TARGETING RNA VIRUSES USING INHIBITORS OF METTL3
20220125768 · 2022-04-28
Inventors
Cpc classification
A61K31/437
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
A61K31/437
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided are methods for prophylaxis or therapy for an RNA virus infection. The methods involve modulating the Type I interferon pathway in RNA virus infected cells of an individual. The Type I interferon pathway is modulated by administering one or more agents to virus infected cells that inhibit the expression and/or function of METTL3 or inhibit expression and/or function of YTHDF1, YTHDF2 or YTHDF3.
Claims
1. A method for prophylaxis or therapy for an RNA virus infection, the method comprising modulating the Type I interferon pathway in RNA virus infected cells of the individual by administering one or more agents to the individual that inhibit the expression and/or function of METTL3 or inhibit expression or function of YTHDF1, YTHDF2 or YTHDF3.
2. The method of claim 1, wherein said agents are selected from an RNAi agent and a small drug molecule.
3. The method of claim 2, wherein the small drug molecule is administered, and wherein the small drug molecule is: ##STR00003## or a combination thereof.
4. The method of claim 1, wherein the individual is infected with a coronavirus.
5. The method of claim 2, wherein the individual is infected with a coronavirus.
6. The method of claim 3, wherein the individual is infected with a coronavirus.
7. The method of claim 4, wherein the coronavirus is SARS-CoV-2.
8. The method of claim 5, wherein the coronavirus is SARS-CoV-2.
9. The method of claim 6, wherein the coronavirus is SARS-CoV-2.
10. The method of claim 1, wherein the individual is a human.
11. The method of claim 10, wherein the human has been diagnosed with or is suspected of having COVID-19.
12. The method of claim 1, wherein administering said one or more agents inhibits or prevents transmission of the RNA virus to an individual who is not infected with the RNA virus.
13. The method of claim 10, wherein administering said one or more agents inhibits or prevents transmission of the RNA virus to an individual who is not infected with the RNA virus.
14. A method comprising delivering to RNA virus infected cells one or more agents more that inhibit the expression and/or function of METTL3.
15. The method of claim 14, wherein the RNA virus is a coronavirus.
16. The method of claim 15, wherein the coronavirus is SARS-CoV-2.
17. The method of claim 15, wherein said agents are selected from an RNAi agent and a small drug molecule.
18. The method of claim 17, wherein the small drug molecule is: ##STR00004##
19. The method of claim 14, wherein said one or more agents inhibits at least one of RNA virus gene expression, RNA virus replication, or RNA virus packaging in the RNA virus infected cells.
20. The method of claim 19, wherein said one or more agents comprise at least one the M3i of the M3i2.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0007] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
DETAILED DESCRIPTION
[0019] Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0020] Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.
[0021] Any sequence or compound associated with a database entry reference described herein is incorporated herein as it exists on the effective filing date of this application or patent.
[0022] The disclosure includes all polynucleotide and amino acid sequences described herein expressly and by reference, and every polynucleotide sequence referred to herein includes its complementary sequence, and its reverse complement. The disclosure includes all polynucleotide and protein sequences described herein expressly or by reference that are between 80.0% and 99.9% identical to the described sequences. Such changes can comprise conservative or non-conservative amino acid substitutions, insertions, and deletions, polymorphisms, and the like. Any one or combination of components can be omitted from the claims, including any polynucleotide sequence, any amino acid sequence, any composition of matter, and any one or combination of steps.
[0023] Data presented in this disclosure demonstrate that components of the cellular m.sup.6A pathway are important for coronavirus replication. Specifically, the data demonstrate that i) targeting METTL3 with a chemical inhibitor and RNAi-based approaches interferes with coronavirus replication; ii) inhibiting METTL3 activity, the primary host enzyme responsible for m.sup.6A installation onto RNA, and inhibiting one or more of YTHDF1, YTHDF2 or YTHDF3, reduces coronavirus replication; and ii) interfering with host m.sup.6A recognition functions reduces coronavirus gene expression and replication. Thus, the disclosure includes inhibiting the expression and/or function of METTL3 and/or the described YTHDF genes in cells infected with a coronavirus, which is expected to extend to any RNA virus. Accordingly, in embodiments and as described further below, the disclosure includes inhibiting the expression and/or function of METTL3 and/or the at least one of the described YTHDF proteins as an approach to prophylaxis and/or therapy of RNA viral infections. In embodiments, inhibiting the expression of METTL3 and/or the described YTHDF proteins is achieved using an RNA interference (RNAi)-mediated approach. In this regard, in non-limiting embodiments, RNAi-mediated silencing and/or reducing mRNA encoding METTL3 and/or mRNA encoding at least one of YTHDF1, YTHDF2 or YTHDF3 is performed. In embodiments, this is achieved by delivery of any suitable RNAi agent. In embodiments, an siRNA-based approach is used. This can be performed by introducing and/or expressing one or more suitable short hairpin RNAs (shRNA) in the cells, shRNA is an RNA molecule that contains a sense strand, antisense strand, and a short loop sequence between the sense and antisense fragments. shRNA is exported into the cytoplasm where it is processed by dicer into short interfering RNA (siRNA). siRNA are 21-23 nucleotide double-stranded RNA molecules that are recognized by the RNA-induced silencing complex (RISC). Once incorporated into RISC, siRNA facilitate cleavage and degradation of targeted mRNA. Thus, for use in RNAi mediated silencing or downregulation of METTL3 expression as described herein, siRNA, shRNA, or miRNA can be used. In alternative embodiments, a functional RNA, such as a ribozyme is used. In embodiments, the ribozyme comprises a hammerhead ribozyme, a hairpin ribozyme, or a Hepatitis Delta Virus ribozyme. In related embodiments, a microRNA (miRNA) adapted to target the relevant mRNA can be used. In embodiments, the RNAi agent may be modified to improve its efficacy, such as by being resistant to nuclease digestion. In embodiments, the RNAi agent polynucleotides which comprise modified ribonucleotides or deoxyribonucleotide, and thus include RNA/DNA hybrids. In non-limiting examples, modified ribonucleotides may comprise methylations and/or substitutions of the 2′ position of the ribose moiety with an —O— alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an —O-aryl group having 3-6 carbon atoms, wherein such alkyl or aryl group may be unsubstituted or may be substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl, or amino groups; or with a hydroxy, an amino or a halo group. In embodiments modified nucleotides comprise methyl-cytidine and/or pseudo-uridine. The nucleotides may be linked by phosphodiester linkages or by a synthetic linkage, i.e., a linkage other than a phosphodiester linkage. Examples of inter-nucleoside linkages in the polynucleotide agents that can be used in the disclosure include, but are not limited to, phosphodiester, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, morpholino, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof.
[0024] In embodiments, and as described above, an agent that inhibits the expression and/or function of METTL3 may be used, and may be used alone or without compounds that inhibit the function of METTL3. Examples of such agents and approaches are described in PCT/US19/42784, published as WO 2020/023360, from which the description of METTL3, and inhibitors and inhibition of METTL3, is incorporated herein by reference. Representative and non-limiting embodiments of RNAi agents that target METTL3, as well as YTHDF1, YTHDF2 and YTHDF3 are described below.
[0025] In embodiments, the disclosure provides for inhibiting the function of METTL3 in RNA virus infected cells using one or more compounds, examples of which are described below. Combinations of RNAi agents and the described compounds are included in the approaches described herein. In embodiments, the compound is any small drug molecule that can inhibit the function of METTL3. A small drug molecule is generally a low molecular weight (e.g., less than 900 Daltons) organic compound that can affect the function of METTL3. The amino acid sequence and the DNA and RNA sequence encoding METTL3 are known in the art (NCBI Reference Sequence NM_019852.5).
[0026] In more detail, the present disclosure reveals a previously unexplored aspect of how coronavirus gene expression and replication are regulated post-transcriptionally. Significantly, both coronavirus gene expression (Huang et al., 2011; Lokugamage et al 2012, 2015) and anti-viral host responses (Rubio et al, 2018; Winkler et al, 2019) are both controlled by numerous post-transcriptionally regulatory mechanisms. In particular, it is known that RNA chemical modification can regulate virus gene expression, the reproduction of both DNA and RNA viruses and anti-viral host responses (Rubio et al, 2018; Winkler et al., 2019). However, how or if RNA chemical modification by N.sup.6-adenosine methylation impacts reproduction of coronaviruses, including the recently emerged SARS-CoV-2 pandemic strain, is unknown and has not been previously described. Thus, without intending to be bound by any particular theory, it is considered that the present disclosure facilitates understanding how coronavirus gene expression is regulated by mRNA epitranscriptomic changes, and reveals new opportunities to interfere with coronavirus infection and provides new strategies for vaccine design and development and anti-viral drug discovery. In connection with this, differential chemical modification of mRNA imposes epitranscriptomic changes that dynamically alter gene expression. Among the numerous RNA chemical modifications, methylation of adenosine at the N.sup.6 position (m.sup.6A) constitutes the most widespread internal base modification to mRNA (Yue et al., 2015; Roundtree et al., 2017). RNA modification by m.sup.6A provides a powerful approach to influence developmental processes, disease pathogenesis, differentiation and reprogramming, circadian rhythm, cell cycle, and stress responses including virus infection (Fustin et al, 2013; Aguilo et al, 2015; Mer et al, 2015; Zhou et al, 2015; Wojtas et al, 2017; Vu et al, 2017; Wen et al, 2018) Virus-encoded mRNAs are also chemically modified by m.sup.6A, and a role for m.sup.6A in infection biology is emerging (Williams et al, 2019). Moreover, it has been shown that host mRNAs, including those encoding powerful innate immune regulators like interferon beta (IFNB1) that orchestrate anti-viral responses, are also regulated by m.sup.6A modification and can regulate both RNA virus and DNA virus infection (Rubio et al, 2018; and PCT/US19/42784, published as WO 2020/023360). In this regard, epitranscriptomic m.sup.6A marks are installed on nascent mRNA cotranscriptionally by a methyltransferase writer core complex composed of the METTL3 catalytic subunit, METTL14, and WTAP (Liu et al., 2014) (
[0027] Thus, in certain embodiments, the present disclosure provides for a previously unexplored approach whereby reproduction of RNA viruses, including coronaviruses, further including but not necessarily limited to the pandemic SARS-CoV-2, is controlled epitranscriptomically by the host machinery that installs, removes and recognizes m.sup.6A. Accordingly, in certain approaches, the disclosure provides for a method of modulating the type I interferon (IFN) pathway, such as by modulating interferon beta (IFNB1), in an individual in need thereof by administering to the individual one or more described agents that inhibits the expression and/or function of the METTL3. In embodiments, the administration results in increased IFN cytokine production and/or increased IFN mRNA in cells of the individual, to thereby provide an anti-viral effect. In embodiments, the disclosure provides a method of inhibiting the METTL3 methyltransferase in an individual to inhibit RNA virus replication, RNA virus gene expression, and/or packaging of viral RNA into a virion.
[0028] In embodiments, a composition comprising a one or more compounds described below is administered to an individual in need thereof. Compounds of this disclosure are as shown in the following structures:
##STR00002##
[0029] The compound referred to as M3c is a control compound that has does not inhibit the function of METTL3. In embodiments, a composition comprising a compound of this disclosure is administered to an individual that has been diagnosed with, is suspected of having, or is susceptible to infection by an RNA virus. The described compounds and their uses include salts, partial salts, hydrates, stereoisomers, and mixtures thereof.
[0030] In embodiments, the individual may be infected with any virus that has an RNA genome. In embodiments, the RNA virus is a single or double stranded RNA virus. In embodiments, the RNA virus has a negative-sense, positive-sense, or ambisense RNA genome. In embodiments, the RNA virus has an intact single stranded genome, or a segmented RNA genome. In embodiments, the RNA virus is selected from Dengue Virus, Zika virus, Hepatitis C Virus, Hepatitis E virus, West Nile Virus, Ebola Virus, Rabies Virus, Polio Virus, Measles Virus, and any member of the virus family Coronaviridae, including but not necessarily limited to RNA viruses that cause any of severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (HERS), coronavirus disease 19 (COVID-19) as caused by SARS-CoV-2, or feline Coronavirus (FCoV) that can lead to the development of feline infectious peritonitis (FIP).
[0031] In embodiments, the composition is administered to an individual who is at risk for contracting a SARS-CoV-2 infection, and thus may be administered prophylactically. In embodiments, a composition of the disclosure is administered to an individual who is infected with SARS-CoV-2, or is suspected of having a SARS-CoV-2 infection. In either case, the individual may be in need of prophylaxis or treatment of an infection caused by any SARS-CoV-2 variant, including but not necessarily limited to variants currently referred to as variants of interest, variants of concern, and variants of high consequence. In embodiments, the SARS-CoV-2 variants include a spike mutation that is an L452R or E484K spike protein amino acid substitution. In embodiments, the described variant is currently referred to as B.1.1.7, B.1.351, P.1, P.2., B.1.427, B.1.429, B.1.526.1, or B.1.617.2, the latter currently referred to as the delta variant.
[0032] In embodiments, a composition of this disclosure is administered to an individual who has been diagnosed with COVID-19. In embodiments, the individual is a human and is of an age wherein risk of developing and/or experiencing adverse outcomes due to having COVID-19 is heightened, such as any individual over the age of 50 years. In embodiments, the individual has an underlying condition wherein the risk of developing severe symptoms of a Coronavirus infection, such as COVID-19, is increased, including but not necessarily limited to any respiratory condition. In embodiments, the individual is a non-human mammal that is infected with a coronavirus, such as a feline mammal, but administering the compositions to any other non-human mammals that are infected, susceptible or may become susceptible to coronavirus infections are included in the disclosure.
[0033] In embodiments, an effective amount of a composition is administered to an individual. An effective amount means an amount of the described compound(s) that will elicit the biological or medical response by a subject that is being sought by a medical doctor or other clinician. In embodiments, an effective amount means an amount sufficient to prevent, or reduce by at least about 30 percent, or by at least 50 percent, or by at least 90 percent, any sign or symptom of viral infection. In embodiments, fever is prevented or is less severe than if the presently described compound(s) had not been administered to an infected individual. In embodiments, viral pneumonia is inhibited or prevented in an infected individual. In embodiments, transmission of the virus from an infected individual to a non-infected individual is inhibited or prevented. In embodiments, a compound of this disclosure is used in a concentration of at least 10 uM.
[0034] In embodiments, the described compound(s) are provided in the form of a pharmaceutical formulation. A pharmaceutical formulation can be prepared by mixing the compound(s) with any suitable pharmaceutical additive, buffer, and the like. Examples of pharmaceutically acceptable carriers, excipients and stabilizers can be found, for example, in Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins, the disclosure of which is incorporated herein by reference.
[0035] Administration of pharmaceutical formulations comprising the described compound(s) of this disclosure can be performed using any suitable route of administration, including but not limited to parenteral, intraperitoneal, and oral administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. The compositions can be administered to humans, and as described above, are also suitable for use in a veterinary context. In embodiments, a single administration is administered and is sufficient for a therapeutic response. In embodiments, more than one administration is provided.
[0036] In embodiments, administration of the described compound(s) can be combined with any other suitable anti-viral therapy, including but not necessarily limited to passive immunotherapies, vaccinations, and anti-viral compounds, such as Remdesvir and Galidesivir.
[0037] In connection with the Examples below, it has been demonstrated that host anti-viral defenses are regulated by the host m.sup.6A machinery in response to DNA and RNA virus infections (Rubio et al, 2018) and (Winkler et al, 2019). In addition, the cellular m.sup.6A modification machinery can influence reproduction of RNA viruses that replicate in the nucleus (influenza, HIV) and cytoplasm (flaviviruses). However, as discussed above, how the cellular m.sup.6A modification machinery influences reproduction of coronaviruses, including the pandemic SARs-CoV-2, has been previously unknown. Accordingly, and without intending to be constrained by any particular theory, it is considered that the present disclosure establishes fundamental features of how the cellular m.sup.6A machinery responds to coronavirus infection, and how interfering with host m.sup.6A modification components impacts coronavirus reproduction. The Examples provide comparisons between the pandemic SARs-CoV-2 with a non-pandemic, related circulating human beta-coronavirus associated with predominately mild respiratory symptoms (hCoV-OC43) to evaluate if the results pertain in general to human coronaviruses or may to any extended to be specific to SARs-CoV-2 pandemic or non-pandemic (Carman et al., 2018) strains. This knowledge gap addressed in the Examples. In particular, to analyze the two described viruses in cell culture, different model cell systems were used to support the replication of these different viruses. SARS-CoV-2 infection biology was investigated using naturally permissive Calu-3 (epithelial origin, human lung adenocarcinoma) cells, while MRCS (limited lifespan normal human diploid lung) human fibroblasts were used to study hCoV-OC43.
[0038] The following Examples are intended to illustrate various embodiments of the disclosure, but are not intended to be limiting.
Example 1
[0039] Inhibiting METTL3 suppresses human coronavirus replication.
[0040] Inactivation of METTL3 in embryonic stem cells has been shown to abolish 99% of cellular m.sup.6A arguing that this is the principal enzyme (Geula et al., 2015). To evaluate how METTL3 enzymatic activity impacted coronavirus reproduction, we compared the activity of a specific METTL3 chemical inhibitor (Tzelepis et al., 2019), here termed M3i, to a structurally related control compound M3c unable to inhibit METTL3. M3i is highly selective for METTL3 and is being developed to treat acute myeloid leukemia (Tzelepis et al., 2019). To measure coronavirus replication, we developed an assay (
Example 2
[0041] Regulation of Coronavirus Replication and Spread by Cellular m.sup.6A Recognition Proteins
[0042] As discussed above, a family of cellular proteins, termed m.sup.6A reader proteins or readers, recognize m.sup.6A-modified RNA to influence gene expression post-transcriptionally. Given that m6A installation by METTL3 is necessary for coronavirus replication, we reasoned that recognition of m.sup.6A-modified RNA by cellular readers might likewise be required for coronavirus replication. To investigate whether cellular m.sup.6A recognition proteins might also regulate coronavirus replication, cytoplasmic host m.sup.6A reader proteins YTHDF1, YTHDF2 and YTHDF3 were depleted using RNAi prior to measuring coronavirus reproduction and spread as described in the preceding section. Each reader was depleted using two validated siRNAs and virus replication and spread assayed by indirect immunofluorescence to detect the coronavirus N protein (
TABLE-US-00001 (SEQ ID NO: 1) YTHDF1#1 GUAACGGAGACCAUCAUUU[dT][dT] (SEQ ID NO: 2) YTHDF1#2 GUCAAUGGGAGUGGGCAUU[dT][dT] (SEQ ID NO: 3) YTHDF2#1 CUGCUUAUCGUUCCAUGAA[dT][dT] (SEQ ID NO: 4) YTHDF2#2 GUUCCAUUAAGUAUAAUAU[dT][dT] (SEQ ID NO: 5) YTHDF3#1 CAAUUCAAGGGACACUCAA[dT][dT] (SEQ ID NO: 6) Mettl3#1 CUGCAAGUAUGUUCACUAUGA[dT][dT (SEQ ID NO: 7) Mettl3#2 AGGAGCCAGCCAAGAAAUCAA[dT][dT].
[0043] Depletion of YTHDF1 and YTHDF3, but not of YTHDF2, led to significant reduction in hCoV-OC43 replication and spread in MRCS cells. The reduction in the number of N protein positive cells coincided with a reduction in infectious virus production as measured by TCID.sub.50 (
Example 3
[0044] Multiple METTL3 inhibitors derived from different chemical series limit coronavirus reproduction.
[0045] To further demonstrate using METTL3 chemical inhibitors to antagonize coronavirus reproduction, a second METTL3 chemical inhibitor (M3i2) derived from a distinct chemical series was evaluated (
Example 4
[0046] The capacity of a METTL3 chemical inhibitor to restrict coronavirus replication requires METTL3.
[0047] To determine whether the METTL3 chemical inhibitor M3i required the cellular METTL3 gene product to restrict coronavirus replication, MRCS cells were first treated with non-silencing (control) or METTL3 siRNA (either METTL3-1 or METTL3-2). The non-silencing control is from QIAGEN Cat No./ID: 1027281, and has no homology to any currently known mammalian gene. After 48h, cultures were infected with hCoV-OC43 and either untreated or treated with a compound unable to inhibit METTL3 (M3c) or the METTL3 inhibitor M3i. As established in
Example 5
[0048] SARS-CoV-2 Productive Replication in A549+ACE2 Cells is Antagonized by Writer and Reader Depletion
[0049] We next asked whether the host m6A methyltransferase and m6A recognition proteins also impact the reproduction of the recently emerged pandemic β-coronavirus SARS-CoV-2 by performing a similar RNAi screen in an additional human lung cell infection model-human A549 lung carcinoma cells engineered to constitutively express the human ACE2 receptor (A549+ACE2) (deVries et al. 2021). A SARS-CoV-2 reporter virus expressing mNeonGreen (icSARS-CoV-2-mNG) was used to identify infected cells and directly monitor virus reproduction and spread (Xie et al. 2020). Compared with a control, nonsilencing siRNA, the siRNAs against METTL3 reduced the percentage of infected cells by 78% or 81% (
Example 6
[0050] Small Molecule Inhibition of METTL3 Restricts β-Coronavirus Replication and Spread in A549+ACE2 Cells
[0051] Having established that depletion of either METTL3 or individual cytoplasmic m6A reader proteins interferes with productive replication of SARS-CoV-2 in lung carcinoma A549+ACE2 cells, we asked whether selective inhibition of METTL3 catalytic activity using [M3i2] could also restrict β-coronavirus replication in A549+ACE2 cells. Following low-multiplicity infection of A549+ACE2 cells with SARS-CoV-2, cultures were treated with vehicle (DMSO), the active METTL3 inhibitor (M3i2), or control compound [M3c]. Viral replication and spread was monitored using the high-content imaging platform to score mNeonGreen fluorescence (icSARS-CoV-2-mNG). Compared with DMSO or M3c, the higher concentrations of METTL3 inhibitor M3i2 clearly reduced icSARS-CoV-2-mNG-infected A549+ACE2 cells (
[0052] Quantifying virus replication revealed that M3i2 reduced SARS-CoV-2 infectious virus production in A549+ACE2 cells by 300-fold (
[0053] Materials and methods for examples 5 and 6
[0054] Cell Line Data
[0055] A549 cells stably expressing human ACE2 [A549+ACE2] (deVries et al 2021) were maintained in DMEM, 10% fetal bovine serum, and penicillin/streptomycin at 37° C. with 5% CO2. Cells were supplemented with puromycin (2 μg/mL) every other passage.
[0056] Virus Data
[0057] The mNeonGreen expressing SARS-CoV-2 recombinant (icSARS-CoV-2-mNG) based on isolate USA/WA/1/2020 was obtained from the UTMB World Reference Center for Emerging Viruses and Arboviruses.
[0058] Cellinsight CX7 LZR High-Content Screening Platform for A549-ACE2 Data
[0059] To monitor virus spread in drug treatment and gene knockdown conditions, cells were seeded in black-walled clear-bottom 96-well plates. For icSARS-CoV-2-mNG infection of A549+ACE2 cells, the next day media was removed and replaced with media containing drugs or vehicle control (DMSO) 2 h prior to infection. Cells were infected at MOI=0.1 in the presence of drugs/vehicle and incubated for 48 h at 37° C. Cells were fixed in a 10% formalin solution for 30 min and permeabilized in 0.5% Triton X-100 in PBS for 15 min prior to DAPI staining and a final PBS wash before analysis. Plates were imaged using a Celllnsight CX7 LZR high-content screening platform by collecting nine images at 4× magnification to cover the entire well. HCS Navigator software was used to quantify cell number by DAPI staining and the percentage infected cells, indicated by mNeonGreen positivity.
[0060] Cell Viability Assay
[0061] To determine viability, cells were seeded to opaque white 96-well plates. The next day, cells were drug- or vehicle-treated and incubated as in infection experiments (for example, treated-MRC-5 cells were placed for 48 h at 33° C.). ATP levels were then assayed using Celltiterglo2.0 (Promega G9242) according to the manufacturer's instructions. Luciferase signal was read on a Perkin Elmer Envision 2103 multilabel reader, and 24-h 1 μM staurosporine treatment used as a positive control for assay sensitivity.
[0062] This reference listing is not an indication that any reference is material to patentability. [0063] Aguilo F, Zhang F, Sancho A, Fidalgo M, Di Cecilia S, Vashisht A, Lee D F, Chen C H, Rengasamy M, Andino B, et al. 2015. Coordination of m.sup.6A mRNA methylation and gene transcription by ZFP217 regulates pluri-potency and reprogramming. Cell Stem Cell 17: 689-704. [0064] Blanco-Melo D, Nilsson-Payant B E, Liu W C, Moller R, Panis M, Sachs D, Albrecht R A, tenOever B R. 2020. SARS-CoV-2 launches a unique transcriptional signature from in vitro, ex vivo, and in vivo systems. bioRxiv. doi: https://doi.org/10.1101/2020.03.24.004655 [0065] Burgess H M, Mohr I. 2015. Cellular 5′-3′ mRNA exonuclease Xrn1 controls double-stranded RNA accumulation and anti-viral responses. Cell Host Microbe. 17: 332-344. [0066] Burgess H M, Mohr I. 2018. Defining the Role of Stress Granules in Innate Immune Suppression by the Herpes Simplex Virus 1 Endoribonuclease VHS. J Virol. 92(15). pii: e00829-18. [0067] Channappanavar R, Fehr A R, Zheng J, Wohlford-Lenane C, Abrahante J E, Mack M, Sompallae R, McCray P B Jr, Meyerholz D K, Perlman S. 2019. IFN-I response timing relative to virus replication determines MERS coronavirus infection outcomes. J Clin Invest. 130: 3625-3639. [0068] Chen C A, Shyu A B. 2017. Decay Emerging Themes in Regulation of Global mRNA Turnover in cis. Trends Biochem Sci. 42: 16-27. [0069] Coots R A, Liu X M, Mao Y, Dong L, Zhou J, Wan J, Zhang X, Qian S B. 2017. m.sup.6A Facilitates eIF4F-Independent mRNA Translation. Mol. Cell. 68: 504-514.e7 [0070] Corman, V M, Muth, D, Niemeyer D, Drosten C. 2018. Hosts and sources of endemic human Coronaviruses Adv. Virus Res. 100: 163-188. [0071] Courtney D G, Kennedy E M, Dumm R E, Bogerd H P, Tsai K, Heaton N S, Cullen B R 2017. Epitranscriptomic Enhancement of Influenza A Virus Gene Expression and Replication. Cell Host & Microbe 22: 377-386. [0072] Depledge D P, Mohr I, Wilson A C. 2018. Going the Distance: Optimizing RNA-Seq Strategies for Transcriptomic Analysis of Complex Viral Genomes. J Virol 93(1). pii: e01342-18. [0073] Depledge D P, Puthankalam S P, Sadaoaka T, Beady D, Mori Y, Placantonakis D, Mohr I, Wilson A C. 2019. Native RNA sequencing on nanopore arrays redefines the transcriptional complexity of a viral pathogen. Nature comms. 10(1):754. [0074] Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, et al. 2012. Topology of the human and mouse m.sup.6A RNA methylomes revealed by m.sup.6A-seq. Nature 485: 201-206. [0075] Du H, Zhao Y, He J, Zhang Y, Xi H, Liu M, Ma J, Wu L. 2016. YTHDF2 destabilizes m.sup.6A-containing RNA through direct recruitment of the CCR4-NOT deadenylase complex. Nat. Commun. 7: 12626. [0076] Edupuganti R R, Geiger S, Lindeboom R G H, Shi H, Hsu P J, Lu Z, Wang S Y, Baltissen M P A, Jansen P W T C, Rossa M, et al. 2017. N.sup.6-methyladenosine (m6A) recruits and repels proteins to regulate mRNA homeostasis. Nat. Struct. Mol. Biol. 24: 870-878. [0077] Fauci, A S, Lane H C L, Redfield R. 2020. Covid19—Navigating the uncharted. NEJM 382:1268-1269. [0078] Fustin J.-M. et al. 2013. RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell 155: 793-806. [0079] Garalde D R, Snell E A, Jachimowicz D, Sipos B, Lloyd J H, Bruce M, Pantic N, Admassu T, James P, Warland A, Jordan M, Ciccone J, Serra S, Keenan J, Martin S, McNeill L, Wallace E J, Jayasinghe L, Wright C, Blasco J, Young S, Brocklebank D, Juul S, Clarke J, Heron A J, Turner D J. 2018. Highly parallel direct RNA sequencing on an array of nanopores. Nat Methods. 15(3): 201-206. [0080] Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour A A, Kol N, Salmon-Divon M, et al. Stem cells. m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science. American Association for the Advancement of Science; 2015 Feb. 27; 347(6225): 1002-6. [0081] Gokhale N S, McIntyre A B, McFadden M J, Roder A E, Kennedy E M, Gandara J A, et al. 2016. N.sup.6-Methyl-adenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe 20: 654-665. [0082] Gonzales-van Horn S R, Sarnow P. 2017. Making the Mark: The Role of Adenosine Modifications in the Life Cycle of RNA Viruses. Cell Host Microbe. 21: 661-669. [0083] Herdy B, Jaramillo M, Svitkin Y V, Rosenfeld A B, Kobayashi M, Walsh D, Alain T, Sean P, Robichaud N, Topisirovic I, Furic L, Dowling R J O, Sylvestre A, Rong L, Colina R, Costa-Mattioli M, Fritz J H, Olivier M, Brown E, Mohr I, Sonenberg N. 2012, Translational control of the activation of transcription factor NF-κB and production of type I interferon by phosphorylation of the translation factor eIF4E. Nat Immunol.13: 543-550. [0084] Huang C, Lokugarnage K G, Rozovics J M, Narayanan K, Semler B L. Makino S. 2011. SARS coronavirus nsp1 protein induces template-dependent endonucleolytic cleavage of mRNAs: viral mRNAs are resistant to nsp1-induced RNA cleavage. PLoS Pathog, 7(12): e1002433. [0085] Haussmann I U, Bodi Z, Sanchez-Moran E, Mongan N P, Archer N, Fray R G, Soller M. 2016. m.sup.6A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature. 540: 301-304. [0086] Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, Yi C, Lindahl T, Pan T, Yang Y G, He C. 2011. N.sup.6-methyl-adenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 7: 885-887. [0087] Ke S, Pandya-Jones, S Y, Fak J J, Vågbø C B, Geula S, Hanna J H, Black D L, Darnell J E Jr, Darnell R B. 2017. m.sup.6A mRNA modifications are deposited in nascent pre-mRNA and are not required for splicing but do specify cytoplasmic turnover. Genes Dev. 31: 990-1006. [0088] Kennedy E M, Bogerd H P, Kornepati A V R, Kang D, Ghoshal D, Marshall J B, Poling, B C, Tsai K, Gokhale N S, Horner S M, Cullen B R. 2016. Post-transcriptional m(6)A Editing of HIV-1 mRNAs Enhances Viral Gene Expression. Cell Host Microbe 19: 675-685. [0089] Kobayashi M, Arias C, Garabedian A, Palmenberg A C, Mohr I. 2012. Site-specific cleavage of the host poly(A) binding protein by the encephalomyocarditis virus 3C proteinase stimulates viral replication. J Virol. 86:10686-94. [0090] Kovaka S, Zimin A V, Pertea G M, Razaghi R, Salzberg S L, Pertea M. 2019. Transcriptome assembly from long-read RNA-seq alignments with StringTie2. Genome Biol. 20(1):278. [0091] Leger A, Amaral P P, Pandolfini L, Capitanchik C, Capraro F, Barbieri I, Migliori V, Luscombe N M, Enright A J, Tzelepis K, Ule J, Fitzgerald T, Birney E, Leonardi T, Kouzarides T. 2019. RNA modifications detection by comparative Nanopore direct RNA sequencing. bioRxiv. doi: https://doi.org/10.1101/843136 [0092] Li Q, Guan X, Wu P, et al. 2020. Early transmission dynamics in Wuhan, China, of novelcoronavirus-infected pneumonia. N Engl J Med. 382:1199-1207. doi: 10.1056/NEJMoa2001316. [0093] Lichinchi G, Gao S, Saletore Y, Gonzalez G M, Bansal V, Wang Y, Mason C E, Rana T M. 2016a. Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat. Microbiol. 1: 16011. [0094] Lichinchi G, Zhao B S, Wu Y, Lu Z, Qin Y, He C, Rana T M. 2016b. Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe 20: 666-673. [0095] Linder B, Grozhik A V, Olarerin-George A O, Meydan C, Mason C E, Jaffrey S R. 2015. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nat Methods 12(8):767-72 [0096] Liu H, Begik O, Lucas M C, Ramirez J M, Mason C E, Wiener D, Schwartz S, Mattick J S, Smith M A, Novoa E M. 2019. Accurate detection of m6A RNA modifications in native RNA sequences. Nat Commun. 9; 10(1):4079. [0097] Liu N, Dai Q, Zheng G, He C, Parisen M, Pan T. 2015. N.sup.6-methyl-adenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature 518: 560-564. [0098] Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. 2014. A METTL3-METTL14 complex mediates mammalian nuclear RNA N.sup.6-adenosine methylation. Nat. Chem. Biol. 10: 93-95. [0099] Liu N, Zhou K I, Parisien M, Dai Q, Diachenko L, Pan T. 2017. N.sup.6-methyladenosine alters RNA structure to regulate binding of a low-complexity protein. Nucleic Acids Res. 45, 6051-6063. [0100] Lokugamage K G, Narayanan K, Nakagawa K, Terasaki K, Ramirez S I, Tseng C T, Makino S. 2015. Middle East Respiratory Syndrome Coronavirus nsp1 inhibits Host Gene Expression by Selectively Targeting mRNAs Transcribed in the Nucleus while Sparing mRNAs of Cytoplasmic Origin. J Viol. 89:10970-81. [0101] Lokugamage K G, Narayanan K. Huang C, Makino S. 2012. Severe acute respiratory syndrome coronavirus protein nspl is a novel eukaryotic translation inhibitor that represses multiple steps of translation initiation. J Virol. 86: 13598-608, [0102] Lokugamage, K G, Schindewolf C, Menachery, V D 2020. SARS-CoV-2 sensitive to type I interferon pretreatment. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.07.982264. [0103] Mauer J, Luo X, Blanjoie A, Jiao X, Grozhik A V, Patil D P, Linder B, Pickering B F, Vasseur J J, Chen Q, Gross S S, Elemento O, Debart F, Kiledjian M, Jaffrey S R. 2017. Reversible methylation of m.sup.6Am in the 5=cap controls mRNA stability. Nature 541: 371-375. McKinney C, Zavadil J, Bianco C, Shiflett L, Brown S, Mohr I. 2014. Global reprogramming of the cellular translational landscape facilitates cytomegalovirus replication. Cell Rep. 6(1): 9-17. [0104] Mer Merkestein M, Laber S, McMurray F, Andrew D, Sachse G, Sanderson J, Li M, Usher S, Sellayah D, Ashcroft F M, Cox R D. 2015. FTO influences adipogenesis by regulating mitotic clonal expansion. Nat. Commun. 6: 6792. [0105] Meyer K D, Patil D P, Zhou J, Zinoviev A, Skabkin M A, Elemento O, Pestova T V, Qian S B, Jaffrey S R. 2015. 5′ UTR m.sup.6A promotes cap-independent translation. Cell 163: 999-1010. [0106] Meyer K D, Saletore Y, Zumbo P, Elemento O, Mason C E, Jaffrey S R. 2012. Comprehensive analysis of mRNA methylation reveals enrichment in 30 UTRs and near stop codons. Cell 149: 1635-1646. [0107] McIntyre A B R, Gokhale N S, Cerchietti L, Jaffrey S R, Horner S M, Mason C E. 2019. Limits in the detection of m6A changes using MeRIP/m6A-seq. BioRxiv. doi: https://doi.org/10.1101/657130 [0108] Parker M T, Knop K, Sherwood A V, Schurch N J, Mackinnon K, Gould P D, Hall A J, Barton G J, Simpson G G. 2020. Nanopore direct RNA sequencing maps the complexity of Arabidopsis mRNA processing and m6A modification. Elife. 14; 9. pii: e49658. [0109] Patil D P, Pickering B F, Jaffrey S R. 2018. Reading m.sup.6A in the Transcriptome: m.sup.6A-Binding Proteins. Trends Cell Biol. 28: 113-127. [0110] Price A M, Hayer K E, McIntyre A B R, Gokhale N S, Della Fera A N, Mason C E, Horner S M, Wilson A C, Depledge D P, Weitzman M D. 2019. Direct RNA sequencing reveals m6A modifications on adenovirus RNA are necessary for efficient splicing. BioRxiv. doi: https://doi.org/10.1101/865485 [0111] Roost C. et al. 2015. Structure and thermodynamics of N.sup.6-methyladenosine in RNA: a spring-loaded base modification. I Am. Chem. Soc. 137: 2107-2115. [0112] Rosa-Mercado N A, Withers J B, Steitz J A. 2017. Settling the m.sup.6A debate: methylation of mature mRNA is not dynamic but accelerates turnover. Genes Dev. 31: 957-958. [0113] Roundtree I A, Evans M E, Pan T, He C. 2017. Dynamic RNA Modifications in Gene Expression Regulation. Cell 169: 1187-1200. [0114] Rubio R M, Depledge D P, Bianco C, Thompson L, Mohr I. 2018. RNA m.sup.6A modification enzymes shape innate responses to DNA by regulating interferon β. Genes Dev. 32: 1472-1484. [0115] Schwartz S, Mumbach M R, Jovanovic M, Wang T, Maciag K, Bushkin G G, Mertins P, Ter-Ovanesyan D, Habib N, Cacchiarelli D, Sanjana N E, Freinkman E, Pacold M E, Satija R, Mikkelsen T S, Hacohen N, Zhang F, Can S A, Lander E S, Regev A. 2018. Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5′ sites. Cell Rep. 8(1): 284-96. [0116] Tirumuru N, Zhao B S, Lu W, Lu Z, He C, Wu L. 2016. N(6)-methyl-adenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. eLife 5: e15528. [0117] Tzelepis K, de braekeleer E, Yankova E, Rak J, Aspris D, Domingues A F, et al. Pharmacological Inhibition of the RNA m6a Writer METTL3 As a Novel Therapeutic Strategy for Acute Myeloid Leukemia. Blood [Internet]. 2019 Nov. 13; 134 (Supplement_1):403-3. Retrieved from: https://doi.org/10.1182/blood-2019-127962 [0118] Vu L P, Pickering B F, Cheng Y, Zaccara S, Nguyen D, Minuesa G, Chou T, Chow A, Saletore Y, MacKay M, et al. 2017. The N.sup.6-methyladenosine (m.sup.6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat. Med. 23: 1369-1376. [0119] Wen J, Lv R, Ma H, Shen H, He C, Wang J, Jiao F, Liu H, Yang P, Tan L, et al., 2018. Zc3h13 Regulates Nuclear RNA m.sup.6A Methylation and Mouse Embryonic Stem Cell Self-Renewal. Mol. Cell. 69: 1028-1038. [0120] Winkler R, Gillis E, Lasman L, Safra M, Geula S, Soyris C, Nachshon A, Tai-Schmiedel J, Friedman N, Le-Trilling V T K, Trilling M, Mandelboim M, Hanna J H, Schwartz S, Stern-Ginossar N. 2019. m.sup.6A modification controls the innate immune response to infection by targeting type I interferons. Nat. Immunol. 20:173-182. [0121] Wu, F., Zhao, S., Yu, B. et al. 2020. A new coronavirus associated with human respiratory disease in China. Nature 579, 265-269. [0122] Wang, C., Horby, P. W., Hayden, F. G. & Gao, G. F. 2020. A novel coronavirus outbreak of global health concern. The Lancet 395: 470-473.
[0123] Wang X, Lu Z, Gomez A, Hon G C, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, et al. 2014. N.sup.6-methyl-adenosine-dependent regulation of messenger RNA stability. Nature. 505: 117-20. [0124] Williams G D, Gokhale N S, Horner S M. 2019. Regulation of Viral Infection by the RNA Modification N.sup.6-methyladenosine. Annu. Rev. Virol. July 5. doi: 10.1146/annurev-virology-092818-015559. [Epub ahead of print] [0125] Wojtas M N, Pandey R R, Mendel M, Homolka D, Sachidanandam R, Pillai R S. 2017. Regulation of m.sup.6A Transcripts by the 3′.fwdarw.5′ RNA Helicase YTHDC2 Is Essential for a Successful Meiotic Program in the Mammalian Germline. Mol. Cell. 68: 374-387. [0126] Yue, Y, Liu, J. He, C. 2015. RNA N.sup.6-methyladenosine methylation in post-transcriptional gene expression regulation. Genes Dev 29: 1343-55. [0127] Zeng Y, Wang S, Gao S, Soares F, Ahmed M, Guo H, Wang M, Hua J T, Guan J, Moran M F, Tsao M S, He F M. 2018. Refined RIP-seq protocol for epitranscriptome analysis with low input materials. PLoS Biol. 16(9): e2006092. [0128] Zheng, G. Q. et al. 2013. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol. Cell 49: 18-29. [0129] Zheng Q, Hou J, Zhou Y, Li Z, Cao X. 2017. The RNA helicase DDX46 inhibits innate immunity by entrapping m6A-demethylated antiviral transcripts in the nucleus. Nat. Immunol. 18: 1094-1103. [0130] Zhou J, Wan J, Shu X E, Mao Y, Liu X M, Yuan X, Zhang X, Hess M E, Bruning J C, Qian S B. 2018. N.sup.6 Methyl-adenosine Guides mRNA Alternative Translation during Integrated Stress Response. Mol. Cell 69: 636-647. [0131] Zhou J, Wan J, Gao X, Zhang X, Jaffrey S R, Qian S B. 2015. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature. 526: 591-594 [0132] Zhou, P., Yang, X., Wang, X. et al. 2020.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579: 270-273.
REFERENCES FOR EXAMPLES 5 AND 6
[0133] de Vries M, Mohamed A S, Prescott R A, Valero-Jimenez A M, Desvignes L, O'Connor R, Steppan C, Devlin J C, Ivanova E, Herrera A, Schinlever A, Loose P, Ruggles K, Koralov S B, Anderson A S, Binder J, Dittmann M. 2021. A comparative analysis of SARS-CoV-2 antivirals characterizes 3CLpro inhibitor PF-00835231 as a potential new treatment for COVID-19. J Virol. 95:e01819-20. doi: 10.1128/JVI.01819-20. [0134] Xie X, Muruato A, Lokugamage K G, Narayanan K, Zhang X, Zou J, Liu J, Schindewolf C, Bopp N E, Aguilar P V, Plante K S, Weaver S C, Makino S, LeDue J W, Menachery V D, Shi P Y. 2020. An Infectious cDNA Clone of SARS-CoV-2. Cell Host Microbe. 27:841-848.e3. doi: 10.1016/j.chom.0.2020.04.004.