DNA Plasmids with Improved Expression
20230242924 · 2023-08-03
Inventors
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
C12N15/635
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
International classification
C12N15/63
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the production and use of covalently closed circular (ccc) recombinant plasmids, and more particulary to vector modifications that improve express of said DNA molecules in the target organism.
Claims
1. An engineered bacterial cell comprising a Rep protein-dependent plasmid vector, a Rep protein gene that expresses a Rep protein, and a P.sub.L promoter that controls the expression of the Rep protein gene, and wherein the P.sub.L promoter comprises an OL1 mutation, wherein the OL1 mutation comprises either a single base substitution or a single base deletion that decreases or prevents repressor biding to OL1, and wherein the Rep protein-dependent plasmid vector comprises an R6K replication origin.
2. The engineered bacterial cell of claim 1, wherein the P.sub.L promoter comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:10 and SEQ ID NO: 44.
3. The engineered bacterial cell of claim 1, wherein said Rep protein comprises an amino acid sequence of SEQ ID NO: 13, wherein the amino acid sequence comprises two mutations at amino acids 106 and 107 of SEQ ID NO:13.
4. The engineered bacterial cell of claim 1, wherein the sequences of the P.sub.L promoter comprising said OL1 mutation is selected from the group consisting of SEQ ID NO: 11 and SEQ ID NO: 12.
5. The engineered bacterial cell of claim 1, wherein the R6K replication origin comprises a nucleic acid sequence that possesses at least 90% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 22.
6. The engineered bacterial cell of claim 1, wherein the Rep protein-dependent plasmid vector further comprises an RNA-OUT selectable marker.
7. The engineered bacterial cell of claim 6, wherein the RNA-OUT selectable marker comprises a nucleic acid sequence with at least 90% sequence identity to SEQ ID NO: 23 or SEQ ID NO: 36.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036] Table 1: P.sub.L promoter with OL1 mutations OL1-G and OL1-G to T improve plasmid yields in HyperGRO fermentation
[0037] Table 2: NTC9385R-EGFP LB media shake flask production yields in R6K production strains
[0038] Table 3: NTC9385C-Luc plasmid performance in different processes and production cell lines
[0039] Table 4: ColE2 Origin EGFP vector production in NTC701131 ColE2 production cell line
[0040] Table 5: NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R vectors
[0041] Table 6: gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685
[0042] Table 7: SR vector expression in vitro and in vivo
[0043] Table 8: RNA Pol III Nanoplasmid vector expression
[0044] Table 9: High level expression is obtained with pMB1 RNAI or RNA-OUT antisense RNA vectors
[0045] SEQ ID NO: 1: R6K gamma Origin
[0046] SEQ ID NO: 2: NTC9385R vector backbone
[0047] SEQ ID NO: 3: NTC9685R vector backbone
[0048] SEQ ID NO: 4: ColE2 Origin (+7)
[0049] SEQ ID NO: 5: ColE2 Origin (+7, CpG free)
[0050] SEQ ID NO: 6: ColE2 Origin (Min)
[0051] SEQ ID NO: 7: ColE2 Origin (+16)
[0052] SEQ ID NO: 8: NTC9385C vector backbone
[0053] SEQ ID NO: 9: NTC9685C vector backbone
[0054] SEQ ID NO: 10: P.sub.L Promoter (-35 to -10)
[0055] SEQ ID NO: 11: P.sub.L Promoter OL1-G (-35 to -10)
[0056] SEQ ID NO: 12: P.sub.L Promoter OL1-G to T(-35 to -10)
[0057] SEQ ID NO: 13: R6K Rep protein P42L-P113S
[0058] SEQ ID NO: 14: R6K Rep protein P42L-P106L-F107S
[0059] SEQ ID NO: 15: ColE2 Rep protein (wild type)
[0060] SEQ ID NO: 16: ColE2 Rep protein mut (G194D)
[0061] SEQ ID NO: 17: pINT pR pL R6K Rep piP42L-P106L- F107S (P3-)
[0062] SEQ ID NO: 18: pINT pR pL ColE2 Rep protein mut (G194D)
[0063] SEQ ID NO: 19: NTC9385R and NTC9685R Bacterial region. [NheI site-trpA terminator-R6K Origin-RNA-OUT- KpnI site]
[0064] SEQ ID NO: 20: NTC9385C and NTC9685C Bacterial region. [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site]
[0065] SEQ ID NO: 21: NTC9385C and NTC9685C CpG free ssiA [from plasmid R6K]
[0066] SEQ ID NO: 22: CpG free R6K origin
[0067] SEQ ID NO: 23: RNA-OUT selectable marker from NTC9385C, NTC9685C, NTC9385R, and NTC9685R
[0068] SEQ ID NO: 24: RNA-OUT Sense strand RNA from NTC9385C, NTC9685C, NTC9385R, NTC9685R, and NTC9385Ra
[0069] SEQ ID NO: 25: TPA secretion sequence
[0070] SEQ ID NO: 26: PCR primer 15061101
[0071] SEQ ID NO: 27: PCR primer 15061102
[0072] SEQ ID NO: 28: ColE2 core replication origin
[0073] SEQ ID NO: 29: +7(CpG free)-ssiA ColE2 origin
[0074] SEQ ID NO: 30: HTLV-IR-Rabbit β globin hybrid intron
[0075] SEQ ID NO: 31: pMB1 RNAI antisense repressor RNA (origin antisense partner of RNAII)
[0076] SEQ ID NO: 32: pMB1 RNAI selectable Marker, RNAI RNA (Sense strand)
[0077] SEQ ID NO: 33: IncB RNAI antisense repressor RNA (IncB plasmid origin RNAII antisense partner)
[0078] SEQ ID NO: 34: IncB RNAI selectable Marker. DraIII-KpnI restriction fragment
[0079] SEQ ID NO: 35: IncB RNAII-SacB. PstI-MamI restriction fragment
[0080] SEQ ID NO: 36: CpG free RNA-OUT selection marker—flanked by KpnI and Bg1II-EcoRI sites
[0081] SEQ ID NO: 37: CpG free R6K gamma—RNA-OUT bacterial region (CpG free R6K origin-CpG free RNA-OUT selection marker)—flanked by EcoRI-SphI and Bglll-EcoRI sites
[0082] SEQ ID NO: 38: CpG free ColE2 bacterial region (CpG free ssiA-CpG free ColE2 origin-CpG free RNA-OUT selection marker)-flanked by EcoRI-SphI and BglII-EcoRI sites
[0083] SEQ ID NO: 39: NTC9385Ra-02 vector backbone
[0084] SEQ ID NO: 40: NTC9385Ra-01 vector backbone
[0085] SEQ ID NO: 41: NTC9385R-BE vector backbone
[0086] SEQ ID NO: 42: P.sub.min minimal pUC replication origin
[0087] SEQ ID NO: 43: pUC (0.85) Bacterial region [NheI site—trpA terminator-P.sub.min pUC replication origin (minimal)- RNA-OUT-KpnI site]
[0088] SEQ ID NO: 44: artificial sequence including a P.sub.L promoter
DEFINITION OF TERMS
[0089] A.sub.405: Absorbance at 405 nanometers
[0090] AF: Antibiotic-free
[0091] APC: Antigen Processing Cell, for example, langerhans cells, plasmacytoid or conventional dendritic cells
[0092] Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is the same or similar to a stated reference value
[0093] BAC: Bacterial artificial chromosome
[0094] Bacterial region: Region of a plasmid vector required for propagation and selection in the bacterial host
[0095] BE: Boundary element: Eukaryotic sequence that that blocks the interaction between enhancers and promoters. Also referred to as insulator element. An example is the AT-rich unique region upstream of the CMV enhancer Spe1 site that can function as an insulator/boundary element (Angulo A, Kerry D, Huang H, Borst E M, Razinsky A, Wu J et al. 2000 J Virol 74: 2826-2839)
[0096] bp: basepairs
[0097] ccc: Covalently Closed Circular
[0098] cI: Lambda repressor
[0099] cITs857: Lambda repressor further incorporating a C to T (Ala to Thr) mutation that confers temperature sensitivity. cITs857 is a functional repressor at 28-30° C., but is mostly inactive at 37-42° C. Also called cI857
[0100] Cm.sup.R: Chloramphenicol resistance
[0101] cmv: Cytomegalovirus
[0102] CMV promoter boundary element: AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer. Also referred to as unique region (Angulo et al. Supra, 2000)
[0103] ColE2-P9 replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to ColE2-P9 replication origin sequences disclosed in SEQ ID NO: 4: ColE2 Origin (+7), SEQ ID NO: 5: ColE2 Origin (+7, CpG free), SEQ ID NO: 6: ColE2 Origin (Min) and SEQ ID NO: 7: ColE2 Origin (+16) and replication functional mutations as disclosed in Yagura et al 2006, J Bacteriol 188:999-1010 included herein by reference
[0104] ColE2 related replication origin: The ColE2-P9 origin is highly conserved across the ColE2-related plasmid family. Fifteen ColE2 related plasmid members including ColE3 are compared in Eiiraga et al 1994, J Bacteriol. 176:7233 and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006. These sequences are included herein by reference
[0105] ColE2-P9 plasmid: a circular duplex DNA molecule of about 7 kb that is maintained at about 10 to 15 copies per host chromosome. The plasmid encodes an initiator protein (Rep protein), which is the only plasmid-specified transacting factor essential for ColE2-P9 plasmid replication ColE2-P9 replication origin RNA-OUT bacterial region: Contains a ColE2-P9 replication origin for propagation and the RNA-OUT selection marker. Optionally includes a PAS, for example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO: 21) or alternative ØX174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al 1991 Gene 108:15
[0106] ColE2 plasmid: NTC9385C and NTC9685C vectors disclosed herein, as well as modifications and alternative vectors containing a ColE2-P9 replication origin delivery methods: Methods to deliver gene vectors [e.g. poly(lactide-co-glycolide) (PLGA), ISCOMs, liposomes, niosomes, virosomes, chitosan, and other biodegradable polymers, electroporation, piezoelectric permeabilization, sonoporation, ultrasound, corona plasma, plasma facilitated delivery, tissue tolerable plasma, laser microporation, shock wave energy, magnetic fields, contactless magneto-permeabilization, gene gun, microneedles, naked DNA injection, hydrodynamic delivery, high pressure tail vein injection, needle free biojector, liposomes, microparticles, microspheres, nanoparticles, virosomes, bacterial ghosts, bacteria, attenuated bacteria, etc] as known in the art and included herein by reference
[0107] DNA replicon: A genetic element that can replicate under its own control; examples include plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof
[0108] E. coli: Escherichia coli, a gram negative bacteria
[0109] EGFP: Enhanced green fluorescent protein
[0110] EP: Electroporation
[0111] Eukaryotic expression vector: A vector for expression of mRNA, protein antigens, protein therapeutics, shRNA, RNA or microRNA genes in a target organism
[0112] Eukaryotic region: The region of a plasmid that encodes eukaryotic sequences and/or sequences required for plasmid function in the target organism. This includes the region of a plasmid vector required for expression of one or more transgenes in the target organism including RNA Pol II enhancers, promoters, transgenes and polyA sequences. A eukaryotic region may express protein or RNA genes using one or more RNA Pol II promoters, or express RNA genes using one or more RNA Pol III promoters or encode both RNA Pol II and RNA Pol III expressed genes. Additional functional eukaryotic region sequences include RNA Pol I or RNA Pol III promoters, RNA Pol I or RNA Pol III expressed transgenes or RNAs, transcriptional terminators, S/MARs, boundary elements, etc
[0113] FU: Fluorescence units
[0114] g: Gram, kg for kilogram
[0115] Hr(s): Hour(s)
[0116] HTLV-I R: HTLV-I R 5′ untranslated region (UTR). Sequences and compositions were disclosed in Williams, J A 2008 World Patent Application W02008153733 and included herein by reference
[0117] IM: Intramuscular
[0118] immune response: Antigen reactive cellular (e.g. antigen reactive T cells) or antibody (e.g. antigen reactive IgG) responses
[0119] IncB RNAI: plasmid pMU720 origin encoded RNAI (SEQ ID NO: 33) that represses RNA II regulated targets (Wilson IW, Siemering K R, Praszkier J, Pittard A J. 1997. J Bacteriol 179:742)
[0120] kan: Kanamycin
[0121] kanR: Kanamycin Resistance gene
[0122] Kd: Kilodalton
[0123] kozak sequence: Optimized sequence of consensus DNA sequence gccRccATG (R=G or A) immediately upstream of an ATG start codon that ensures efficient tranlation initiation. A Sail site (GTCGAC) immediately upstream of the ATG start codon (GTCGACATG) is an effective Kozak sequence Minicircle: Covalently closed circular plasmid derivatives in which the bacterial region has been removed from the parent plasmid by in vivo or in vitro intramolecular (cis-) site specific recombination or in vitro restriction digestion/ligation
[0124] mSEAP: Murine secreted alkaline phosphatase Nanoplasmid vector: Vector combining an RNA selection marker with a R6K or ColE2 related replication origin. For example, NTC9385C, NTC9685C, NTC9385R, NTC9685R, NTC9385R-BE, NTC9385Ra-01 and NTC9385Ra-02 vectors described herein and modifications thereof
[0125] NTC7382 promoter: A chimeric promoter comprising the CMV enhancer-CMV promoter-HTLV R-synthetic rabbit β globin 3′ intron acceptor-exon 2-SRF protein binding site-kozak sequence, with or without an upstream SV40 enhancer. The creation and application of this chimeric promoter is disclosed in Williams J A Supra, 2008 and included herein by reference
[0126] NTC8385: NTC8385 and NTC8685 plasmids are antibiotic-free vectors that contain a short RNA (RNA-OUT) selection marker in place of the antibiotic resistance marker (kanR) The creation and application of these RNA-OUT based antibiotic-free vectors are disclosed in Williams, J A Supra, 2008 and included herein by reference
[0127] NTC8685: NTC8685 (
[0128] OL1: Lambda repressor binding site in the P.sub.L promoter (
[0129] OD.sub.600: optical density at 600 nm
[0130] PAS: Primosomal assembly site. Priming of DNA synthesis on a single stranded DNA ssi site. ØX174 type PAS: DNA hairpin sequence that binds priA, which, in turn, recruits the remaining proteins to form the preprimosome [priB, dnaT, recruits dnaB (delivered by dnaC)], which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. ABC type PAS: DNA hairpin binds dnaA, recruits dnaB (delivered by dnaC) which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. See Masai et al, 1990 J Biol Chem 265:15134. For example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO: 21) or alternative ØX174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al Supra, 1991
[0131] PAS-BH: Primosomal assembly site on the heavy (leading) strand
[0132] PAS-BH region: pBR322 origin region between ROP and PAS-BL (approximately pBR322 2067-2351)
[0133] PAS-BL: Primosomal assembly site on the light (lagging) strand
[0134] PBS: Phosphate buffered Saline
[0135] PCR: Polymerase Chain Reaction
[0136] pDNA: Plasmid DNA
[0137] pINT pR pL vector: The pINT pR pL integration expression vector is disclosed in Luke et al 2011 Mol Biotechnol 47:43 and included herein by reference. The target gene to be expressed is cloned downstream of the pLl promoter (
[0138] Plasmid: An extra chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently from the chromosomal DNA
[0139] pMB1 RNAI: pMB1 plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31; SEQ ID NO: 32) that represses RNAII regulated targets such as those described in Grabherr R, Pfaffenzeller I. 2006 U.S. Pat. Application US20060063232 and Cranenburgh R M. 2009; U.S. Pat. No. 7,611,883
[0140] P.sub.min: Minimal 678 bp pUC replication origin SEQ ID NO: 42 and functional variants with base substitutions and/or base deletions. Vectors described herein incorporating P.sub.min include NTC8385-Min and NTC8885MP-U6
[0141] Pol: Polymerase
[0142] polyA: Polyadenylation signal or site. Polyadenylation is the addition of a poly(A) tail to an RNA molecule. The poly-adenylation signal is the sequence motif recognized by the RNA cleavage complex. Most human polyadenylation sites contain an AAUAAA motif and conserved sequences 5′ and 3′ to it. Commonly utilized polyA sites are derived from the rabbit β globin (NTC8685;
[0143] pUC plasmid: Plasmid containing the pUC origin
[0144] R6K plasmid: NTC9385R, NTC9685R, NTC9385Ra-O1 and RNA9385Ra-O2 vectors disclosed herein, as well as modifications, and alternative R6K vectors known in the art including but not limited to pCOR vectors (Gencell), pCpG- free vectors (Invivogen), and CpG free University of Oxford vectors including pGM169
[0145] R6K replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to R6K replication origin sequence disclosed as SEQ ID NO: 1: R6K Origin, and CpG free versions (SEQ ID NO: 22) as disclosed in Drocourt et al U.S. Pat. No. 7,244,609 and incorporated herein by reference
[0146] R6K replication origin-RNA-OUT bacterial region: Contains a R6K replication origin for propagation and the RNA-OUT selection marker
[0147] Rep: Replication
[0148] Rep protein dependent plasmid: A plasmid in which replication is dependent on a replication (Rep) protein provided in Trans. For example, R6K replication origin, ColE2-P9 replication origin and ColE2 related replication origin plasmids in which the Rep protein is expressed from the host strain genome. Numerous additional Rep protein dependent plasmids are known in the art, many of which are summarized in del Solar et al 1998 Microbiol. Mol. Biol. Rev 62:434-464 which is included herein by reference
[0149] RNA-IN: Insertion sequence 10 (IS10) encoded RNA-IN, an RNA complementary and antisense to RNA-OUT. When RNA-IN is cloned in the untranslated leader of a mRNA, annealing of RNA-IN to RNA-OUT reduces translation of the gene encoded downstream of RNA-IN
[0150] RNA-IN regulated selection marker: A genomically expressed RNA-IN regulated selectable marker. In the presence of plasmid borne RNA-OUT, expression of a protein encoded downstream of RNA-IN is repressed. An RNA-IN regulated selection marker is configured such that RNA-IN regulates either 1) a protein that is lethal or toxic to said cell per se or by generating a toxic substance (e.g. SacB), or 2) a repressor protein that is lethal or toxic to said bacterial cell by repressing the transcription of a gene that is essential for growth of said cell (e.g. murA essential gene regulated by RNA-IN tetR repressor gene). For example, genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation are disclosed in Williams, J A Supra, 2008 (SEQ ID NO: 23) and included herein by reference. Alternative selection markers described in the art may be substituted for SacB
[0151] RNA-OUT: Insertion sequence 10 (IS 10) encoded RNA- OUT (SEQ ID NO: 24), an antisense RNA that hybridizes to, and reduces translation of, the transposon gene expressed downstream of RNA-IN. The sequence of the core RNA- OUT sequence (SEQ ID NO: 24) and complementary RNA- IN SacB genomically expressed RNA-IN-SacB cell lines can be modified to incorporate alternative functional RNA-IN/RNA-OUT binding pairs such as those disclosed in Mutalik et al. 2012 Nat Chem Biol 8:447, including, but not limited to, the RNA-OUT A08/RNA-IN S49 pair, the RNA-OUT A08/RNA-IN S08 pair, and CpG free modifications of RNA-OUT A08 that modify the CG in the RNA-OUT 5′ TT CGCT sequence to a non-CpG sequence
[0152] RNA-OUT Selectable marker: An RNA-OUT selectable marker DNA fragment including E. coli transcription promoter and terminator sequences flanking an RNA-OUT RNA. An RNA-OUT selectable marker, utilizing the RNA-OUT promoter and terminator sequences, that is flanked by DraIII and KpnI restriction enzyme sites, and designer genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation, are disclosed in Williams, J A Supra, 2008 (SEQ ID NO: 23) and included herein by reference. The RNA-OUT promoter and terminator sequences flanking the RNA-OUT RNA may be replaced with heterologous promoter and terminator sequences. For example, the RNA-OUT promoter may be substituted with a CpG free promoter known in the art, for example the I-EC2K promoter or the P⅚ ⅚ or P⅚ 6/6 promoters disclosed in Williams, J A Supra, 2008 and included herein by reference
[0153] RNA selectable marker: also RNA selection marker. An RNA selectable marker is a plasmid borne expressed non translated RNA that regulates a chromosomally expressed target gene to afford selection. This may be a plasmid borne nonsense suppressing tRNA that regulates a nonsense suppressible selectable chromosomal target as described by Crouzet J and Soubrier F 2005 U.S. Pat. No. 6,977,174 included herein by reference. This may also be a plasmid borne antisense repressor RNA, a non limiting list included herein by reference includes RNA-OUT that represses RNA-IN regulated targets, pMB1 plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31; SEQ ID NO: 32; Grabherr and, Pfaffenzeller Supra, 2006; Cranenbuigh R M. Supra, 2009), IncB plasmid pMU720 origin encoded RNAI that represses RNA II regulated targets (SEQ ID NO: 33; SEQ ID NO: 34; Wilson et al Supra, 1997), ParB locus Sok of plasmid R1 that represses Hok regulated targets, Flm locus FlmB of F plasmid that represses flmA regulated targets (Morsey M A, 1999 U.S. Pat. No. 5,922,583). An RNA selectable marker may be another natural antisense repressor RNAs known in the art such as those described in Wagner E G H, Altuvia S, Romby P. 2002. Adv Genet 46:361 and Franch T, and Gerdes K. 2000. Current Opin Microbiol 3:159. An RNA selectable marker may also be an engineered repressor RNAs such as synthetic small RNAs expressed SgrS, MicC or MicF scaffolds as described in Na D, Yoo S M, Chung H, Park H, Park J H, Lee S Y. 2013. Nat Biotechnol 31:170
[0154] ROP: Repressor of primer
[0155] sacB: Structural gene encoding Bacillus subtilis levansucrase. Expression of sacB in gram negative bacteria is toxic in the presence of sucrose
[0156] SEAP: Secreted alkaline phosphatase
[0157] shRNA: Short hairpin RNA
[0158] SR: Spacer region. As used herein, spacer region is the region linking the 5′ and 3′ ends of the eukaryotic region sequences. The eukaryotic region 5′ and 3′ ends are typically separated by the replication origin and selection marker. In simple single RNA Pol II transcription vectors this will be between the RNA Pol II promoter region (5′ to a promoter, enhancer, boundary element, S/MAR) and the RNA Pol II polyA region (3′ to a polyA sequence, eukaryotic transcriptional terminator sequence, boundary element, S/MAR). For example, in NTC9385R (
[0159] ssi: Single stranded initiation sequences
[0160] SV40 enhancer: Region containing the 72 bp and optionally the 21 bp repeats
[0161] target antigen: Immunogenic protein or peptide epitope, or combination of proteins and epitopes, against which an immune response can be mounted. Target antigens may by derived from a pathogen for infectious disease applications, or derived from a host organism for applications such as cancer, allergy, or autoimmune diseases. Target antigens are well defined in the art. Some examples are disclosed in Williams, Supra, 2008 and are included herein by reference TE buffer: A solution containing approximately 10 mM Tris pH 8 and 1 mM EDTA
[0162] Transcription terminator: Bacterial: A DNA sequence that marks the end of a gene or operon for transcription. This may be an intrinsic transcription terminator or a Rho-dependent transcriptional terminator. For an intrinsic terminator, such as the trpA terminator, a hairpin structure forms within the transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex. Alternatively, Rho-dependent transcriptional terminators require Rho factor, an RNA helicase protein complex, to disrupt the nascent mRNA-DNA-RNA polymerase ternary complex. Eukaryotic: PolyA sites are not ‘terminators’, instead internal cleavage at PolyA sites leaves an uncapped 5′ end on the 3′UTR RNA for nuclease digestion. Nuclease catches up to RNA Pol II and causes termination. Termination can be promoted within a short region of the poly A site by introduction of RNA Pol II pause sites (eukaryotic transcription terminator). Pausing of RNA Pol II allows the nuclease introduced into the 3′ UTR mRNA after PolyA cleavage to catch up to RNA Pol II at the pause site. A nonlimiting list of eukaryotic transcription terminators know in the art include the C2x4 terminator (Ashfield R, Patel A J, Bossone S A, Brown H, Campbell R D, Marcu K B, Proudfoot N J. 1994. EMBO J 13:5656) and the gastrin terminator (Sato K, Ito R, Baek K H, Agarwal K, 1986. Mol. Cell. Biol. 6:1032). Terminator element may stabilize mRNA by enhancing proper 3′-end processing of mRNA (Kim D, Kim J D, Baek K, Yoon Y, Yoon J. 2003. Biotechnol Prog 19:1620)
[0163] Transgene: Target antigen or protein or RNA gene that is cloned into a vector
[0164] ts: Temperature sensitive
[0165] .Math.g: microgram
[0166] .Math.l: microliter
[0167] UTR: Untranslated region of a mRNA (5′ or 3′ to the coding region)
[0168] VARNA: Adenoviral virus associated RNA, including VAR-NAI (VAI or VA1) and or VARNAII (VAII or VA2) from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
[0169] VARNAI: Adenoviral virus associated RNAI, also referred to as VAI, or VAI, from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
[0170] Vector: A gene delivery vehicle, including viral (e.g. alphavirus, poxvirus, lentivirus, retrovirus, adenovirus, adenovirus related virus, etc) and nonviral (e.g. plasmid, midge, transcriptionally active PCR fragment, minicircles, bacteriophage, etc) vectors. These are well known in the art and are included herein by reference
[0171] Vector backbone: Eukaryotic region and bacterial region of a vector, without the transgene or target antigen coding region
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0172] The invention relates generally to plasmid DNA compositions and methods to improve plasmid expression and plasmid production. The invention can be practiced to improve expression of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. The invention can be practiced to improve the copy number of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. It is to be understood that all references cited herein are incorporated by reference in their entirety.
[0173] According to one preferred embodiment, the present invention provides for method of increasing in vivo expression of transgene from covalently closed super-coiled plasmid DNA, which comprises modifying the plasmid DNA to replace the pMB1, ColE1 or pBR322 derived replication origin and selectable marker with a replication origin selected from the group consisting of an P.sub.min minimal pUC replication origin, ColE2-P9 replication origin, ColE2 related replication origin, and R6K replication origin and a RNA selectable marker; transforming the modified plasmid DNA into a Rep protein producing bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells. The modified plasmid produced from these cells has increased transgene expression in the target organism.
[0174] In one preferred embodiment, the spacer region encoded pMB1, ColE1 or pBR322 derived replication origin is replaced with a CpG free ColE2 origin. In another preferred embodiment, a primosome assembly site is incorporated into a ColE2 plasmid DNA backbone to improve plasmid copy number. In yet another preferred embodiment, the pMB1, ColE1 or pBR322 derived replication origin is replaced with a CpG free R6K origin.
[0175] The methods of plasmid modification of the present invention have been surprisingly found to improve plasmid expression in the target organism. Increased expression vectors may find application to improve the magnitude of DNA vaccination mediated antigen reactive B or T cell responses for preventative or therapeutic vaccination, increase RNA and or protein transgene levels to improve gene replacement therapy or gene knockdown therapy, increase plasmid based expression levels of DNA vector expressed therapeutic antibodies that neutralize infectious diseases such as influenza, EHV, malaria, hepatitis C virus, tuberculosis, etc.
[0176] Plasmid encoded transgene expression in the target organ-ism is preferably increased by employing specific constructs or compositions incorporated in a vector. According to one preferred embodiment, the present invention provides a composition for construction of a vector, comprising a ColE2 origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and a RNA selectable marker and a eukaryotic region, wherein the ColE2 origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this ColE2 origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9.
[0177] According to another preferred embodiment, the present invention provides a composition for construction of a vector, comprising an R6K origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 1, SEQ ID NO: 22, and a RNA selectable marker and a eukaryotic region, wherein the R6K origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this R6K origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41.
[0178] As used herein, the term “sequence identity” refers to the degree of identity between any given query sequence, e.g., SEQ ID NO: 2, and a subject sequence. A subject sequence may, for example, have at least 90 percent, at least 95 percent, or at least 99 percent sequence identity to a given query sequence. To determine percent sequence identity, a query sequence (e.g., a nucleic acid sequence) is aligned to one or more subject sequences using any suitable sequence alignment program that is well known in the art, for instance, the computer program ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid sequences to be carried out across their entire length (global alignment). Chema et al., 2003 Nucleic Acids Res., 31:3497-500. In a preferred method, the sequence alignment program (e.g., ClustalW) calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities, and differences can be determined Gaps of one or more nucleotides can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pair-wise alignments of nucleic acid sequences, suitable default parameters can be selected that are appropriate for the particular alignment program. The output is a sequence alignment that reflects the relationship between sequences. To further determine percent identity of a subject nucleic acid sequence to a query sequence, the sequences are aligned using the alignment program, the number of identical matches in the alignment is divided by the length of the query sequence, and the result is multiplied by 100. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.
[0179] According to another preferred embodiment, the present invention provides methods and compositions for production of a Rep protein dependent plasmid vector. Production cell lines providing improved heat inducible P.sub.L promoter expression of a Rep protein integrated into the genome and expressed from the heat inducible P.sub.L promoter incorporating the OL1-G deletion (SEQ ID NO: 11), or the heat inducible P.sub.L promoter incorporating the OL1-G to T substitution (SEQ ID NO: 12). It has been surprisingly found that these promoter modifications improves Rep protein dependent plasmid vector copy number in shake flask and fermentation cultures.
[0180] Turning now to the drawings,
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192] The invention also relates to compositions and methods for producing high expression level plasmids. The present invention provides sequences that, when introduced into a vector backbone, increase plasmid expression.
[0193] The surprising observation that a ColE2 replication origin-RNA selection marker or R6K replication origin-RNA selection marker can be utilized as a plasmid expression enhancer is disclosed.
[0194] As described herein, plasmid expression is increased by replacement of the pMB1, ColE1 or pBR322 derived origin-selection marker bacterial region with an R6K origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the R6K origin is CpG free. In yet another preferred embodiment, the R6K origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the R6K origin is included with an pMB 1 RNAI selection marker. In yet another preferred embodiment, the R6K origin is included with an IncB RNAI selection marker.
[0195] In yet another preferred embodiment, plasmid expression is increased by replacement of the pMB1, ColE1 orpBR322 derived origin-selection marker bacterial region with a ColE2 origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the ColE2 origin is CpG free. In yet another preferred embodiment, the ColE2 origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the ColE2 origin is included with an pMB 1 RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with an IncB RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with a primosome assembly site.
[0196] In yet another preferred embodiment, plasmid expression is increased by replacement of the pMB1, ColE1 or pBR322 derived origin-selection marker with a P.sub.min minimal pUC, ColE2 or a R6K origin in the plasmid backbone spacer region and an RNA selection marker in an intron. In yet another preferred embodiment, the R6K or ColE2 origin is CpG free. In yet another preferred embodiment, the RNA selection marker is the RNA-OUT selection marker. In yet another preferred embodiment, the RNA selection marker is the pMB1 RNAI selection marker. In yet another preferred embodiment, the RNA selection marker is the IncB RNAI selection marker.
EXAMPLES
[0197] The methods of the invention are further illustrated by the following examples. These are provided by way of illustration and are not intended in any way to limit the scope of the invention.
Example 1: Heat Inducible R6K Replication Origin Plasmid Production
Fermentation
[0198] Fermentations were performed using proprietary fed-batch media (NTC3019, HyperGRO media) in New Brunswick BioFlo 110 bioreactors as described (Carnes and Williams, Supra, 2011). The seed cultures were started from glycerol stocks or colonies and streaked onto LB medium agar plates containing 6% sucrose. The plates were grown at 30-32° C.; cells were resuspended in media, and used to provide approximately 0.1% inoculums for the fermentations that contained 0.5% sucrose to select for RNA-OUT plasmids.
[0199] Antibiotic-free RNA-OUT plasmid fermentations were performed in E. coli strain XLlBlue [recAl endAl gyrA96 thi-1 hsdR17 supE44 relAl lac [F′ proAB lacIqZΔM15TnlO (Tef] (Stratagene, La Jolla, Calif.)] or GT115 [F—mcrA Δ(mrr-hsdRMS-mcrBC) φ801 acZΔM15 ΔlacX74 recAl rspL (StrA) endAl Δdcm uidA(ΔMluI)::pir-116 ΔsbcC-sbcD (Invivogen, San Diego)] strains containing chromosomally integrated pCAH63-CAT RNA-IN-SacB (P⅚ 6/6) at the phage lambda integration site as disclosed in Williams, J A Supra, 2008. SacB (Bacillus subtilis levansucrase) is a counterselectable marker which is lethal to E. coli cells in the presence of sucrose. Translation of SacB from the RNA-IN-SacB transcript is inhibited by plasmid encoded RNA-OUT. This facilitates plasmid selection in the presence of sucrose, by inhibition of SacB mediated lethality.
Analytical Methods
[0200] Culture samples were taken at key points and at regular intervals during all fermentations. Samples were analyzed immediately for biomass (OD.sub.600) and for plasmid yield. Plasmid yield was determined by quantification of plasmid obtained from Qiagen Spin Miniprep Kit preparations as described (Carnes and Williams, Supra, 2011). Briefly, cells were alkaline lysed, clarified, plasmid was column purified, and eluted prior to quantification. Agarose gel electrophoresis analysis (AGE) was performed on 0.8-1% Tris/acetate/ EDTA (TAE) gels as described in Carnes and Williams J A, Supra, 2011.
R6K Background
[0201] The R6K gamma plasmid replication origin requires a single plasmid replication protein it that binds as a monomer to multiple repeated ‘iteron’ sites (seven core repeats containing TGAGNG consensus) and as a dimer to repressive sites [TGAGNG (dimer repress) as well as to iterons with reduced affinity]. Various host factors are used including IHF, DnaA, and primosomal assembly proteins DnaB, DnaC, DnaG (Abhyankar et al 2003 J Biol Chem 278: 45476-45484). The R6K core origin contains binding sites for DnaA and IHF that affect plasmid replication (π, IHF and DnaA interact to initiate replication).
[0202] Different versions of the R6K gamma replication origin have been utilized in various eukaryotic expression vectors, for example pCOR vectors (Soubrier et al 1999, Gene Therapy 6:1482) and a CpG free version in pCpGfree vectors (Invivogen, San Diego Calif.), and pGM169 (University of Oxford). Incorporation of the R6K replication origin does not improve expression levels compared to an optimized pUC origin vector (Soubrier et al Supra, 1999). However, use of a conditional replication origin such as R6K gamma that requires a specialized cell line for propagation adds a safety margin since the vector will not replicate if transferred to a patients endogenous flora.
[0203] A highly minimalized R6K gamma derived replication origin that contains core sequences required for replication (including the DnaA box and stb 1-3 sites; Wu et al, 1995. J Bacteriol. 177: 6338-6345), but with the upstream π dimer repressor binding sites and downstream π promoter deleted (by removing one copy of the iterons, as with pCpG; see map below) was designed (SEQ ID NO: 1) and NTC9685R and NTC9385R expression vectors incorporating it constructed (see Example 3).
[0204] Typical R6K production strains incorporate the π protein derivative PIR116 that contains a P106L substitution that increases copy number (by reducing π dimerization; π monomers activate while π dimers repress). Fermentation results with pCOR (Soubrier et al., Supra, 1999) and pCpG plasmids (Hebel H L, Cai Y, Davies L A, Hyde S C, Pringle I A, Gill D R. 2008. Mol Ther 16: SI 10) were low, around 100 mg/L in PIR116 cell lines.
[0205] As expected, fermentation yields of the R6K expression vector NTC9685R-EGFP in R6K plasmid production cell line NTC641642 (GT115-SacB; GT115 modified for RNA-OUT AF vector selection by insertion of pCAH63-CAT RNA-IN-SacB (P⅚ 6/6) into the genome. The GT115 genome encoded endogenous π gene P3 promoter constitutively expresses R6K replication protein π containing the pir-116 mutation; Metcalf et al, 1994; Gene 138; 1-7) were low (Table 1). Mutagenesis of the pir-116 replication protein and selection for increased copy number has been used to make new production strains. For example, the TEX2pir42 strain contains a combination of P106L and P42L. The P42L mutation interferes with DNA looping replication repression. The TEX2pir42 cell line improved copy number and fermentation yields with pCOR plasmids with reported yields of 205 mg/L (Soubrier F. 2004. World Patent Application WO2004033664). Methods to improve R6K origin yields are needed.
[0206] Other combinations of π copy number mutants have been shown to improve copy number. This includes ‘P42L and P113S’ and ‘P42L, P106L and F107S’ (Abhyankar et al 2004. J Biol Chem 279:6711-6719).
[0207] Two cell lines using the endogenous π gene P3 promoter to express π mutants ‘P42L and P113S’ (SEQ ID NO: 13) (NTC640722 cell line) and ‘P42L, P106L and F107S’ (SEQ ID NO: 14) were constructed and tested for copy number improvement with NTC9685R-EGFP. Two additional cell lines using the P.sub.L promoter in addition to the endogenous π gene P3 promoter to express π mutants ‘P42L and P113S’ (NTC641981 cell line) and ‘P42L, P106L and F107S’ (NTC641053 cell line) were made and tested for copy number improvement with NTC9685R-EGFP. R6K production cell lines were made in XLl-Blue SacB (XLl-Blue attλ:P⅚ 6/6-RNAIN-SacB, CmR).
[0208] These cell lines were constructed as follows. The R6K replication proteins π were cloned into the pINT pR pL integration vectors as described in Luke et al Supra, 2011 40 and included herein by reference. Constructed R6K Rep protein vectors were integrated into the genome at the HK022 phage attachment site as described in Luke et al, Supra, 2011. Briefly the pINT pINT pR pL R6K Rep vectors were amplified by PCR to delete the R6K replication origin, 45 ligated to form a circle, and integrated into the HK022 attachment site using the pAH69 helper plasmid as described.
[0209] The results (Table 1) demonstrated that constitutive expression of ‘P42L and P113S’ or ‘P42L, P106L and F107S’ resulted in much higher levels of NTC9685R-EGFP than the NTC641642 encoded P106L Rep protein. However, constitutive expression from P3 resulted in low overall biomass and plasmid multimerization with P42L, P106L and F107S (RF306, RF314), due to high plasmid levels and resultant metabolic burden during the growth phase
TABLE-US-00001 2.6 kb NTC9685R-EGFP R6K Nanoplasmid fermentation yields in R6K rep cell lines Ferm # Cell line Rep Gene Promoter Growth phase temp (C.) Growth spec yield.sup.a Induced phase temp (C.) Induced spec yield.sup.a Final OD.sub.600 Final plasmid yield (mg/L) Plasmid multimerization RF310 NTC641642 P106L Const P3 37 1.1 NA, 37 1.2 43 53 RF323 NTC641642 P106L Const P3 37 ND NA, 37 0.9 54 49 Monomer RF305 NTC640722 P42L-P1138 Const P3 30 3.4 37 3.6 96 345 Monomer RF321 NTC641981 P43L-P1138 p8, PL & P3 32 4.4-5.0 43 3.8 93 259 Monomer.sup.b RF346 NTC641053 P42L-P186L-P1078 P8, PL & P3 30 3.1 37 6.6 86 567 Monomer RF314 NTC641083 P42L-P106L-P1075 pR PL & P3 32 2.6-4.7 42 3.1 79 558 Monomer RF351 NTC661135 P42L-P166L-F1078 p8, PL only 32 0.4 42 1.49 88 128 Monomer RF326 NTC661138-MLT P42L-P106L-F107S pR PL OL1 G 32 0.64 42 6.7 81 548 Monomer RF358 NTC711055 P42L-P106L-F1078 p8, PL OL1 G 32 1 42 5.9 118 690 Monomer RF339 NTC711231 P42L-P106L-P1038 p8 PL OL1 G to 7 30 1.8 42 8.8 82 695 Monomer NTC640321 - NTC5402-P42L-P10L-F1078 NTCM0722 - NTC8402-P42L-P1338 NTC541083 - NTC9332-pK pL P42L-P302S NTC641642 -Gt15-S32B (c1845) pl136-P106L NTC641981 - NTC6402 p8 PL P42L-P1338 NTC64135 - NTC54208-p8 pL P42L-P106L-P302S(P3-) NTC661135-ML1 - NTC64208-p8 pL (pL-3) P42L-P105L-P1078 (P3-) NTC661134 - NTC6423-pK PL P42L-P3138 (P3-) NTC513848 - NTC54168-p8 pL (OL1-G) P42L-P108L-P1078 (P3-) NTC311231 - NTC84208-p8 pL (OL1-G to 7) P42L-P108L-P107S (P3-) ND - Not discontinued NA - Not applicable .sup.aSpecific Yield - ms plasmid LODGO .sup.bSome smx ground NTC6402 - XL181x,SwB NTC54208 - XL1Ble SwB, dwx
[0210] Heat inducible versions were then made by deletion of the P3 promoter to determine if P.sub.L promoter mediated replication protein induction in a temperature shift improved R6K plasmid production yields and quality by reduction of plasmid copy number and metabolic burden during the reduced temperature growth phase. A strain encoding a deletion of the P3 promoter expressing P42L, P106L and F107S (NTC661135, incorporating a single copy of the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector;
[0211] However, excellent results were obtained after fermentation with a second NTC661135 cell line (RF326) in which plasmid copy number was increased 10 fold by temperature shifting, resulting in excellent final plasmid yields of 545 mg/L. PCR amplification and sequencing of the P42L, P106L and F107S expression cassette from the RF326 cell line (NTC661135-MUT) and the RF351 cell line (NTC661135) demonstrated that NTC661135-MUT contained a mutation in the OL1 lambda repressor binding site in the P.sub.L promoter (
[0212] This mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OL1-G mutation integrated into the genome (NTC711055) as described above. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF358) dem-onstrated similar dramatic 6 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 690 mg/L.
[0213] Repressor binding to OL1 is altered by mutations in OL1, such as OL1-G (
[0214] The OLl-G to T (V2) mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OLl-G mutation integrated into the genome as described above to create NTC711231. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF359) demonstrated, similar to OL1G, a dramatic 5 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 695 mg/L.
[0215] Cell lines incorporating the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector containing either the wildtype P.sub.L promoter (NTC661135, SEQ ID NO: 10), the OLl-G mutation (NTC711055, SEQ ID NO: 11) or the OLl-G to T mutation (NTC711231, SEQ ID NO: 12) were transformed with the NTC9385R-EGFP plasmid and yields in shake flask determined (Table 2). The results demonstrated the OL1-G and OLl-G to T mutations dramatically improve temperature inducible R6K plasmid yields in shake flask culture. Improved yield with two different R6K plasmids (NTC9385R, Table 2; NTC9685R, Table 1) in either LB shake flask media or HyperGRO fermentation media demonstrates improved temperature inducible R6K plasmid is generic, and is not plasmid or growth media specific. Thus the invention can be utilized with a plurality of R6K origin vectors, in various plasmid growth media described in the art and various temperature induction profiles.
[0216] Likewise the pINT pR pL R6K Rep plasmids can be integrated into alternative E. coli strains to create production hosts. Any strain that is acceptable for plasmid production, such as JM108, BL21, DH5, DH1, DH5a, GT115, GT116, DH10B, EC 100, can be converted to a high yield temperature inducible R6K plasmid production host by integration of a pINT pR pL R6K Rep plasmid into the genome. The pR pL R6K Rep expression cassette may alternatively be removed from the pINT vector backbone and directly integrated into the chromosome, for example, using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner 2000 Proc Natl Acad Sci USA 97:6640-6645). The pR pL R6K Rep expression cassette may alternatively be transferred to a different vector backbone, such as integration vectors that target different phage attachment sites, for example, those described by Haldimann and Warmer 2001, J Bacteriol 183:6384-6393.
TABLE-US-00002 NTC9385R-EGFP LB media shake flask production yields in R6K production strains Cell Line Rep Gene Rep Gene Promoter 30° C. Spec yield.sup.a 32° C. Spec yield.sup.a 37° C. Spec yield.sup.a NTC661135 P42L-P106L-F107S P.sub.R P.sub.L 1.2 2.1 0.6 NTC711055 P42L-P106L-F107S P.sub.R P.sub.L (OLI-G) 0.5 1.3 9.1 NTC711231 P42L-P106L-F107S P.sub.R P.sub.L (OL1-G to T) 1.3 7.0 9.3 .sup.aSpecific yield = mg plasmid/L/OD.sub.600
[0217] These results are surprising since the art teaches that P.sub.L promoter mutations in the OL1 binding site such as V2 (OL1-G to T) are constitutively active due to an inability of the lambda repressor to stop expression from the P.sub.L promoter (Bailone and Galibert, Supra, 1980). While not limliting the application of the invention, it is possible that the lambda repressor is able to repress the P.sub.L promoter through binding to the OL2 and OL3 sites (
[0218] The application of two independent OL1 mutations (OL1-G and OL1-G to T) to create cell lines for high yield R6K plasmid production demonstrates the general utility of P.sub.L promoters incorporating OL1 mutations to improve heat inducible chromosomal expression of a target protein. Any OL1 mutation is contemplated for use in the current invention. New OL1 mutations can be defined by standard methods known in the art, for example error prone mutagenesis of the OL1 region, with subsequent selection of beneficial OL1 mutations by screening for heat inducible taiget protein production. The taiget protein can be a Rep protein as described herein, or a fluorescent marker, or any target protein or RNA. Thus application of P.sub.L promoters incorporating OL1 mutations is contemplated generally as a platform for improved heat inducible chromosomal expression of any recombinant protein or RNA. This can be applied to improve heat inducible chromosomal expression of any recombinant protein or RNA using either shake flask (Table 2) or fermentation (Table 1) culture.
[0219] These cell lines may also be used to produce alternative R6K plasmids, such as CpGfree vectors, pCOR vectors, pGM169, etc. P.sub.L promoter vectors with the OL1 mutations may be used to improve expression of alternative taiget proteins or mRNAs from the genome.
[0220] These cell lines may also be used to produce alternative Rep protein dependent plasmids, such as ColE2-P9 replication origin plasmids (Examples 2 and 3), ColE2 related replication origin plasmids, etc. Numerous additional Rep protein dependent plasmids known in the art may also be produced using the cell lines of the invention. Many Rep protein dependent plasmids are described in del Solar et al Supra, 1998 which is included herein by reference.
[0221] Heat inducible target protein production may be further improved, by further mutating OL1 -G and OL1-G to T or an alternative OL1 mutation to incorporate a mutation in the P.sub.L-10 GATACT sequence to make it more closely match the consensus TATAAT (-35 is already consensus TTGACA (
[0222] Alternative temperature sensitive (ts) lambda repressors (cI) may be substituted for the cITs857 mutation utilized in the pINT vectors. Multiple alternative ts lambda repressors have been defined (for example, see Lieb M. 1979 J Virol 32:162 incorporated herein by reference) or new ts lambda repressors may be isolated by screening for temperature sensitive cI function.
[0223] Alternative integration methods rather than the described pINT pR pL integration vectors may be utilized such as integration of the pR pL expression cassette into the genome at defined sites using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner Supra, 2000).
Example 2: ColE2-P9 Replication Origin Plasmid Production
[0224] Similar to plasmid R6K, the ColE2 replication origin is separate from the replication protein, so the ColE2 replication origin theoretically may be utilized to construct Rep protein dependent plasmids. Here application of the ColE2 replication origin, using ColE2-P9 as an example, to produce ColE2 Rep protein dependent plasmids is demonstrated (Example 3).
ColE2 Background
[0225] The ColE2 replication origin (for example, ColE2-P9) is highly conserved across the ColE2-related plasmid family (15 members are compared in Hiraga et al Supra, 1994, and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006, both references are included herein by reference). Plasmids containing this origin are normally 10 copies/cell (low copy #). For application in gene therapy or DNA vaccination vectors, the copy number of ColE2 replication origin vectors needs to be improved dramatically.
[0226] Expression of the ColE2-P9 replication (Rep) protein is regulated by antisense RNA (RNAI). Copy number mutations have been identified that interfere with this regulation and raise the copy number to 40/cell (Takechi et al 1994 Mol Gen Genet 244:49-56). pINT pR pL ColE2 Rep Protein Cell Line NTC641711:
[0227] The ColE2 Rep protein (SEQ ID NO: 15) was expressed using the heat inducible pINT pR pL vector as described in Example 1. The ColE2 RNAI region was removed and replaced with an optimal kozak-ATG region. This modification deletes the RNAI -10 promoter box. The Rep internal RNAI -35 box (Yasueda et al 1994 Mol Gen Genet 244: 41-48) was mutagenized (from (opposite strand) TTGAAG to CTGAAG) to lower the consensus. A high copy mutation in the Rep coding region (C139T; Nagase et al 2008 Plasmid 59:36-44) was also incorporated.
[0228] These changes do not alter the Rep protein amino acid sequence (SEQ ID NO: 15).
[0229] The ColE2 Rep gene was PCR amplified from CGSC Strain #8203 with following primers 15061101 :
TABLE-US-00003 (SEQ ID NO : 26) ggaacgggatccagaaggagatatacatatgag tgccgtacttcagcgcttcaggga
15061102 :
TABLE-US-00004 (SEQ ID NO : 27) ggaacggaattcttatcattttgcgagatctgg atcacat
[0230] The 920 bp PCR product was digested with BamHI/ EcoRI and cloned into BamHI/EcoRI digested pINT pR pL BamHI/EcoRI (3766, polylinker). Recombinant clones were selected by restriction digestion and sequence verified. The map of the resultant pINT pR pL CoE2 Rep integration vector is shown in
[0231] A kanR ColE2-P9 replication origin fluorescent reporter plasmid (pDNAVACCUltra5-C2-P⅚,4/6-T7RBS EGFP) was constructed to select for copy number improving mutations. The 1067 bp pUC replication origin was removed from the kanR pDNAVACCUltra5-P⅚,4/6-T7RBS EGFP vector (the pDNAVACCUltra5-EGFP vector disclosed in Williams J A, 2006 World patent application WO06078979, modified to express the EGFP reporter in E. coli utilizing the weak constitutive P⅚,4/6 promoter disclosed in Lissemore J L, Jankowski J T, Thomas C B, Mascotti D P, deFlaseth P L. 2000. Biotechniques 28: 82-89 and included herein by reference) by Nhel-DraIII digestion, and replaced with a 132 bp ColE2-P9 replication origin (+7-ssiA; see below). Recombinant clones were recovered in cell line NTC641711 and the ColE2 origin confirmed by restriction digestion and sequence verification. This demonstrates that the ColE2-P9 Rep protein cell line NTC641711 can be used to select and propagate ColE2 replication origin containing plasmids. ColE2 Rep Protein Mutagenesis, Selection of Copy Number Increasing Mutants
Background
[0232] The ColE2 Rep protein binds as a monomer to the ColE2 replication origin. However, Rep protein exists mostly as a dimer in solution; Rep dimerization will limit the amount of active monomeric Rep which is hypothesized will maintain ColE2 plasmid at a low copy number (Flan M, Aoki K, Yagura M, Itoh T. 2007. Biochem Biophys Res Commun 353:306). Copy number autoregulation by Rep protein dimerization is a common copy number control mechanism. Significantly, R6K Rep protein mutations such as P106L (PIR116) utilized in Example 1 that interfere with dimer formation dramatically increase copy number (Abhyankar et al Supra, 2004). It was hypothesized that ColE2 plasmid copy number can also be increased with a dimerization deficient Rep mutation.
Mutagenesis
[0233] ColE2 Rep protein functional domains have been mapped and a region responsible for dimerization defined (
[0234] Two colonies were isolated from 30,000 screened cells with significantly higher colony fluorescence. Both cell lines were verified to have improved pDNAVACCUltra5-C2-P5/ 6,4/6-T7RBS EGFP plasmid copy number in liquid culture demonstrating increased fluorescence corresponds to increased copy number.
[0235] The lambda repressor-P.sub.L-ColE2 Rep regions from genomic DNA from these two cell lines were amplified by PCR and sequenced to determine the basis for improvement. One colony had a mutation in the lambda repressor which presumably reduces the activity of the repressor leading to Rep protein overexpression. This demonstrates that alternations to the vector backbone that increase P.sub.L promoter activity improve ColE2 plasmid copy number. Thus ColE2 copy number, like R6K plasmids, will be improved by making a cell line with the ColE2 Rep protein (or Rep protein copy number improving mutations) expressed from pINT pR pL vectors incorporating the lambda repressor binding site OL1 mutations (OL1-G and OL1-G to T) identified in Example 1.
[0236] The second colony had a mutation in the Rep protein (G194D; SEQ ID NO: 16). This mutation was introduced back into the pINT pR pL ColE2 Rep vector to create the pINT pR pL ColE2 Rep protein mutant (G194D) (SEQ ID NO: 18). The integration plasmid was integrated into NTC54208 (XLlBlue-sacB [dcm-]) to create cell line NTC701131 as described in Example 1. ColE2 plasmid production yields were improved in the ColE2 Rep protein mutant cell line NTC701131, compared to the parental ColE2 Rep protein cell line NTC641711 in both shake flask and fermentation culture (Table 3). This demonstrates that the ColE2 Rep protein, like the R6K Rep protein, can be mutagenized to create copy number improving variants.
[0237] Combining the ColE2 Rep protein G194D mutant with pINT pR pL vector incorporating the lambda repressor binding site OL1 OL1 -G to T mutation identified in Example 1 further increased copy number (cell line NTC710351=NTC54208-pR pL (OL1-G to T) ColE2 rep G194D) and fermentation production yields (Example 3).
TABLE-US-00005 NTC938SC-Luc plasmid performance in different processes and production cell lines.sup.a ColB2 Plasimid LB shake flask (37 C.) Plasmid + Shake flask (37 C.) .sup.c HyperGRO fermentation production cell line OD.sub.600 mg/L Spec yield.sup.b OD.sub.600 mg/L Spec yield.sup.b OD.sub.600 mg/L Spec yield.sup.b NTC641711 3.4 1.4 0.4 13.0 12.3 0.93 148 61 0.4 NTC701131 3.4 3.1 0.9 16.6 17.9 1.1 113 110 1.0 Rep mutant 140 142 1.0 .sup.aAll plasmid preparations at harvest were high quality monomers. .sup.bSpecific yield = mg plasmid/L/OD.sub.600 .sup.cPlasmid + media from Thomson Instruments Company
[0238] Additional rounds of mutagenesis of the wild type Rep protein, or mutagenesis of mutant Rep protein such as G194D may be performed to further improve copy number. The entire Rep protein or subfragments can be mutagenized (e.g. BamHl-EcoRI fragment for entire Rep protein;
ColE2 Origin Vectors
[0239] The following vectors containing the minimal ColE2-P9 origin (Yagura and Itoh 2006 Biochem Biophys Res Commun 345:872-877) and various origin region modifications were constructed.
+7-ssiA
[0240] This combines the ColE2 origin (+7) (SEQ ID NO: 4) with ssiAfrom plasmid R6K (SEQ ID NO: 21). Thus ssiA vectors contain, in addition to the ColE2-P9 origin, a downstream primosome assembly site. Like most plasmid origins, the ColE2 origin contains a primosomal assembly site about 100 bp downstream of the origin (Nomura et al Supra, 1991). This site primes lagging strand DNA replication (Masai et al 1990 J Biol Chem265:15124-15133) which may improve plasmid copy number or plasmid quality. The ColE2 PAS (ssiA) is similar to PAS-BF1 (ColE1 ssiA=PAS-BL Marians et al 1982 J Biol Chem 257:5656-5662) and both sites (and PAS-BH) are CpG rich ØX174 type PAS. A CpG free PAS (ssiAfrom R6K; Nomura et al Supra, 1991; SEQ ID NO: 21) that acts as a dnaA, dnaB dnaC (ABC) primosome on a dnaA box hairpin sequence (Masai et al 1990 J Biol Chem 265:15134-15144) was selected for inclusion in the +7-ssiA vectors. Alternative ABC or ØX174 type PAS sequences are functionally equivalent to ssiA from R6K, and may be substituted for ssiA in these ColE2 replication origin vectors.
[0241] +7-ssiA vectors were constructed by replacing the pUC origin Nhel-DraIII region (
+7 (No ssiA)
[0242] This deletes the ssiA sequence from +7-ssiA while retaining the ColE2 origin (+7) (SEQ ID NO: 4). The ssiA sequence was removed by Nhel-Mfel digestion, the sites blunted with Klenow and the vector religated to delete the 64 bp ssiA region. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
+7 CpG-ssiA
[0243] This combines the ColE2 replication origin (+7 CpG) (SEQ ID NO: 5) with ssiA from plasmid R6K (SEQ ID NO: 21). The single CpG in the ColE2 replication origin (Table 4) was removed from the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified. +16-ssiA:
[0244] This combines the ColE2 replication origin (+16) (SEQ 30 ID NO:7) with ssiA from plasmid R6K (SEQ ID NO: 21). A 16 bp region of homology downstream of the ColE2-P9 replication origin is conserved with the ColE3 replication origin. This 16 bp region was added to the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
Min-ssiA
[0245] This combines the ColE2 Min replication origin (SEQ ID NO:6) with ssiA from plasmid R6K (SEQ ID NO: 21). This is the minimal 32 bp ColE2 sequence sufficient for replication defined by Yasueda et al 1989 Mol Gen Genet 215:209) (SEQ ID NO: 28), extended by an additional 6 bp (Table 4). This vector was created by site directed mutagenesis of the +7-ssiA clone. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
[0246] The series of plasmids were transformed into ColE2 plasmid production host NTC701131 (Rep mutant). The resultant cell lines were then used determine plasmid copy number and quality (Table 4). Two different backbones were evaluated with the +7-ssiA and +16-ssiA ColE2 replication origins to determine the effect of plasmid sequence alterations.
[0247] The results demonstrate that the four replication origin variants containing the ssiA sequence [+7-ssiA; +16-ssiA; +7 (CpG free) ssiA; Min-ssiA] are functional in NTC701131, replicating to a similar copy number (0.73-1 x). All plasmids were high quality monomer. This demonstrates that any of these minimal ColE2 origin variants can function as a plasmid replication origin to produce high quality plasmid.
[0248] Yagura et al Supra, 2006 have demonstrated that the Min ColE2 Replication origin (SEQ ID NO: 28, which is reverse complement of residues 7-38, in
[0249] A surprising observation that is contrary to the teachings of Yagura et al Supra, 2006 is that the +7(CpG free)-ssiA ColE2 origin is fully functional. This origin contains a change of a G to C in residue 36 (
[0250] The ssiA sequence was not necessary for plasmid replication, although removal of ssiA in +7 (no ssiA) reduced copy number to 55% of +7 (ssiA). Thus inclusion of a primosomal assembly site is beneficial to ColE2 plasmid copy number.
Example 3: NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R Vectors
[0251] A series of AF eukaryotic expression vectors incorporating these novel ColE2-P9 derived vector origins were made. To replace the pUC origin, the +7 (ssiA) ColE2 origin from Example 2 was selected as well as the R6K origin (SEQ ID NO: 1) from Example 1. The features of these vectors (NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R) are summarized in Table 5.
[0252] NTC9682C, NTC9685C (
[0253] NTC9382C, NTC9385C (
[0254] NTC9682C, NTC9682R, NTC9382C, and NTC9382R all express the secreted transgene product as TPA fusion proteins while NTC9685C, NTC9685R, NTC9385C, and NTC9385R all express the native transgene product from a vector encoded ATG start codon.
[0255] The remainder of the vector sequences is identical between the different vectors, with the exception that the two R vectors NTC9682R and NTC9382R (
[0256] An R6K gamma origin vector was constructed by swapping in the R6K gamma origin (SEQ ID NO: 1) in a NotI-DraIII R6K origin synthetic gene for the corresponding NotI-DraIII pUC origin region in NTC8685. The NTC9682R, NTC9685R NTC9382R, NTC9385R vectors were made by standard restriction digestion mediated fragment swaps. The ColE2 origin vectors were constructed in a similar fashion, by swapping in the +7 ssiA ColE2 origin in a Nhel-Dralll synthetic gene for the corresponding Nhel-DraIII pUC origin region. The NTC9682C, NTC9685C, NTC9382C, NTC9385C vectors were made by standard restriction digestion mediated fragment swaps. The 466 bp Bacterial region [NheI site-trpA terminator-R6K Origin-RNA-OUT-KpnI site] for NTC9385R and NTC9685R is shown in SEQ ID NO: 19. The 281 bp Bacterial region [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] for NTC9385C and NTC9685C is shown in SEQ ID NO: 20.
[0257] High fermentation yields in HyperGRO media are obtained with these vectors. For example 695 mg/mL with NTC9685R-EGFP in R6K production cell line NTC711231 (Table 1) and 672 mg/L with NTC9385C-EGFP in ColE2 production cell line NTC710351.
[0258] These are just a few possible nonlimiting vector configurations. Many alternative vector configurations incorporating the novel R6K or ColE2 origin vector modifications may also be made, including but not limited to vectors with alternative selection markers, alternative promoters, alternative terminators, and different orientations of the various vector-encoded elements or alternative R6K or ColE2 origins as described in Examples 1 and 2.
TABLE-US-00006 NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C,NTC9685C, NTC9682R, and NTC9685R vectors Vector Origin VA RNAI presence SV40 enhancer Transgene targeting NTC9382C ColE2-P9 No No Secretion (TPA) NTC9382R R6K No No Secretion (TPA) NTC9682C ColE2-P9 Yes Yes Secretion (TPA) NTC9682R R6K Yes Yes Secretion (TPA) NTC9385C ColE2-P9 No No Native (SEQ ID NO: 8) NTC9385R R6K No No Native (SEQ ID NO: 2) NTC9685C ColE2-P9 Yes Yes Native (SEQ ID NO: 9) NTC9685R R6K Yes Yes Native (SEQ ID NO: 3)
An example strategy for cloning into these vectors is outlined below.
TABLE-US-00007 GTCGACATG--------Gene of interest----Stop codon ------AGATCT
indicates text missing or illegible when filed
[0259] For the NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors, the ATG start codon (double underlined) is immediately preceded by a unique SaII site. The SaII site is an effective Kozak sequence for translational initiation. In NTC9382C, NTC9682C, NTC9382R, and NTC9682R, the SaII site is downstream in frame with the optimized TPA secretion sequence (SEQ ID NO: 25). The TEA ATG start codon is double underlined and the SaII site single underlined.
TABLE-US-00008 SEQ ID NO: 25: TPA secretion sequence atggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtctt cgtttcgcccagcggtaccggatccgtcgac
[0260] For precise cloning, genes are copied by PCR amplification from clones, cDNA, or genomic DNA using primers with Sail (5′ end) and BgIII (3′ end) sites. Alternatively, genes are synthesized chemically to be compatible with the unique SaII/BgIII cloning sites in these vectors.
[0261] For NTC9385C, NTC9685C, NTC9385R, and NTC9685R, the start codon ATG may immediately follow the SaII site (GTCGACATG) since the SaII site is a high function Kozak sequence. For all vectors one or two stop codons (preferably TAA or TGA) may be included after the open reading frame, prior to the BgIII site. A PCR product or synthetic gene designed for NTC9385C, NTC9685C, NTC9385R, and NTC9685R is compatible with, and can also be cloned into, the NTC9382C, NTC9682C, NTC9382R, and NTC9682R vectors.
[0262] EGFP and muSEAP transgene versions NTC9385C, NTC9685C, NTC9385R, and NTC9685R were constructed by standard restriction fragment swaps. The muSEAP gene is secreted using its endogenous secretion signal, while EGFP is cell associated. Expression levels in vitro were determined using EGFP, while expression levels in vivo were determined using muSEAP Expression levels were compared to the NTC8685 parent vector, the gWIZ vector, and a minicircle comparator.
[0263] Adherent HEK293 (human embryonic kidney), A549 (human lung carcinoma), cell lines were obtained from the American Type Culture Collection (Manassas, Va., USA). Cell lines were propagated in Dulbecco’s modified Eagle’s medium/F12 containing 10% fetal bovine serum and split (0.25% trypsin-EDTA) using Invitrogen (Carlsbad, Calif., USA) reagents and conventional methodologies. For trans-fections, cells were plated on 24-well tissue culture dishes, plasmids were transfected into cell lines using Lipo-fectamine 2000 following the manufacturer’s instructions (Invitrogen).
[0264] Total cellular lysates for EGFP determination were prepared by resuspending cells in cell lysis buffer (BD Biosciences Pharmingen, San Diego, Calif., USA), lysing cells by incubating for 30 min at 37° C., followed by a freeze-thaw cycle at -80° C. Lysed cells were clarified by centrifugation and the supernatants assayed for EGFP by FLX800 microplate fluorescence reader (Bio-Tek, Winooski, Vt., USA). The results are summarized in
[0265] Groups of five mice were injected with plasmid DNA in an IACUC-approved study. Five micrograms of muSEAP plasmid in 25 or 50 .Math.L of phosphate-buffered saline (PBS) was injected intramuscularly (IM) into a tibialis cranialis muscles of female BALB/c mice or ND4 Swiss Webster mice (6 to 8 weeks old) followed by Ichor TriGrid electroporation. SEAP levels in serum were determined using the Phospha-light SEAP Reporter Gene Assay System from Applied Biosystems (Foster City, Calif.) according to the manufacturer’s instructions. The results are summarized in
[0266] The NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors had similar expression to the parent NTC8685 vector in vitro, and higher expression than the gWIZ comparator (
TABLE-US-00009 gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685 Plasmid % NTC8685 expression in vitro.sup.a % NTC8685 expression T =7 day BALB/c.sup.b % NTC8685 expression T =7 days ND4.sup.b % NTC8685 expression T =28 days BALB/c.sup.b % NTC8685 expression T =28 days ND4.sup.b gWIZ 58 59 57 21 57 NTC8385 NA NA 101 NA 101 NTC9385C 92 377 349 150 233 Minicircle.sup.c NA 89 NA 40 NA .sup.a 100 .Math.g/well BGFP transgene vectors transfected with lipofectamine into HEK293 cells .sup.b murine SEAP (muSEAP) transgene vectors in 8-10 week old BALB/c ND4 Swiss Webster female mice. 5 .Math.g dose with EP intramuscular into one anterior muscle followded by Labor TriGrid electroporation. 25 .Math.L dose for ND4 mice, 50 .Math.L dose gor BALB/c. .sup.c Minicircle equivalent to NTC9385C or NTC9385R, with Nbel-KpaI region containing the replication origin and RNA-OUT selection marker (bacteral region) removed from NTC8385-muSEAP by Spel/Nbel digestion, gel purification of the enkaryotic region in vitro ligation and superceiling with DNA gyrase. The SpeI site is the same site used to truncate the CMV promoter to make NTC8685 and the NTC9385C muSEAP vector so the minicircle cukaryotic region is the same as NTC9385C-muSEAP, the difference being the C2 and RNA-OUT region including the KpaI site is deleted in the minicircle. NA = Not assayed
[0267] This improved in vivo expression was not specific to the CMV promoter. Versions of NTC8685-muSEAP and NTC9385C-muSEAP were constructed in which the murine creatine kinase (MCK) promoter (3 copies of the MCK Enhancer upstream of the MCK promoter and 50 bp of the MCK exon 1 leader sequence; Wang B, Li J, Fu F H, Chen C, Zhu X, Zhou L, Jiang X, Xiao X. 2008. Gene Ther 15:1489) was substituted for the CMV promoter. The swaps replaced the entire CMV enhancer CMV promoter-exon 1 leader (NTC8685: from a Xbal site immediately after the SV40 enhancer to a SacII site in the CMV derived exon 1 leader sequence
[0268] While the basis for expression improvement is unknown, it is not simply due to the size difference between the parent pUC origin vectors and the modified R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors of the invention, since expression was not improved with a minicircle comparator vector that contains no bacterial region (Table 6). This demonstrates improved in vivo expression with the R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors is not the result of simple elimination of a threshold amount of bacterial region sequences.
[0269] Reduction of the vector spacer region size as described herein by replacement of the spacer region replication origin and selection marker with the R6K, ColE2 origin-RNA selection marker vectors of the invention will also increase the duration of in vivo expression since expression duration is improved with plasmid vectors in which the bacterial region is removed (minicircle) or replaced with a spacer region of up to at least 500 bp (Lu J, Zhang F, Xu S, Fire A Z, Kay M A. 2012. Mol Ther. 20:2111-9). Thus the replicative minicircle vectors of the invention also have additional utility for applications requiring extended duration expression, such as: liver gene therapy using hydrodynamic delivery with transgenes such as a-1 antitrypsin (AAT) for AAT deficiency, Coagulation Factor VIII for Hemophilia A Therapy or Coagulation Factor IX for Hemophilia B Therapy etc: lung gene therapy with transgenes such as Cystic fibrosis transmembrane conductance regulator 30 (CFTR) for cystic fibrosis etc; muscle gene therapy with transgenes such as the GNE gene for Hereditary inclusion body myopathies (HIBM), or dystrophin or dystrophin minigenes for duchenne muscular dystrophy (DMD).
Example 4: Spacer Region and Intron Modified Nanoplasmid Vectors
[0270] NTC8685 (SR=1465 bp) has much lower expression than NTC9385R (SR=466 bp) and NTC9385C (SR=281 bp). A minimal pUC origin vector was constructed with an 866 bp spacer region (NTC8385-Min; contains Pml,, minimal pUC origin-RNA-OUT). These vectors were tested for expression in vitro (lipofectamine 2000 delivery) and in vivo after intradermal electroporation delivery. As with Intramuscular injection (Example 3), the results (Table 7) demonstrated ColE2 and R6K origin vector dramatically improved in vivo expression after intradermal delivery compared to NTC8685. For example the NTC9385C vector was unexpectedly improved 2.7 to 3.1x compared to NTC8685 while the NTC9385R vector was unexpectedly improved 5.3 to 6.3x that of NTC8685 (Table 7). The 866 bp minimal pUC origin vector also improved expression to 1.4-1.9x that of NTC8685. This demonstrates improved in vivo expression with the NTC9385C and NTC9385R vectors is not limited to muscle tissue, and is observed also after intradermal delivery. Inclusion of the C2x4 eukaryotic transcription terminator in the NTC9385C vector further improved in vivo expression to 2.9 to 4.1x compared to NTC8685. This demonstrates improved in vivo expression with Nanoplasmid vectors may be obtained with alternative/additional sequences flanking the bacterial region.
[0271] A NTC9385R derivative was made in which the RNA-OUT antibiotic free marker was transferred to the intron (NTC9385Ra-02 SEQ ID NO: 39; RNA-OUT SEQ ID NO:23) inserted into the unique HpaI site in the intron (SEQ ID NO: 30). This vector encodes the R6K replication origin in the spacer region (SR=306 bp). To determine splicing accuracy NTC9385Ra-02-EGFP was transfected into the A549 cell line and cytoplasmic RNA isolated. The RNAwas reverse transcribed using an EGFP specific primer, and PCR amplified using Exon 1 and Exon 2 specific primers. The resultant PCR product (a single band) was determined by 5 sequencing to be the correct spliced exonl -exon2 fragment. This demonstrated that intronic RNA-OUT is accurately removed by splicing and does not interfere with splicing accuracy. NTC9385Ra-02-EGFP also demonstrated improved in vivo expression compared to NTC8685 (Table to 7: 1.6-3.5x). This demonstrates that Nanoplasmid vectors with improved expression of the current invention may encode the RNA selection marker in the intron rather than the spacer region.
[0272] The improved expression level after intradermal delivery demonstrates the application of Nanoplasmid vectors of the invention for cutaneous gene therapy applications, for example, for wound healing, bums, diabetic foot ulcer, or critical limb ischemia therapies using growth factors such as hypoxia inducible factor, hypoxia inducible factor 1α, keratinocyte growth factor, vascular endothelial growth factor (VEGF), fibroblast growth factor-1 (FGF-1, or acidic FGF), FGF-2 (also known as basic FGF), FGF-4, placental growth factor (P1GF), angiotensin-1 (Ang-1), hepatic growth factor (HGF), Developmentally Regulated Endothelial Locus 25 (Del-1), stromal cell derived factor-1 (SDF-1), etc.
TABLE-US-00010 SR vector expression in vitro and in vivo muSEAP Vector.sup.b SR.sup.a SR (bp) Intron.sup.a A549 (A.sub.405).sup.d HEK-293 (A.sub.405).sup.d ID + EP.sup.e (pg/mL) T = 4 ID + EP (pg/mL) T = 7 ID + EP.sup.e (pg/mL) T = 14 NTC8685 T-Val-BH-A
.fwdarw. 1465 HR- β 0.240 = 0.029 (1.0x) 3.002 ± 0.188 (1.0x) 1.9 ± 1.2 (1.0x) 6.7 ± 4.1 (1.0x) 5.0 ± 3.9 (1.0x) NTC8385-Min
A
.fwdarw. 866 HR- β 0.495 ± 0.027 (1.0x) 2.713 ± 0.177 (1.0x) 3.7 ± 2.7 (1.0x) 12.4 ± 8.1 (1.0x) 7.1 ± 5.2 (1.0x) NTC9385R (SEQ ID NO: 2) T ←R-A
.fwdarw. 466 HR- β 0.604 ± 0.04 (1.0x) 3.036 ± 0.169 (1.0x) 13.0 ± 7.4 (1.0 x) 35.5 ± 31.1 (1.0 x) 29.9.± 23.4 (1.0 x) NTC9385C (SEQ ID NO: 8) ←C-A
.fwdarw. 281 HR-β 0.267 ± 0.053 (1.1x) 2.720 ± 0.238 (0.9x) 5.8 ± 3.0 (3.1 x) 20.8 ± 9.6 (3.1 x) 13.5 ± 9.8 (2.7x) NTC9385C (2×4 ←C-A
.fwdarw. 281 HR- β 0.214 ± 0.017 (0.89x) 2.472 ± 0.197 (0.82x) 5.6 ± 2.3 (2.9 x) 27.7 ± 20.3 (4.1 x) 16.0 ± 14.3 (3.2x) NTC9385R a-O2 (SEQ ID NO: 39) T←R 306 HR-←AF- β 0.524 ± 0.071 (2.2x) 3.065 ± 0.220 (1.0x) 3.6 ± 2.8 (1.9x) 23.4 ± 16.5 (3.5 x) 7.8 ± 8.0 (1.6 x) .sup.a
.sup.b
.sup.c
.sup.d
.sup.e
indicates text missing or illegible when filed
Example 5: RNA Pol III Nanoplasmid Vectors
[0273] An example Nanoplasmid vector for RNA Pol III directed expression of RNA is shown in
[0274] RNA Pol III Nanoplasmid vectors were made by standard restriction digestion mediated fragment swaps to combine either U6 or HI RNA Pol III promoter-target RNA-TTTTTT terminator (Eukaryotic region) with either the 466 bp Bacterial region [NheI site-trpA terminator-R6K Origin-RNA-OUT-KpnI site; SEQ ID NO: 19] for NTC9385R-U6 and NTC9385RE-U6 vectors (Table 8) or the 281 bp Bacterial region [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site; SEQ ID NO: 20] for NTC9385C-U6 and NTC9385CE-U6 vectors (Table 8). Versions were modified to express from the U6 promoter eRNA18, a single stranded RNA the expression of which can be quantified by Reverse transcriptase dependent RT-PCR. Vector performance (U6 promoter mediated eRNA18 RNA expression) was determined in total RNA extracted from HEK293 at either 25 or 48 hrs after lipofectamine 2000 mediated transfection as described (Luke J, Simon G G, Soderholm J, Errett J S, August J T, Gale M Jr, Flodgson C P, Williams J A. 2011. J Virol. 85:1370). These results (Table 9) demonstrate Nanoplasmid RNA Pol III vectors direct dramatically improved RNA expression relative to a plasmid RNA Pol III vector (NTC7485-U6-eRNA18) comparator.
[0275] Random 22 bp shRNA (KP2F11) versions of NTC9385CE-U6 (903 bp NTC9385CE-U6-KP2F11 shRNA propagated in ColE2 rep cell line NTC710351) and NTC9385R-U6 (855 bp NTC9385R-U6-KP2F11 shRNA propagated in R6K rep cell line NTC711231) were fermented in FlyperGRO media as described in Example 1 except fermentation and cultures for inoculations were grown at 37° C. throughout. Final yields were 149 mg/L (NTC9385CE-U6-KP2F11) and 216 mg/L (NTC9385R-U6- KP2F11 shRNA). This demonstrates that Nanoplasmid vectors for RNA Pol III expression (and RNA Pol II; Example 3) have superior manufacturing simplicity and yield com-pared to shRNA expressing minicircle vectors (Zhao et al 2011. Gene Ther 18:220-224). For example, optimal manu-facture of minicircle vectors yields only 5 mg of minicircle per liter culture (Kay M A, He C Y, Chen Z Y. 2010. Nat 5 Biotechnol 28:1287-1289).
TABLE-US-00011 RNA Pol III Nanoplasmid vector expression Vector Pol II Enhancer Size (bp) Transfection 1: RNA isolated 48 hr post transfection Transfection 2: RNA isolated 25 hr post transfection HEK pg RNA/100 ng mRNA.sup.a HEK Std.sup.b HEK pg RNA/100 ng mRNA.sup.a HEK Std.sup.b NTC9385R-EGFP (negative control) None NA 0.0 ± 0.0 0% NTC8885MP-U6-cRNA18 SV40 1578.sup.c 62.2 ± 5.9 (1.3x) 69% NTC9385RE-U6-eRNA18 SV40 1178 119.1 ± 13.9 (2.5x) 98% NTC9385R-U6-eRNA18 None 945.sup.d 123.7 = 8.0 (2.6x) 82% NTC9385CE-U6-eRNA18 SV40 993 119.0 ± 13.9 (2.5x) 83% NTC9385C-U6-eRNA18 None 760.sup.e 131.1 ± 10.5 (2.7x) 70% 57.3 ± 2.6 (5.0x) 127% NTC7485-U6-eRNA18 SV40 2978 48.0 ± 1.3 (1x control) 100% (100% control) 11.5 ± 1.5 (1x) 100% (control) .sup.apg eRNA18 target/100 ng total RNA isolated post-transfection. .sup.bStandarized mU6 expression compared to NTC7485-U6 shRNA eRNA18 vector (C) = test vector average pg RNA × test vector size (bp)/2978 × 100% .sup.cPmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO: 43) with SV40) is 1035 bp .sup.dR6K origin and RNA-OUT (bacterial region = SEQ ID NO: 19). HI promoter version (with shRNA) is 635 bp .sup.eC2 origin and RNA-OUT (bacteria region = SEQ ID NO: 20). HI promoter version (with shRNA) is 442 bp (
Example 6: Alternative RNA Selection Marker Nanoplasmid Vectors
[0276] Expression of Nanoplasmid vectors encoding RNA-OUT in the intron (both orientations of RNA-OUT SEQ ID NO: 23 inserted into the unique HpaI site in the intron SEQ ID NO: 30; NTC9385Ra-01 dual and NTC9385Ra-02 dual) demonstrated robust expression with RNA-OUT in either orientation in the intron (Table 9). Consistent with this, similarly high levels of expression are obtained with NTC9385Ra-01 (SEQ ID NO: 40) and NTC9385Ra-02 (SEQ ID NO: 39) which have opposite orientations of intronic RNA-OUT marker and the R6K origin in the spacer region. Nanoplasmid variants with the pMB1 antisense RNA RNAI (SEQ ID NO: 31) with promoter and terminator region (RNAI selectable marker: SEQ ID NO: 32 flanked by DraIII-KpnI restriction sites for cloning as described previously for RNA-OUT) substituted for RNA-OUT were constructed and tested for expression to determine if alternative selection markers may be utilized in place of RNA-OUT. The results (Table 9) demonstrate alternative RNA selection markers may be substituted for RNA-OUT. Substitution of 60 RNAI for RNA-OUT in the vector backbone (NTC9385Ra- RNAI-O1) or in the intron in either orientation (NTC9385R-RNAI-O1 and NTC9385R-RNAI-O2) did not reduce expression relative to the corresponding RNA-OUT construct. To determine splicing accuracy, NTC9385R-RNAI-O1-EGFP and NTC9385R-RNAI-O2-EGFP were transfected into the A549 cell line and cytoplasmic RNA isolated from transfected HEK293 and A549 cells using the protein and RNA isolation system (PARIS kit, Ambion, Austin Tex.) and quantified by A.sub.260. Samples were DNase treated (DNA-free DNase; Ambion, Austin Tex.) prior to reverse transcription using the Agpath-ID One step RT-PCR kit (Ambion, Austin Tex.) with a EGFP transgene specific complementary strand primer. Intron splicing was determined by PCR amplification of the reverse transcribed cytoplasmic RNA with the exon 1 and exon 2 specific primers. The resultant PCR product (a single band in each case) was determined by sequencing to be the correct spliced exon1-exon2 fragment. This demonstrated that, like intronic RNA-OUT, intronic RNAI in either orientation is accurately removed by splicing and does not interfere with splicing accuracy. This demon-strates that alternative RNA based selection markers could be substituted for RNA-OUT in the spacer region or the intron and that pMB 1 RNAI is a preferred RNA based selection marker.
[0277] The RNAI transcription unit (SEQ ID NO: 32) may be substituted for the RNA-OUT selection marker (SEQ ID NO: 23) in any of the constructs described in Examples 1-6. Alternatively, the 108 bp RNAI antisense repressor RNA (SEQ ID NO: 31) may be substituted for the 70 bp RNA-OUT antisense repressor RNA (SEQ ID NO: 24) retaining the flanking RNA-OUT transcription control sequences in any of the constructs described in Examples 1-6. RNAI regulated vectors may be grown in RNAII-SacB regulated cell lines further expressing, as required, R6K, ColE2-P9, or ColE2 related rep protein. RNAII-SacB regulated cell lines may be made replacing the RNA-IN sequence in pCAH63- CAT RNA-IN-SacB (P⅚ 6/6) with a RNAII taiget sequence as described in Williams, J A Supra, 2008 included herein by reference. Alternatively, RNAI regulated vectors may be grown in any of the RNAII regulated chromosomal selection marker cell lines disclosed in Grabherr and, Pfaffenzeller Supra, 2006; Cranenburgh Supra, 2009. These cell lines would be modified for expression, as required, of R6K, ColE2-P9, or ColE2 related rep protein.
[0278] Another preferred RNA based selection marker, IncB plasmid RNAI (SEQ ID NO: 33; SEQ ID NO: 34), is shown in
TABLE-US-00012 High level expression is explained with pMBI RNAI or RNA-OUT universe RNA vectors Vector (EGFP) Spacer region.sup.a SR (bp) Intron.sup.a A549 FU.sup.b (T = 48 hr mean + SD) HEK293 FU.sup.b (T = 48 hr mean + SD) NTC8685 T-VAI-BH-P-AF-SV40 1465 HR- β.sup.a 8546 = 1163 (1.0x) 62068 = 1760 (1.0x) NTC8385 (0.85 kb).sup.d T-P.sub.min-AF-BB 866 HR- β.sup.c 9364 ± 966 (1.10x) 31482 ± 1822 (0.51x) NTC9385C (SEQ ID NO: 8) ←C - AF.fwdarw. 281 HR- β.sup.c 8860 ± 382 (1.04x) 3.3356 ±1489 (0.54x) NTC9385R (SEQ ID NO: 2) ←R - AF.fwdarw. 466 HR- β.sup.a 16237 ± 2520 (1.90x) 55919 ± 6371 (0.90x) NTC9385Rn-O2 (SEQ ID NO: 39) ←R 306 HR ← AF - β 14510 ± 835 (1.70x) 49526 ± 2179 (0.50x) NTC9385Ra-O1 dual ←R -AF.fwdarw. 466 HR-AF.fwdarw. β 13929 ± 129 (1.63x) 56552 ± 2714 (0.91x) NTC9385Ra-O2 dual ←R -AF.fwdarw. 466 HR-←AF- β 12543 ± 245 (1.47x) 54379 ± 1244 (0.89x) NTC9385Ra-RNAI-O1 ←RRNAI.fwdarw. 488 HR-AF.fwdarw. β 15773 ± 238 (1.85x) 55468 ± 6619 (0.89x) NTC9385R-RNAI-O1 ←R-AF.fwdarw. 466 HR← RNAI - β 14296 ± 287 (1.67x) 60630 ± 2176 (0.98x) NTC9385R-RNAI-O2 ←R -AF .fwdarw. 466 HR - RNAI .fwdarw. β 12271 ± 466 (1.44x) 6069 ± 6482 (0.98x) .sup.a rPa term = TMS-M =HR: B globin I′ accptor side δ: RNA-OUT sucrose reaction maker = AF: pHC region RNAI variance RNA =RNAI (. p) /( origin = R: CoE2 origin = C; BH = PAS-BH VP = upstrream pUC plasmid derived DNA .sup.b EGFP plasmid DNA transfected with Lipofectmine 2000. Fluorescence nids (FU) reported Mese FU standardized m NTC8685 .sup.c HR p irdron is 225 bp .sup.d Pmin minimal pUC origin (SEQ ID NO: 42) abd RNA-OUT (bacterial region = SEQ ID NO: 43)
[0279] Thus, the reader will see that the improved expression vectors of the invention provide for a rational approach to improve plasmid expression.
[0280] While the above description contains many examples, so these should not be construed as limitations on the scope of the invention, but rather should be viewed as an exempli-fication of preferred embodiments thereof. Many other variations are possible. For example, the RNA-OUT selectable marker may be substituted with an alternative RNA-OUT sequence variant that functionally binds RNA-IN to repress expression, for example, a CpG free RNA-OUT (SEQ ID NO: 36). A CpG free R6K-RNA-OUT bacterial region (SEQ ID NO: 37) or CpG free ColE2-RNA-OUT bacterial region (SEQ ID NO: 38) may be utilized. Likewise, the RNA-OUT promoter and/or terminator could be substituted with an alternative promoter and/or terminator. Likewise, the ColE2-P9 or R6K replication origin may be substituted with a ColE2 related replication origin, and propagated in a strain expressing the ColE2 related replication origin replication protein. Likewise, the ColE2-P9 or R6K origin may be substituted with an origin from one of the numerous additional Rep protein dependent plasmids that are know in the art, for example the Rep protein dependent plasmids described in del Solar et al Supra, 1998 which is included herein by reference. Likewise, the vectors may encode a diversity of transgenes different from the examples provided herein, for example, antigen genes for a variety of pathogens, or therapeutic genes such as hypoxia inducible factor, keratinocyte growth factor, factor IX, factor VIII, etc, or RNA genes such as microRNAs or shRNA. to Likewise, the eukaryotic region may express RNA from a RNA Pol III promoter as described herein. The orientation of the various vector-encoded elements may be changed relative to each other. The vectors may optionally contain additional functionalities, such as nuclear localizing sequences, and/or immunostimulatory RNA elements as disclosed in Williams, Supra, 2008. The vectors may include a boundary element between the bacterial region and the eukaryotic region, for example, the CMV promoter boundary element upstream of the CMV enhancer (or heterologous promoter enhancer) may be included in the vector design (e.g. NTC9385R-BE; SEQ ID NO: 41). The vectors may include a eukaryotic transcriptional terminator between the bacterial region and the eukaryotic region, for example, the 4xC2 terminator or the gastrin terminator. Likewise, the vectors may utilize a diversity of RNA Pol II promoters different from the CMV promoter examples provided herein, for example, constitutive promoters such as the elongation factor 1 (EF1) promoter, the chicken ß-actin promoter, the ß-actin promoter from other species, the elongation factor-1a (EF1a) promoter, the phosphoglycerokinase (PGK) promoter, the Rous sarcoma virus (RSV) promoter, the human serum albumin (SA) promoter, the α-1 antitrypsin (AAT) promoter, the thyroxine binding globulin (TBG) promoter, the cytochrome P450 2E1 (CYP2E1) promoter, etc. The vectors may also utilize combination promoters such as the chicken ß-actin/CMV enhancer (CAG) promoter, the human or murine CMV-derived enhancer elements combined with the elongation factor 1α (EF1α) promoters, CpG free versions of the human or murine CMV-derived enhancer elements combined with the elongation factor 1a (EF1α) promoters, the albumin promoter combined with an α-feto- protein MERII enhancer, etc, or the diversity of tissue specific or inducible promoters know in the art such as the muscle specific promoters muscle creatine kinase (MCK), and C5-12 described herein or the liver-specific promoter apolipoprotein A-I (ApoAI).
[0281] Accordingly, the scope of the invention should be determined not by the embodiments illustrated, but by the appended claims.