAAGGAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTC TGTGGCCAAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCA ACCCAGAGCTGAACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGC ATCACCATGATTGAGATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCG TTCCAGCAGCTGAAGCAGGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCG TTTCTCCCCCGAGTTTGTGGACTTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGA GCGTATGAGCTACCTGGAGCTGATGGAGCACCCCTTCTTCACCTTGCACAAAACCAA GAAGACGGACATTGCTGCCTTCGTGAAGGAGATCCTGGGAGAAGACTCATAG Human MEK6 CDS (SEQ ID NO: 19) ATGTCTCAGTCGAAAGGCAAGAAGCGAAACCCTGGCCTTAAAATTCCAAAAGAAGC ATTTGAACAACCTCAGACCAGTTCCACACCACCTCGAGATTTAGACTCCAAGGCTTG CATTTCTATTGGAAATCAGAACTTTGAGGTGAAGGCAGATGACCTGGAGCCTATAAT GGAACTGGGACGAGGTGCGTACGGGGTGGTGGAGAAGATGCGGCACGTGCCCAGC GGGCAGATCATGGCAGTGAAGCGGATCCGAGCCACAGTAAATAGCCAGGAACAGA AACGGCTACTGATGGATTTGGATATTTCCATGAGGACGGTGGACTGTCCATTCACTG TCACCTTTTATGGCGCACTGTTTCGGGAGGGTGATGTGTGGATCTGCATGGAGCTCA TGGATACATCACTAGATAAATTCTACAAACAAGTTATTGATAAAGGCCAGACAATTC CAGAGGACATCTTAGGGAAAATAGCAGTTTCTATTGTAAAAGCATTAGAACATTTAC ATAGTAAGCTGTCTGTCATTCACAGAGACGTCAAGCCTTCTAATGTACTCATCAATG CTCTCGGTCAAGTGAAGATGTGCGATTTTGGAATCAGTGGCTACTTGGTGGACTCTG TTGCTAAAACAATTGATGCAGGTTGCAAACCATACATGGCCCCTGAAAGAATAAAC CCAGAGCTCAACCAGAAGGGATACAGTGTGAAGTCTGACATTTGGAGTCTGGGCAT CACGATGATTGAGTTGGCCATCCTTCGATTTCCCTATGATTCATGGGGAACTCCATTT CAGCAGCTCAAACAGGTGGTAGAGGAGCCATCGCCACAACTCCCAGCAGACAAGTT CTCTGCAGAGTTTGTTGACTTTACCTCACAGTGCTTAAAGAAGAATTCCAAAGAACG GCCTACATACCCAGAGCTAATGCAACATCCATTTTTCACCCTACATGAATCCAAAGG AACAGATGTGGCATCTTTTGTAAAACTGATTCTTGGAGACTAA Human MEKK1 CDS (SEQ ID NO: 20) ATGGCGGCGGCGGCGGGGAATCGCGCCTCGTCGTCGGGATTCCCGGGCGCCAGGGC TACGAGCCCTGAGGCAGGCGGCGGCGGAGGAGCCCTCAAGGCGAGCAGCGCGCCC GCGGCTGCCGCGGGACTGCTGCGGGAGGCGGGCAGCGGGGGCCGCGAGCGGGCGG ACTGGCGGCGGCGGCAGCTGCGCAAAGTGCGGAGTGTGGAGCTGGACCAGCTGCCT GAGCAGCCGCTCTTCCTTGCCGCCTCACCGCCGGCCTCCTCGACTTCCCCGTCGCCG GAGCCCGCGGACGCAGCGGGGAGTGGGACCGGCTTCCAGCCTGTGGCGGTGCCGCC GCCCCACGGAGCCGCGAGCCGCGGCGGCGCCCACCTTACCGAGTCGGTGGCGGCGC CGGACAGCGGCGCCTCGAGTCCCGCAGCGGCCGAGCCCGGGGAGAAGCGGGCGCC CGCCGCCGAGCCGTCTCCTGCAGCGGCCCCCGCCGGTCGTGAGATGGAGAATAAAG AAACTCTCAAAGGGTTGCACAAGATGGATGATCGTCCAGAGGAACGAATGATCAGG GAGAAACTGAAGGCAACCTGTATGCCAGCCTGGAAGCACGAATGGTTGGAAAGGAG AAATAGGCGAGGGCCTGTGGTGGTAAAACCAATCCCAGTTAAAGGAGATGGATCTG AAATGAATCACTTAGCAGCTGAGTCTCCAGGAGAGGTCCAGGCAAGTGCGGCTTCA CCAGCTTCCAAAGGCCGACGCAGTCCTTCTCCTGGCAACTCCCCATCAGGTCGCACA GTGAAATCAGAATCTCCAGGAGTAAGGAGAAAAAGAGTTTCCCCAGTGCCTTTTCA GAGTGGCAGAATCACACCACCCCGAAGAGCCCCTTCACCAGATGGCTTCTCACCAT ATAGCCCTGAGGAAACAAACCGCCGTGTTAACAAAGTGATGCGGGCCAGACTGTAC TTACTGCAGCAGATAGGGCCTAACTCTTTCCTGATTGGAGGAGACAGCCCAGACAAT AAATACCGGGTGTTTATTGGGCCTCAGAACTGCAGCTGTGCACGTGGAACATTCTGT ATTCATCTGCTATTTGTGATGCTCCGGGTGTTTCAACTAGAACCTTCAGACCCAATGT TATGGAGAAAAACTTTAAAGAATTTTGAGGTTGAGAGTTTGTTCCAGAAATATCACA GTAGGCGTAGCTCAAGGATCAAAGCTCCATCTCGTAACACCATCCAGAAGTTTGTTT CACGCATGTCAAATTCTCATACATTGTCATCATCTAGTACTTCTACGTCTAGTTCAGA AAACAGCATAAAGGATGAAGAGGAACAGATGTGTCCTATTTGCTTGTTGGGCATGC TTGATGAAGAAAGTCTTACAGTGTGTGAAGACGGCTGCAGGAACAAGCTGCACCAC CACTGCATGTCAATTTGGGCAGAAGAGTGTAGAAGAAATAGAGAACCTTTAATATG TCCCCTTTGTAGATCTAAGTGGAGATCTCATGATTTCTACAGCCACGAGTTGTCAAG TCCTGTGGATTCCCCTTCTTCCCTCAGAGCTGCACAGCAGCAAACCGTACAGCAGCA GCCTTTGGCTGGATCACGAAGGAATCAAGAGAGCAATTTTAACCTTACTCATTATGG AACTCAGCAAATCCCTCCTGCTTACAAAGATTTAGCTGAGCCATGGATTCAGGTGTT TGGAATGGAACTCGTTGGCTGCTTATTTTCTAGAAACTGGAATGTGAGAGAGATGGC CCTCAGGCGTCTTTCCCATGATGTCAGTGGGGCCCTGCTGTTGGCAAATGGGGAGAG CACTGGAAATTCTGGGGGCAGCAGTGGAAGCAGCCCGAGTGGGGGAGCCACCAGTG GGTCTTCCCAGACCAGTATCTCAGGAGATGTGGTGGAGGCATGCTGCAGCGTTCTGT CAATGGTCTGTGCTGACCCTGTCTACAAAGTGTACGTTGCTGCTTTAAAAACATTGA GAGCCATGCTGGTATATACTCCTTGCCACAGTTTAGCGGAAAGAATCAAACTTCAGA GACTTCTCCAGCCAGTTGTAGACACCATCCTAGTCAAATGTGCAGATGCCAATAGCC GCACAAGTCAGCTGTCCATATCAACACTGTTGGAACTGTGCAAAGGCCAAGCAGGA GAGTTGGCAGTTGGCAGAGAAATACTAAAAGCTGGATCCATTGGTATTGGTGGTGTT GATTATGTCTTAAATTGTATTCTTGGAAACCAAACTGAATCAAACAATTGGCAAGAA CTTCTTGGCCGCCTTTGTCTTATAGATAGACTGTTGTTGGAATTTCCTGCTGAATTTT ATCCTCATATTGTCAGTACTGATGTTTCACAAGCTGAGCCTGTTGAAATCAGGTATA AGAAGCTGCTGTCCCTCTTAACCTTTGCTTTGCAGTCCATTGATAATTCCCACTCAAT GGTTGGCAAACTTTCCAGAAGGATCTACTTGAGTTCTGCAAGAATGGTTACTACAGT ACCCCATGTGTTTTCAAAACTGTTAGAAATGCTGAGTGTTTCCAGTTCCACTCACTTC ACCAGGATGCGTCGCCGTTTGATGGCTATTGCAGATGAGGTGGAAATTGCCGAAGC CATCCAGTTGGGCGTAGAAGACACTTTGGATGGTCAACAGGACAGCTTCTTGCAGGC ATCTGTTCCCAACAACTATCTGGAAACCACAGAGAACAGTTCCCCTGAGTGCACAGT CCATTTAGAGAAAACTGGAAAAGGATTATGTGCTACAAAATTGAGTGCCAGTTCAG AGGACATTTCTGAGAGACTGGCCAGCATTTCAGTAGGACCTTCTAGTTCAACAACAA CAACAACAACAACAACAGAGCAACCAAAGCCAATGGTTCAAACAAAAGGCAGACC CCACAGTCAGTGTTTGAACTCCTCTCCTTTATCTCATCATTCCCAATTAATGTTTCCA GCCTTGTCAACCCCTTCTTCTTCTACCCCATCTGTACCAGCTGGCACTGCAACAGATG TCTCTAAGCATAGACTTCAGGGATTCATTCCCTGCAGAATACCTTCTGCATCTCCTCA AACACAGCGCAAGTTTTCTCTACAATTCCACAGAAACTGTCCTGAAAACAAAGACTC AGATAAACTTTCCCCAGTCTTTACTCAGTCAAGACCCTTGCCCTCCAGTAACATACA CAGGCCAAAGCCATCTAGACCTACCCCAGGTAATACAAGTAAACAGGGAGATCCCT CAAAAAATAGCATGACACTTGATCTGAACAGTAGTTCCAAATGTGATGACAGCTTTG GCTGTAGCAGCAATAGTAGTAATGCTGTTATACCCAGTGACGAGACAGTGTTCACCC CAGTAGAGGAGAAATGCAGATTAGATGTCAATACAGAGCTCAACTCCAGTATTGAG GACCTTCTTGAAGCATCTATGCCTTCAAGTGATACAACAGTAACTTTTAAGTCAGAA GTTGCTGTCCTGTCTCCTGAAAAGGCTGAAAATGATGATACCTACAAAGATGATGTG AATCATAATCAAAAGTGCAAAGAGAAGATGGAAGCTGAAGAAGAAGAAGCTTTAG CAATTGCCATGGCAATGTCAGCGTCTCAGGATGCCCTCCCCATAGTTCCTCAGCTGC AGGTTGAAAATGGAGAAGATATCATCATTATTCAACAGGATACACCAGAGACTCTA CCAGGACATACCAAAGCAAAACAACCGTATAGAGAAGACACTGAATGGCTGAAAG GTCAACAGATAGGCCTTGGAGCATTTTCTTCTTGTTATCAGGCTCAAGATGTGGGAA CTGGAACTTTAATGGCTGTTAAACAGGTGACTTATGTCAGAAACACATCTTCTGAGC AAGAAGAAGTAGTAGAAGCACTAAGAGAAGAGATAAGAATGATGAGCCATCTGAA TCATCCAAACATCATTAGGATGTTGGGAGCCACGTGTGAGAAGAGCAATTACAATCT CTTCATTGAATGGATGGCAGGGGGATCGGTGGCTCATTTGCTGAGTAAATATGGAGC CTTCAAAGAATCAGTAGTTATTAACTACACTGAACAGTTACTCCGTGGCCTTTCGTA TCTCCATGAAAACCAAATCATTCACAGAGATGTCAAAGGTGCCAATTTGCTAATTGA CAGCACTGGTCAGAGACTAAGAATTGCAGATTTTGGAGCTGCAGCCAGGTTGGCAT CAAAAGGAACTGGTGCAGGAGAGTTTCAGGGACAATTACTGGGGACAATTGCATTT ATGGCACCTGAGGTACTAAGAGGTCAACAGTATGGAAGGAGCTGTGATGTATGGAG TGTTGGCTGTGCTATTATAGAAATGGCTTGTGCAAAACCACCATGGAATGCAGAAAA ACACTCCAATCATCTTGCTTTGATATTTAAGATTGCTAGTGCAACTACTGCTCCATCG ATCCCTTCACATTTGTCTCCTGGTTTACGAGATGTGGCTCTTCGTTGTTTAGAACTTC AACCTCAGGACAGACCTCCATCAAGAGAGCTACTGAAGCATCCAGTCTTTCGTACTA CATGGTAG Human MEKK 3 CDS (SEQ ID NO: 21) ATGGACGAACAGGAGGCATTGAACTCAATCATGAACGATCTGGTGGCCCTCCAGAT GAACCGACGTCACCGGATGCCTGGATATGAGACCATGAAGAACAAAGACACAGGTC ACTCAAATAGGCAGAAAAAACACAACAGCAGCAGCTCAGCCCTTCTGAACAGCCCC ACAGTAACAACAAGCTCATGTGCAGGGGCCAGTGAGAAAAAGAAATTTTTGAGTGA CGTCAGAATCAAGTTCGAGCACAACGGGGAGAGGCGAATTATAGCGTTCAGCCGGC CTGTGAAATATGAAGATGTGGAGCACAAGGTGACAACAGTATTTGGACAACCTCTT GATCTACATTACATGAACAATGAGCTCTCCATCCTGCTGAAAAACCAAGATGATCTT GATAAAGCAATTGACATTTTAGATAGAAGCTCAAGCATGAAAAGCCTTAGGATATT GCTGTTGTCCCAGGACAGAAACCATAACAGTTCCTCTCCCCACTCTGGGGTGTCCAG ACAGGTGCGGATCAAGGCTTCCCAGTCCGCAGGGGATATAAATACTATCTACCAGC CCCCCGAGCCCAGAAGCAGGCACCTCTCTGTCAGCTCCCAGAACCCTGGCCGAAGC TCACCTCCCCCTGGCTATGTTCCTGAGCGGCAGCAGCACATTGCCCGGCAGGGGTCC TACACCAGCATCAACAGTGAGGGGGAGTTCATCCCAGAGACCAGCGAGCAGTGCAT GCTGGATCCCCTGAGCAGTGCAGAAAATTCCTTGTCTGGAAGCTGCCAATCCTTGGA CAGGTCAGCAGACAGCCCATCCTTCCGGAAATCACGAATGTCCCGTGCCCAGAGCTT CCCTGACAACAGACAGGAATACTCAGATCGGGAAACTCAGCTTTATGACAAAGGGG TCAAAGGTGGAACCTACCCCCGGCGCTACCACGTGTCTGTGCACCACAAGGACTAC AGTGATGGCAGAAGAACATTTCCCCGAATACGGCGTCATCAAGGCAACTTGTTCACC CTGGTGCCCTCCAGCCGCTCCCTGAGCACAAATGGCGAGAACATGGGTCTGGCTGTG CAATACCTGGACCCCCGTGGGCGCCTGCGGAGTGCGGACAGCGAGAATGCCCTCTC TGTGCAGGAGAGGAATGTGCCAACCAAGTCTCCCAGTGCCCCCATCAACTGGCGCC GGGGAAAGCTCCTGGGCCAGGGTGCCTTCGGCAGGGTCTATTTGTGCTATGACGTGG ACACGGGACGTGAACTTGCTTCCAAGCAGGTCCAATTTGATCCAGACAGTCCTGAGA CAAGCAAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAG CATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCT GACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTT ACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGGC ATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACATTAAGGGAGCCAACATC CTCCGAGACTCTGCTGGGAATGTAAAGCTGGGGGACTTTGGGGCCAGCAAACGCCT GCAGACGATCTGTATGTCGGGGACGGGCATGCGCTCCGTCACTGGCACACCCTACTG GATGAGCCCTGAGGTGATCAGCGGCGAGGGCTATGGAAGGAAAGCAGACGTGTGG AGCCTGGGCTGCACTGTGGTGGAGATGCTGACAGAGAAACCACCGTGGGCAGAGTA TGAAGCTATGGCCGCCATCTTCAAGATTGCCACCCAGCCCACCAATCCTCAGCTGCC CTCCCACATCTCTGAACATGGCCGGGACTTCCTGAGGCGCATTTTTGTGGAGGCTCG CCAGAGACCTTCAGCTGAGGAGCTGCTCA CACACCACTTTGCACAGCTCATGTACTGA Human MEKK4 CDS (SEQ ID NO: 22) ATGAGAGAAGCCGCTGCCGCGCTGGTCCCTCCTCCCGCCTTTGCCGTCACGCCTGCC GCCGCCATGGAGGAGCCGCCGCCACCGCCGCCGCCGCCACCACCGCCACCGGAACC CGAGACCGAGTCAGAACCCGAGTGCTGCTTGGCGGCGAGGCAAGAGGGCACATTGG GAGATTCAGCTTGCAAGAGTCCTGAATCTGATCTAGAAGACTTCTCCGATGAAACAA ATACAGAGAATCTTTATGGTACCTCTCCCCCCAGCACACCTCGACAGATGAAACGCA TGTCAACCAAACATCAGAGGAATAATGTGGGGAGGCCAGCCAGTCGGTCTAATTTG AAAGAAAAAATGAATGCACCAAATCAGCCTCCACATAAAGACACTGGAAAAACAGT GGAGAATGTGGAAGAATACAGCTATAAGCAGGAGAAAAAGATCCGAGCAGCTCTTA GAACAACAGAGCGTGATCATAAAAAAAATGTACAGTGCTCATTCATGTTAGACTCA GTGGGTGGATCTTTGCCAAAAAAATCAATTCCAGATGTGGATCTCAATAAGCCTTAC CTCAGCCTTGGCTGTAGCAATGCTAAGCTTCCAGTATCTGTGCCCATGCCTATAGCC AGACCTGCACGCCAGACTTCTAGGACTGACTGTCCAGCAGATCGTTTAAAGTTTTTT GAAACTTTACGACTTTTGCTAAAGCTTACCTCAGTCTCAAAGAAAAAAGACAGGGA GCAAAGAGGACAAGAAAATACGTCTGGTTTCTGGCTTAACCGATCTAACGAACTGA TCTGGTTAGAGCTACAAGCCTGGCATGCAGGACGGACAATTAACGACCAGGACTTC TTTTTATATACAGCCCGTCAAGCCATCCCAGATATTATTAATGAAATCCTTACTTTCA AAGTCGACTATGGGAGCTTCGCCTTTGTTAGAGATAGAGCTGGTTTTAATGGTACTT CAGTAGAAGGGCAGTGCAAAGCCACTCCTGGAACAAAGATTGTAGGTTACTCAACA CATCATGAGCATCTCCAACGCCAGAGGGTCTCATTTGAGCAGGTAAAACGGATAAT GGAGCTGCTAGAGTACATAGAAGCACTTTATCCATCATTGCAGGCTCTTCAGAAGGA CTATGAAAAATATGCTGCAAAAGACTTCCAGGACAGGGTGCAGGCACTCTGTTTGTG GTTAAACATCACAAAAGACTTAAATCAGAAATTAAGGATTATGGGCACTGTTTTGGG CATCAAGAATTTATCAGACATTGGCTGGCCAGTGTTTGAAATCCCTTCCCCTCGACC ATCCAAAGGTAATGAGCCGGAGTATGAGGGTGATGACACAGAAGGAGAATTAAAG GAGTTGGAAAGTAGTACGGATGAGAGTGAAGAAGAACAAATCTCTGATCCTAGGGT ACCGGAAATCAGACAGCCCATAGATAACAGCTTCGACATCCAGTCGCGGGACTGCA TATCCAAGAAGCTTGAGAGGCTCGAATCTGAGGATGATTCTCTTGGCTGGGGAGCAC CAGACTGGAGCACAGAAGCAGGCTTTAGTAGACATTGTCTGACTTCTATTTATAGAC CATTTGTAGACAAAGCACTGAAGCAGATGGGGTTAAGAAAGTTAATTTTAAGACTTC ACAAGCTAATGGATGGTTCCTTGCAAAGGGCACGTATAGCATTGGTAAAGAACGAT CGTCCAGTGGAGTTTTCTGAATTTCCAGATCCCATGTGGGGTTCAGATTATGTGCAG TTGTCAAGGACACCACCTTCATCTGAGGAGAAATGCAGTGCTGTGTCGTGGGAGGA GCTGAAGGCCATGGATTTACCTTCATTCGAACCTGCCTTCCTAGTTCTCTGCCGAGTC CTTCTGAATGTCATACATGAGTGTCTGAAGTTAAGATTGGAGCAGAGACCTGCTGGA GAACCATCTCTCTTGAGTATTAAGCAGCTGGTGAGAGAGTGTAAGGAGGTCCTGAA GGGCGG CCTGCTGATGAAGCAGTACTACCAGTTCATGCTGCAGGAGGTTCTGGAGGACTTGGA GAAGCCCGACTGCAACATTGACGCTTTTGAAGAGGATCTACATAAAATGCTTATGGT GTATTTTGATTACATGAGAAGCTGGATCCAAATGCTACAGCAATTACCTCAAGCATC GCATAGTTTAAAAAATCTGTTAGAAGAAGAATGGAATTTCACCAAAGAAATAACTC ATTACATACGGGGAGGAGAAGCACAGGCCGGGAAGCTTTTCTGTGACATTGCAGGA ATGCTGCTGAAATCTACAGGAAGTTTTTTAGAATTTGGCTTACAGGAGAGCTGTGCT GAATTTTGGACTAGTGCGGATGACAGCAGTGCTTCCGACGAAATCAGGAGGTCTGTT ATAGAGATCAGTCGAGCCCTGAAGGAGCTCTTCCATGAAGCCAGAGAAAGGGCTTC CAAAGCACTTGGATTTGCTAAAATGTTGAGAAAGGACCTGGAAATAGCAGCAGAAT TCAGGCTTTCAGCCCCAGTTAGAGACCTCCTGGATGTTCTGAAATCAAAACAGTATG TCAAGGTGCAAATTCCTGGGTTAGAAAACTTGCAAATGTTTGTTCCAGACACTCTTG CTGAGGAGAAGAGTATTATTTTGCAGTTACTCAATGCAGCTGCAGGAAAGGACTGTT CAAAAGATTCAGATGACGTACTCATCGATGCCTATCTGCTTCTGACCAAGCACGGTG ATCGAGCCCGTGATTCAGAGGACAGCTGGGGCACCTGGGAGGCACAGCCTGTCAAA GTCGTGCCTCAGGTGGAGACTGTTGACACCCTGAGAAGCATGCAGGTGGATAATCTT TTACTAGTTGTCATGCAGTCTGCGCATCTCACAATTCAGAGAAAAGCTTTCCAGCAG TCCATTGAGGGACTTATGACTCTGTGCCAGGAGCAGACATCCAGTCAGCCGGTCATC GCCAAAGCTTTGCAGCAGCTGAAGAATGATGCATTGGAGCTATGCAACAGGATAAG CAATGCCATTGACCGCGTGGACCACATGTTCACATCAGAATTTGATGCTGAGGTTGA TGAATCTGAATCTGTCACCTTGCAACAGTACTACCGAGAAGCAATGATTCAGGGGTA CAATTTTGGATTTGAGTATCATAAAGAAGTTGTTCGTTTGATGTCTGGGGAGTTTAG ACAGAAGAT AGGAGACAAATATATAAGCTTTGCCCGGAAGTGGATGAATTATGTCCTGACTAAAT GTGAGAGTGGTAGAGGTACAAGACCCAGGTGGGCGACTCAAGGATTTGATTTTCTA CAAGCAATTGAACCTGCCTTTATTTCAGCTTTACCAGAAGATGACTTCTTGAGTTTAC AAGCCTTGATGAATGAATGCATTGGCCATGTCATAGGAAAACCACACAGTCCTGTTA CAGGTTTGTACCTTGCCATTCATCGGAACAGCCCCCGTCCTATGAAGGTACCTCGAT GCCATAGTGACCCTCCTAACCCACACCTCATTATCCCCACTCCAGAGGGATTCAGCA CTCGGAGCATGCCTTCCGACGCGCGGAGCCATGGCAGCCCTGCTGCTGCTGCTGCTG CTGCTGCTGCTGCTGTTGCTGCCAGTCGGCCCAGCCCCTCTGGTGGTGACTCTGTGCT GCCCAAATCCATCAGCAGTGCCCATGATACCAGGGGTTCCAGCGTTCCTGAAAATG ATCGATTGGCTTCCATAGCTGCTGAATTGCAGTTTAGGTCCCTGAGTCGTCACTCAA GCCCCACGGAGGAGCGAGATGAACCAGCATATCCAAGAGGAGATTCAAGTGGGTCC ACAAGAAGAAGTTGGGAACTTCGGACACTAATCAGCCAGAGTAAAGATACTGCTTC TAAACTAGGACCCATAGAAGCTATCCAGAAGTCAGTCCGATTGTTTGAAGAAAAGA GGTACCGAGAAATGAGGAGAAAGAATATCATTGGTCAAGTTTGTGATACGCCTAAG TCCTATGATAATGTTATGCACGTTGGCTTGAGGAAGGTGACCTTCAAATGGCAAAGA GGAAACAAAATTGGAGAAGGCCAGTATGGGAAGGTGTACACCTGCATCAGCGTCGA CACCGGGGAGCTGATGGCCATGAAAGAGATTCGATTTCAACCTAATGACCATAAGA CTATCAAGGAAACTGCAGACGAATTGAAAATATTCGAAGGCATCAAACACCCCAAT CTGGTTCGGTATTTTGGTGTGGAGCTCCATAGAGAAGAAATGTACATCTTCATGGAG TACTGCGATGAGGGGACTTTAGAAGAGGTGTCAAGGCTGGGACTTCAGGAACATGT GATTAGGCTGTATTCAAAGCAGATCACCATTGCGATCAACGTCCTCCATGAGCATGG CATAGTCCACCGTGACATTAAAGGTGCCAATATCTTCCTTACCTCATCTGGATTAATC AAACTGGGAGATTTTGGATGTTCAGTAAAGCTCAAAAACAATGCCCAGACCATGCC TGGTGAAGTGAACAGCACCCTGGGGACAGCAGCATACATGGCACCTGAAGTCATCA CTCGTGCCAAAGGAGAGGGCCATGGGCGTGCGGCCGACATCTGGAGTCTGGGGTGT GTTGTCATAGAGATGGTGACTGGCAAGAGGCCTTGGCATGAGTATGAGCACAACTTT CAAATTATGTATAAAGTGGGGATGGGACATAAGCCACCAATCCCTGAAAGATTAAG CCCTGAAGGAAAGGACTTCCTTTCTCACTGCCTTGAGAGTGACCCAAAGATGAGATG GACCGCCAGCCAGCTCCTCGACCATTCGTTTGTCAA GGTTTGCACAGATGAAGAATG Human MEKK 6 CDS (SEQ ID NO: 23) ATGGCGGGGCCGTGTCCCCGGTCCGGGGCGGAGCGCGCCGGCAGCTGCTGGCAGGA CCCGCTGGCCGTGGCGCTGAGCCGGGGCCGGCAGCTCGCGGCGCCCCCGGGCCGGG GCTGCGCGCGGAGCCGGCCGCTCAGCGTGGTCTACGTGCTGACCCGGGAGCCGCAG CCCGGGCTCGAGCCTCGGGAGGGAACCGAGGCGGAGCCGCTGCCCCTGCGCTGCCT GCGCGAGGCTTGCGCGCAGGTCCCCCGGCCGCGGCCGCCCCCGCAGCTGCGCAGCC TGCCCTTCGGGACGCTGGAGCTAGGCGACACCGCGGCTCTGGATGCCTTCTACAACG CGGATGTGGTGGTGCTGGAGGTGAGCAGCTCGCTGGTACAGCCCTCCCTGTTCTACC ACCTTGGTGTGCGTGAGAGCTTCAGCATGACCAACAATGTGCTCCTCTGCTCCCAGG CCGACCTCCCTGACCTGCAGGCCCTGCGGGAGGATGTTTTCCAGAAGAACTCGGATT GCGTTGGCAGCTACACACTGATCCCCTATGTGGTGACGGCCACTGGTCGGGTGCTGT GTGGTGATGCAGGCCTTCTGCGGGGCCTGGCTGATGGGCTGGTACAGGCTGGAGTG GGGACCGAGGCCCTGCTCACTCCCCTGGTGGGCCGGCTTGCCCGCCTGCTGGAGGCC ACACCCACAGACTCTTGTGGCTATTTCCGGGAGACCATTCGGCGGGACATCCGGCAG GCGCGGGAGCGGTTCAGTGGGCCACAGCTGCGGCAGGAGCTGGCTC GCCTGCAGCGGAGACTGGACAGCGTGGAGCTGCTGAGCCCCGACATCATCATGAAC TTGCTGCTCTCCTACCGCGATGTGCAGGACTACTCGGCCATCATTGAGCTGGTGGAG ACGCTGCAGGCCTTGCCCACCTGTGATGTGGCCGAGCAGCATAATGTCTGCTTCCAC TACACTTTTGCCCTCAACCGGAGGAACAGGCCTGGGGACCGGGCGAAGGCCCTGTC TGTGCTGCTGCCGCTGGTACAGCTTGAGGGCTCTGTGGCGCCCGATCTGTACTGCAT GTGTGGCCGTATCTACAAGGACATGTTCTTCAGCTCGGGTTTCCAGGATGCTGGGCA CCGGGAGCAGGCCTATCACTGGTATCGCAAGGCTTTTGACGTAGAGCCCAGCCTTCA CTCAGGCATCAATGCAGCTGTGCTCCTCATTGCTGCCGGGCAGCACTTTGAGGATTC CAAAGAGCTCCGGCTAATAGGCATGAAGCTGGGCTGCCTGCTGGCCCGCAAAGGCT GCGTGGAGAAGATGCAGTATTACTGGGATGTGGGTTTCTACCTGGGAGCCCAGATCC TCGCCAATGACCCCACCCAGGTGGTGCTGGCTGCAGAGCAGCTGTATAAGCTCAAT GCCCCCATATGGTACCTGGTGTCCGTGATGGAGACCTTCCTGCTCTACCAGCACTTC AGGCCCACGCCAGAGCCCCCTGGAGGGCCACCACGCCGTGCCCACTTCTGGCTCCA CTTCTTGCTACAGTCCTGCCAACCATTCAAGACAGCCTGTGCCCAGGGCGACCAGTG CTTGGTGCTGGTCCTGGAGATGAACAAGGTGCTGCTGCCTGCAAAGCTCGAGGTTCG GGGTACTGACCCAGTAAGCACAGTGACCCTGAGCCTGCTGGAGCCTGAGACCCAGG ACATTCCCTCCAGCTGGACCTTCCCAGTCGCCTCCATATGCGGAGTCAGCGCCTCAA AGCGCGACGAGCGCTGCTGCTTCCTCTATGCACTCCCCCCGGCTCAGGACGTCCAGC TGTGCTTCCCCAGCGTAGGGCACTGCCAGTGGTTCTGCGGCCTGATCCAGGCCTGGG TGACGAACCCGGATTCCACGGCGCCCGCGGAGGAGGCGGAGGGCGCGGGGGAGAT GTTGGAGTTTGATTATGA GTACACGGAGACGGGCGAGCGGCTGGTGCTGGGCAAGGGCACGTATGGGGTGGTGT ACGCGGGCCGCGATCGCCACACGAGGGTGCGCATCGCCATCAAGGAGATCCCGGAG CGGGACAGCAGGTTCTCTCAGCCCCTGCATGAAGAGATCGCTCTTCACAGACGCCTG CGCCACAAGAACATAGTGCGCTATCTGGGCTCAGCTAGCCAGGGCGGCTACCTTAA GATCTTCATGGAGGAAGTGCCTGGAGGCAGCCTGTCCTCCTTGCTGCGGTCGGTGTG GGGACCCCTGAAGGACAACGAGAGCACCATCAGTTTCTACACCCGCCAGATCCTGC AGGGACTTGGCTACTTGCACGACAACCACATCGTGCACAGGGACATAAAAGGGGAC AATGTGCTGATCAACACCTTCAGTGGGCTGCTCAAGATTTCTGACTTCGGCACCTCC AAGCGGCTGGCAGGCATCACACCTTGCACTGAGACCTTCACAGGAACTCTGCAGTA TATGGCCCCAGAAATCATTGACCAGGGCCCACGCGGGTATGGGAAAGCAGCTGACA TCTGGTCACTGGGCTGCACTGTCATTGAGATGGCCACAGGTCGCCCCCCCTTCCACG AGCTCGGGAGCCCACAGGCTGCCATGTTTCAGGTGGGTATGTACAAGGTCCATCCGC CAATGCCCAGCTCTCTGTCGGCCGAGGCCCAAGCCTTTCTCCTCCGAACTTTTGAGC CAGACCCCCGCCTCCGAGCCAGCGCCCAGACACTGCTGGGGGACCCCTTCCTGCAG CCTGGGAAAAGGAGCCGCAGCCCCAGCTCCCCACGACATGCTCCACGGCCCTCAGA TGCCCCTTCTGCCAGTCCCACTCCTTCAGCCAACTCAACCACCCAGTCTCAGACATTC CCGTGCCCTCAGGCACCCTCTCAGCACCCACCCAGCCCCCCGAAGCGCTGCCTCAGT TATGGGGGCACCAGCCAGCTCCGGGTGCCCGAGGAGCCTGCGGCCGAGGAGCCTGC GTCTCCGGAGGAGAGTTCGGGGCTGAGCCTGCTGCACCAGGAGAGCAAGCGTCGGG CCATGCTGGCCGCAGTATTGGAGCAGGAGCTGCCAGCGCTGGCGGAGAATCTGCAC CAGGAGCAGAAGCAAGAGCAGGGGGCCCGTCTGGGCAGAAACCATGTGGAAGAGC TGCTGCGCTGCCTCGGGGCACACATCCACACTCCCAACCGCCGGCAGCTCGCCCAGG AGCTGCGGGCGCTGCAAGGACGGCTGAGGGCCCAGGGCCTTGGGCCTGCGCTTCTG CACAGACCGCTGTTTGCCTTCCCGGATGCGGTGAAGCAGATCCTCCGCAAGCGCCAG ATCCGTCCACACTGGATGTTCGTTCTGGACTCACTGCTCAGCCGTGCTGTGCGGGCA GCCCTGGGTGTGCTAGGACCGGAGGTGGAGAAGGAGGCGGTCTCACCGAGGTCAGA GGAGCTGAGTAATGAAGGGGACTCCCAGCAGAGCCCAGGCCAGCAGAGCCCGCTTC CGGTGGAGCCCGAGCAGGGCCCCGCTCCTCTGATGGTGCAGCTGAGCCTCTTGAGG GCAGAGACTGATCGGCTGCGCGAAATCCTGG CGGGGAAGGAACGGGAGTACCAGGCCCTGGTGCAGCGGGCTCTACAGCGGCTGAAT GAGGAAGCCCGGACCTATGTCCTGGCCCCAGAGCCTCCAACTGCTCTTTCAACGGAC CAGGGCCTGGTGCAGTGGCTACAGGAACTGAATGTGGATTCAGGCACCATCCAAAT GCTGTTGAACCATAGCTTCACCCTCCACACTCTGCTCACCTATGCCACTCGAGATGA CCTCATCTACACCCGCATCAGGGGAGGGATGGTATGCCGCATCTGGAGGGCCATCTT GGCACAGCGAGCAGGATCCACACCAGTCACCTCTGGACCCTGA Human MEKK7 CDS (SEQ ID NO: 24) ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCG AAGCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTG GAAGAGGTTGTTGGAAGAGGAGCCTTTGGAGTTGTTTGCAAAGCTAAGTGGAGAGC AAAAGATGTTGCTATTAAACAAATAGAAAGTGAATCTGAGAGGAAAGCGTTTATTG TAGAGCTTCGGCAGTTATCCCGTGTGAACCATCCTA ATATTGTAAAGCTTTATGGAGCCTGCTTGAATCCAGTGTGTCTTGTGATGGAATATG CTGAAGGGGGCTCTTTATATAATGTGCTGCATGGTGCTGAACCATTGCCATATTATA CTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTC ACAGCATGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTG CTGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATT CAGACACACATGACCAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTTTT TGAAGGTAGTAATTACAGTGAAAAATGTGACGTCTTCAGCTGGGGTATTATTCTTTG GGAAGTGATAACGCGTCGGAAAC CCTTTGATGAGATTGGTGGCCCAGCTTTCCGAATCATGTGGGCTGTTCATAATGGTA CTCGACCACCACTGATAAAAAATTTACCTAAGCCCATTGAGAGCCTGATGACTCGTT GTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATTGTGAAAATAATGA CTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTATCCTTGTCAGT ATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGGCTCATTCATGGACATT GCTTCTACAAATACGAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCCAC AAATGATACTATTAAGCGCTTAGAATCAAAATTGTTGAAAAATCAGGCAAAGCAAC AGAGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGAGCAGTGTGGAGAGC TTGCCCCCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGC TAGGATCGCCGCAACCACAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACT TGACTGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCAGT GTCAGAATGATTACTACCTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCC ATGGACCCCTGATGATTCCACAGATACCAATGGATCAGATAACTCCATCCCAATGGC TTATCTTACACTGGATCACCAACTACAGCCTCTAGCACCGTGCCCAAACTCCAAAGA ATCTATGGCAGTGTTTGAACAGCATTGTAAAATGGCACAAGAATATATGAAAGTTCA AACAGAAATTGCATTGTTATTACAGAGAAAGCAAGAACTAGTTGCAGAACTGGACC AGGATGAAAAGGACCAGCAAAATACATCTCGCCTGGTACAGGAACATAAAAAGCTT TTAGATGAAAACAAAAGCCTTTCTACTTACTACCAGCAATGCAAAAAACAACTAGA GGTCATCAGAAGTCAGCAGCAGAAACGACAAGGCACTTCATGA Human MK2 CDS (SEQ ID NO: 25) ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCG CCGCCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCG CCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAGAA CGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACG GCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATG CTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCA GTGCCCGCACATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGA AGTGCCTGCTGATTGTCATGGAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATCC AGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCATCCGAAATCATGAAGAG CATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCCATCGGGATGTCAA GCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAACGCCATCCTGAAACTCACTGA CTTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATAC ACCGTACTATGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTATGACAAGTCCTGTG ACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTATCCCCCCTTCTA CTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGAATGGGCCA GTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATGCTCA TTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATG AACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAG CCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGGGTGTCTTCATG ACAAGAACAGCGACCAGGCCACTTGGCTGACCAGGTTGTGA Human MyD88 CDS (SEQ ID NO: 26) ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCC CGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTC AACATGCGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCG GCCGACTGGACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCA ACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCC CTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACG TGCTGCTGGAGCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAG CAGCAGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGT CCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGGCATA TGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGACATCCAGTTTGTGCA GGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGTGTCTG ACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAA AGAGGTTGGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATGGTGGTGGTTGTCTCT GATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTC TCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAA AGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCAC CAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA Human NF-κB CDS (SEQ ID NO: 27) ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAACAAATGTTTCATTTGGATCCT TCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAACCACAGATGGCACTGCCA ACAGATGGCCCATACCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTC CGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGTGCCTCTAGTGAAAAG AACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGACCAGCAAAGGT TATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCACAGCCTGGT GGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGACATGG TGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAAA CACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCCTGGACTCTTG GTGCACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGG AGATCGGGAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATG GACCTCAGCGTGGTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGC TTCACAAGGCGCCTGGAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCC CAATGCATCCAACTTGAAAATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTG GAGGGGAGGAAATTTATCTTCTTTGTGACAAAGTTCAGAAAGATGACATCCAGATTC GATTTTATGAAGAGGAAGAAAATGGTGGAGTCTGGGAAGGATTTGGAGATTTTTCC CCCACAGATGTTCATAGACAATTTGCCATTGTCTTCAAAACTCCAAAGTATAAAGAT ATTAATATTACAAAACCAGCCTCTGTGTTTGTCCAGCTTCGGAGGAAATCTGACTTG GAAACTAGTGAACCAAAACCTTTCCTCTACTATCCTGAAATCAAAGATAAAGAAGA AGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCGGATAGTTTCGGCGGTGG TAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGCGGTGGAGGAGGGG GCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATG GTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAA CCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAA AACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCC CAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAA AAGAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTT GCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGAT GCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGT CTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTC ACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACCAGACG CCCTTGCACTTGGCAGTGATCACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAG GGCTGGGGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTGTTTTGCACCTAGC TGCCAAAGAAGGACATGATAAAGTTCTCAGTATCTTACTCAAGCACAAAAAGGCAG CACTACTTCTTGACCACCCCAACGGGGACGGTCTGAATGCCATTCATCTAGCCATGA TGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTGGCCGCTGGGGCTGACGTCAATG CTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTGGCTGTGGAGCACGACAAC ATCTCATTGGCAGGCTGCCTGCTCCTGGAGGGTGATGCCCATGTGGACAGTACTACC TACGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCCACCAGGCTGGC AGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAGCCTCTCTA TGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCTGGAA CCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAAC CATATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAG CTGGCTGAAGATGTGAAGCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGAC AAAAACTGGGCTACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTC CGGCTGAGTCCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGT ACAGTCAGAGAGCTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGA AGTGATCCAGGCAGCCTCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCC TCTCTCGCCTGCCTCCACAAGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTG TCTGCGACAGCGGCGTGGAGACATCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGA CCAGTGGTGCCTCACTGCTAACTCTCAACAAAATGCCCCATGATTATGGGCAGGAAG GACCTCTAGAAGGCAAAATTTAG Human NIK CDS (SEQ ID NO: 28) ATGGCAGTGATGGAAATGGCCTGCCCAGGTGCCCCTGGCTCAGCAGTGGGGCAGCA GAAGGAACTCCCCAAAGCCAAGGAGAAGACGCCGCCACTGGGGAAGAAACAGAGC TCCGTCTACAAGCTTGAGGCCGTGGAGAAGAGCCCTGTGTTCTGCGGAAAGTGGGA GATCCTGAATGACGTGATTACCAAGGGCACAGCCAAGGAAGGCTCCGAGGCAGGGC CAGCTGCCATCTCTATCATCGCCCAGGCTGAGTGTGAGAATAGCCAAGAGTTCAGCC CCACCTTTTCAGAACGCATTTTCATCGCTGGGTCCAAACAGTACAGCCAGTCCGAGA GTCTTGATCAGATCCCCAACAATGTGGCCCATGCTACAGAGGGCAAAATGGCCCGT GTGTGTTGGAAGGGAAAGCGTCGCAGCAAAGCCCGGAAGAAACGGAAGAAGAAGA GCTCAAAGTCCCTGGCTCATGCAGGAGTGGCCTTGGCCAAACCCCTCCCCAGGACCC CTGAGCAGGAGAGCTGCACCATCCCAGTGCAGGAGGATGAGTCTCCACTCGGCGCC CCATATGTTAGAAACACCCCGCAGTTCACCAAGCCTCTGAAGGAACCAGGCCTTGG GCAACTCTGTTTTAAGCAGCTTGGCGAGGGCCTACGGCCGGCTCTGCCTCGATCAGA ACTCCACAAACTGATCAGCCCCTTGCAATGTCTGAACCACGTGTGGAAACTGCACCA CCCCCAGGACGGAGGCCCCCTGCCCCTGCCCACGCACCCCTTCCCCTATAGCAGACT GCCTCATCCCTTCCCATTCCACCCTCTCCAGCCCTGGAAACCTCACCCTCTGGAGTCC TTCCTGGGCAAACTGGCCTGTGTAGACAGCCAGAAACCCTTGCCTGACCCACACCTG AGCAAACTGGCCTGTGTAGACAGTCCAAAGCCCCTGCCTGGCCCACACCTGGAGCC CAGCTGCCTGTCTCGTGGTGCCCATGAGAAGTTTTCTGTGGAGGAATACCTAGTGCA TGCTCTGCAAGGCAGCGTGAGCTCAGGCCAGGCCCACAGCCTGACCAGCCTGGCCA AGACCTGGGCAGCAAGGGGCTCCAGATCCCGGGAGCCCAGCCCCAAAACTGAGGAC AACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGA AGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGG TGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGG CTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAG AATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGA GCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAG AGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTG GAATACCTCCACTCACGAAGGATTCTGCATGGGGACGTCAAAGCTGACAACGTGCT CCTGTCCAGCGATGGGAGCCACGCAGCCCTCTGTGACTTTGGCCATGCTGTGTGTCT TCAACCTGATGGCCTGGGAAAGTCCTTGCTCACAGGGGACTACATCCCTGGCACAG AGACCCACATGGCTCCGGAGGTGGTGCTGGGCAGGAGCTGCGACGCCAAGGTGGAT GTCTGGAGCAGCTGCTGTATGATGCTGCACATGCTCAACGGCTGCCACCCCTGGACT CAGTTCTTCCGAGGGCCGCTCTGCCTCAAGATTGCCAGCGAGCCTCCGCCTGTGAGG GAGATCCCACCCTCCTGCGCCCCTCTCACAGCCCAGGCCATCCAAGAGGGGCTGAG GAAAGAGCCCATCCACCGCGTGTCTGCAGCGGAGCTGGGAGGGAAGGTGAACCGG GCACTACAGCAAGTGGGAGGTCTGAAGAGCCCTTGGAGGGGAGAATATAAAGAACC AAGACATCCACCGCCAAATCAAGCCAATTACCACCAGACCCTCCATGCCCAGCCGA GAGAGCTTTCGCCAAGGGCCCCAGGGCCCCGGCCAGCTGAGGAGACAACAGGCAG AGCCCCTAAGCTCCAGCCTCCTCTCCCACCAGAGCCCCCAGAGCCAAACAAGTCTCC TCCCTTGACTTTGAGCAAGGAGGAGTCTGGGATGTGGGAACCCTTACCTCTGTCCTC CCTGGAGCCAGCCCCTGCCAGAAACCCCAGCTCACCAGAGCGGAAAGCAACCGTCC CGGAGCAGGAACTGCAGCAGCTGGAAATAGAATTATTCCTCAACAGCCTGTCCCAG CCATTTTCTCTGGAGGAGCAGGAGCAAATTCTCTCGTGCCTCAGCATCGACAGCCTC TCCCTGTCGGATGACAGTGAGAAGAACCCATCAAAGGCCTCTCAAAGCTCGCGGGA CACCCTGAGCTCAGGCGTACACTCCTGGAGCAGCCAGGCCGAGGCTCGAAGCTCCA GCTGGAACATGGTGCTGGCCCGGGGGCGGCCCACCGACACCCCAAGCTATTTCAAT GGTGTGAAAGTCCAAATACAGTCTCTTAATGGTGAACACCTGCACATCCGGGAGTTC CACCGGGTCAAAGTGGGAGACATCGCCACTGGCATCAGCAGCCAGATCCCAGCTGC AGCCTTCAGCTTGGTCACCAAAGACGGGCAGCCTGTTCGCTACGACATGGAGGTGC CAGACTCGGGCATCGACCTGCAGTGCACACTGGCCCCTGATGGCAGCTTCGCCTGGA GCTGGAGGGTCAAGCATGGCCAGCTGGAGAACAGGCCCTAA Human p38 CDS (SEQ ID NO: 29) ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGA GGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGT GTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAG ACCATTTCAGTCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAA ACATATGAAACATGAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTC TCTGGAGGAATTCAATGATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAA CAACATTGTGAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCA AATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATTCACAGGGACCTAAA ACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTGAAGATTCTGGATTTTGGACT GGCTCGGCACACAGATGATGAAATGACAGGCTACGTGGCCACTAGGTGGTACAGGG CTCCTGAGATCATGCTGAACTGGATGCATTACAACCAGACAGTTGATATTTGGTCAG TGGGATGCATAATGGCCGAGCTGTTGACTGGAAGAACATTGTTTCCTGGTACAGACC ATATTAACCAGCTTCAGCAGATTATGCGTCTGACAGGAACACCCCCCGCTTATCTCA TTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAGTCTTTGACTCAGATGC CGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACTTGC TGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCCCAAGCCCTT GCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCCGATCCT TATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACC TATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC TGA Human PKR CDS (SEQ ID NO: 30) ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCG TCAGAAGCAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCAC ATGATAGGAGGTTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGT GAAGGTAGATCAAAGAAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGAT ACTTAATAAGGAAAAGAAGGCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTC AGAAGGATTATCCATGGGGAATTACATAGGCCTTATCAATAGAATTGCCCAGAAGA AAAGACTAACTGTAAATTATGAACAGTGTGCATCGGGGGTGCATGGGCCAGAAGGA TTTCATTATAAATGCAAAATGGGACAGAAAGAATATAGTATTGGTACAGGTTCTACT AAACAGGAAGCAAAACAATTGGCCGCTAAACTTGCATATCTTCAGATATTATCAGA AGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGTTCTTTTGCTACTACGTGTGAG TCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCTGAATCATCATCTGAAGGT GACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGACAGTTTAAACAGTTCT TCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAAAGATCTTTGGC ACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGACAAGAGGT TTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAAGTTT TCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAA TATTGTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGA TGATTCTCTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTC AAAGACTAAGTGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACA ATGGATTGAAAAAAGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCT TTGAACAAATAACAAAAGGGGTGGATTATATACATTCAAAAAAATTAATTCATAGA GATCTTAAGCCAAGTAATATATTCTTAGTAGATACAAAACAAGTAAAGATTGGAGA CTTTGGACTTGTAACATCTCTGAAAAATGATGGAAAGCGAACAAGGAGTAAGGGAA CTTTGCGATACATGAGCCCAGAACAGATTTCTTCGCAAGACTATGGAAAGGAAGTG GACCTCTACGCTTTGGGGCTAATTCTTGCTGAACTTCTTCATGTATGTGACACTGCTT TTGAAACATCAAAGTTTTTCACAGACCTACGGGATGGCATCATCTCAGATATATTTG ATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCAAAGAAACCTGAGGATCGA CCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAGAAAAGCCCAGAGAA AAATGAACGACACACATGTTAG Human Rac CDS (SEQ ID NO: 31) ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACAT CAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTA CAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTG TGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATC CGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAG GAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCA GGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTG AAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACGAGTTT GAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGGA GAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGG CCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGG CACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTG TCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGT TCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACC TGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTG GACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAA GGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGG TGCTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTC ATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTT TTTGAGCTCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCC AAGTCCTTGCTTTCAGGG CTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGG AGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGA AGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTG ATGAGGAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGC ATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCC AGCGGCACGGCCTGA Human Raf CDS (SEQ ID NO: 32) ATGGCTAGCAAACGAAAATCTACAACTCCATGCATGGTTCGGACATCACAAGTAGT AGAACAAGATGTGCCCGAGGAAGTAGACAGGGCCAAAGAGAAAGGAATCGGCACA CCACAGCCTGACGTGGCCAAGGACAGTTGGGCAGCAGAACTTGAAAACTCTTCCAA AGAAAACGAAGTGATAGAGGTGAAATCTATGGGGGAAAGCCAGTCCAAAAAACTC CAAGGTGGTTATGAGTGCAAATACTGCCCCTACTCCACGCAAAACCTGAACGAGTTC ACGGAGCATGTCGACATGCAGCATCCCAACGTGATTCTCAACCCCCTCTACGTGTGT GCAGAATGTAACTTCACAACCAAAAAGTACGACTCCCTATCCGACCACAACTCCAA GTTCCATCCCGGGGAGGCCAACTTCAAGCTGAAGTTAATTAAACGCAATAATCAAA CTGTCTTGGAACAGTCCATCGAAACCACCAACCATGTCGTGTCCATCACCACCAGTG GCCCTGGAACTGGTGACAGTGATTCTGGGATCTCGGTGAGTAAAACCCCCATCATGA AGCCTGGAAAACCAAAAGCGGATGCCAAGAAGGTGCCCAAGAAGCCCGAGGAGAT CACCCCCGAGAACCACGTGGAAGGGACCGCCCGCCTGGTGACAGACACAGCTGAGA TCCTCTCGAGACTCGGCGGGGTGGAGCTCCTCCAAGACACATTAGGACACGTCATGC CTTCTGTACAGCTGCCACCAAATATCAACCTTGTGCCCAAGGTCCCTGTCCCACTAA ATACTACCAAATACAACTCTGCCCTGGATACAAATGCCACGATGATCAACTCTTTCA ACAAGTTTCCTTACCCGACCCAGGCTGAGTTGTCCTGGCTGACAGCTGCCTCCAAAC ACCCAGAGGAGCACATCAGAATCTGGTTTGCCACCCAGCGCTTAAAGCATGGCATC AGCTGGTCCCCAGAAGAGGTGGAGGAGGCCCGGAAGAAGATGTTCAACGGCACCAT CCAGTCAGTACCCCCGACCATCACTGTGCTGCCCGCCCAGTTGGCCCCCACAAAGGT GACGCAGCCCATCCTCCAGACGGCTCTACCGTGCCAGATCCTCGGCCAGACTAGCCT GGTGCTGACTCAGGTGACCAGCGGGTCAACAACCGTCTCTTGCTCCCCCATCACACT TGCCGTGGCAGGAGTCACCAACCATGGCCAGAAGAGACCCTTGGTGACTCCCCAAG CTGCCCCCGAACCCAAGCGTCCACACATCGCTCAGGTGCCAGAGCCCCCACCCAAG GTGGCCAACCCCCCGCTCACACCAGCCAGTGACCGCAAGAAGACAAAGGAGCAGAT AGCACATCTCAAGGCCAGCTTTCTCCAGAGCCAGTTCCCTGACGATGCCGAGGTTTA CCGGCTCATCGAGGTGACTGGCCTTGCCAGGAGCGAGATCAAGAAGTGGTTCAGTG ACCACCGATATCGGTGTCAAAGGGGCATCGTCCACATCACCAGCGAATCCCTTGCCA AAGACCAGTTGGCCATCGCGGCCTCCCGACACGGTCGCACGTATCATGCGTACCCA GACTTTGCCCCCCAGAAGTTCAAAGAGAAAACACAGGGTCAGGTTAAAATCTTGGA AGACAGCTTTTTGAAAAGTTCTTTTCCTACCCAAGCAGAACTGGATCGGCTAAGGGT GGAGACCAAGCTGAGCAGGAGAGAGATCGACTCCTGGTTCTCGGAGAGGCGGAAGC TTCGAGACAGCATGGAACAAGCTGTCTTGGATTCCATGGGGTCTGGCAAAAAAGGC CAAGATGTGGGAGCCCCCAATGGTGCTCTGTCTCGACTCGACCAGCTCTCCGGTGCC CAGTTAACAAGTTCTCTGCCCAGCCCTTCGCCAGCAATTGCAAAAAGTCAAGAACA GGTTCATCTCCTGAGGAGCACGTTTGCAAGAACCCAGTGGCCTACTCCCCAGGAGTA CGACCAGTTAGCGGCCAAGACTGGCCTGGTCCGAACTGAGATTGTGCGTTGGTTCAA GGAGAACAGATGCTTGCTGAAAACGGGAACCGTGAAGTGGATGGAGCAGTACCAGC ACCAGCCCATGGCAGATGATCACGGCTACGATGCCGTAGCAAGGAAAGCAACAAAA CCCATGGCCGAGAGCCCAAAGAACGGGGGTGATGTGGTTCCACAATATTACAAGGA CCCCAAAAAGCTCTGCGAAGAGGACTTGGAGAAGTTGGTGACCAGGGTAAAAGTAG GCAGCGAGCCAGCAAAAGACTGTTTGCCAGCAAAGCCCTCAGAGGCCACCTCAGAC CGGTCAGAGGGCAGCAGCCGGGACGGCCAGGGTAGCGACGAGAACGAGGAGTCGA GCGTTGTGGATTACGTGGAGGTGACGGTCGGGGAGGAGGATGCGATCTCAGATAGA TCAGATAGCTGGAGTCAGGCTGCGGCAGAAGGTGTGTCGGAACTGGCTGAATCAGA CTCCGACTGCGTCCCTGCAGAGGCTGGCCAGGCCTAG Human K-Ras CDS (SEQ ID NO: 33) ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTG ACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGAT TCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGAC ACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGG AGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCA TTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGT AGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACT TAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGGGT GTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATG AGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGT AA Human N-Ras CDS (SEQ ID NO: 34) ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCACT GACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGG ATTCTTACAGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGG ATACAGCTGGACAAGAAGAGTACAGTGCCATGAGAGACCAATACATGAGGACAGG CGAAGGCTTCCTCTGTGTATTTGCCATCAATAATAGCAAGTCATTTGCGGATATTAA CCTCTACAGGGAGCAGATTAAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGC TAGTGGGAAACAAGTGTGATTTGCCAACAAGGACAGTTGATACAAAACAAGCCCAC GAACTGGCCAAGAGTTACGGGATTCCATTCATTGAAACCTCAGCCAAGACCAGACA GGGTGTTGAAGATGCTTTTTACACACTGGTAAGAGAAATACGCCAGTACCGAATGA AAAAACTCAACAGCAGTGATGATGGGACTCAGGGTTGTATGGGATTGCCATGTGTG GTGATGTAA Human RIP CDS (SEQ ID NO: 35) ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAG AGTGCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTTCCACAGAAC CCAGGGACTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACA ACGAGGCCCTCTTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTG GTGAAGCTCCTGGGCGTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTA CATGGAGAAGGGCAACCTGATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTT CTGTAAAAGGAAGGATAATTTTGGAAATCATTGAAGGAATGTGCTACTTACATGGA AAAGGCGTGATACACAAGGACCTGAAGCCTGAAAATATCCTTGTTGATAATGACTTC CACATTAAGATCGCAGACCTCGGCCTTGCCTCCTTTAAGATGTGGAGCAAACTGAAT AATGAAGAGCACAATGAGCTGAGGGAAGTGGACGGCACCGCTAAGAAGAATGGCG GCACCCTCTACTACATGGCGCCCGAGCACCTGAATGACGTCAACGCAAAGCCCACA GAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCGATATTTGCAAATAAG GAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGCATAAAATCTGG GAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATTATCAGTC TCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGCATTG AAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCA GTCTCTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGA ACAGCCTGGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTC CTGGTTTGCTCCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGA GTAAACTCCAAGACGAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAG ACGAAACAGCAGCCCAGACAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGAC GCAGGGTCTCCCATGACCCTTTTGCACAGCAAAGACCTTACGAGAATTTTCAGAATA CAGAGGGAAAAGGCACTGCTTATTCCAGTGCAGCCAGTCATGGTAATGCAGTGCAC CAGCCCTCAGGGCTCACCAGCCAACCTCAAGTACTGTATCAGAACAATGGATTATAT AGCTCACATGGCTTTGGAACAAGACCACTGGATCCAGGAACAGCAGGTCCCAGAGT TTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTGCATAATATCCCAGTGCCTGA GACCAACTATCTAGGAAATACACCCACCATGCCATTCAGCTCCTTGCCACCAACAGA TGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAGATTGGAGCCTACAA TTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACAAATACGAACTT CAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACTAGTCTGAC GGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAACTGTG CCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAGC GAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAA GGCATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAG GATCGACCTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA Human TRAF6 CDS (SEQ ID NO: 36) ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTG CTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGG AACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATG ATGTAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGG CATTACGAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATC ATAAAATCAATAAGGGATGCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCT GGAAAATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGATGGT GAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGATC ATCAAGCACATTGTGAGTTTGCTCTTATGGATTGTCCCCAATGCCAGCGTCCCTTCCA AAAATTCCATATTAATATTCACATTCTGAAGGATTGTCCAAGGAGACAGGTTTCTTG TGACAACTGTGCTGCATCAATGGCATTTGAAGATAAAGAGATCCATGACCAGAACT GTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACTATACTCATCAGAGAACAGA TGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATTCCATGCACATTCAGTA CTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGCCACCTACAAGAG AACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTGAGCGTTATA CCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTA GAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGA AACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACA AAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGC AACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGC CCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAG TTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAA GGAGAATATGACAGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATT CTTGATCAGTCTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAA ACCAGAGCTGCTTGCTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGG CTATGTAACTTTTATGCATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGATGA CACATTATTAGTGCGCTGTGAGGTCTCCACCCGCTTTGACATGGGTAGCCTTCGGAG GGAGGGTTTTCAGCCACGAAGTACTGATGCAGGGGTATAG Human TTP CDS (SEQ ID NO: 37) ATGGCCAACCGTTACACCATGGATCTGACTGCCATCTACGAGAGCCTCCTGTCGCTG AGCCCTGACGTGCCCGTGCCATCCGACCATGGAGGGACTGAGTCCAGCCCAGGCTG GGGCTCCTCGGGACCCTGGAGCCTGAGCCCCTCCGACTCCAGCCCGTCTGGGGTCAC CTCCCGCCTGCCTGGCCGCTCCACCAGCCTAGTGGAGGGCCGCAGCTGTGGCTGGGT GCCCCCACCCCCTGGCTTCGCACCGCTGGCTCCCCGCCTGGGCCCTGAGCTGTCACC CTCACCCACTTCGCCCACTGCAACCTCCACCACCCCCTCGCGCTACAAGACTGAGCT ATGTCGGACCTTCTCAGAGAGTGGGCGCTGCCGCTACGGGGCCAAGTGCCAGTTTGC CCATGGCCTGGGCGAGCTGCGCCAGGCCAATCGCCACCCCAAATACAAGACGGAAC TCTGTCACAAGTTCTACCTCCAGGGCCGCTGCCCCTACGGCTCTCGCTGCCACTTCAT CCACAACCCTAGCGAAGACCTGGCGGCCCCGGGCCACCCTCCTGTGCTTCGCCAGA GCATCAGCTTCTCCGGCCTGCCCTCTGGCCGCCGGACCTCACCACCACCACCAGGCC TGGCCGGCCCTTCCCTGTCCTCCAGCTCCTTCTCGCCCTCCAGCTCCCCACCACCACC TGGGGACCTTCCACTGTCACCCTCTGCCTTCTCTGCTGCCCCTGGCACCCCCCTGGCT CGAAGAGACCCCACCCCAGTCTGTTGCCCCTCCTGCCGAAGGGCCACTCCTATCAGC GTCTGGGGGCCCTTGGGTGGCCTGGTTCGGACCCCCTCTGTACAGTCCCTGGGATCC GACCCTGATGAATATGCCAGCAGCGGCAGCAGCCTGGGGGGCTCTGACTCTCCCGT CTTCGAGGCGGGAGTTTTTGCACCACCCCAGCCCGTGGCAGCCCCCCGGCGACTCCC CATCTTCAATCGCATCTCTGTTTCTGAGTGA
(2044) An antisense nucleic acid molecule can be complementary to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1 protein. Non-coding regions (5′ and 3′ untranslated regions) are the 5′ and 3′ sequences that flank the coding region in a gene and are not translated into amino acids.
(2045) Based upon the sequences disclosed herein, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense nucleic acids to target a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein described herein. Antisense nucleic acids targeting a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1protein can be designed using the software available at the Integrated DNA Technologies website.
(2046) An antisense nucleic acid can be, for example, about 5, 10, 15, 18, 20, 22, 24, 25, 26, 28, 30, 32, 35, 36, 38, 40, 42, 44, 45, 46, 48, or 50 nucleotides or more in length. An antisense oligonucleotide can be constructed using enzymatic ligation reactions and chemical synthesis using procedures known in the art. For example, an antisense nucleic acid can be chemically synthesized using variously modified nucleotides or naturally occurring nucleotides designed to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides or to increase the biological stability of the molecules.
(2047) Examples of modified nucleotides which can be used to generate an antisense nucleic acid include 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
(2048) The antisense nucleic acid molecules described herein can be prepared in vitro and administered to a subject, e.g., a human subject. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense nucleic acid molecules can be delivered to a mammalian cell using a vector (e.g., an adenovirus vector, a lentivirus, or a retrovirus).
(2049) An antisense nucleic acid can be an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, p-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids Res. 15:6625-6641, 1987). The antisense nucleic acid can also comprise a chimeric RNA-DNA analog (Inoue et al., FEBS Lett. 215:327-330, 1987) or a 2′-O-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15:6131-6148, 1987).
(2050) Another example of an inhibitory nucleic acid is a ribozyme that has specificity for a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA, e.g., specificity for any one of SEQ ID NOs: 1-37). Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591, 1988)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. An AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., Science 261:1411-1418, 1993.
(2051) Alternatively, a ribozyme having specificity for an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be designed based upon the nucleotide sequence of any of the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA sequences disclosed herein. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (see, e.g., U.S. Pat. Nos. 4,987,071 and 5,116,742).
(2052) An inhibitory nucleic acid can also be a nucleic acid molecule that forms triple helical structures. For example, expression of an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide (e.g., the promoter and/or enhancer, e.g., a sequence that is at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb upstream of the transcription initiation start state) to form triple helical structures that prevent transcription of the gene in target cells. See generally Maher, Bioassays 14(12):807-15, 1992; Helene, Anticancer Drug Des. 6(6):569-84, 1991; and Helene, Ann. N.Y. Acad. Sci. 660:27-36, 1992.
(2053) In various embodiments, inhibitory nucleic acids can be modified at the sugar moiety, the base moiety, or phosphate backbone to improve, e.g., the solubility, stability, or hybridization, of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see, e.g., Hyrup et al., Bloorganic Medicinal Chem. 4(1):5-23, 1996). Peptide nucleic acids (PNAs) are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs allows for specific hybridization to RNA and DNA under conditions of low ionic strength. PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols (see, e.g., Perry-O'Keefe et al., Proc. Natl. Acad. Sci. U.S.A. 93:14670-675, 1996). PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
(2054) Small Molecules
(2055) In some embodiments, the anti-TNFα agent is a small molecule. In some embodiments, the small molecule is a tumor necrosis factor-converting enzyme (TACE) inhibitor (e.g., Moss et al., Nature Clinical Practice Rheumatology 4: 300-309, 2008). In some embodiments, the anti-TNFα agent is C87 (Ma et al., J. Biol. Chem. 289(18):12457-66, 2014). In some embodiments, the small molecule is LMP-420 (e.g., Haraguchi et al., AIDS Res. Ther. 3:8, 2006). In some embodiments, the TACE inhibitor is TMI-005 and BMS-561392. Additional examples of small molecule inhibitors are described in, e.g., He et al., Science 310(5750):1022-1025, 2005.
(2056) In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of AP-1, ASK1, IKK, JNK, MAPK, MEKK 1/4, MEKK4/7, MEKK 3/6, NIK, TRADD, RIP, NF-κB, and TRADD in a cell (e.g., in a cell obtained from a subject, a mammalian cell).
(2057) In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of CD14, MyD88 (see, e.g., Olson et al., Scientific Reports 5:14246, 2015), ras (e.g., Baker et al., Nature 497:577-578, 2013), raf (e.g., vemurafenib (PLX4032, RG7204), sorafenib tosylate, PLX-4720, dabrafenib (GSK2118436), GDC-0879, RAF265 (CHIR-265), AZ 628, NVP-BHG712, SB590885, ZM 336372, sorafenib, GW5074, TAK-632, CEP-32496, encorafenib (LGX818), CCT196969, LY3009120, R05126766 (CH5126766), PLX7904, and MLN2480).
(2058) In some examples, the anti-TNFα agent TNFα inhibitor is a small molecule that inhibits the activity of one of MK2 (PF 3644022 and PHA 767491), JNK (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 1S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), c-jun (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 1S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), MEK3/6 (e.g., Akinleye et al., J. Hematol. Oncol. 6:27, 2013), p38 (e.g., AL 8697, AMG 548, BIRB 796, CMPD-1, DBM 1285 dihydrochloride, EO 1428, JX 401, ML 3403, Org 48762-0, PH 797804, RWJ 67657, SB 202190, SB 203580, SB 239063, SB 706504, SCIO 469, SKF 86002, SX 011, TA 01, TA 02, TAK 715, VX 702, and VX 745), PKR (e.g., 2-aminopurine or CAS 608512-97-6), TTP (e.g., CAS 329907-28-0), MEK1/2 (e.g., Facciorusso et al., Expert Review Gastroentrol. Hepatol. 9:993-1003, 2015), ERK1/2 (e.g., Mandal et al., Oncogene 35:2547-2561, 2016), NIK (e.g., Mortier et al., Bioorg. Med. Chem. Lett. 20:4515-4520, 2010), IKK (e.g., Reilly et al., Nature Med. 19:313-321, 2013), IκB (e.g., Suzuki et al., Expert. Opin. Invest. Drugs 20:395-405, 2011), NF-κB (e.g., Gupta et al., Biochim. Biophys. Acta 1799(10-12):775-787, 2010), rac (e.g., U.S. Pat. No. 9,278,956), MEK4/7, IRAK (Chaudhary et al., J. Med. Chem. 58(1):96-110, 2015), LBP (see, e.g., U.S. Pat. No. 5,705,398), and TRAF6 (e.g., 3-[(2,5-Dimethylphenyl)amino]-1-phenyl-2-propen-1-one).
(2059) In some embodiments of any of the methods described herein, the inhibitory nucleic acid can be about 10 nucleotides to about 50 nucleotides (e.g., about 10 nucleotides to about 45 nucleotides, about 10 nucleotides to about 40 nucleotides, about 10 nucleotides to about 35 nucleotides, about 10 nucleotides to about 30 nucleotides, about 10 nucleotides to about 28 nucleotides, about 10 nucleotides to about 26 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 24 nucleotides, about 10 nucleotides to about 22 nucleotides, about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 18 nucleotides, about 10 nucleotides to about 16 nucleotides, about 10 nucleotides to about 14 nucleotides, about 10 nucleotides to about 12 nucleotides, about 12 nucleotides to about 50 nucleotides, about 12 nucleotides to about 45 nucleotides, about 12 nucleotides to about 40 nucleotides, about 12 nucleotides to about 35 nucleotides, about 12 nucleotides to about 30 nucleotides, about 12 nucleotides to about 28 nucleotides, about 12 nucleotides to about 26 nucleotides, about 12 nucleotides to about 25 nucleotides, about 12 nucleotides to about 24 nucleotides, about 12 nucleotides to about 22 nucleotides, about 12 nucleotides to about 20 nucleotides, about 12 nucleotides to about 18 nucleotides, about 12 nucleotides to about 16 nucleotides, about 12 nucleotides to about 14 nucleotides, about 15 nucleotides to about 50 nucleotides, about 15 nucleotides to about 45 nucleotides, about 15 nucleotides to about 40 nucleotides, about 15 nucleotides to about 35 nucleotides, about 15 nucleotides to about 30 nucleotides, about 15 nucleotides to about 28 nucleotides, about 15 nucleotides to about 26 nucleotides, about 15 nucleotides to about 25 nucleotides, about 15 nucleotides to about 24 nucleotides, about 15 nucleotides to about 22 nucleotides, about 15 nucleotides to about 20 nucleotides, about 15 nucleotides to about 18 nucleotides, about 15 nucleotides to about 16 nucleotides, about 16 nucleotides to about 50 nucleotides, about 16 nucleotides to about 45 nucleotides, about 16 nucleotides to about 40 nucleotides, about 16 nucleotides to about 35 nucleotides, about 16 nucleotides to about 30 nucleotides, about 16 nucleotides to about 28 nucleotides, about 16 nucleotides to about 26 nucleotides, about 16 nucleotides to about 25 nucleotides, about 16 nucleotides to about 24 nucleotides, about 16 nucleotides to about 22 nucleotides, about 16 nucleotides to about 20 nucleotides, about 16 nucleotides to about 18 nucleotides, about 18 nucleotides to about 20 nucleotides, about 20 nucleotides to about 50 nucleotides, about 20 nucleotides to about 45 nucleotides, about 20 nucleotides to about 40 nucleotides, about 20 nucleotides to about 35 nucleotides, about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 28 nucleotides, about 20 nucleotides to about 26 nucleotides, about 20 nucleotides to about 25 nucleotides, about 20 nucleotides to about 24 nucleotides, about 20 nucleotides to about 22 nucleotides, about 24 nucleotides to about 50 nucleotides, about 24 nucleotides to about 45 nucleotides, about 24 nucleotides to about 40 nucleotides, about 24 nucleotides to about 35 nucleotides, about 24 nucleotides to about 30 nucleotides, about 24 nucleotides to about 28 nucleotides, about 24 nucleotides to about 26 nucleotides, about 24 nucleotides to about 25 nucleotides, about 26 nucleotides to about 50 nucleotides, about 26 nucleotides to about 45 nucleotides, about 26 nucleotides to about 40 nucleotides, about 26 nucleotides to about 35 nucleotides, about 26 nucleotides to about 30 nucleotides, about 26 nucleotides to about 28 nucleotides, about 28 nucleotides to about 50 nucleotides, about 28 nucleotides to about 45 nucleotides, about 28 nucleotides to about 40 nucleotides, about 28 nucleotides to about 35 nucleotides, about 28 nucleotides to about 30 nucleotides, about 30 nucleotides to about 50 nucleotides, about 30 nucleotides to about 45 nucleotides, about 30 nucleotides to about 40 nucleotides, about 30 nucleotides to about 38 nucleotides, about 30 nucleotides to about 36 nucleotides, about 30 nucleotides to about 34 nucleotides, about 30 nucleotides to about 32 nucleotides, about 32 nucleotides to about 50 nucleotides, about 32 nucleotides to about 45 nucleotides, about 32 nucleotides to about 40 nucleotides, about 32 nucleotides to about 35 nucleotides, about 35 nucleotides to about 50 nucleotides, about 35 nucleotides to about 45 nucleotides, about 35 nucleotides to about 40 nucleotides, about 40 nucleotides to about 50 nucleotides, about 40 nucleotides to about 45 nucleotides, about 42 nucleotides to about 50 nucleotides, about 42 nucleotides to about 45 nucleotides, or about 45 nucleotides to about 50 nucleotides) in length. One skilled in the art will appreciate that inhibitory nucleic acids may comprises at least one modified nucleic acid at either the 5′ or 3′ end of DNA or RNA.
(2060) In some embodiments, the inhibitory nucleic acid can be formulated in a liposome, a micelle (e.g., a mixed micelle), a nanoemulsion, or a microemulsion, a solid nanoparticle, or a nanoparticle (e.g., a nanoparticle including one or more synthetic polymers). Additional exemplary structural features of inhibitory nucleic acids and formulations of inhibitory nucleic acids are described in US 2016/0090598.
(2061) In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a sterile saline solution (e.g., phosphate-buffered saline (PBS)). In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a tissue-specific delivery molecule (e.g., a tissue-specific antibody).
(2062) Compound Preparation and Biological Assays
(2063) As can be appreciated by the skilled artisan, methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and RGM. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
PREPARATIVE EXAMPLES
(2064) The following abbreviations have the indicated meanings: ACN=acetonitrile BTC=trichloromethyl chloroformate DCM=dichloromethane DEA=diethylamine DMF=N,N-dimethylformamide DMSO=dimethyl sulfoxide EtOH=ethanol Hex=hexane HPLC=high performance liquid chromatography LC-MS=liquid chromatography-mass spectrometry Me=methyl MeOH=methanol NBS=N-brornosuccinimide NCS=N-chlorosuccinimide NMR=nuclear magnetic resonance Pd(dppf)Cl.sub.2 dichloro[1,1′-bis(diphenylphosphino)ferrocene]palladium Ph=phenyl PPh.sub.3Cl.sub.2=dichlorotriphenylphosphorane Py=pyridine RT=room temperature TBAF=tetrabutylammonium fluoride TBS=tert-butyldinethylsilyl TBSCl=tert-butyldimethylsilyl chloride TEA=triethylamine TFA=trifluoroacetic acid THF=tetrahydrofuran TLC=thin layer chromatography UV=ultraviolet
General
(2065) The progress of reactions was often monitored by TLC or LC-MS. The identity of the products was often confirmed by LC-MS. The LC-MS was recorded using one of the following methods.
(2066) Method A: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm IV range, 5-100% (1.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 2 minute total run time.
(2067) Method B: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mL/min flow rate. 90-900 amu scan range, 190-400 nm UV range, 10-95% (1.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO.sub.3), 2 minute total run time.
(2068) Method C: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 5-100% (2.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 3 minute total run time.
(2069) Method D: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mi/min flow rate, 90-900 amu scan range, 190-400 nm JV range, 10-95% (2.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO.sub.3), 3 minute total run time.
(2070) The final targets were purified by Prep-HPLC. The Prep-HPLC was carried out using the following method.
(2071) Method E: Prep-HPLC: Column, XBridge Shield RP18 OBD (19×250 mm, 10 um); mobile phase, Water (10 mmol/L NH.sub.4HCO.sub.3) and ACN, UV detection 254/210 nm.
(2072) The final targets were purified by Prep-HPLC. The Prep-HPLC was carried out using the following method.
(2073) Method F: Prep-HPLC: Higgins Analytical Proto 200, C18 Column, 250×20 mm, 10 um; mobile phase, Water (0.1% TFA) and ACN (0.1% TFA), UV detection 254/210 nm.
(2074) NMR was recorded on BRUKER NMR 300.03 MHz, DUL-C-H, ULTRASHIELD™300,
(2075) AVANCE II 300 B-ACS™120 or BRUKER NMR 400.13 MHz, BBFO,
(2076) ULTRASHIELD™400, AVANCE III 400, B-ACS™120.
(2077) NMR was recorded on 250 MHz, BRUKER AC 250 NMR
(2078) Racemic compounds of this invention can be resolved to give individual enantiomers using a variety of known methods. For example, chiral stationary phases can used and the elution conditions can include normal phase or super-critical fluid with or without acidic or basic additives. Enantiomerically pure acids or bases can be used to form diatereomeric salts with the racemic compounds whereby pure enantiomers can be obtained by fractional crystallization. The racemates can also be derivatized with enantiomerically pure auxiliary reagents to form diastereomeric mixtures that can be separated. The auxiliary is then removed to give pure enantiomers.
(2079) The compounds herein may be prepared, for example, using the synthetic route as shown in Scheme 1.
(2080) ##STR00695##
(2081) Scheme of final targets: Schemes A-E illustrate several conditions used for coupling of acid 1 and sulfonamide 2 to afford acyl sulfonamide 3.
(2082) ##STR00696##
(2083) ##STR00697##
(2084) ##STR00698##
(2085) ##STR00699##
(2086) ##STR00700##
(2087) ##STR00701##
(2088) Scheme of Sulfonamides Intermediates: Schemes F-Z illustrate the preparation of sulfonamide intermediates. It is understood that the numbering used in the schemes below refers only to the intermediates and that the intermediates are distinct from compounds of formula A, I, and/or II. that may have the same numerical designation. Thus, by way of example, intermediate number “116” in Scheme AB below is distinct from compound 116 disclosed herein.
(2089) ##STR00702##
Intermediate 1
(2090) ##STR00703##
5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonamide
Step 1: Methyl 2-mercaptothiazole-5-carboxylate
(2091) Into a 250-mL round-bottom flask, was placed methyl 2-bromothiazole-5-carboxylate (10 g, 45 mmol), EtOH (100 mL), and sodium hydrogensulfide (5 g, 89 mmol). The resulting solution was stirred for 2 h at 80° C. and then was cooled to 0° C. with a water/ice bath. The pH value of the solution was adjusted to 3 with hydrogen chloride (1 N). The solids were collected by filtration. This resulted in 6 g (76%) of the title compound as a light yellow solid. MS-ESI: 176.0 (M+1).
Step 2: Methyl 2-(chlorosulfonyl)thiazole-5-carboxylate
(2092) Into a 250-mL round-bottom flask, was placed methyl 2-mercaptothiazole-5-carboxylate (6 g, 34 mmol), and acetic acid (60 mL). This was followed by the addition of sodium hypochlorite (60 mL, 8%-10% wt) in portions at 0° C. The resulting solution was stirred for 1 h at RT and then was diluted with 100 mL of water. The solution was extracted with 3×50 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 5 g (crude, 60%) of the title compound as yellow oil. The crude product was used in the next step.
Step 3: Methyl 2-sulfamoylthiazole-5-carboxylate
(2093) Into a 250-mL round-bottom flask, was placed methyl 2-(chlorosulfonyl)thiazole-5-carboxylate (5 g, 21 mmol), and DCM (50 mL). This was followed by the addition of a saturated solution of ammonia in DCM (10 mL) in portions at RT. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 3 g (65%) of the title compound as a white solid. MS-ESI: 223.0 (M+1).
Step 4: 5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonamide
(2094) Into a 250-mL round-bottom flask purged with and maintained under nitrogen, was placed a solution of methyl 2-sulfamoylthiazole-5-carboxylate (3 g, 13.5 mmol) in THF (25 mL). This was followed by the addition of MeMgBr/THF (3 M, 18 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 20 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 2.3 g (78%) of the title compound as a white solid. MS-ESI: 223.0 (M+1), 221.0 (M−1).
Intermediate 2
(2095) ##STR00704##
5-Isopropylthiazole-2-sulfonamide
Step 5: 5-Isopropylthiazole-2-sulfonamide
(2096) Into a 40-mL sealed tube, was placed 5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide (500 mg, 2.25 mmol) in TFA (5 mL), and Et.sub.3SiH (5 mL). The resulting solution was stirred for 4 h at 70° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:4 to 1:2). This resulted in 380 mg (82%) of the title compound as a yellow solid. MS-ESI: 205.0 (M−1).
(2097) ##STR00705##
Intermediate 3
(2098) ##STR00706##
4-(1-Hydroxycyclopropyl)thiophene-2-sulfonamide
Step 1: 4-(1-Hydroxycyclopropyl)thiophene-2-sulfonamide
(2099) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed methyl 5-sulfamoylthiophene-3-carboxylate (5.525 g, 24.97 mmol), THF (80 mL), Ti(i-PrO).sub.4 (1.5 mL). This was followed by the addition of EtMgBr/THF (3 M, 21 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 30 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×40 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 662 mg (12%) of the title compound as a light yellow solid. MS-ESI: 218.0 (M−1).
(2100) ##STR00707##
Intermediate 4
(2101) ##STR00708##
3-Chloro-5-(2-hydroxypropan-2-yl)benzenesulfonamide
Step 1: 3-Chloro-5-(2-hydroxypropan-2-yl)benzenesulfonamide
(2102) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of methyl 3-chloro-5-sulfamoylbenzoate (579 mg, 2.32 mmol) in THF (30 mL). This was followed by the addition of MeMgBr/THF (3 M, 3.5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 12 h at RT and then was quenched by the addition of 20 mL of NH.sub.4Cl (sat.). The solution was extracted with 3×20 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 415 mg (72%) of the title compound as a light yellow solid. MS-ESI: 248.0, 250.0 (M−1).
(2103) ##STR00709##
Intermediate 5
(2104) ##STR00710##
3-(2-Hydroxypropan-2-yl)benzenesulfonamide
Step 1: Methyl 3-sulfamoylbenzoate
(2105) Into a 100-mL round-bottom flask, was placed a solution of methyl 3-(chlorosulfonyl)benzoate (2 g, 8.5 mmol) in DCM (35 mL). To the above was added a saturated solution of ammonia in DCM (15 mL). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 1.753 g (93%) of the title compound as a white solid. MS-ESI: 214.0 (M−1).
Step 2: 3-(2-Hydroxypropan-2-yl)benzenesulfonamide
(2106) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of methyl 3-sulfamoylbenzoate (1.753 g, 8.14 mmol) in THF (70 mL). This was followed by the addition of MeMgBr/THF (3 M, 12.2 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 12 h at RT and then was quenched by the addition of 30 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 5×30 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 1.642 g (94%) of the title compound as a white solid. MS-ESI: 214.0 (M−1).
(2107) TABLE-US-00006 TABLE 2 The Intermediates in the following Table were prepared using the similar procedure for converting compound 7 to compound 8 shown in Scheme 1. Intermediate # Structure IUPAC Name Mass Spec [M + H].sup.+ Intermediate 6
Intermediate 8
(2108) ##STR00713##
5-(2-Hydroxypropan-2-yl)thiophene-2-sulfonamide
(2109) Intermediate 8 was prepared using the similar procedures for converting compound 7 to Intermediate 5 shown in Scheme I. MS-ESI: 220.0 (M−1).
(2110) ##STR00714##
Intermediate 9
(2111) ##STR00715##
3-(Methylsulfonyl)benzenesulfonamide
Step 1: 3-(Methylsulfonyl)benzene-1-sulfonyl chloride
(2112) Into a 100-mL round-bottom flask, was placed a solution of 3-(methylsulfonyl)benzenamine (200 mg, 1.17 mmol) in HCl (6 M, 5 mL). This was followed by the addition of a solution of NaNO.sub.2 (97 mg, 1.41 mmol) in water (0.5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 20 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (5 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (157 mg, 1.17 mmol). The resulting solution was stirred for 1 h at RT and then was quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×10 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 250 mg (84%) of the title compound as a light yellow solid. The crude product was used in the next step.
Step 2: 3-(Methylsulfonyl)benzenesulfonamide
(2113) Into a 50-mL round-bottom flask, was placed 3-(methylsulfonyl)benzene-1-sulfonyl chloride (250 mg, 0.98 mmol) and DCM (3 mL). To the above was added a saturated solution of ammonia in DCM (5 mL). The resulting solution was stirred for 1 h at RT and then was diluted with 5 mL of water. The resulting solution was extracted with 3×10 mL of ethyl acetate; and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 220 mg (crude, 95%) of the title compound as a white solid. MS-ESI: 234.0 (M−1).
(2114) TABLE-US-00007 TABLE 3 The Intermediates in the following Table were prepared using the similar procedures for converting compound 9 to Intermediate 9 shown in Scheme J. Intermediate # Structure IUPAC Name Mass Spec [M − H].sup.− Intermediate 10
(2115) ##STR00719##
Intermediate 13
(2116) ##STR00720##
1-Isopropyl-1H-pyrazole-3-sulfonamide
Step 1: 1-Isopropyl-3-nitro-1H-pyrazole
(2117) Into a 250-mL round-bottom flask, was placed a solution of 3-nitro-1H-pyrazole (10 g, 88.4 mmol) in DMF (100 mL). This was followed by the addition of NaH (60%, 3.9 g) in portions at 0° C. The resulting solution was stirred for 0.5 h at 0° C. This was followed by the addition of 2-bromopropane (14.1 g, 114.6 mmol) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for 16 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 11.8 g (86%) of the title compound as yellow oil. MS-ESI: 156.1 (M+1).
Step 2: 3-Amino-1-(propan-2-yl)-1H-pyrazole
(2118) Into a 250-mL round-bottom flask, was placed a solution of 1-isopropyl-3-nitro-1H-pyrazole (10.8 g, 69.6 mmol) in MeOH (100 mL). Then Pd/C (10% wt, 1.5 g) was added. The flask was evacuated and flushed three times with hydrogen. The mixture was stirred for 24 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 7.27 g (83%) of the title compound as yellow oil. MS-ESI: 126.1 (M+1).
(2119) Steps 3-4 used similar procedures for converting compound 9 to Intermediate 9 shown in Scheme J to afford Intermediate 13. MS-ESI: 188.0 (M−1).
(2120) ##STR00721##
Intermediate 14
(2121) ##STR00722##
4-(2-Hydroxypropan-2-yl)furan-2-sulfonamide
Step 1: Ethyl 5-(chlorosulfonyl)furan-3-carboxylate
(2122) Into a 500-mL 3-necked round-bottom flask, was placed ethyl furan-3-carboxylate (7 g, 50 mmol), DCM (200 mL). This was followed by the addition of chlorosulfonic acid (5.8 g, 49.8 mmol) dropwise with stirring at −10° C. Then the reaction was stirred for 48 h at RT and the system was cooled to −10° C. Then to the above was added pyridine (3.96 g, 50.1 mmol), phosphorus pentachloride (11.46 g, 55.0 mmol). The resulting solution was stirred for 12 h at RT and then was quenched by the addition of 200 mL of water. The resulting solution was extracted with 3×200 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 7.13 g (60%) of the title compound as light brown oil. The crude product was used in the next step.
Step 2: Ethyl 5-sulfamoylfuran-3-carboxylate
(2123) Into a 250-mL round-bottom flask, was placed a solution of ethyl 5-(chlorosulfonyl)furan-3-carboxylate (6.111 g, 25.61 mmol) in DCM (60 mL). To the above was added a saturated solution of ammonia in DCM (40 mL). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:4 to 1:2). This resulted in 3.698 g (66%) of the title compound as a light yellow solid. MS-ESI: 218.0 (M−1).
Step 3: 4-(2-Hydroxypropan-2-yl)furan-2-sulfonamide
(2124) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of ethyl 5-sulfamoylfuran-3-carboxylate (3.698 g, 16.87 mmol) in THE (100 mL). This was followed by the addition of MeMgBr/THF (3 M, 25 mL) dropwise with stirring at −10° C. The resulting solution was stirred for 10 h at RT and then was quenched by the addition of 50 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 2.6 g (75%) of the title compound as a light yellow solid. MS-ESI: 204.0 (M−1).
(2125) TABLE-US-00008 TABLE 4 The Intermediates in the following Table were prepared using the similar procedures for converting compound 15 to Intermediate 14 shown in Scheme L. Intermediate # Structure IUPAC Name Mass Sec [M − H].sup.− Intermediate 15
(2126) ##STR00727##
Intermediate 19
(2127) ##STR00728##
3-(2-Hydroxypropan-2-yl)-2-methylbenzenesulfonamide
Step 1: Methyl 3-(chlorosulfonyl)-2-methylbenzoate
(2128) Into a 100-mL round-bottom flask, was placed methyl methyl 3-amino-2-methylbenzoate (2 g, 12.1 mmol), HCl (6 M, 10 mL). This was followed by the addition of a solution of NaNO.sub.2 (1 g, 14.5 mmol) in water (5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 20 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (15 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (1.63 g, 12.1 mmol). The resulting solution was stirred for 1 h at RT and then was quenched by the addition of 15 mL of water. The resulting solution was extracted with 2×20 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 2 g (66%) of the title compound as a light yellow solid. The crude product was used in the next step.
Step 2: Methyl 2-methyl-3-sulfamoylbenzoate
(2129) Into a 100-mL round-bottom flask, was placed a solution of methyl 3-(chlorosulfonyl)-2-methylbenzoate (2 g, 8.04 mmol) in DCM (10 mL). To the above was added a saturated solution of ammonia in DCM (15 mL). The resulting solution was stirred for 1 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 1.2 g (65%) of the title compound as a white solid. MS-ESI: 228.0 (M−1).
Step 3: 3-(2-Hydroxypropan-2-yl)-2-methylbenzenesulfonamide
(2130) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of methyl 2-methyl-3-sulfamoylbenzoate (1.2 g, 5.23 mmol) in THE (20 mL). This was followed by the addition MeMgBr/THF (3 M, 8.7 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 12 h at RT. The reaction was then quenched by the addition of 15 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×20 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 1.1 g (crude, 92%) of the title compound as an off-white solid. MS-ESI: 228.1 (M−1).
(2131) TABLE-US-00009 TABLE 5 The Intermediates in the following Table were prepared using the similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M. Intermediate # Structure IUPAC Name Mass Spec [M − H].sup.− Intermediate 20
(2132) ##STR00743## ##STR00744##
Intermediate 34
(2133) ##STR00745##
3-(2-Hydroxypropan-2-yl)-5-(pyridin-4-yl)benzenesulfonamide
Step 1: Ethyl 3-nitro-5-(pyridin-4-yl)benzoate
(2134) Into a 500-mL round-bottom flask purged with and maintained under nitrogen, was placed ethyl 3-bromo-5-nitrobenzoate (5.5 g, 20.1 mmol), dioxane (250 mL), water (50 mL), (pyridin-4-yl)boronic acid (3.0 g, 24.4 mmol), Cs.sub.2CO.sub.3 (12.7 g, 38.98 mmol), and Pd(dppf)Cl.sub.2 (600 mg, 0.82 mmol). The resulting solution was stirred for 12 h at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:1 to 3:1). This resulted in 4.2 g (77%) of the title compound as a white solid. MS-ESI: 273.1 (M+1).
Step 2: Ethyl 3-amino-5-(pyridin-4-yl)benzoate
(2135) Into a 250-mL round-bottom flask, was placed ethyl 3-nitro-5-(pyridin-4-yl)benzoate (4.2 g, 15.4 mmol), MeOH (150 mL). Then Pd/C (10% wt, 500 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 2 days at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting solution was concentrated under vacuum. This resulted in 3.7 g (99%) of the title compound as a white solid. MS-ESI: 243.1 (M+1).
(2136) Steps 3-5 used similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M to afford Intermediate 34. MS-ESI: 293.1 (M+1), 291.1 (M−1).
Intermediate 35
(2137) ##STR00746##
5-(2-Hydroxypropan-2-yl)biphenyl-3-sulfonamide
(2138) Intermediate 35 was prepared using the similar procedures for converting compound 21 to Intermediate 34 shown in Scheme N. MS-ESI: 290.1 (M−1).
(2139) ##STR00747##
Intermediate 36
(2140) ##STR00748##
5-(2-Hydroxypropan-2-yl)-1-phenyl-1H-pyrazole-3-sulfonamide
Step 1: Ethyl 3-nitro-1-phenyl-1H-pyrazole-5-carboxylate
(2141) Into a 500-mL round-bottom flask, was placed ethyl 3-nitro-1H-pyrazole-5-carboxylate (5 g, 27.0 mmol), THE (150 mL), phenylboronic acid (6.59 g, 54.1 mmol), Cu(OAc).sub.2 (7.36 g, 40.5 mmol), and pyridine (8.54 g, 108 mmol). The resulting solution was stirred for 14 h at 55° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:7 to 1:4). This resulted in 2 g (28%) of the title compound as an off-white solid. MS-ESI: 262.1 (M+1).
Step 2: Ethyl 3-amino-1-phenyl-1H-pyrazole-5-carboxylate
(2142) Into a 100-mL round-bottom flask, was placed ethyl 3-nitro-1-phenyl-1H-pyrazole-5-carboxylate (2 g, 7.66 mmol), EtOH (50 mL). Then Pd/C (10% wt, 200 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 1 g (56%) of the title compound as a light yellow solid. MS-ESI: 232.1 (M+1).
(2143) Steps 3-5 used similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M to afford Intermediate 36. MS-ESI: 280.1 (M−1).
(2144) ##STR00749##
Intermediate 37
(2145) ##STR00750##
5-(2-Hydroxypropan-2-yl)-1-methyl-1H-pyrazole-3-sulfonamide
Step 1: Methyl 1-methyl-3-nitro-1H-pyrazole-5-carboxylate
(2146) Into a 250-mL round-bottom flask purged with and maintained under nitrogen, was placed methyl 3-nitro-1H-pyrazole-5-carboxylate (15 g, 87.7 mmol), DMF (50 mL), potassium carbonate (22.4 g, 162 mmol), and CH.sub.3I (18.5 g, 130 mmol). The resulting solution was stirred for 15 h at RT and then was quenched by the addition of 50 mL of water. The resulting solution was extracted with 3×40 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 17 g (crude) of the title compound as a yellow solid. MS-ESI: 186.0 (M+1).
Step 2: Methyl 3-amino-1-methyl-1H-pyrazole-5-carboxylate
(2147) Into a 500-mL round-bottom flask, was placed methyl 1-methyl-3-nitro-1H-pyrazole-5-carboxylate (17 g, 91.8 mmol), and MeOH (100 mL). Then Pd/C (10% wt, 2 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:4 to 2:3). This resulted in 11.6 g (81%) of the title compound as a yellow solid. MS-ESI: 156.1 (M+1).
(2148) Steps 3-5 used similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M to afford Intermediate 37. MS-ESI: 218.0 (M−1).
(2149) ##STR00751## ##STR00752##
Intermediate 38
(2150) ##STR00753##
3-(2-Hydroxypropan-2-yl)-5-morpholinobenzenesulfonamide
Step 1: Ethyl 3-bromo-5-nitrobenzoate
(2151) Into a 500-mL round-bottom flask, was placed 3-bromo-5-nitrobenzoic acid (25 g, 101.6 mmol), EtOH (200 mL). This was followed by the addition of thionyl chloride (15 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at 80° C. and then was quenched by the addition of 50 mL water. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 27.5 g (99%) of the title compound as a white solid.
Step 2: Ethyl 3-(morpholin-4-yl)-5-nitrobenzoate
(2152) Into a 500-mL round-bottom flask purged with and maintained under nitrogen, was placed ethyl 3-bromo-5-nitrobenzoate (10 g, 36.5 mmol), toluene (250 mL), morpholine (4.6 g, 52.8 mmol), t-BuONa (5 g, 52.0 mmol), Pd.sub.2(dba).sub.3CHCl.sub.3 (1.9 g, 1.93 mmol), BINAP (1.2 g, 1.93 mmol). The resulting solution was stirred for 18 h at 60° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:30 to 1:10). This resulted in 2.8 g (27%) of the title compound as a yellow solid. MS-ESI: 281.1 (M+1).
Step 3: Ethyl 3-amino-5-(morpholin-4-yl benzoate
(2153) Into a 250-mL round-bottom flask, was placed ethyl 3-(morpholin-4-yl)-5-nitrobenzoate (3.0 g, 10.7 mmol), MeOH (100 mL). Then Pd/C (10% wt, 300 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 2.6 g (97%) of the title compound as a yellow solid. MS-ESI: 251.1 (M+1).
(2154) Steps 4-6 used similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M to afford Intermediate 38. MS-ESI: 299.1 (M−1).
(2155) ##STR00754##
Intermediate 39
(2156) ##STR00755##
3-((Tert-butyldiphenylsilyloxy)methyl)-4-(2-hydroxypropan-2-yl)benzenesulfonamide
(2157) Steps 1-3 used similar procedures for converting compound 18 to Intermediate 19 shown in Scheme M to afford compound 45. MS-ESI: 212.1 (M−1).
Step 4: 3-((Tert-butyldiphenylsilyloxy)methyl)-4-(2-hydroxypropan-2-yl)benzenesulfonamide
(2158) Into a 100-mL round-bottom flask, was placed 3-(hydroxymethyl)-4-(2-hydroxypropan-2-yl)benzenesulfonamide (1.9 g, 7.75 mmol), DMF (20 mL), imidazole (1.06 g, 15.57 mmol), and TBDPSCl (3.2 g, 11.64 mmol). The resulting solution was stirred overnight at RT and then was diluted with 20 mL of water. The resulting solution was extracted with 2×20 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, ACN/H.sub.2O (10 mmol/NH.sub.4HCO.sub.3)=1:4 increasing to ACN/H.sub.2O (10 mmol/NH.sub.4HCO.sub.3)=4:1 within 30 min; Detector, UV 210 nm. This resulted in 1.4 g (37%) of the title compound as an off-white solid. MS-ESI: 482.2 (M−1).
(2159) ##STR00756##
Intermediate 40
(2160) ##STR00757##
5-((Tert-butyldiphenylsilyloxy)methyl)thiazole-2-sulfonamide
Step 1: (2-Bromothiazol-5-yl)methanol
(2161) Into a 250-mL round-bottom flask, was placed a solution of methyl 2-bromothiazole-5-carboxylate (15 g, 67.55 mmol) in EtOH (100 mL). This was followed by the addition of sodium borohydride (5.13 g, 139.3 mmol) in portions at 0° C. The resulting solution was stirred for 12 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 10 g (crude, 76%) of the title compound as a light yellow oil. MS-ESI: 195.9, 193.9 (M+1).
Step 2: 2-Bromo-5-((tert-butyldiphenylsilyloxy)methyl)thiazole
(2162) Into a 250-mL round-bottom flask, was placed (2-bromothiazol-5-yl)methanol (8 g, 41.2 mmol), DMF (50 mL), TBDPSCl (12.5 g, 45.5 mmol), and imidazole (5.6 g, 82.4 mmol). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 1:80). This resulted in 15 g (84%) of the title compound as a light yellow solid. MS-ESI: 434.0, 432.0 (M+1).
Step 3: 5-((Tert-butyldiphenylsilyloxy)methyl)thiazole-2-sulfonamide
(2163) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of 2-bromo-5-((tert-butyldiphenylsilyloxy)methyl)thiazole (15 g, 34.7 mmol) in THF (200 mL). This was followed by the addition of n-BuLi (2.5 M, 16.7 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 30 min at −78° C. To the above SO.sub.2 was introduced. The reaction was warmed to RT and stirred for 30 min and then was concentrated under vacuum. The residue diluted in DCM (150 mL) and then NCS (5.7 g, 42.69 mmol) was added. The resulting solution was stirred for 30 min at RT. To the above was added a saturated solution of ammonia in DCM (100 mL). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 7.5 g (50%) of the title compound as a light yellow solid. MS-ESI: 431.1 (M−1).
(2164) ##STR00758##
Intermediate 41
(2165) ##STR00759##
5-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole-2-sulfonamide
Step 1: 2-Bromothiazole-5-carbaldehyde
(2166) Into a 500-mL round-bottom flask, was placed (2-bromothiazol-5-yl)methanol (20 g, 103 mmol), DCM (200 mL). This was followed by the addition of Dess-Martin reagent (46 g, 103 mmol) in portions at 0° C. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 18 g (91%) of the title compound as a white solid. MS-ESI: 193.9, 191.9 (M+1).
Step 2: 1-(2-Bromothiazol-5-yl)ethanol
(2167) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of 2-bromothiazole-5-carbaldehyde (18 g, 93.7 mmol) in THF (200 mL). This was followed by the addition of MeMgBr/THF (3 M, 33 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 0.5 h at 0° C. The reaction was then quenched by the addition of 200 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 2×200 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:15). This resulted in 15 g (77%) of the title compound as colorless oil. MS-ESI: 209.9, 207.9 (M+1).
(2168) Steps 3-4 used similar procedures for converting compound 46 to Intermediate 40 shown in Scheme S to afford Intermediate 41. MS-ESI: 445.1 (M−1).
(2169) ##STR00760##
Intermediate 42
(2170) ##STR00761##
5-(1-(Tert-butyldimethylsilyloxy)propan-2-yl)thiazole-2-sulfonamide
Step 1: 1-(2-Bromothiazol-5-yl)ethanone
(2171) Into a 250-mL round-bottom flask, was placed 1-(2-bromothiazol-5-yl)ethanol (5.792 g, 27.84 mmol), DCM (150 mL), and Dess-Martin reagent (17.72 g, 41.78 mmol). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 5.29 g (92%) of the title compound as an off-white solid. MS-ESI: 207.9, 205.9 (M+1).
Step 2: 2-Bromo-5-(1-methoxyprop-1-en-2-yl)thiazole
(2172) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed (methoxymethyl)triphenylphosphanium chloride (13.16 g, 38.39 mmol) and THF (100 mL). This was followed by the addition of LiHMDS (1 M, 38.52 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 0.5 h at 0° C. To this was added a solution of 1-(2-bromothiazol-5-yl)ethanone (5.29 g, 25.67 mmol) in THF (30 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 1 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×80 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 4.38 g (73%) of the title compound as light yellow oil. MS-ESI: 235.9, 234.0 (M+1).
Step 3: 2-(2-Bromothiazol-5-yl)propanal
(2173) Into a 250-mL round-bottom flask, was placed 2-bromo-5-(1-methoxyprop-1-en-2-yl)thiazole (4.38 g, 18.7 mmol), THE (30 mL), water (50 mL), and HBr (47% wt, 50 mL). The resulting solution was stirred for 4 h at 70° C. and then was diluted with 30 mL of water. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 3.79 g (crude, 92%) of the title compound as light yellow oil. MS-ESI: 221.9, 219.9 (M+1).
Step 4: 2-(2-Bromothiazol-5-yl)propan-1-ol
(2174) Into a 250-mL round-bottom flask, was placed 2-(2-bromothiazol-5-yl)propanal (4 g, 18.2 mmol) and EtOH (60 mL). This was followed by the addition of NaBH.sub.4 (1.38 g, 36.5 mmol) in portions at 0° C. The resulting solution was stirred overnight at RT and then was quenched by the addition of 50 mL of water. The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 3.79 g (94%) of the title compound as light yellow oil. MS-ESI: 223.9, 222.0 (M+1).
Step 5: 2-Bromo-5-(1-(tert-butyldimethylsilyloxy)propan-2-yl)thiazole
(2175) Into a 100-mL round-bottom flask, was placed 2-(2-bromothiazol-5-yl)propan-1-ol (3.79 g, 17.1 mmol), DMF (25 mL), imidazole (2.33 g, 34.2 mmol), TBDMSCl (3.87 g, 25.7 mmol). The resulting solution was stirred overnight at RT and then was diluted with 30 mL of water. The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:15 to 1:10). This resulted in 3.12 g (54%) of the title compound as a white solid. MS-ESI: 338.0, 336.0 (M+1).
(2176) Step 6 used similar procedure for converting compound 47 to Intermediate 40 shown in Scheme S to afford Intermediate 42. MS-ESI: 335.1 (M−1).
(2177) ##STR00762##
Intermediate 43
(2178) ##STR00763##
5-(2-Methoxypropan-2-yl)thiazole-2-sulfonamide
Step 1: 2-(Thiazol-5-yl)propan-2-ol
(2179) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of ethyl ethyl thiazole-5-carboxylate (3.75 g, 23.9 mmol) in THE (50 mL). This was followed by the addition of MeMgBr/THF (3 M, 40 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 50 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×80 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 2.1 g (61%) of the title compound as yellow oil. MS-ESI: 144.0 (M+1).
Step 2: 5-(2-Methoxypropan-2-yl)thiazole
(2180) Into a 100-mL round-bottom flask, was placed a solution of 2-(thiazol-5-yl)propan-2-ol (2.06 g, 14.4 mmol) in DMF (20 mL). This was followed by the addition of NaH (60%, 1.15 g, 28.8 mmol) in portions at 0° C. To this was added CH.sub.3I (3.07 g, 21.6 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 1 h at RT and then was quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×30 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 1.42 g (63%) of the title compound as yellow oil. MS-ESI: 158.1 (M+1). Step 3 used similar procedure for converting compound 47 to Intermediate 40 shown in Scheme S to afford Intermediate 43. MS-ESI: 235.0 (M−1).
(2181) ##STR00764##
Intermediate 44
(2182) ##STR00765##
5-(2-(Tert-butyldimethylsilyloxy)ethyl)thiazole-2-sulfonamide
Step 1: 2-Bromo-5-(2-methoxyvinyl)thiazole
(2183) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed (methoxymethyl)triphenylphosphanium chloride (3.2 g, 9.33 mmol), THF (15 mL). This was followed by the addition of LiHMDS (1 M, 9.4 mL) dropwise with stirring at 0° C. To this was added a solution of 2-bromo-1,3-thiazole-5-carbaldehyde (1.5 g, 7.81 mmol) in THF (10 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 0.5 h at 0° C. and then was quenched by the addition of 50 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 1:80). This resulted in 1.3 g (76%) of the title compound as brown oil. The crude product was used in the next step.
Step 2: 2-(2-Bromo-1,3-thiazol-5-yl)acetaldehyde
(2184) Into a 50-mL round-bottom flask purged with and maintained under nitrogen, was placed 2-bromo-5-(2-methoxyvinyl)thiazole (1.3 g, 5.91 mmol), THF (10 mL). This was followed by the addition of aqueous hydrogen chloride (4 M, 5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at 60° C. The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 1.1 g (90%) of the title compound as light yellow oil. MS-ESI: 205.9, 207.9 (M+1).
Step 3: 2-(2-Bromo-1,3-thiazol-5-yl)ethan-1-ol
(2185) Into a 50-mL round-bottom flask, was placed 2-(2-bromo-1,3-thiazol-5-yl)acetaldehyde (1.1 g, 5.34 mmol), EtOH (10 mL), and sodium borohydride (200 mg, 5.43 mmol). The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×30 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. This resulted in 1.0 g (90%) of the title compound as light yellow oil. MS-ESI: 207.9, 209.9 (M+1).
Step 4: 2-Bromo-5-(2-(tert-butyldimethylsilyloxy)ethyl thiazole
(2186) Into a 50-mL round-bottom flask, was placed 2-(2-bromo-1,3-thiazol-5-yl)ethan-1-ol (1.0 g, 4.81 mmol), DMF (10 mL), imidazole (650 mg, 9.56 mmol), and TBDMSCl (1.1 g, 7.30 mmol). The resulting solution was stirred for 2 h at RT and then was diluted with 20 mL of water. The resulting solution was extracted with 2×20 mL of DCM and the organic layers combined and concentrated under vacuum. This resulted in 1.2 g (77%) of the title compound as light yellow oil. MS-ESI: 324.0, 322.0 (M+1).
(2187) Step 5 used similar procedure for converting compound 47 to Intermediate 40 shown in Scheme S to afford Intermediate 44. MS-ESI: 321.1 (M−1).
(2188) ##STR00766##
Intermediate 45
(2189) ##STR00767##
5-(1-(Tert-butyldimethylsilyloxy)-2-methylpropan-2-yl)thiazole-2-sulfonamide
Step 1: Tert-butyl 2-(thiazol-5-yl)acetate
(2190) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed 5-bromothiazole (3 g, 18.29 mmol), THF (30 mL), X-phos (1.74 g, 3.66 mmol), and Pd.sub.2(dba).sub.3CHCl.sub.3 (950 mg, 0.91 mmol). The resulting solution was stirred for 0.5 h at RT. To the above was added tert-butyl 2-(bromozincio)acetate (7.13 g, 27.37 mmol). The resulting solution was stirred for 4 h at 70° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 2.4 g (66%) of the title compound as brown oil. MS-ESI: 200.1 (M+1).
Step 2: Tert-butyl 2-methyl-2-(thiazol-5-yl)propanoate
(2191) Into a 100-mL round-bottom flask purged with and maintained under nitrogen, was placed tert-butyl 2-(thiazol-5-yl)acetate (1 g, 5.02 mmol), DMF (20 mL). This was followed by the addition of NaH (60%, 600 mg, 25.00 mmol) in portions at 0° C. The solution was stirred for 0.5 h at 0° C. This was followed by the addition of CH.sub.3I (2.13 g, 15.06 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 40 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×50 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:3). This resulted in 0.7 g (61%) of the title compound as light yellow oil. MS-ESI: 228.1 (M+1).
Step 3: 2-Methyl-2-(thiazol-5-yl)propan-1-ol
(2192) Into a 100-mL round-bottom flask, was placed tert-butyl 2-methyl-2-(thiazol-5-yl)propanoate (700 mg, 3.08 mmol), THF (20 mL). This was followed by the addition of LiAlH.sub.4 (200 mg, 5.27 mmol) in portions at 0° C. and was stirred for 2 h at 0° C. and then was quenched by the addition of 1 mL of water. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 400 mg (83%) of the title compound as brown oil. MS-ESI: 158.1 (M+1).
(2193) Steps 4-5 used similar procedures for converting compound 54 to Intermediate 42 shown in in Scheme U to afford Intermediate 45. MS-ESI: 349.1 (M−1).
(2194) ##STR00768##
Intermediate 46
(2195) ##STR00769##
2-Fluoro-5-(2-methyl-1,3-dioxolan-2-yl)benzenesulfonamide
Step 1: 2-(3-Bromo-4-fluorophenyl)-2-methyl-1,3-dioxolane
(2196) Into a 250-mL round-bottom flask, was placed a solution of 1-(3-bromo-4-fluorophenyl)ethan-1-one (5 g, 23.0 mmol) in toluene (50 mL), ethane-1,2-diol (4 mL), and TsOH (200 mg, 1.16 mmol). The resulting solution was stirred for 6 h at 120° C. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2SO.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:4). This resulted in 5.5 g (91%) of the title compound as yellow oil.
(2197) Step 2 used similar procedure for converting compound 47 to Intermediate 40 shown in Scheme S to afford Intermediate 46. MS-ESI: 260.0 (M−1).
Intermediate 47
(2198) ##STR00770##
5-Acetyl-2-fluorobenzenesulfonamide
Step 3: 5-Acetyl-2-fluorobenzenesulfonamide
(2199) Into a 50-mL round-bottom flask, was placed 2-fluoro-5-(2-methyl-1,3-dioxolan-2-yl)benzene-1-sulfonamide (300 mg, 1.15 mmol), THF (5 mL), and hydrogen chloride (1 N, 5 mL). The resulting solution was stirred for 12 h at RT. The pH value of the solution was adjusted to 7˜8 with NaOH (2 N). The resulting solution was extracted with 3×30 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. This resulted in 240 mg (crude, 96%) of the title compound as a light yellow solid. MS-ESI: 216.0 (M−1).
(2200) ##STR00771##
Intermediate 48
(2201) ##STR00772##
2-(2-Hydroxypropan-2-yl)thiazole-5-sulfonamide
(2202) Compound 73 was prepared using similar procedures for converting compound 68 to Intermediate 47 shown in Scheme Y.
Step 4: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfonamide
(2203) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed 2-acetylthiazole-5-sulfonamide (1 g, 4.85 mmol), and THE (20 mL). This was followed by the addition of MeMgBr (3 M, 7 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 20 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 2×30 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 580 mg (54%) of the title compound as a light yellow solid. MS-ESI: 221.0 (M−1).
(2204) ##STR00773##
Intermediate 49
(2205) ##STR00774##
Step 1: 4-Nitrobenzoyl Chloride
(2206) Into a 500-mL round-bottom flask was placed 4-nitrobenzoic acid (20 g, 120 mmol), DCM (200 mL), and DMF (0.2 mL). This was followed by the addition of oxalyl chloride (15 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at RT and then was concentrated under vacuum. This resulted in 22 g (crude) of the title compound as yellow oil. The crude product was used in the next step.
Step 2: N,N-dimethyl-4-nitrobenzamide
(2207) Into a 500-mL round-bottom flask was placed dimethylamine hydrochloride (6.5 g, 79.7 mmol), DCM (200 mL), and TEA (50 mL). This was followed by the addition of 4-nitrobenzoyl chloride (22 g, 119 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 6 h at RT and then was concentrated under vacuum. The resulting mixture was washed with 2×50 mL of water. The solids were collected by filtration. This resulted in 16 g (69% over two steps) of the title compound as a white solid. MS-ESI: 195.1 (M+1).
Step 3: 4-Amino-N,N-dimethylbenzamide
(2208) Into a 250-mL round-bottom flask was placed N,N-dimethyl-4-nitrobenzamide (16 g, 82.4 mmol), MeOH (100 mL). Then Pd/C (10% wt., 1 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 13 g (96%) of the title compound as a white solid. MS-ESI: 165.1 (M+1).
(2209) Steps 4-5 used similar steps as described for intermediate 38 shown in Scheme Q to afford compound 41. MS-ESI: 229.1
(2210) (M+1).
(2211) ##STR00775##
Intermediate 50
(2212) ##STR00776##
2-(4-Chloro-3,5-difluoro-2,6-diisopropylphenyl)acetic acid
Step 1: 4-Chloro-3,5-difluorobenzenamine
(2213) Into a 500-mL round-bottom flask, was placed 3,5-difluorobenzenamine (10.3 g, 79.8 mmol), ACN (100 mL), NCS (10.8 g, 80.9 mmol). The resulting solution was stirred for 5 h at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 7.1 g (54%) of the title compound as a gray solid. 164.0, 166.0 (M+1).
Step 2: 2,6-Dibromo-4-chloro-3,5-difluorobenzenamine
(2214) Into a 250-mL round-bottom flask, was placed 4-chloro-3,5-difluorobenzenamine (4.0 g, 24.5 mmol), ACN (100 mL), NBS (13.0 g, 73.0 mmol). The resulting solution was stirred for 1 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:6 to 1:4). This resulted in 7.4 g (94%) of the title compound as a yellow solid. MS-ESI: 319.8, 321.8, 323.8 (M+1).
(2215) Steps 3-7 used similar procedures for converting compound 87 to Intermediate 51 shown in Scheme OO (below) to afford Intermediate 50. MS-ESI: 289.1, 291.1 (M−1).
(2216) Compound 84: .sup.1H NMR (400 MHz, CDCl.sub.3-d) δ 3.67 (hept, J=7.2 Hz, 2H), 1.33 (d, J=7.2 Hz, 12H).
(2217) ##STR00777##
Intermediate 51
(2218) ##STR00778##
2-(4-Chloro-2-isopropyl-6-(trifluoromethyl)phenyl)acetic acid
Step 1: 2-Bromo-4-chloro-6-(trifluoromethyl)aniline
(2219) Into a 250-mL round-bottom flask, was placed 4-chloro-2-(trifluoromethyl)aniline (5 g, 25.6 mmol), ACN (150 mL), NBS (9.2 g, 51.7 mmol). The resulting solution was stirred overnight at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:15 to 1:10). This resulted in 6 g (86%) of the title compound as a white solid. MS-ESI: 275.9, 273.9 (M+1).
Step 2: 4-chloro-2-(prop-1-en-2-yl)-6-(trifluoromethyl)aniline
(2220) Into a 500-mL round-bottom flask purged with and maintained under nitrogen, was placed 2-bromo-4-chloro-6-(trifluoromethyl)aniline (1 equiv.), dioxane (0.372 M in limiting reagent), water (14.9 equiv.), Cs.sub.2CO.sub.3 (3.0 equiv.), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (2.67 equiv.), and Pd(dppf)Cl.sub.2 (9.8 mol %). The resulting solution was stirred for 15 h at 100° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether. This resulted in the title compound.
Step 3: 4-chloro-2-isopropyl-6-(trifluoromethyl)aniline
(2221) Into a 500-mL round-bottom flask, was placed 4-chloro-2-(prop-1-en-2-yl)-6-(trifluoromethyl)aniline (1 equiv.) and MeOH (0.24 M in limiting reagent). Then Pd/C (10% wt, ca. 1.76 mol % Pd) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether. This resulted in the title compound.
Step 4: 2-bromo-5-chloro-1-isopropyl-3-(trifluoromethyl)benzene
(2222) Into a 500-mL round-bottom flask purged with and maintained under nitrogen, was placed 4-chloro-2-isopropyl-6-(trifluoromethyl)aniline (1.0 equiv.), ACN (0.12 M in limiting reagent), and CuBr (1.50 equiv.). This was followed by the addition of tert-butyl nitrite (1.50 equiv.) dropwise with stirring at 0° C. The resulting solution was stirred for 3 h at 60° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column with petroleum ether. This resulted in the title compound.
Step 5: tert-butyl 2-(4-chloro-2-isopropyl-6-(trifluoromethyl)phenyl)acetate
(2223) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen, was placed 2-bromo-5-chloro-1-isopropyl-3-(trifluoromethyl)benzene (1.0 equiv.), THF (0.077 M in limiting reagent), X-phos (10 mol %), and Pd.sub.2(dba).sub.3CHCl.sub.3 (5 mol %). The resulting solution was stirred for 0.5 h at RT. Then to the above tert-butyl 2-(bromozincio)acetate (1.9 equiv.) was added. The resulting solution was stirred for 5 h at 70° C. and then was quenched by the addition of NH.sub.4Cl (sat.). The resulting solution was extracted with ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 3:97). This resulted in the title compound.
Step 6: 2-(4-chloro-2-isopropyl-6-(trifluoromethyl)phenyl)acetic acid
(2224) Into a 50-mL round-bottom flask, was placed tert-butyl 2-(4-chloro-2-isopropyl-6-(trifluoromethyl)phenyl)acetate (1.0 equiv.), DCM (0.53 M in limiting reagent), TFA (0.53 M in limiting reagent). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. This resulted in the title compound as a light yellow solid. MS-ESI: 279.0 (M−1).
(2225) Compound 91: .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.70 (s, 1H), 7.58 (s, 1H), 3.77 (s, 2H), 3.11-2.97 (m, 1H), 1.35 (s, 9H), 1.17 (d, J=6.8 Hz, 6H).
(2226) ##STR00779##
Intermediate 52
(2227) ##STR00780##
2-(4-Chloro-2,6-diisopropylphenyl)acetic acid
Step 1: 4-Chloro-2,6-bis(propan-2-yl)aniline
(2228) Into a 100-mL round-bottom flask, was placed 2,6-bis(propan-2-yl)aniline (5 g, 28.2 mmol), DMF (20 mL), NCS (4.9 g, 36.7 mmol). The resulting solution was stirred for 15 h at RT and then was diluted with 20 mL of water. The resulting solution was extracted with 3×20 mL of DCM and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 3.7 g (62%) of the title compound as brown oil. MS-ESI: 212.1, 214.1 (M+1).
(2229) Steps 2-4 used similar procedures for converting compound 89 to Intermediate 51 shown in Scheme OO to afford Intermediate 58. MS-ESI: 253.1, 255.1 (M−1).
(2230) ##STR00781##
Intermediate 53
(2231) ##STR00782##
2-(8-Chloro-1,2,3,5,6,7-hexahydros-indacen-4-yl)acetic acid
Step 1: 8-Chloro-1,2,3,5,6,7-hexahydros-indacen-4-amine
(2232) Into a 100-mL round-bottom flask, was placed 1,2,3,5,6,7-hexahydros-indacen-4-amine (1.73 g, 9.99 mmol), DMF (10 mL), NCS (1.47 g, 11.0 mmol). The resulting solution was stirred for 12 h at RT and then was diluted with 50 mL of DCM. The resulting mixture was washed with 3×10 mL of water. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:10). This resulted in 1.88 g (91%) of the title compound as a yellow solid. MS-ESI: 208.1, 210.1 (M+1).
(2233) Steps 2-4 used similar procedures for converting compound 89 to Intermediate 51 shown in Scheme OO to afford Intermediate 60. MS-ESI: 249.1, 251.1 (M−1).
Intermediate 54
(2234) ##STR00783##
(2235) ##STR00784##
Step 1: Preparation of 4-bromo-2,6-diisopropylaniline
(2236) ##STR00785##
(2237) To a stirred solution of 2,6-diisopropylaniline (5.05 g, 28.4 mmol, 1.00 equiv) in N,N-dimethylformamide (70 mL) at 0° C. was added a solution of NBS (5.05 g, 28.4 mmol, 1.00 equiv) in N,N-dimethylformamide (30 mL) dropwise over 60 min. The reaction was stirred for another hour at 0° C., at which time water (300 mL) was added. The resulting mixture was extracted with ethyl acetate (2×300 mL), and the combined organic layers were washed with saturated NH.sub.4Cl solution (3×100 mL) followed by water (100 mL) and dried over anhydrous sodium sulfate. Concentration of the solution under vacuum afforded 4-bromo-2,6-diisopropylaniline (6.5 g, 88% yield). LCMS (Method A): 256.1 [M+H].sup.+, retention time 2.97 min.
Step 2: Preparation of 5-bromo-2-iodo-1,3-diisopropylbenzene
(2238) ##STR00786##
(2239) 4-Bromo-2,6-diisopropylaniline (35.6 g, 138.96 mmol) was added to a suspension of p-TsOH monohydrate (118.95 g, 625.34 mmol) in a mixture of t-BuOH (500 mL) and water (30 mL). The mixture was cooled to 0° C. in an ice bath and a solution of sodium nitrite (28.76 g, 416.89 mmol) and potassium iodide (86.51 g, 521.11 mmol) in water (70 mL) was then added dropwise over 2.5 h, keeping the temperature of the mixture at 10-15° C. Following the addition, the temperature was then allowed to rise to 25° C., and the mixture was stirred for an additional 1.5 h. The reaction mixture was poured into water and extracted with Et.sub.2O. The ether layer was then washed with 10% sodium bisulfite solution to remove iodine related by-products. The organic layer was dried over MgSO.sub.4 and concentrated under reduced pressure. The residue was flushed through the silica gel plug eluting with hexane/EtOAc (100/0 to 90/10). Fractions containing the desired product were combined and concentrated under reduced pressure to afford pure 5-bromo-2-iodo-1,3-diisopropylbenzene (34.5 g, 67% yield). LCMS (Method A): 366.0 [M*], retention time 4.31 min.
Step 3: Preparation of tert-butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate
(2240) ##STR00787##
(2241) (2-(tert-butoxy)-2-oxoethyl)zinc(II) bromide solution: Under a N.sub.2 atmosphere, to a 500 mL round-bottom flask were added zinc powder (32.19 g, 492.17 mmol), dry THF (200 mL), and TMSCl (2.08 mL, 16.41 mmol). The suspension was warmed to 56° C. and stirred at this temperature for 30 min. A solution of t-butyl bromoacetate (32 g, 164.06 mmol) in THF (50 mL) was added dropwise to the suspension. After insoluble matter precipitated, the light yellow supernatant solution was decanted and used for subsequent experiment as is. tert-Butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate: Into a 5 L 3-necked round-bottom flask purged with and maintained under nitrogen, was placed 5-bromo-2-iodo-1,3-diisopropylbenzene (34.5 g, 93.99 mmol), THE (150 mL), X-phos (4.48 g, 9.4 mmol), Pd.sub.2(dba).sub.3CHCl.sub.3 (3.2 g, 4.7 mmol). The resulting solution was stirred for 0.5 h at room temperature, at which time the previously prepared solution of 2-(tert-butoxy)-2-oxoethyl)zinc(II) bromide was added. The resulting solution was stirred for 3 h at 76° C. and then quenched by the addition of 200 mL of NH.sub.4Cl (saturated). The organic layer was separated and the aqueous layer was back extracted with EtOAc (200 mL). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by percolation through silica gel, eluting with mixtures of hexane and EtOAc. The product was analyzed on HPLC and had a retention time of 4.11 min using method A. Fractions containing pure product were concentrated and used in the next step without further purification.
Step 4: Preparation of 2-(4-bromo-2,6-diisopropylphenyl) acetic acid
(2242) ##STR00788##
(2243) tert-Butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate from the previous step was dissolved in dichloromethane (60 mL) and treated with TFA (35 mL). The reaction mixture was stirred overnight at room temperature and then concentrated and partially purified by silica gel flash chromatography. The majority of the desired product eluted with 100% hexanes, but further fractions collected from 1-20% EtOAc/hexanes also contained product. Those fractions which contained product were combined, concentrated in vacuo, and then partitioned between hexane and aqueous 10% Na.sub.2CO.sub.3. The product-containing aqueous layer was washed once with hexanes and then acidified to pH-1 using 2N HCl. The product was extracted into EtOAc (150 mL×3). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated to give desired product 2-(4-bromo-2,6-diisopropylphenyl)acetic acid as white solid (7 g, 25% yield over two steps).
(2244) The product does not have discernible [M+H].sup.+ but does have a UV and ELSD signal. The retention time was 3.2 min on an LCMS run using method A. .sup.1H NMR (250 MHz, DMSO-d.sub.6): 7.26 (s, 2H), 3.68 (s, 2H), 3.08 (m, 2H), 1.13 (d, J=7.5 Hz, 12H).
Intermediates 55 and its Use in the Preparation of a Compound of Formula AA
(2245) ##STR00789##
Step 1: Preparation of 4-(bromomethyl)benzenesulfonamide
(2246) ##STR00790##
(2247) 4-(bromomethyl)benzenesulfonyl chloride (2.5 g, 9.3 mmol) was dissolved in dioxane (20 mL). To this solution was added concentrated NH.sub.4OH (5 mL). The solution was stirred at room temperature for 5 min. After the initial exotherm, the solution was poured into the water and extracted with EtOAc several times. The combined organic extracts were dried over MgSO.sub.4, filtered and concentrated under reduced pressure. The resulting sulfonamide was used without further purification. Product does not ionize on LCMS but has a UV (254 nm) signal at 2.0 min (Method A).
Step 2: Preparation of 4-((dimethylamino)methyl)benzenesulfonamide
(2248) ##STR00791##
(2249) To a solution of 4-(bromomethyl)benzenesulfonamide (2.5 g, 10 mmol) in DMSO (10 mL) was added dimethylamine hydrochloride followed by K.sub.2CO.sub.3. The reaction mixture was heated at 70° C. for 1 h. LCMS showed complete conversion of the starting material and the mixture was poured into the water and extracted with EtOAc several times. The the product in the combined organic layers was extracted with 1M HCL. The aqueous phase was washed with EtOAc and dichloromethane to remove impurities and the aqueous layer was basified with 2M NaOH and extracted with EtOAc. The solution was dried over MgSO.sub.4, filtered and concentrated under reduced pressure to afford pure 4-((dimethylamino)methyl) benzenesulfonamide as white crystals (0.800 g, 37% yield over two steps). LCMS (Method A): 215.1 [M+H].sup.+, retention time 0.86 min. H NMR (250 MHz, DMSO-d.sub.6): 7.77 (d, J=7.5 Hz, 2H), 7.46 (d, J=7.5 Hz, 2H), 3.45 (s, 2H), 2.15 (s, 6H).
Step 3: Preparation of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide
(2250) ##STR00792##
(2251) A solution of 2-(4-bromo-2,6-diisopropylphenyl)acetic acid (0.598 g, 2 mmol), 4-((dimethylamino)-methyl) benzene sulfonamide (0.643 g, 3 mmol, 1.5 eq.), 4-dimethyaminopyridine (DMAP, 0.489 g, 4 mmol, 2 equiv), and 1-[3-(dimethyamino)-propyl]-3-ethylcarbodiimide hydrochloride (EDCI, 0.767 g, 4 mmol, 2 eq.) in CH.sub.2Cl.sub.2 (15 mL) was stirred at room temperature for 1 h. After LCMS showed complete conversion of the acid, the reaction was quenched by the addition of water, and aqueous phase was extracted with DCM (3×50 mL). The combined organic layers were washed with brine and dried over MgSO.sub.4, and evaporated in vacuo to afford 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino) methyl)phenyl)-sulfonyl)acetamide (0.891 g, 90% yield) of sufficient purity to be used as a scaffold for the cross coupling reactions without further purification. An analytically pure sample was obtained when the product was purified on HPLC with TFA buffer. LCMS (Method A): 497.3, 495.3 [M+H].sup.+, retention time 2.63 min. .sup.1H NMR (250 MHz, DMSO-d.sub.6): 7.79 (d, J=7.5 Hz, 2H), 7.46 (d, J=7.5 Hz, 2H), 7.14 (s, 2H), 3.86 (s, 2H), 3.58 (s, 2H), 2.97 (m, 2H), 2.41 (s, 6H), 0.97 (d, J=7.5 Hz, 12H).
General Protocol 1: General Procedure for Suzuki Coupling of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)sulfonyl)acetamide with Boronic Acids/Esters
(2252) ##STR00793##
(2253) 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)sulfonyl)acetamide (30.0 mg, 0.06 mmol, 1 equiv), a boronic acid or ester (0.18 mmol, 3 equiv), [1,1′-Bis(diphenylphosphino)ferrocene]dichloropalladium(II) (Pd(dppf)Cl.sub.2, 22.15 mg, 0.5 equiv) and cesium carbonate (59.18 mg, 0.16 mmol, 3 equiv, 1M aqueous, 181.6 μL) were mixed with DMF (1 mL) and heated overnight at 80° C. The cooled mixture was filtered and the filtrate was purified by preparative HPLC method F. R in Scheme TT is as defined for Y—Z in Formula AA.
General Protocol 2: For Stille Coupling of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)sulfonyl)acetamide with Aryl (Heteroaryl) Tributylstannanes
(2254) ##STR00794##
(2255) An intimate mixture of palladium acetate (11 mg, 0.05 mmol) and XPhos (53 mg, 0.11 mmol) was prepared in a 4 mL vial. Cesium fluoride was added (34 mg, 0.22 mmol) and the vial was purged with dry nitrogen. The heteroaryl tributylstannane (0.406 mmol) was added followed by 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)sulfonyl)acetamide (50 mg, 0.10 mmol) suspended/dissolved in anhydrous dimethoxyethane (1.5 mL). The reaction mixture was stirred vigorously at 80° C. for 2-4 h or until LCMS analysis indicated complete reaction. The cooled reaction mixture was filtered through a pad of Celite to remove solids and the Celite was washed with methanol and the combined organic solvents were evaporated to dryness. Purification was carried out by preparative HPLC method E. Het in Scheme UU is as defined for Y—Z in Formula AA.
(2256) Examples of compounds that may be prepared in a manner analogous to Schemes UU and TT are as follows:
(2257) TABLE-US-00010 Example Retention # Compound LCMS: time (min) Structure Method Number [M + H].sup.+ Method B IUPAC NAME .sup.1H NMR Tabulation
Preparation of 2-[2,6-bis(propan-2-yl)-4-(tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide
(2258) ##STR00827##
(2259) To a solution of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide (530 mg, 1.06 mmol) in dioxane (20 mL) and NMP (2 mL) was added 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (410 mg, 1.61 mmol), Pd(dppf)Cl.sub.2.Math.DCM (86 mg, 0.106 mmol) and potassium acetate (312 mg, 3.18 mmol). The resulting mixture was stirred at 80° C. for 12 h. Reaction mixture was brought to room temperature, filtered through a pad of celite, diluted with water (50 mL) and extracted with EtOAc (3×30 mL). The combined organic layer was washed water and brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to provide titled compound (437 mg, 75%) as light buff color solid.
General Procedure for Reverse Suzuki Coupling of 2-[2,6-bis(propan-2-yl)-4-(tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide with Aryl Bromides and Heteroaryl Chlorides/Bromides
(2260) ##STR00828##
(2261) To a solution of 2-[2,6-bis(propan-2-yl)-4-(tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (0.1 mmol) in dioxane (1.5 mL) was added arylbromide or heteroaryl chloride or bromide (0.2 mmol), Pd(dppf)Cl.sub.2.Math.DCM (0.01 mmol) and 1M aqueous cesium carbonate solution (0.3 mL). The resulting mixture was stirred at 80° C. for 12 h. Reaction mixture was brought to room temperature, filtered through a pad of celite and rinsed with EtOAc (5 mL). Filtrates were concentrated in vacuo and purified by prep-HPLC to obtain desired product.
General Procedure for Sonogashira Coupling of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)sulfonyl)acetamide with Alkynes
(2262) ##STR00829##
(2263) To a solution of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide (0.2 mmol) in dioxane (0.8 mL) was added alkyne (0.4 mol), Pd(dppf)Cl.sub.2.Math.DCM (0.02 mmol), CuI (0.02 mmol) and triethylamine (0.6 mmol) at room temperature. The resulting mixture was then stirred at 90° C. for 48 h. Reaction mixture was brought to room temperature, filtered through a pad of celite and rinsed with EtOAc (5 mL). Filtrates were concentrated in vacuo and purified by prep-HPLC to obtain desired product.
General Procedure for the Hydrogenation of Unsaturated Compounds
(2264) ##STR00830##
Hydrogenation Method A
(2265) To a solution of unsaturated starting material (0.1 mmol) in MeOH (15 mL) was added 10 weight % Pd/C (10% w/w), trifluoroacetic acid (0.5 mL) and the resulting mixture was hydrogenated at 45 psi for 12 h. Reaction mixture was filtered through a pad of celite, filtrates were concentrated and purified by prep-HPLC.
Hydrogenation Method B
(2266) To a solution of unsaturated starting material (crude obtained either from Suzuki or Sonogashira coupling at 0.1 mmol scale) in ethyl acetate (15 mL) was added Pd(OH).sub.2 (22 mg) and trifluoroacetic acid (0.2 mL) and the resulting mixture was hydrogenated at 45 psi for 12 h. Reaction mixture was filtered through a pad of celite, filtrates were concentrated and purified by prep-HPLC.
General Procedure for the De-protection of tert-Butyloxycarbonyl (Boc) Group
(2267) 25% TFA/DCM solution (1.3 mL) was added to Boc-protected amine (0.065 mmol) at 0° C. The resulting solution was then warmed up to room temperature and stirred until the completion of reaction. Reaction mixture was concentrated in vacuo and purified by prep-HPLC.
(2268) Examples of compounds that may be prepared in a manner analogous to Schemes VV, WW, XX and/or YY are as follows:
(2269) TABLE-US-00011 Example Retention # Compound LCMS: time (min) Structure Method # [M + H].sup.+ Method B IUPAC NAME
Example #137: Preparation of N-{4-[(dimethylamino)methyl]benzenesulfonyl}-2-(4-[hydroxy(phenyl)methyl]-2,6-bis(propan-2-yl)phenyl)acetamide (Compound 372)
(2270) ##STR00902##
(2271) To a solution of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide (83 mg, 0.167 mmol) (83 mg, 0.167 mmol) in anhydrous THF (3.8 mL) was added NaH (6.7 mg, 0.167 mmol, 60% dispersed in oil) under nitrogen at −78° C. t-BuLi (0.107 mL, 0.182 mmol, 1.7M in pentane) was added slowly and after 3 min benzaldehyde (0.12 mL) was added quickly. Reaction mixture was further stirred at −78° C. for 5 min before quenching with water. Reaction mixture froze. Dry ice/acetone cooling bath was removed. The reaction mixture was gradually warmed up to room temperature and extracted with EtOAc (3×5 mL). Combined organic layer was concentrated in vacuo to obtain crude material which was purified by prep-HPLC to obtain titled compound (10 mg, 11%). LCMS (Method A): 523.32 [M+H].sup.+, retention time 2.19 min.
Example #138: Preparation of 2-[4-benzoyl-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (Compound 373)
(2272) ##STR00903##
(2273) To the crude material of N-{4-[(dimethylamino)methyl]benzenesulfonyl}-2-{4-[hydroxy(phenyl)methyl]-2,6-bis(propan-2-yl)phenyl}acetamide obtained from 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide (83 mg, 0.167 mmol) as described in example 137, in DCM (4 mL) was added Dess-Martin reagent (140 mg, 0.33 mmol) portion wise over 1.5 h at room temperature. 10% aqueous Na.sub.2S.sub.2O.sub.3 solution (1 mL), water (3 mL) and EtOAc (4 mL) was added. A sticky solid appeared which was collected and purified by prep-HPLC to give titled compound (9 mg, 10%). LCMS (Method A): 521.22 [M+H].sup.+, retention time 2.37 min.
Example #139: Preparation of N-cyclohexyl-4-[({4-[(dimethylamino)methyl]benzene-sulfonyl}carbamoyl)methyl]-3,5-bis(propan-2-yl)benzamide (Compound 374)
(2274) ##STR00904##
Step 1: Preparation of methyl 4-[({4-[(dimethylamino)methyl]benzenesulfonyl}-carbamoyl)methyl]-3,5-bis(propan-2-yl)benzoate
(2275) To a solution of 2-(4-bromo-2,6-diisopropylphenyl)-N-((4-((dimethylamino)methyl)phenyl)-sulfonyl)acetamide (200 mg, 0.404 mmol) in MeOH (35 mL) was added Pd(dppf)Cl.sub.2.Math.DCM (29 mg, 0.035 mmol) and triethylamine (0.169 mL, 1.21 mmol). The resulting mixture was autoclaved under CO (250 psi) at 90° C. for 72 h. Reaction mixture was filtered through a pad of celite, rinsed with MeOH and concentrated to give titled compound (158 mg, 83%) which was used in the next step without any further purification.
Step 2: Preparation of 4-[({4-[(dimethylamino)methyl]benzenesulfonyl}carbamoyl)methyl]-3,5-bis(propan-2-yl)benzoic acid
(2276) To a solution of methyl 4-[({4-[(dimethylamino)methyl]benzenesulfonyl}carbamoyl)methyl]-3,5-bis(propan-2-yl)benzoate (158 mg, 0.332 mmol) in a 1:1 mixture of THE and MeOH (3 mL) was added LiOH (10 mg, 0.39 mmol) and the resulting mixture was heated at 50° C. for 2 h. Reaction mixture was brought to room temperature and basified with aqueous 1 N NaOH solution. The resulting precipitates were filtered and dried under high vacuum to give titled compound (113 mg, 74%).
Step 3: Preparation of N-cyclohexyl-4-[({4-[(dimethylamino)methyl]benzene-sulfonyl}-carbamoyl)methyl]-3,5-bis(propan-2-yl)benzamide (Compound 374)
(2277) A solution of 4-[({4-[(dimethylamino)methyl]benzenesulfonyl}carbamoyl)methyl]-3,5-bis(propan-2-yl)benzoic acid (46 mg, 0.1 mmol), cyclohexylamine (0.034 mL, 0.3 mmol), DIEA (0.068 mL, 0.4 mmol) and HATU (45 mg, 0.12 mmol) in DMF (0.5 mL) was stirred at room temperature for 1 h. Subsequently the reaction mixture was directly purified using prep-HPLC to obtain titled compound (19 mg, 35%). LCMS (Method A): 542.53 [M+H].sup.+, retention time 1.96 min.
Example #140: Preparation of N-{4-[(dimethylamino)methyl]benzenesulfonyl}-2-[4-(piperidine-1-carbonyl)-2,6-bis(propan-2-yl)phenyl]acetamide (Compound 375)
(2278) ##STR00905##
(2279) Using the same method as described above in Step 3 of example 139, by replacing cyclohexylamine with piperidine (0.029 mL, 0.3 mmol), the titled compound was obtained (19 mg, 37%). LCMS (Method A): 528.42 [M+H].sup.+, retention time 1.83 min.
Example #141: Preparation of 2-[4-cyclopropyl-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (Compound 376)
(2280) ##STR00906##
Step 1: Preparation of 2-(4-cyclopropyl-2,6-diisopropylphenyl)acetic acid
(2281) In the 20 mL vial were placed 2-(4-bromo-2,6-diisopropylphenyl) acetic acid (20 mg, 0.067 mmol), tricyclohexylphosphine tetrafluoroborate (25 mg, 0.067 mmol), Pd(OAc).sub.2 (7.5 mg, 0.033 mmol) K.sub.3PO.sub.4, (42 mg, 0.20 mmol) and cyclopropylboronic acid (17.2 mg, 0.020 mmol). A solution of toluene (3 mL) and water (0.3 mL) was added and the resulting mixture was stirred at 115° C. for 2 h. Reaction mixture was brought to room temperature and filtered through a pad of celite. Filtrate was concentrated in vacuo to afford crude titled compound which was directly used in the next without any purification.
Step 2: Preparation of 2-[4-cyclopropyl-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)-methyl]benzenesulfonyl}acetamide
(2282) A solution of 2-(4-cyclopropyl-2,6-diisopropylphenyl)acetic acid (crude from step 1), 4-((dimethylamino)methyl) benzene sulfonamide (120 mg, 0.56 mmol), 4-dimethyaminopyridine (DMAP, 137 mg, 1.12 mmol), and 1-[3-(dimethyamino)-propyl]-3-ethylcarbodiimide hydrochloride (EDCI, 214.7 mg, 1.12 mmol) in CH.sub.2Cl.sub.2 (10 mL) was stirred at room temperature for 1 h. Reaction mixture was then concentrated under reduced pressure and purified by prep-HPLC to obtain titled compound (4.7 mg, 16% over two steps). LCMS (Method A): 457.58 [M+H].sup.+, retention time 2.13 min.
Example #142 and 143: Preparation of 2-[4-(cyclohex-1-en-1-ylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (Compound 377) and 2-[4-(cyclohexylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (Example 378)
(2283) ##STR00907##
Step 1: Preparation of a mixture of 2-(4-(cyclohexenylmethyl)-2,6-diisopropylphenyl)acetic acid and 2-(4-(cyclohexylmethyl)-2,6-diisopropylphenyl)acetic acid
(2284) In the 20 mL vial were placed 2-(4-bromo-2,6-diisopropylphenyl) acetic acid (20 mg, 0.067 mmol), tricyclohexylphosphine tetrafluoroborate (25 mg, 0.067 mmol), Pd(OAc).sub.2 (7.5 mg, 0.033 mmol) K.sub.3PO.sub.4, (42 mg, 0.20 mmol) and cyclohexylmethylboronic acid (28.5 mg, 0.20 mmol). A solution of toluene (3 mL) and water (0.3 mL) was added and the resulting mixture was stirred at 115° C. for 2 h. Reaction mixture was brought to room temperature and filtered through a pad of celite. Filtrate was concentrated in vacuo to afford crude titled compounds which were directly used in the next without any purification.
Step 2: Preparation of 2-[4-(cyclohex-1-en-1-ylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide and 2-[4-(cyclohexylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide
(2285) A solution of 2-(4-(cyclohexenylmethyl)-2,6-diisopropylphenyl)acetic acid and 2-(4-(cyclohexylmethyl)-2,6-diisopropylphenyl)acetic acid (crude from step 1), 4-((dimethylamino)methyl) benzene sulfonamide (200 mg, 0.93 mmol), 4-dimethyaminopyridine (DMAP, 228 mg, 1.86 mmol), and 1-[3-(dimethyamino)-propyl]-3-ethylcarbodiimide hydrochloride (EDCI, 358 mg, 1.86 mmol) in CH.sub.2Cl.sub.2 (10 mL) was stirred at room temperature for 1 h. Reaction mixture was then concentrated under reduced pressure and purified by prep-HPLC to obtain titled compound 2-[4-(cyclohex-1-en-1-ylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}acetamide (6.1 mg, 18% over two steps), LCMS (Method A): 511.61 [M+H].sup.+, retention time 2.57 min and 2-[4-(cyclohexylmethyl)-2,6-bis(propan-2-yl)phenyl]-N-{4-[(dimethylamino)methyl]benzenesulfonyl}-acetamide (3.4 mg, 10% over two steps), LCMS (Method A): 513.41 [M+H].sup.+, retention time 2.69 min.
PROPHETIC EXAMPLES
(2286) The following schemes depict synthetic sequences that can be used to prepare a variety of sulfonamide intermediates. The sulfonamide intermediates may be coupled, according to any one of schemes A-E above, to carboxylic acids (such as the carboxylic acids prepared according to schemes MM-RR or schemes EEE-FFF) to form a variety of N-acyl sulfonamides which can, optionally, be functionalized using conditions described in Schemes TT-YY and AAA-DDD.
Intermediate 56
(2287) ##STR00908##
(2288) Referring to Scheme GGG, Intermediate 56 is prepared from compound 1-9. Pyrazolone 1-9 is reacted with 1,3-dibromopropane (e.g., using potassium carbonate as a base at elevated temperatures (e.g., 130° C.)) to provide compound 1-10. Bromination of 1-10 (e.g., using NBS) allows the formation of compound 1-11. Treatment of 1-11 with n-BuLi leads to lithium-halogen exchange. The resulting organolithium species is contacted with ZnCl.sub.2, whereupon treatment of the intermediate with TCPC leads to compound 1-12. Intermediate 56 is obtained by reacting 1-12 with aqueous ammonia.
Intermediate 57
(2289) ##STR00909##
(2290) Referring to Scheme HHH, pyrazolone 1-9 is reacted with 2-((1,3-dibromopropan-2-yl)oxy)tetrahydro-2H-pyran to produce compound 1-13 which is brominated (e.g., with NBS) to provide compound 1-14. Sequential treatment of compound 1-14 with n-butyl lithium, zinc chloride, and TCPC affords compound 1-15. The reaction between 1-15 and aqueous ammonia then provides 1-16. The THP protecting group in 1-16 is removed with HCl, affording Intermediate 57.
Intermediate 58
(2291) ##STR00910##
(2292) Referring to Scheme III, compound 1-14 is exposed to concentrated HCl which leads to the removal of the TIP protecting group, resulting in 1-17. Compound 1-17 is methylated (e.g., with NaH and MeI) to provide compound 1-18. Sequential treatment of 1-18 with n-butyl lithium, zinc chloride, and TCPC provides compound 1-19 which is reacted with aqueous ammonia to provide Intermediate 58.
Intermediate 59
(2293) ##STR00911##
(2294) Referring to Scheme JJJ, pyrazolone 1-9 is acetylated (e.g., with acetic anhydride and pyridine at elevated temperatures) to provide compound 1-20. The non-acylated nitrogen of 1-20 can engage (R)-oxiran-2-ylmethanol in a Mitsunobu reaction (e.g., with DEAD, PPh.sub.3) to afford compound 1-21. The epoxide moiety in 1-21 is opened with a chloride nucleophile (e.g., LiCl), leading to the formation of 1-22. Removal of the acetyl protecting group (e.g, with aqueous potassium carbonate) allows the formation of 1-23, which is brominated (e.g., with NBS) to provide compound 1-24. Compound 1-24 is methylated (e.g., with MeI and NaH) to provide compound 1-25. Sequential treatment of 1-25 with n-butyl lithium, zinc chloride, TCPC, and ammonium hydroxide provides Intermediate 59. The (S)-enantiomer of Intermediate 59 can be prepared in an analogous fashion using (S)-oxiran-2-ylmethanol in the reaction with 1-20.
Intermediate 60
(2295) ##STR00912##
(2296) Referring to Scheme KKK, cyclopropane-1,1-diyldimethanol is mesylated (e.g., with MsCl and TEA). Treatment of the ensuing mesylate with pyrazolone 1-9 affords compound 1-26 (e.g., using potassium carbonate as the base and DMF as the solvent). Compound 1-26 is brominated (e.g., with NBS) to afford 1-27 which is reacted sequentially with n-butyl lithium, zinc chloride, and TCPC to furnish compound 1-28. Intermediate 60 is obtained by reacting compound 1-28 with aqueous ammonia.
Intermediate 61
(2297) ##STR00913##
(2298) Referring to Scheme LLL, the amino group in diol 1-29 is protected with Boc.sub.2O to provide compound 1-30 which is mesylated (e.g., with MsCl and TEA) to afford compound 1-31. Compound 1-31 is subjected to a double nucleophilic substitution with pyrazolone 1-9, providing 1-32, which is brominated (e.g., with NBS) to afford compound 1-33. Sequential treatment of 1-33 with n-butyl lithium, zinc chloride, and TCPC provides compound 1-34. Intermediate 61 is obtained when 1-34 is reacted with aqueous ammonia.
Intermediate 62
(2299) ##STR00914##
(2300) Referring to Scheme MMM, bis-chloride 1-35 is reacted with pyrazolone 1-9 to yield compound 1-36. Hydroboration-oxidation of 1-36 provides compound 1-37, whereupon the primary alcohol is converted into an azido group (e.g., with DPPA and DBU). The azide moiety in the resulting 1-38 is then reduced (e.g., with Pd/C, H.sub.2); and the ensuing amino group is protected with Boc.sub.2O to afford 1-39. Compound 1-39 is brominated to provide 1-40. Sequential treatment of 1-40 with n-butyl lithium, zinc chloride, and TCPC affords compound 1-41. Intermediate 62 is obtained by treating 1-41 with aqueous ammonia.
Intermediate 63, 63a and 63b
(2301) ##STR00915##
(2302) Referring to Scheme NNN, compound 1-17 is ethylated (e.g., with ethyl iodide) to provide 1-42. Sequential treatment of 1-42 with n-butyl lithium, zinc chloride, and TCPC affords 1-43 which is reacted with aqueous ammonia to provide Intermediate 63. Chiral resolution of Intermediate 63 affords Intermediate 63a and 63b.
Intermediate 64
(2303) ##STR00916## ##STR00917##
(2304) Referring to Scheme OOO, compound 1-44 is reacted with sulfonyl azide 1-49 (in a Regitz-type diazo transfer) to provide compound 1-45. Compound 1-45 is subjected to Rh.sub.2(OAc).sub.4 and i-PrI to afford compound 1-46. The ester groups in 1-46 is reduced (e.g., with lithium borohydride) to afford diol compound 1-47 which is mesylated (e.g., with MsCl) to provide compound 48. Compound 48 is reacted with pyrazolone 1-9 to furnish 1-49, whereupon bromination of the pyrazole ring affords 1-50. Sequential treatment of 1-50 with n-butyl lithium, zinc chloride, TCPC, and aqueous ammonia provide Intermediate 64.
Intermediate 65
(2305) ##STR00918##
(2306) Referring to Scheme PPP, aminodiol 1-29 is converted into 1-30 upon treatment with Boc.sub.2O. Compound 1-30 is mesylated (e.g., with MsCl) to provide 1-31. Reaction of 1-31 with 1-9 provides 1-32, whereupon bromination of 1-32 affords 1-33. The carbamate nitrogen of 1-33 is then methylated (e.g., with MeI and NaH) to provide 1-51. Sequential treatment of 1-51 with n-butyl lithium, zinc chloride, and TCPC provides 1-52, whereupon treatment with aqueous ammonia provide Intermediate 65.
Intermediate 66, 66a and 66b
(2307) ##STR00919##
(2308) Referring to Scheme QQQ, diester compound 1-53 is reduced to give rise to diol 1-54 which is mesylated (e.g., with MsCl) to provide 1-55. Treatment of 1-55 with pyrazolone 1-9 affords bicyclic compound 1-56. Exposure of 1-56 to ClSO.sub.3H (e.g., at elevated temperatures) provides 1-57, whereupon treatment with aqueous ammonia affords Intermediate 66. Chiral separation of Intermediate 66 affords Intermediate 66a and 66b.
Intermediate 67
(2309) ##STR00920##
(2310) Referring to Scheme RRR, compound 1-58 is treated sequentially with n-butyl lithium, zinc chloride, and TCPC to provide compound 1-59. Reaction of 1-59 with dibenzylamine provides 1-60. The THP group in 1-60 is removed (e.g., with concentrated HCl) to afford compound 1-61. The secondary alcohol in 1-61 is oxidized to a ketone (e.g., with Dess-Martin's reagent). The resulting 1-62 is subjected to a reductive amination with 3-fluoroazetidine to provide 1-63, whereupon removal of the benzyl protecting groups affords Intermediate 67.
Intermediate 68
(2311) ##STR00921##
(2312) Referring to Scheme SSS, compound 1-62 is subjected to a reductive amination with 3-hydroxyazetidine to provide compound 1-64 which is then methylated (e.g., with MeI) to afford 1-65. Removal of the benzyl protecting groups on 1-65 affords Intermediate 68.
(2313) The Following Protocols are Suitable for Testing the Activity of the Compounds Disclosed Herein.
(2314) IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin.
(2315) THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Prior to experiments, cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment THP-1 were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in a 384-well plate at a density of 50,000 cells/well (final assay volume 50 μl). Compounds were dissolved in dimethyl sulfoxide (DMSO) and added to the culture medium to achieve desired concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Cell free supernatant was collected and the production of IL-1β was evaluated by HTRF (cisbio). A vehicle only control was run concurrently with each experiment. Final DMSO concentration was 0.38%. Compounds exhibited a concentration-dependent inhibition of IL-1p production in PMA-differentiated THP-1 cells.
(2316) IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin.
(2317) THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Prior to experiments, cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment THP-1 were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. Compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in a 384-well plate at a density of 50,000 cells/well (final assay volume 50 μl). Compounds were first dissolved in assay medium to obtain a 5× top concentration of 500 μM. 10 step dilutions (1:3) were then undertaken in assay medium containing 1.67% DMSO. 5× compound solutions were added to the culture medium to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). Final DMSO concentration was at 0.37%. Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1p was evaluated by HTRF (cisbio). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1p production in PMA-differentiated THP-1 cells.
(2318) IL-1p Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin.
(2319) THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment, compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. The compound stock was first pre-diluted in DMSO to 3, 0.34, 0.042 and 0.0083 mM intermediate concentrations and subsequently spotted using Echo550 liquid handler into an empty 384-well assay plate to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). DMSO was backfilled in the plate to achieve a final DMSO assay concentration of 0.37%. The plate was then sealed and stored at room temperature until required.
(2320) THP-1 cells were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, and resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in the 384-well assay plate containing the spotted compounds at a density of 50,000 cells/well (final assay volume 50 μl). Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1β was evaluated by HTRF (cisbio). The plates were incubated for 18 h at 4° C. and read using the preset HTRF program (donor emission at 620 nm, acceptor emission at 668 nm) of the SpectraMax i3x spectrophotometer (Molecular Devices, software SoftMax 6). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1p production in PMA-differentiated THP-1 cells.
(2321) TABLE-US-00012 TABLE 6 Average IC.sub.50 of compounds in hTHP-1 assay NLRP3 Antagonist, human THP1 NLRP3, IL-1b, Compound Normalized: GeoMean IC50 Number (uM) 101 +++ 102 + 106 >30.0000 107 ++ 107 ++ 108 +++ 109 ++ 110 ++ 111 ++ 112 +++ 113 +++ 114 ++ 115 + 116 ++ 117 +++ 118 +++ 119 +++ 120 ++ 121 ++ 122 >30.0000 124 + 125 + 137 ++++ 139 ++++ 145 ++ 146 +++ 147 ++ 147 ++ 148 ++ 149 ++ 313 ++ 314 ++ 315 >30.0000 316 ++ 321 ++ 322 +++ 323 ++ 324 ++++ 325 ++ 355 + 370 ++++ 372 >30.0000 373 >30.0000 377 ++ 378 + 379 ++ Table 6 shows the biological activity of compounds in hTHP-1 assay containing 2% fetal bovine serum: <0.008 μM = “++++++”; ≥0.008 and <0.04 μM = “+++++”; ≥0.04 and <0.2 μM = “++++”; ≥0.2 and <1 μM = “+++”; ≥1 and <5 μM = “++”; ≥5 and <30 μM = “+”.
(2322) A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.