METHODS OF TREATING DUCHENNE MUSCULAR DYSTROPHY USING AAV MINI-DYSTROPHIN GENE THERAPY
20230241248 · 2023-08-03
Inventors
- Phoebe Arnold BALDUS (Chesterfield, MO, US)
- David Roger BEIDLER (Newton, MA, US)
- Michael BINKS (Cambridge, MA, US)
- Suzanne C. DEMARCO (Manchester, MO, US)
- Rong HUANG (Chapel Hill, NC, US)
- Tara MCDONNELL MOOREHEAD (Hopkinton, MA, US)
- Srividya NEELAKANTAN (East Walpole, MA, US)
- Hendrik NEUBERT (Charlestown, MA, US)
- Herbert RUNNELS (Chesterfield, MO, US)
- Savita SANKAR (Chesterfield, MO, US)
- Tatiana G. SHAPKINA (Raleigh, NC, US)
- Sarah Paige SHERLOCK (Lincoln, MA, US)
- Laurence Oliver WHITELEY (Lexington, MA, US)
- Florence Hiu-Ling YONG (Lexington, MA, US)
Cpc classification
C12N2800/22
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/0083
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
C12N2830/008
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
The disclosure describes methods of treating humans with Duchenne muscular dystrophy by providing doses of an AAV9 vector that expresses a mini-dystrophin protein in transduced muscle cells.
Claims
1. A method for preparing a pharmaceutical composition for treating Duchenne muscular dystrophy (DMD), comprising: titering a sample of purified recombinant AAV vector by a quantitative PCR (qPCR) assay, wherein said recombinant AAV vector comprises an AAV capsid and a vector genome comprising a first AAV ITR, a muscle-specific transcriptional regulatory element operably linked to a nucleotide sequence encoding a mini-dystrophin protein consisting of the amino acid sequence of SEQ ID NO:7, a transcription termination sequence, and a second AAV ITR, and formulating said sample with a pharmaceutically acceptable carrier to contain a predetermined number of vector genomes per unit volume.
2. The method of claim 1, wherein each of said AAV ITRs is an AAV2 ITR.
3. The method of claim 2, wherein said nucleotide sequence encoding mini-dystrophin protein is codon optimized.
4. The method of claim 3, wherein said nucleotide sequence encoding mini-dystrophin protein comprises the nucleotide sequence of SEQ ID NO:1, or a sequence at least 90% identical thereto.
5. The method of claim 1, wherein said muscle-specific transcriptional regulatory element is derived from the human or mouse creatine kinase gene.
6. The method of claim 5 wherein said muscle-specific transcriptional regulatory element comprises an enhancer and a promoter.
7-10. (canceled)
11. The method of claim 1, wherein a therapeutically effective dose of said recombinant AAV vector about 2×10.sup.14 vg/kg, or a dose range selected from the group consisting of 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, and 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg.
12-38. (canceled)
39. The method of claim 1, wherein said qPCR assay is a transgene qPCR assay performed using forward and reverse primer oligonucleotides that specifically anneal to said nucleotide sequence encoding human mini-dystrophin protein, wherein the amplification product is detected using a probe oligonucleotide, and wherein quantification of the amplification product is in reference to a standard curve produced from serial dilutions of a standard comprising the same nucleotide sequence encoding human mini-dystrophin protein.
40. The method of claim 39, wherein said nucleotide sequence encoding human mini-dystrophin protein is provided by SEQ ID NO:1.
41. The method of claim 40, wherein the forward primer oligonucleotide (F), probe oligonucleotide (P) and reverse primer oligonucleotide (R) used in the assay are selected from the group of primer-probe sets consisting of: TABLE-US-00019 15 F 77 P 132 R, 38 F 82 P 126 R, 42 F 77 P 131 R, 98 F 156 P 275 R, 113 F 156 P 241 R, 178 F 205 P 259 R, 240 F 283 P 356 R, 256 F 384 P 430 R, 333 F 382 P 422 R, 397 F 431 P 488 R, 398 F 431 P 487 R, 400 F 420 P 489 R, 739 F 773 P 836 R, 740 F 773 P 837 R, 805 F 828 P 894 R, 805 F 850 P 903 R, 1009 F 1072 P 1118 R, 1010 F 1072 P 1121 R, 1042 F 1072 P 1127 R, 1102 F 1128 P 1173 R, 1112 F 1221 P 1273 R, 1112 F 1157 P 1201 R, 1143 F 1221 P 1307 R, 1177 F 1221 P 1335 R, 1288 F 1311 P 1370 R, 1316 F 1341 P 1399 R, 1345 F 1387 P 1434 R, 1351 F 1387 P 1475 R, 1370 F 1407 P 1476 R, 1406 F 1437 P 1495 R, 1408 F 1437 P 1497 R, 1585 F 1607 P 1645 R, 1609 F 1688 P 1769 R, 1750 F 1804 P 1929 R, 1838 F 1868 P 1927 R, 1910 F 1934 P 1986 R, 1955 F 1985 P 2028 R, 2116 F 2138 P 2237 R, 2218 F 2285 P 2379 R, 2319 F 2367 P 2408 R, 2349 F 2399 P 2453 R, 2434 F 2504 P 2573 R, 2450 F 2504 P 2552 R, 2470 F 2492 P 2549 R, 2483 F 2492 P 2547 R, 2485 F 2525 P 2574 R, 2533 F 2574 P 2623 R, 2601 F 2623 P 2690 R, 2602 F 2623 P 2691 R, 2604 F 2624 P 2736 R, 2652 F 2673 P 2737 R, 2720 F 2746 P 2809 R, 2721 F 2746 P 2805 R, 2721 F 2746 P 2810 R, 2776 F 2825 P 2865 R, 2786 F 2828 P 2868 R, 2950 F 2970 P 3028 R, 2955 F 2972 P 3027 R, 2970 F 3016 P 3059 R, 2971 F 3017 P 3060 R, 2972 F 3017 P 3061 R, 3041 F 3086 P 3130 R, 3148 F 3178 P 3238 R, 3149 F 3178 P 3237 R, 3166 F 3208 P 3255 R, 3206 F 3237 P 3306 R, 3218 F 3238 P 3304 R, 3218 F 3264 P 3307 R, 3220 F 3264 P 3309 R, 3273 F 3302 P 3362 R, 3285 F 3324 P 3375 R, 3286 F 3324 P 3375 R, 3462 F 3515 P 3557 R, 3538 F 3570 P 3610 R, 3587 F 3658 P 3748 R, 3677 F 3709 P 3765 R, 3729 F 3749 P 3880 R, and 3755 F 3845 P 3915 R.
42. The method of claim 39, wherein said probe oligonucleotide comprises a fluorescent reporter dye and a quencher dye.
43. The method of claim 42, wherein said fluorescent reporter dye is selected from the group consisting of: 6-FAM™, FAM™, VIC™, NED™, HEX™, TET™, TAMRA™, JOE™, ROX™, Cyanine 3, Cyanine 5, Cyanine 5.5, Cal Fluor® Gold 540, Cal Fluor® Orange 560, Cal Fluor® Red 590, Quasar® 570, Quasar® 670, and TxRd (Sulforhodamine 101-X).
44. The method of claim 43, wherein said quencher dye is selected from the group consisting of: TAMRA, DABCYL dT, BHQ®-1, BHQ®-2, BHQ®-3, OQ, MGB NFQ, Iowa Black® FQ, and Iowa Black® RQ.
45. The method of claim 39, wherein the amplification reactions of said transgene qPCR assay are performed using forward and reverse primer oligonucleotides at a concentration of 50-1200 nM.
46. The method of claim 39, wherein the amplification reactions of said transgene qPCR assay are performed using probe oligonucleotide at a concentration of 50-500 nM.
47. The method of claim 39, wherein said transgene qPCR assay is performed using a two-step thermocycler program wherein the denaturation step occurs at 95° C. for 10-30 seconds, and the combined annealing and elongation step occurs at 60° C. for 30-90 seconds.
48. The method of claim 39, wherein the standard curve of said transgene qPCR assay has an efficiency value E between 90% and 110%, and an R.sup.2 value of at least 0.98.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063] p<0.01;
p<0.001), both as negative controls.
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084] p<0.01), and compare later trials against trial 1 in vehicle treated Dmd.sup.mdx rats (§ § p<0.01, § § § p<0.001).
[0085]
[0086] p<0.05).
[0087] p<0.05), Dmd.sup.mdx rats treated with vehicle against WT rats receiving vehicle (**p<0.01, ***p<0.001), and trial 5 against trial 1 in vehicle treated Dmd.sup.mdx rats (§§ p<0.01).
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
DETAILED DESCRIPTION OF THE INVENTION
[0098] The present invention will now be described with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
[0099] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
[0100] Nucleotide sequences are presented herein by single strand only, in the 5′ to 3′ direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 CFR § 1.822 and established usage. See, e.g., PatentIn User Manual, 99-102 (November 1990) (U.S. Patent and Trademark Office).
[0101] Except as otherwise indicated, standard methods known to those skilled in the art may be used for the construction of recombinant parvovirus and AAV (rAAV) constructs, packaging vectors expressing the parvovirus Rep and/or Cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, N.Y., 1989); AUSUBEL et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).
[0102] Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.
[0103] To illustrate further, if, for example, the specification indicates that a particular amino acid can be selected from A, G, I, L and/or V, this language also indicates that the amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such subcombination is expressly set forth herein. Moreover, such language also indicates that one or more of the specified amino acids can be disclaimed. For example, in particular embodiments the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.
Definitions
[0104] The following terms are used in the description herein and the appended claims.
[0105] The singular forms “a” and “an” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
[0106] Furthermore, the term “about,” as used herein when referring to a measurable value such as an amount of the length of a polynucleotide or polypeptide sequence, dose, time, temperature, and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0107] Also as used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0108] As used herein, the term “adeno-associated virus” (AAV), includes but is not limited to, AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3, including types 3A and 3B), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), AAV type 10 (AAV10), AAV type 11 (AAV11), AAV type 12 (AAV12), AAV type 13 (AAV13), Avian AAV ATCC VR-865, Avian AAV strain DA-1, Bb1, Bb2, Ch5, Cy2, Cy3, Cy4, Cy5, Cy6, Hu1, Hu10, Hu11, Hu13, Hu15, Hu16, Hu17, Hu18, Hu19, Hu2, Hu20, Hu21, Hu22, Hu23, Hu24, Hu25, Hu26, Hu27, Hu28, Hu29, Hu3, Hu31, Hu32, Hu34, Hu35, Hu37, Hu39, Hu4, Hu40, Hu41, Hu42, Hu43, Hu44, Hu45, Hu46, Hu47, Hu48, Hu49, Hu51, Hu52, Hu53, Hu54, Hu55, Hu56, Hu57, Hu58, Hu6, Hu60, Hu61, Hu63, Hu64, Hu66, Hu67, Hu7, Hu9, HuLG15, HuS17, HuT17, HuT32, HuT40, HuT41, HuT70, HuT71, HuT88, Pi1, Pi2, Pi3, Rh1, Rh10, Rh13, Rh2, Rh25, Rh32, Rh33, Rh34, Rh35, Rh36, Rh37, Rh38, Rh40, Rh43, Rh48, Rh49, Rh50, Rh51, Rh52, Rh53, Rh54, Rh55, Rh57, Rh58, Rh61, Rh62, Rh64, Rh74, Rh8, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9.45, RHM4-1 (SEQ ID NO:5 of WO 2015/013313), AAV2-TT, AAV2-TT-S312N, AAV3B-S312N, AAV-LK03, and any other AAV now known or later discovered. see, e.g., Fields et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Capsids may be derived from a number of AAV serotypes disclosed in U.S. Pat. No. 7,906,111; Gao et al., 2004, J. Virol. 78:6381; Moris et al., 2004, Virol. 33:375; WO 2013/063379; WO 2014/194132; and include true type AAV (AAV-TT) variants disclosed in WO 2015/121501, and RHM4-1, RHM15-1 through RHM15-6, and variants thereof, disclosed in WO 2015/013313, and one skilled in the art would know there are likely other variants not yet identified that perform the same or similar function, or may include components from two or more AAV capsids. A full complement of AAV cap proteins includes VP1, VP2, and VP3. The open reading frame comprising nucleotide sequences encoding AAV capsid proteins may comprise less than a full complement AAV cap proteins or the full complement of AAV cap proteins may be provided.
[0109] and any other AAV now known or later discovered. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of relatively new AAV serotypes and clades have been identified (See, e.g., Gao et al., (2004) J. Virol. 78:6381; Moris et al., (2004) Virol. 33-:375).
[0110] AAV is a small non-enveloped virus with an icosahedral capsid about 20-30 nm in diameter. AAV are not able to replicate without the contribution of so-called helper proteins from other viruses (e.g., adenovirus, herpes simplex virus, vaccinia virus and human papillomavirus), and so were placed into a special genus, called dependovirus (because they depend on other viruses for replication) within the family of parvoviridae. Although many different serotypes of AAV have been discovered, and many humans produce antibodies against one or more AAV serotypes (suggesting widespread history of AAV infection), no diseases are known to be caused by AAV suggesting AAV is non-pathogenic in humans.
[0111] Although many different AAV serotypes have been discovered, one of the best characterized is AAV2, and the following discussion of AAV biology focuses on some of what has been learned regarding AAV2. The life cycle of other AAV serotypes is believed to be similar, although the details may differ. The particular details by which AAV2 or any other AAV serotype infect and replicate inside cells are provided merely to aid in the understanding of the inventions disclosed herein, and are not intended to limit their scope in any way. Even if some of this information is later found to be incorrect or incomplete, it should not be construed as detracting from the utility or enablement of the inventions disclosed and claimed herein. Further information about AAV lifecycle can be found in M. Goncalves, Virol J 2:43 (2005), M D Weitzman and R M Linden, Adeno-Associated Virus Biology, Ch. 1, pp. 1-23, Adeno-Associated Virus Methods and Protocols, Ed. R O Snyder and P Moullier, Humana Press (2011), GE Berry and A Asokan, Curr Opin Virol 21:54-60 (2016), and references cited therein.
[0112] The wild type genome of AAV2 is linear DNA approximately 4.7 kilobases in length. Although mostly single-stranded, the 5′ and 3′ ends of the genome consist of so-called inverted terminal repeats (ITR), each 145 basepairs long and containing palindromic sequences that self-anneal through classic Watson-Crick base-pairing to form T-shaped hairpin structures. One of these structures contains a free 3′ hydroxyl group that, relying on cellular DNA polymerases, permits initiation of viral DNA replication through a self-priming strand-displacement mechanism. See, for example, M. Goncalves, Adeno-associated virus: from defective virus to effective vector, Virology J 2:43 (2005). Due to the mechanism by which the single-stranded viral genomes are replicated and then packaged into capsids in infected cells, plus (sense or coding) and minus (antisense or non-coding) strands are packaged with equal efficiency into separate particles.
[0113] In addition to the flanking ITRs, the wild type AAV2 genome contains two genes, rep and cap, that code respectively for four replication proteins (Rep 78, Rep 68, Rep 52, and Rep 40) and three capsid proteins (VP1, VP2, and VP3) through efficient use of alternative promoters and splicing. The large replication proteins, Rep 78 and 68, are multifunctional and play a role in AAV transcription, viral DNA replication, and site-specific integration of the viral genome into human chromosome 19. The smaller Rep proteins have been implicated in packing the viral genome into the viral capsids in infected cell nuclei. The three capsid proteins are produced through a combination of alternative splicing and use of alternative translational start sites, so that all three proteins share sequence towards their carboxy-termini, but VP2 includes additional amino-terminal sequence absent from VP3, and VP1 includes additional amino-terminal sequence absent from both VP2 and VP3. It is estimated that capsids contain a total of 60 capsid proteins in an approximate VP1:VP2:VP3 stoichiometry of 1:1:10, although these ratios can apparently vary.
[0114] Despite its relatively small size, and therefore capacity to carry heterologous genes, AAV has been identified as a leading viral vector for gene therapy. Advantages of using AAV compared to other viruses that have been proposed as gene therapy vectors include the ability of AAV to support long term gene expression in transduced cells, to transduce both dividing and nondividing cells, to transduce a wide variety of different types of cells depending on serotype, the inability to replicate without a helper virus, and an apparent lack of pathogenicity associated with wild type infections.
[0115] Because of their small size, AAV capsids can physically accommodate a single stranded DNA genome that is at most about 4.7-5.0 kilobases in length. Without modifying the genome, there would not be enough room to include a heterologous gene, such as coding sequence for a therapeutic protein, and gene regulatory elements, such as a promoter and optionally an enhancer. To create more room, the rep and cap genes can be removed and replaced with desired heterologous sequences, as long as the flanking ITRs are retained. The functions of the rep and cap genes can be provided in trans on a different piece of DNA. By contrast, the ITRs are the only AAV viral elements that must remain in cis with the heterologous sequence. Combining the ITRs with a heterologous gene and removing the rep and cap genes to a different plasmid lacking ITRs also prevents production of infectious wild type AAV at the same time that AAV vector for gene therapy is being produced. Removing rep and cap also means that AAV vectors for gene therapy cannot replicate in the cells they transduce.
[0116] In some embodiments, the genome of AAV vectors is linear single-stranded DNA flanked by AAV ITRs. Before it can support transcription and translation of the heterologous gene, the single stranded DNA genome must be converted to double-stranded form by cellular DNA polymerases that utilize the free 3′-OH of one of the self-priming ITRs to initiate second-strand synthesis. In alternative embodiments, full length-single stranded genomes of opposite polarity can anneal to generate a full length double-stranded genome, and can result when a plurality of AAV vectors carrying genomes of opposite polarity simultaneously transduce the same cell. After double-stranded vector genomes form, by whatever mechanism, the cellular gene transcription machinery can act on the double-stranded DNA to express the heterologous gene.
[0117] In other embodiments, the vector genome can be designed to be self-complementary (scAAV), having a wild type ITR at each end and a mutated ITR in the middle. See, for example, McCarty, D M, et al., Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10:2112-18 (2003). It has been proposed that after entering a cell, self-complementary AAV genomes can self-anneal starting with the ITR in the middle to form a double-stranded genome without need for de novo DNA replication. This approach was shown to result in more efficient transduction and faster expression of heterologous gene, but reduces the size of the heterologous gene that may be used by about half.
[0118] Different strategies for producing AAV vectors for gene therapy have been developed, but one of the most common is the triple transfection technique, in which three different plasmids are transfected into producer cells. See, for example, N. Clement and J. Grieger, Mol Ther Methds Clin Dev, 3:16002 (2016), Grieger, J C, et al., Mol Ther 24(2):287-97 (2016), and the references cited therein. In this technique, a plasmid is created that includes the sequence of the vector genome including, for example a heterologous promoter and optionally an enhancer, and a heterologous gene to express a desired RNA or protein, flanked by the left and right ITRs. The vector plasmid would be co-transfected into producer cells, such as HEK293 cells, with a second plasmid containing the rep and cap genes, and a third plasmid containing adenovirus (or other virus) helper genes required to replicate and package the vector genome into AAV capsids. In alternative embodiments of the technique, rep, cap and adenovirus helper genes all reside on the same plasmid, and two plasmids are co-transfected into producer cells. Examples of adenovirus helper genes include E1a, E1b, E2a, E4orf6, and VA RNA genes. For many AAV serotypes, the AAV2 ITRs can be substituted for native ITRs without significantly impairing the ability of the vector genome to be replicated and packaged into non-AAV2 capsids. This approach, known as pseudo-typing, merely requires using a rep/cap plasmid that contains the rep and cap genes from the other serotype. Thus, for example, an AAV gene therapy vector could use an AAV9 capsid and a vector genome containing AAV2 ITRs flanking a heterologous gene (which can be designated “AAV2/9”), such as a mini-dystrophin. After the AAV particles are produced by the cell, they can be collected and purified using standard techniques known in the art, such as ultracentrifugation in a CsCl gradient, or using chromatography columns of various types.
[0119] The parvovirus particles and genomes of the present invention can be from, but are not limited to AAV. The genomic sequences of various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also, e.g., Bantel-Schaal et al., (1999) J. Virol. 73: 939; Chiorini et al., (1997) J. Virol. 71:6823; Chiorini et al., (1999) J. Virol. 73:1309; Gao et al., (2002) Proc. Nat. Acad. Sci. USA 99:11854; Moris et al., (2004) Virol. 33-:375-383; Mori et al., (2004) Virol. 330:375; Muramatsu et al., (1996) Virol. 221:208; Ruffing et al., (1994) J. Gen. Virol. 75:3385; Rutledge et al., (1998) J. Virol. 72:309; Schmidt et al., (2008) J. Virol. 82:8911; Shade et al., (1986) J. Virol. 58:921; Srivastava et al., (1983) J. Virol. 45:555; Xiao et al., (1999) J. Virol. 73:3994; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Pat. No. 6,156,303; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. ITR sequences from AAV1, AAV2 and AAV3 are provided by Xiao, X., (1996), “Characterization of Adeno-associated virus (AAV) DNA replication and integration,” Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, Pa. (incorporated herein it its entirety).
[0120] As used herein, “transduction” of a cell by AAV refers to AAV-mediated transfer of genetic material into the cell. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (3d ed., Lippincott-Raven Publishers).
[0121] The terms “5′ portion” and “3′ portion” are relative terms to define a spatial relationship between two or more elements. Thus, for example, a “3′ portion” of a polynucleotide indicates a segment of the polynucleotide that is downstream of another segment. The term “3′ portion” is not intended to indicate that the segment is necessarily at the 3′ end of the polynucleotide, or even that it is necessarily in the 3′ half of the polynucleotide, although it may be. Likewise, a “5′ portion” of a polynucleotide indicates a segment of the polynucleotide that is upstream of another segment. The term “5′ portion” is not intended to indicate that the segment is necessarily at the 5′ end of the polynucleotide, or even that it is necessarily in the 5′ half of the polynucleotide, although it may be.
[0122] As used herein, the term “polypeptide” encompasses both peptides and proteins, unless indicated otherwise.
[0123] A “polynucleotide” is a linear sequence of nucleotides in which the 3′-position of each monomeric unit is linked to the 5′-position of the neighboring monomeric unit via a phosphate group. Polynucleotides may be RNA (containing RNA nucleotides only), DNA (containing DNA nucleotides only), RNA and DNA hybrids (containing RNA and DNA nucleotides), as well as other hybrids containing naturally occurring and/or non-naturally occurring nucleotides. The linear order of bases of the nucleotides in a polynucleotide is called the “nucleotide sequence,” “nucleic acid sequence,” “nucleobase sequence,” or sometimes, just “sequence” of the polynucleotide. Typically, the order of bases is provided starting from the 5′ end of the polynucleotide and ending at the 3′ end of the polynucleotide. As known in the art, polynucleotides can adopt secondary structures, such as regions of self-complementarity. Polynucleotides can also hybridize with fully or partially complementary polynucleotides through classic Watson-Crick base pairing, or other mechanisms familiar to those of ordinary skill.
[0124] As used herein, a “gene” is a section of a polynucleotide, typically but not necessarily of DNA, that encodes a polypeptide or protein. In some embodiments, genes can be interrupted by introns. In some embodiments a polynucleotide can encode more than one polypeptide or protein due to mechanisms such as alternative splicing, use of alternate start codons, or other biological mechanisms familiar to those of ordinary skill in the art. The term “open reading frame,” abbreviated “ORF,” refers to a portion of a polynucleotide that encodes a polypeptide or protein.
[0125] The term “codon-optimized,” as used herein, refers to a gene coding sequence that has been optimized to increase expression by substituting one or more codons normally present in a coding sequence (for example, in a wildtype sequence, including, e.g., a coding sequence for dystrophin or a mini-dystrophin) with a codon for the same (synonymous) amino acid. In this manner, the protein encoded by the gene is identical, but the underlying nucleobase sequence of the gene or corresponding mRNA is different. In some embodiments, the optimization substitutes one or more rare codons (that is, codons for tRNA that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation. For example, in human codon-optimization one or more codons in a coding sequence are replaced by codons that occur more frequently in human cells for the same amino acid. Codon optimization can also increase gene expression through other mechanisms that can improve efficiency of transcription and/or translation. Strategies include, without limitation, increasing total GC content (that is, the percent of guanines and cytosines in the entire coding sequence), decreasing CpG content (that is, the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and/or adding or removing ribosomal entry sites, such as Kozak sequences. Desirably, a codon-optimized gene exhibits improved protein expression, for example, the protein encoded thereby is expressed at a detectably greater level in a cell compared with the level of expression of the protein provided by the wildtype gene in an otherwise similar cell.
[0126] The term “sequence identity,” as used herein, has the standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using the default settings, or by inspection.
[0127] An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Eva 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5:151 (1989).
[0128] Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al., J. Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Meth. Enzymol., 266:460 (1996); blast.wustl/edu/blast/README.html. WU-BLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
[0129] An additional useful algorithm is gapped BLAST as reported by Altschul et al., Nucleic Acids Res. 25:3389 (1997).
[0130] A percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the “longer” sequence in the aligned region. The “longer” sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
[0131] In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.
[0132] The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.
[0133] In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of “0,” which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the “shorter” sequence in the aligned region and multiplying by 100. The “longer” sequence is the one having the most actual residues in the aligned region.
[0134] “Substantial homology” or “substantial similarity,” means, when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the sequence.
[0135] As used herein, an “isolated” polynucleotide (e.g., an “isolated DNA” or an “isolated RNA”) means a polynucleotide separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide.
[0136] Likewise, an “isolated” polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
[0137] A “therapeutic polypeptide” is a polypeptide that may alleviate or reduce symptoms that result from an absence or defect in a protein in a cell or subject. Alternatively, a “therapeutic polypeptide” is one that otherwise confers a benefit to a subject, e.g., anti-cancer effects or improvement in transplant survivability.
[0138] As used herein, the term “modified,” as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.
[0139] As used herein, by “isolate” or “purify” (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.
[0140] By the terms “treat,” “treating,” or “treatment of” (and grammatical variations thereof) it is meant that the severity of the subject's condition is reduced, at least partially improved or stabilized and/or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and/or there is a delay in the progression of the disease or disorder.
[0141] The terms “prevent,” “preventing,” and “prevention” (and grammatical variations thereof) refer to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. The prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset is less than what would occur in the absence of the present invention.
[0142] A “treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a “treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.
[0143] A “prevention effective” amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some benefit is provided to the subject.
[0144] The terms “heterologous” or “exogenous” nucleotide or nucleic acid sequence are used interchangeably herein and refer to a nucleic acid sequence that is not naturally occurring in the virus or a cell. In some embodiments, the heterologous nucleic acid comprises an open reading frame that encodes a polypeptide or nontranslated RNA of interest (e.g., for delivery to a cell or subject).
[0145] As used herein, the terms “virus vector,” “viral vector,” “gene delivery vector,” or sometimes just “vector,” refer to a virion or virus particle that functions as a nucleic acid delivery vehicle and which comprises a vector genome packaged within the virion or virus particle. Vectors can be infectious or non-infectious. Non-infectious vectors cannot replicate themselves without exogenously added factors. Vectors may be AAV particles or virions comprising an AAV capsid within which is packaged an AAV vector genome. These vectors may also be referred to herein as “recombinant AAV” (abbreviated “rAAV”) vectors, particles or virions.
[0146] A vector genome is a polynucleotide for packaging within a vector particle or virion for delivery into a cell (which cell may be referred to as a “target cell”). Typically, a vector genome is engineered to contain a heterologous nucleic acid sequence, such as a gene, for delivery into the target cell. A vector genome may also contain one or more nucleic acid sequences that function as regulatory elements to control expression of the heterologous gene in the target cell. A vector genome may also contain wildtype or modified viral nucleic acid sequence(s) required for the production and/or function of the vector, such as, without limitation, replication of the vector genome in a host and packaging into vector particles. In some embodiments, the vector genome is an “AAV vector genome,” which is capable of being packaged into an AAV capsid. In some embodiments, an AAV vector genome includes one or two inverted terminal repeats (ITRs) in cis with the heterologous gene to support replication and packaging. All other structural and non-structural protein coding sequences required for AAV vector production may be provided in trans (e.g., from a plasmid, or by stably integrating the sequences into a host cell). In certain embodiments, an AAV vector genome comprises at least one ITR (e.g., an AAV ITR), optionally two ITRs (e.g., two AAV ITRs), which typically will be at the 5′ and 3′ ends of the vector genome and flank the heterologous nucleic acid sequence, but need not be contiguous thereto. The ITRs can be the same or different from each other, and from the same or different AAV serotypes.
[0147] The terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include “transformants,” “transformed cells,” and “transduced cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. For purposes of producing AAV vectors, certain host cells may be used as “producer” or “packaging” cells that contain all the genes required to assemble functional virus particles including a capsid and vector genome. As understood by those of ordinary skill in the art, different host cells can usefully serve as producer cells, such as HEK293 cells, or the Pro10 cell line, but others are possible. The required genes for virion assembly include the vector genome as described elsewhere herein, AAV rep and cap genes, and certain helper genes from other viruses, including without limitation adenovirus. As appreciated by those ordinarily skilled, the requisite genes for AAV production can be introduced into producer cells in various ways, including without limitation transfection of one or more plasmids, however, certain of the genes can already be present in the producer cells, either integrated into the genome or carried on an episome.
[0148] The term “inverted terminal repeat” or “ITR” includes any palindromic viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates certain viral functions such as replication, virus packaging, integration and/or provirus rescue, and the like). The ITR can be an AAV ITR or a non-AAV ITR. For example, a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition. Further, the ITR can be partially or completely synthetic, such as the “double-D sequence” as described in U.S. Pat. No. 5,478,745 to Samulski et al. See also FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
[0149] An “AAV inverted terminal repeat” or “AAV ITR” may be from any AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, or any other AAV now known or later discovered. An AAV ITR need not have the native terminal repeat sequence (e.g., a native AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, persistence, and/or provirus rescue, and the like. The sequence of the AAV2 ITRs are 145 basepairs long, and are provided herein as SEQ ID NO:14 and SEQ ID NO:15.
[0150] “Cis-motifs” includes conserved sequences such as found at or close to the termini of the genomic sequence and recognized for initiation of replication; cryptic promoters or sequences at internal positions likely used for transcription initiation, splicing or termination.
[0151] “Flanked,” with respect to a sequence that is flanked by other elements, indicates the presence of one or more the flanking elements upstream and/or downstream, i.e., 5′ and/or 3′, relative to the sequence. The term “flanked” is not intended to indicate that the sequences are necessarily contiguous. For example, there may be intervening sequences between the nucleic acid encoding the transgene and a flanking element. A sequence (e.g., a transgene) that is “flanked” by two other elements (e.g., TRs), indicates that one element is located 5′ to the sequence and the other is located 3′ to the sequence; however, there may be intervening sequences there between.
[0152] “Transfection” of a cell means that genetic material is introduced into a cell for the purpose of genetically modifying the cell. Transfection can be accomplished by a variety of means known in the art, such as calcium phosphate, polyethyleneimine, electroporation, and the like.
[0153] “Gene transfer” or “gene delivery” refers to methods or systems for reliably inserting foreign DNA into host cells. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g. episomes), or integration of transferred genetic material into the genomic DNA of host cells.
[0154] “Transgene” is used to mean any heterologous nucleotide sequence incorporated in a vector, including a viral vector, for delivery to and including expression in a target cell (also referred to herein as a “host cell”), and associated expression control sequences, such as promoters. It is appreciated by those of skill in the art that expression control sequences will be selected based on ability to promote expression of the transgene in the target cell. An example of a transgene is a nucleic acid encoding a therapeutic polypeptide.
[0155] The virus vectors of the invention can further be “targeted” virus vectors (e.g., having a directed tropism) and/or a “hybrid” parvovirus (i.e., in which the viral ITRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al., (2000) Mol. Therapy 2:619.
[0156] Further, the viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.
[0157] As used herein, parvovirus or AAV “Rep coding sequences” indicate the nucleic acid sequences that encode the parvoviral or AAV non-structural proteins that mediate viral replication and the production of new virus particles. The parvovirus and AAV replication genes and proteins have been described in, e.g., F
[0158] The “Rep coding sequences” need not encode all of the parvoviral or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep 68, Rep52 and Rep40), in fact, it is believed that AAV5 only expresses the spliced Rep68 and Rep40 proteins. In representative embodiments, the Rep coding sequences encode at least those replication proteins that are necessary for viral or vector genome replication and packaging into new virions. The Rep coding sequences will generally encode at least one large Rep protein (i.e., Rep78/68) and one small Rep protein (i.e., Rep52/40). In particular embodiments, the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and/or Rep40 proteins. In other embodiments, the Rep coding sequences encode the Rep68 and the Rep52 and/or Rep40 proteins. In a still further embodiment, the Rep coding sequences encode the Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins.
[0159] As used herein, the term “large Rep protein” refers to Rep68 and/or Rep78. Large Rep proteins of the claimed invention may be either wild-type or synthetic. A wild-type large Rep protein may be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered. A synthetic large Rep protein may be altered by insertion, deletion, truncation and/or missense mutations.
[0160] In the native AAV genome, the different Rep proteins are encoded by a single gene through use of two different promoters and alternative splicing. For purposes of AAV vector production, however, Rep proteins can be expressed in producer cells from a single gene, or from distinct polynucleotides, one sequence for each Rep protein to be expressed. Thus, for example, a Rep encoding gene can be engineered to inactivate the p5 or p19 promoter so that only small or only large Rep proteins are expressed the respective modified genes. Expression of the large and small Rep proteins from different genes can be advantageous when one of the viral promoters is inactive in a host cell, in which case a constitutively active promoter can be used instead, or where it is desired to express the Rep proteins at different levels under the control of separate transcriptional and/or translational control elements. For example, in some embodiments, it may be advantageous to down-regulate expression of the large Rep protein relative to small Rep protein (e.g., Rep78/68) to avoid toxicity to the host cells (see, e.g., Urabe et al., (2002) Human Gene Therapy 13:1935).
[0161] As used herein, the parvovirus or AAV “cap coding sequences” encode the structural proteins that form a functional parvovirus or AAV capsid (i.e., can package DNA and infect target cells). Typically, the cap coding sequences will encode all of the parvovirus or AAV capsid subunits, but less than all of the capsid subunits may be encoded as long as a functional capsid is produced. Typically, but not necessarily, the cap coding sequences will be present on a single nucleic acid molecule.
[0162] The capsid structure of autonomous parvoviruses and AAV are described in more detail in BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).
[0163] A “micro-dystrophin” or a “mini-dystrophin” is an engineered protein comprising certain subdomains or portions of subdomains present in full length muscle dystrophin or isoforms thereof that possess at least some of the functionality of dystrophin when expressed in a muscle cell. Micro-dystrophins and mini-dystrophins are smaller than full length muscle dystrophin (Dp427m). Relative to full length muscle dystrophin, micro-dystrophins and mini-dystrophins may contain deletions at the N-terminus, the C-terminus, internally, or any combination thereof.
[0164] As used herein, a “dystrophinopathy” is a muscle disease caused by pathogenic variants in DMD, the gene encoding the protein dystrophin. Dystrophinopathies manifest as a spectrum of phenotypes depending on the nature of the underlying genetic lesion. The mild end of the spectrum includes without limitation the phenotypes of asymptomatic increase in serum concentration of creatine phosphokinase (CK) and muscle cramps with myoglobinuria. The severe end of the spectrum includes without limitation the progressive muscle diseases Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), in which skeletal muscle is primarily affected and heart to a lesser degree, and DMD-associated dilated cardiomyopathy (DCM), in which the heart is primarily affected.
Mini-Dystrophin Polynucleotides, Expression Cassettes and Vectors
[0165] The present disclosure provides codon-optimized mini-dystrophin gene sequences and expression cassettes containing the same. Such genes and expression cassettes are useful for, among other applications, gene therapy to prevent or treat dystrophinopathies, such as DMD, in subjects in need thereof. Expression of mini-dystrophin proteins in transduced muscle cells is able to replicate and replace at least some of the function normally attributable to full-length dystrophin, such as supporting a mechanically strong link between the extra-cellular matrix and the cytoskeleton.
[0166] The codon-optimized sequences are designed to fit within the size limitations of parvovirus vectors, e.g., AAV vectors, as well as provide enhanced expression of mini-dystrophin compared to non-optimized sequences. In some embodiments, the optimized mini-dystrophin sequences provide increased expression of mini-dystrophin protein in muscle cells or in muscle in animals that is at least about 5% greater than the expression of non-codon-optimized dystrophin sequences, e.g., at least about 5, 10, 20, 30, 40, 50, 75, 100, 200, 300, 400, or 500% or more, where the non-codon-optimized sequence is based on the mRNA encoding wildtype human full-length muscle dystrophin, as exemplified by NCBI Reference Sequence NM_004006.2, which is incorporated by reference.
[0167] Thus, one aspect of the invention relates to a polynucleotide encoding a mini-dystrophin protein, the polynucleotide comprising, consisting essentially of, or consisting of: (a) the nucleotide sequence of SEQ ID NO:1 or a sequence at least about 90% identical thereto; (b) the nucleotide sequence of SEQ ID NO:2 or a sequence at least about 90% identical thereto; or (c) the nucleotide sequence of SEQ ID NO:3 or a sequence at least about 90% identical thereto. In some embodiments, the polynucleotide is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of one of SEQ ID NOS: 1-3. In certain embodiments, the polynucleotide has a length that is within the capacity of a viral vector, e.g., a parvovirus vector, e.g., an AAV vector. In some embodiments, the polynucleotide is about 5000, 4900, 4800, 4700, 4600, 4500, 4400, 4300, 4200, 4100, or about 4000 nucleotides, or fewer.
[0168] In some embodiments, the mini-dystrophin protein encoded by the polynucleotide comprises, consists essentially of, or consists of the N-terminus, hinge H1, rods R1 and R2, hinge H3, rods R22, R23, and R24, hinge H4, the cysteine-rich domain (CR domain), and in some embodiments, all or a portion of the carboxy-terminal domain (CT domain) of wild-type dystrophin protein. In other embodiments, the mini-dystrophin protein encoded by the polynucleotide comprises, consists essentially of, or consists of the N-terminus, Actin-Binding Domain (ABD), hinge H1, rods R1 and R2, rods R22, R23, and R24, hinge H4, the CR domain, and in some embodiments, all or a portion of the CT domain of wild-type dystrophin protein. In further embodiments, the mini-dystrophin protein does not comprise the last three amino acids at the C-terminus of the wild-type dystrophin protein (SEQ ID NO:25). In certain embodiments, the polynucleotide encodes a mini-dystrophin protein comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO:7 or SEQ ID NO:8 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:7 or SEQ ID NO:8.
[0169] The nucleotide sequence of dystrophin is well known in the art and may be found in sequence databases such as GenBank. For example, the human dystrophin mRNA sequence may be found at GenBank Accession No. M18533 or NCBI Reference Sequence NM_004006.2, which are incorporated by reference herein in their entirety.
[0170] In some embodiments, the polynucleotide is part of an expression cassette for production of dystrophin protein. The expression cassette may further comprise expression elements useful for increasing expression of dystrophin.
[0171] In some embodiments, the polynucleotide of the invention is operably linked to a promoter. The promoter may be a constitutive promoter or a tissue-specific or tissue-preferred promoter such as a muscle-specific or muscle-preferred promoter. In some embodiments, the promoter is a creatinine kinase promoter, e.g., a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
[0172] In some embodiments, the polynucleotide of the invention is operably linked to a polyadenylation element. In some embodiments, the polyadenylation element comprises the nucleotide sequence of SEQ ID NO: 6.
[0173] In some embodiments, the polynucleotide is part of an expression cassette comprising, consisting essentially of, or consisting or the polynucleotide operably linked to a promoter and a polyadenylation element. In certain embodiments, the gene expression cassette comprises, consists essentially or, or consists of the nucleotide sequence of any one of SEQ ID NOS: 9-12 or a sequence at least about 90% identical thereto, e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0174] Another aspect of the invention relates to a vector comprising the polynucleotides of the invention. Suitable vectors include, but are not limited to, a plasmid, phage, phagemid, viral vector (e.g., AAV vector, an adenovirus vector, a herpesvirus vector, an alphavirus, or a baculovirus vector), bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC). For example, the nucleic acid can comprise, consist of, or consist essentially of an AAV vector comprising a 5′ and/or 3′ terminal repeat (e.g., 5′ and/or 3′ AAV terminal repeat). In some embodiments, the vector is a viral vector, e.g., a parvovirus vector, e.g., an AAV vector, e.g., an AAV9 vector. The viral vector may further comprise a nucleic acid comprising a recombinant viral template, wherein the nucleic acid is encapsidated by the parvovirus capsid. The invention further provides a recombinant parvovirus particle (e.g., a recombinant AAV particle) comprising the polynucleotides of the invention. Viral vectors and viral particles are discussed further below.
[0175] In certain embodiments, the viral vector exhibits modified tissue tropism compared to vectors from which the modified vector is derived. In one embodiment, the parvovirus vector exhibits systemic tropism for skeletal, cardiac, and/or diaphragm muscle. In other embodiments, the parvovirus vector has reduced tropism for liver compared to a virus vector comprising a wild-type capsid protein. Tissue tropism can be modified by altering certain viral capsid amino acids, for example, those present in AAV capsid VP1, VP2, and/or VP3 proteins, according to the knowledge of those ordinarily skilled in the art.
[0176] In some embodiments, the vector genome is self-complementary or duplexed, and AAV virions containing such vector genomes are known as scAAV vectors. scAAV vectors are described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety). Use of scAAV to express a mini-dystrophin may provide an increase in the number of cells transduced, the copy number per transduced cell, or both.
[0177] An additional aspect of the invention relates to a transformed cell comprising the polynucleotide and/or vector of the invention. The cell may be an in vitro, ex vivo, or in vivo cell.
[0178] A further aspect of the invention relates to a non-human transgenic animal comprising the polynucleotide and/or vector and/or transformed cell of the invention. In some embodiments, the transgenic animal is a laboratory animal, e.g., an animal model of a disease, e.g., an animal model of muscular dystrophy.
[0179] Another aspect of the invention relates to a mini-dystrophin protein encoded by the polynucleotides of the invention. The mini-dystrophin protein contains all of the sequences necessary for a functional dystrophin protein. The domains of dystrophin are well known in the art and sequences may be found in sequence databases such as GenBank. For example, the human dystrophin amino acid sequence may be found at NCBI Reference Sequence: NP_003997.1 and GenBank Accession No. AAA53189, which are incorporated by reference herein in their entirety.
[0180] In some embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the N-terminus, hinge H1, rods R1 and R2, hinge H3, rods R22, R23, and R24, hinge H4, the CR domain, and in some embodiments, all or a portion of the CT domain, wherein the mini-dystrophin protein does not comprise the last three amino acids at the C-terminus of wild-type dystrophin protein (SEQ ID NO:25). According to some of these embodiments, the N-terminal actin binding domain comprises, consists essentially of, or consists of amino acid numbers 1-240 from SEQ ID NO:25, the amino acid sequence of full length human dystrophin protein; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 from SEQ ID NO:25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 from SEQ ID NO:25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 from SEQ ID NO:25; H3 comprises, consists essentially of, or consists of amino acid numbers 2424-2470 from SEQ ID NO:25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 from SEQ ID NO:25; R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 from SEQ ID NO:25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 from SEQ ID NO:25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 from SEQ ID NO:25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 from SEQ ID NO:25; and the CT domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 from SEQ ID NO:25. In certain embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 7. Further description of this and related constructs is included in Example 1 herein.
[0181] In some embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the N-terminus, hinge H1, rods R1 and R2, rods R22, R23, and R24, hinge H4, the CR domain, and in some embodiments, all or a portion of the CT domain. In certain embodiments, the mini-dystrophin protein does not comprise the last three amino acids at the C-terminus of wild-type dystrophin protein. According to some of these embodiments, the N-terminal actin binding domain comprises, consists essentially of, or consists of amino acid numbers 1-240 from SEQ ID NO:25, the amino acid sequence of full length human dystrophin protein; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 from SEQ ID NO:25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 from SEQ ID NO:25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 from SEQ ID NO:25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 from SEQ ID NO:25; R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 from SEQ ID NO:25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 from SEQ ID NO:25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 from SEQ ID NO:25; cysteine rich domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 from SEQ ID NO:25; and carboxy-terminal domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 from SEQ ID NO:25. In certain embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 8.
[0182] A further aspect of the invention relates to a method of producing a mini-dystrophin protein in a cell, comprising contacting the cell with the polynucleotide or vector of the invention, thereby producing the mini-dystrophin in the cell. The cell may be an in vitro, ex vivo, or in vivo cell, e.g., a cell line or a primary cell. Methods of producing a protein in a cell by introduction of a polynucleotide encoding the protein are well known in the art.
[0183] Another aspect of the invention relates to a method of producing a mini-dystrophin protein in a subject, comprising delivering to the subject the polynucleotide, vector and/or transformed cell of the invention, thereby producing the mini-dystrophin protein in the subject.
[0184] An additional aspect of the invention relates to a method of treating muscular dystrophy in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the polynucleotide, vector, and/or transformed cell of the invention, thereby treating muscular dystrophy in the subject. The muscular dystrophy may be any form of muscular dystrophy, e.g., Duchenne muscular dystrophy or Becker muscular dystrophy.
Recombinant Virus Vectors
[0185] The virus vectors of the present invention are useful for the delivery of polynucleotides encoding mini-dystrophin to cells in vitro, ex vivo, and in vivo. In particular, the virus vectors can be advantageously employed to deliver or transfer polynucleotides encoding mini-dystrophin to animal, including mammalian, cells.
[0186] The virus vector may also comprise a heterologous nucleic acid that shares homology with and recombines with a locus on a host chromosome. This approach can be utilized, for example, to correct a genetic defect in the host cell.
[0187] As a further alternative, the polynucleotides encoding mini-dystrophin can be used to produce mini-dystrophin protein in a cell in vitro, ex vivo, or in vivo. For example, the virus vectors may be introduced into cultured cells and the expressed mini-dystrophin protein isolated therefrom.
[0188] It will be understood by those skilled in the art that the polynucleotide encoding mini-dystrophin can be operably associated with appropriate control sequences. For example, the polynucleotide can be operably associated with expression control elements, such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
[0189] Those skilled in the art will appreciate that a variety of promoter and optionally enhancer elements can be used depending on the level and tissue-specific expression desired. The promoter/enhancer can be constitutive or inducible, depending on the pattern of expression desired. The promoter/enhancer can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. An enhancer, if employed, can be chosen from the same gene and species as the promoter, from the orthologous gene in a different species as the promoter, from a different gene in the same species as the promoter, or from a different gene in a different species as the promoter.
[0190] In particular embodiments, the promoter/enhancer elements can be native to the target cell or subject to be treated. In representative embodiments, the promoters/enhancer element can be native to the heterologous nucleic acid sequence. The promoter/enhancer element is generally chosen so that it functions in the target cell(s) of interest. Further, in particular embodiments the promoter/enhancer element is a mammalian promoter/enhancer element. The promoter/enhancer element may be constitutive or inducible.
[0191] Inducible expression control elements are typically advantageous in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s). Inducible promoters/enhancer elements for gene delivery can be tissue-specific or -preferred promoter/enhancer elements, and include muscle specific or preferred (including cardiac, skeletal and/or smooth muscle specific or preferred) promoter/enhancer elements. Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoters/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.
[0192] In embodiments wherein the polynucleotide encoding mini-dystrophin is transcribed and then translated in the target cells, specific initiation signals are generally included for efficient translation of inserted protein coding sequences. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.
[0193] The virus vectors according to the present invention provide a means for delivering polynucleotide encoding mini-dystrophin into a broad range of cells, including dividing and non-dividing cells. The virus vectors can be employed to deliver the polynucleotide to a cell in vitro, e.g., to produce mini-dystrophin in vitro or for ex vivo gene therapy. The virus vectors are additionally useful in a method of delivering the polynucleotide to a subject in need thereof, e.g., to express mini-dystrophin. In this manner, the protein can be produced in vivo in the subject. The subject can be in need of mini-dystrophin because the subject has a deficiency of functional dystrophin. Further, the method can be practiced because the production of mini-dystrophin in the subject may impart some beneficial effect.
[0194] The virus vectors can also be used to produce mini-dystrophin in cultured cells or in a subject (e.g., using the subject as a bioreactor to produce the protein or to observe the effects of the protein on the subject, for example, in connection with screening methods).
[0195] In general, the virus vectors of the present invention can be employed to deliver the polynucleotide encoding mini-dystrophin to treat and/or prevent any disease state for which it is beneficial to deliver mini-dystrophin. Illustrative disease states include, but are not limited to muscular dystrophies including Duchenne and Becker.
[0196] Virus vectors according to the instant invention find use in diagnostic and screening methods, whereby a polynucleotide encoding mini-dystrophin is transiently or stably expressed in a cell culture system, or alternatively, a transgenic animal model.
[0197] The virus vectors of the present invention can also be used for various non-therapeutic purposes, including but not limited to use in protocols to assess gene targeting, clearance, transcription, translation, etc., as would be apparent to one skilled in the art. The virus vectors can also be used for the purpose of evaluating safety (spread, toxicity, immunogenicity, etc.). Such data, for example, are considered by the United States Food and Drug Administration as part of the regulatory approval process prior to evaluation of clinical efficacy.
[0198] According to certain embodiments of the disclosure of AAV vectors or particles for treating dystrophinopathy, such as DMD, the disclosure provides AAV vectors or particles including AAV capsids from an AAV serotype that has tropism for striated muscle, including without limitation, skeletal muscle, including the diaphragm, and cardiac muscle. Non-limiting examples of naturally occurring AAV capsids having tropism for striated muscle are AAV1, AAV6, AAV7, AAV8, and AAV9. However, other embodiments include AAV capsids that are not known to occur naturally, but rather have been engineered for the express purpose of creating novel AAV capsids that preferentially transduce striated muscle compared to other tissues. Such engineered capsids are known in the art, but the disclosure encompasses new muscle-specific AAV capsids yet to be developed. Non-limiting examples of muscle-specific engineered AAV capsids were reported in Yu, C Y, et al., Gene Ther 16(8):953-62 (2009), Asokan, A, et al., Nat Biotech 28(1):79-82 (2010 (describing AAV2i8), Bowles, D E, et al., Mol Therapy 20(2):443-455 (2012) (describing AAV 2.5), and Asokan, A, et al., Mol Ther 20(4):699-708 (2012). The amino acid sequences of the capsid proteins, including VP1, VP2, and VP3 proteins, for many naturally and non-naturally occurring AAV serotypes are known in the art. In one non-limiting example, the amino acid sequence for the AAV9 serotype is provided as the amino acid sequence of SEQ ID NO:13.
[0199] The AAV particles of the disclosure for treating dystrophinopathy, such as DMD, include a vector genome for expressing a mini-dystrophin protein with dystrophin subdomains selected to at least partially restore in transduced muscle cells the function supplied by the missing full length dystrophin protein. According to some embodiments, the mini-dystrophin protein is constructed from subdomains from the full length wild type human dystrophin protein. In some embodiments, the mini-dystrophin protein includes the following subdomains from the human dystrophin protein in the following order from N-terminus to C-terminus: N-terminal actin binding domain (ABD); H1 hinge domain; R1 and R2 spectrin-like repeat domains; H3 hinge domain; R22, R23 and R24 spectrin-like repeat domains; H4 hinge domain; cysteine rich (CR) domain; and carboxy-terminal (CT) domain. According to some of these embodiments, the N-terminal actin binding domain comprises, consists essentially of, or consists of amino acid numbers 1-240 from SEQ ID NO:25, the amino acid sequence of full length human dystrophin protein; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 from SEQ ID NO:25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 from SEQ ID NO:25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 from SEQ ID NO:25; H3 comprises, consists essentially of, or consists of amino acid numbers 2424-2470 from SEQ ID NO:25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 from SEQ ID NO:25; R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 from SEQ ID NO:25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 from SEQ ID NO:25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 from SEQ ID NO:25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 from SEQ ID NO:25; and the CT domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 from SEQ ID NO:25. According to certain embodiments, the mini-dystrophin protein has the amino acid sequence of SEQ ID NO:7.
[0200] The vector genome of the AAV particles of the disclosure for treating dystrophinopathy, such as DMD, includes a gene for expressing a mini-dystrophin. Typically, the vector genome will lack the rep and cap genes normally present in wild type AAV to provide room for the gene expressing the mini-dystrophin. In some embodiments, the gene encodes a mini-dystrophin protein with the following subdomains from full length human dystrophin protein: ABD-H1-R1-R2-H3-R22-R23-R24-H4-CRD-CTD. In some embodiments, the CTD is only a portion of the CTD found in wildtype muscle dystrophin, and in some embodiments does not include the last three amino acids present in wildtype muscle dystrophin (SEQ ID NO:25). In certain embodiments, the gene encodes for a human mini-dystrophin protein having the amino acid sequence of SEQ ID NO:7.
[0201] According to some embodiments, the gene encoding the human mini-dystrophin protein is codon-optimized with respect to the species of the subject to which the AAV particles of the disclosure will be administered to effect gene therapy. Without wishing to be bound by theory, it is believed that codon-optimization improves the efficiency with which transduced cells are able to transcribe the gene into mRNA and/or translate the mRNA into protein, thereby increasing the amount of mini-dystrophin protein produced compared to expression of a mini-dystrophin encoding gene that is non-codon-optimized. In some non-limiting embodiments, the codon-optimization is human codon-optimization, but codon-optimization can be performed with respect to other species, including canine.
[0202] In some embodiments, codon-optimization substitutes one or more codons that pair with relatively rare tRNAs present in a species, such as human, with synonymous codons that pair with more prevalent tRNAs for the same amino acid. This approach can increase the efficiency of translation. In other embodiments, codon-optimization eliminates certain cis-acting motifs that can influence the efficiency of transcription or translation. Non-limiting examples of codon-optimization include adding a strong Kozak sequence at the intended start of the coding sequence, or eliminating internal ribosome entry sites downstream of the intended start codon. Other cis-acting motifs that may be eliminated through codon-optimization include internal TATA-boxes; chi-sites; ARE, INS, and/or CRS sequence elements; repeat sequences and/or RNA secondary structures; cryptic splice donor and/or acceptor sites, branch points; and Sall sites.
[0203] In certain embodiments, codon-optimization increases the GC content (that is, the number of G and C nucleobases present in a nucleic acid sequence, usually expressed as a percentage) relative to the wildtype sequence from which the mini-dystrophin gene was assembled. In some embodiments, the GC content is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than the GC content of the corresponding wildtype gene. In related embodiments, the GC content of a codon-optimized gene is about or at least 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, or greater.
[0204] In some embodiments, codon-optimization increases the codon adaptation index (CAI) of the gene encoding the mini-dystrophin protein. The CAI is a measure of synonymous codon usage bias in a particular species. The CAI value (which ranges from 0 to 1) in a particular species is positively correlated with gene expression levels. See, for example, Sharp, P M and W-H Lie, Nuc Acids Res 15(3):1281-95 (1987). According to certain embodiments, codon-optimization increases the CAI of the mini-dystrophin gene in reference to highly expressed human genes to a value that is at least 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, or 0.99.
[0205] In other embodiments, codon-optimization reduces the number of CpG dinucleotides in the coding sequence of a mini-dystrophin. Without wishing to be bound by any particular theory of operation, it is believed that methylation at CpG dinucleotides can silence gene transcription, such that reducing the number of CpG dinucleotides in a gene sequence can reduce the level of methylation, thereby resulting in enhanced transcription efficiency. Thus, in some embodiments of the codon-optimized mini-dystrophin genes, the number of CpG dinucleotides is reduced by about or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more compared to the wildtype sequence from which the mini-dystrophin gene was assembled.
[0206] A non-limiting example of a human codon-optimized human mini-dystrophin gene is provided by the DNA sequence of SEQ ID NO:1. This DNA sequence, which is 3978 nucleobases long (including a stop codon) is referred to herein as Hopti-Dys3978, although the particular terminology is merely used for convenience and is not intended to be limiting. The mini-dystrophin protein sequence encoded by SEQ ID NO:1, which is called Dys3978, is provided by SEQ ID NO:7. An example of a canine codon-optimized human mini-dystrophin gene is provided by SEQ ID NO:3, which also encodes Dys3978. As described in additional detail herein, the coding sequence for the mini-dystrophin of SEQ ID NO:7 was assembled from subsequences of the wildtype full-length human muscle dystrophin gene (as exemplified by NCBI Reference Sequence NM_004006.2, which is incorporated by reference) corresponding to certain subdomains present in the dystrophin protein (SEQ ID NO:25). The resulting gene sequence is provided herein as SEQ ID NO:26, which was then human codon-optimized, resulting in the DNA sequence of SEQ ID NO:1. Without limitation, the codon-optimization increased the GC content, decreased the use of infrequent codons (that is, increased the codon-adaptation index (CAI)), and included a strong translation initiation site (Kozak consensus sequence or similar), compared to the gene sequence before codon-optimization.
[0207] The vector genome of the AAV particles of the disclosure for treating dystrophinopathy, such as DMD, further include AAV inverted terminal repeats (ITR) flanking the codon-optimized gene encoding mini-dystrophin protein. In some embodiments, the ITRs are from the same AAV serotype as the capsid (for example, without limitation AAV9 ITRs used with AAV9 capsid), but in other embodiments, AAV ITRs from a different serotype may be used. For example, ITRs from the AAV2 serotype may be used in a vector genome in combination with an AAV capsid from a different, non-AAV2 serotype. Non-limiting examples include use of AAV2 ITRs with a capsid from the AAV1, AAV6, AAV7, AAV8, or AAV9 serotypes, or a different naturally or non-naturally occurring AAV serotype. In a particular non-limiting example, AAV2 ITRs may be used in combination with the capsid from the AAV9 serotype. From the perspective of the plus or sense DNA strand of the vector genome, the sequence of the left, 5′, or upstream AAV2 ITR is provided as the DNA sequence of SEQ ID NO:14, and the sequence of the right, 3′, or downstream AAV2 ITR is provided as the DNA sequence of SEQ ID NO:15.
[0208] The vector genome of the AAV vectors of the disclosure for treating dystrophinopathy, such as DMD, further includes a transcriptional regulatory element operably linked with the gene encoding the mini-dystrophin protein so that the vector genome, once converted into its double stranded form can express the mini-dystrophin gene in transduced cells. Transcriptional regulatory elements typically include a promoter, but optionally one or more enhancer elements that can act to augment the rate of transcription initiation from the promoter.
[0209] Operable linkage of a transcriptional regulatory element with respect to the mini-dystrophin coding sequence means that the transcriptional regulatory element can function to control transcription and expression of the gene, but does not necessarily require any particular structural or spatial relationship. Because vector genomes of the disclosure are typically packaged into AAV capsids as single-stranded DNA molecules, it should be understood that the operable linkage may not be functional until the vector genome is converted into double-stranded form. Usually, a promoter will be positioned 5′ or upstream of a gene sequence encoding the mini-dystrophin protein, but other transcriptional regulatory elements, such as enhancers, may be positioned 5′ or elsewhere, such as 3′, of the gene.
[0210] In some embodiments, the transcriptional regulatory element can be a strong constitutively active promoter, such those found in certain viruses that infect eukaryotic cells. A well-known example from the art include the promoter from the cytomegalovirus (CMV), but others are known as well such at the promoter from the Rous sarcoma virus (RSV). Strong viral promoters such as CMV or RSV are typically not tissue specific, so that if used the mini-dystrophin protein would be expressed not only in muscle cells, but any other cell type, such as liver, transduced by the AAV particles of the disclosure. Hence, in other embodiments, a muscle-specific transcriptional regulatory element can be used to reduce the amount of mini-dystrophin protein expressed in non-muscle cells, such as liver cells, that may also be transduced by the AAV particles of the disclosure.
[0211] Muscle-specific transcriptional regulatory elements can be derived from muscle-specific genes from any species, including mammalian species, such as without limitation, human or mouse muscle genes. Muscle-specific transcriptional regulatory elements will typically include at minimum a promoter from a muscle-specific gene as well as one or more enhancers from the same or a different muscle specific gene. Such enhancers can originate from many parts of the native gene, such as enhancers positioned 5′ or 3′ of the gene, or even reside in introns. Muscle-specific transcriptional regulatory elements can be removed en bloc from a muscle-specific gene and inserted into a plasmid for producing the AAV vector genomes of the disclosure, or can be engineered to tailor their activity and reduce their size as much as possible.
[0212] Non-limiting examples of muscle-specific genes from which muscle-specific transcriptional regulatory elements can be derived include the muscle creatine kinase gene, myosin heavy chain gene, or myosin light chain gene, or the alpha 1 actin gene from skeletal muscle, though others are possible as well. These genes can be from human, mouse, or other species.
[0213] Muscle-specific transcriptional regulatory elements that have been created for use in gene therapy applications are described in the art, and may be used in the AAV vectors of the disclosure for treating muscular dystrophy. In non-limiting examples, Hauser described muscle-specific transcriptional regulatory elements known as CK4, CK5, and CK6 derived from the mouse creatine kinase (MCK) gene (Hauser, M A, et al., Mol Therapy 2(1):16-25 (2000)), Salva described muscle-specific transcriptional regulatory elements known as CK1 and CK7, derived from the MCK gene, and MHCK1 and MHCK7, which additionally include enhancers from the mouse α-MHC gene (Salva, M Z, et al., Mol Therapy 15(2):320-9 (2007)), and Wang described muscle-specific transcriptional regulatory elements known as enh358MCK, dMCK and tMCK (Wang, B, et al., Gene Therapy 15:1489-9 (2008)). Use of other muscle-specific transcriptional regulatory elements in the AAV vectors of the disclosure for treating muscular dystrophy are also possible.
[0214] Non-limiting examples of muscle-specific transcriptional regulatory elements that may be used in the AAV vectors of the disclosure for treating muscular dystrophy include CK4, CK5, CK6, CK1, CK7, MHCK1, MHCK7, enh358MCK, dMCK and tMCK, each as described in the art, or those disclosed herein as having the DNA sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:16. Other muscle-specific transcriptional regulatory elements may be used as well.
[0215] The vector genome of the AAV vectors of the disclosure for treating dystrophinopathy, such as DMD, further includes a transcription termination sequence positioned 3′ of the coding sequence for the mini-dystrophin gene. Inclusion of transcription termination sequence ensures that the mRNA transcript encoding the mini-dystrophin protein will be appropriately polyadenylated by the transduced cell thereby ensuring efficient translation of the message into protein. Without intending to be limited by any particular theory of operation, research into mammalian transcription termination sequences identified a consensus sequence in the 3′ UTR of genes that serves to terminate transcription and signal polyadenylation of the growing transcript. Specifically, these sequences typically include the motif AATAAA, followed by 15-30 nucleotides, and then CA. See, for example, N. Proudfoot, Genes Dev 25:1770-82 (2011). Other motifs, such as an upstream element (USE) and downstream element (DSE) may contribute to transcription termination in some genes. Many transcription termination sequences are known in the art and can be used in the AAV vectors of the disclosure. Non-limiting examples include the polyadenylation signal from the SV40 virus early or late genes (SV40 early or late polyA) or the polyadenylation signal from the bovine growth hormone gene (bGH polyA). Transcription termination sequences from other genes of any species may be used in the AAV vectors of the disclosure. Alternatively, synthetic transcription termination sequences may be designed and used to signal transcription termination and polyadenylation. Additional non-limiting examples of transcription termination sequences that may be used in the AAV vectors of the disclosure include those disclosed herein as having the DNA sequences of SEQ ID NO:6 and SEQ ID NO:17.
[0216] According to certain non-limiting embodiments, the disclosure provides an AAV viral particle or vector for treating dystrophinopathy, such as DMD, comprising an AAV capsid and a vector genome encoding a mini-dystrophin protein. In some embodiments, the mini-dystrophin protein includes the following subdomains from full length human dystrophin protein: ABD-H1-R1-R2-H3-R22-R23-R24-H4-CRD-CTD. In some embodiments, the CTD is only a portion of the CTD found in wildtype muscle dystrophin, and in some embodiments does not include the last three amino acids present in wildtype muscle dystrophin (SEQ ID NO:25). According to certain embodiments, the gene encoding the mini-dystrophin protein of SEQ ID NO:7 is human codon-optimized and has the DNA sequence of SEQ ID NO:1. In some embodiments, the AAV capsid is from the AAV9 serotype.
[0217] As noted elsewhere herein, single-stranded AAV vector genomes are packaged into capsids as the plus strand or minus strand in about equal proportions. Consequently, embodiments of the vector or particle include AAV particles in which the vector genome is in the plus strand polarity (that is, has the nucleobase sequence of the sense or coding DNA strand), as well as AAV particles in which the vector genome is in the minus strand polarity (that is, has the nucleobase sequence of the antisense or template DNA strand). Given the nucleobase sequence of the plus strand in its regular 5′ to 3′ order, the nucleobase sequence of the minus strand in its 5′ to 3′ order can be determined as the reverse-complement of the nucleobase sequence of the plus strand.
[0218] In some embodiments of the vector, the vector genome, when in plus polarity, comprises a muscle-specific transcriptional regulatory element derived from the creatine kinase gene having the DNA sequence of SEQ ID NO:16 positioned 5′ of and operably linked with SEQ ID NO:1, the DNA sequence of the human codon-optimized gene encoding mini-dystrophin protein. Particles comprising the corresponding minus strand are also possible, where the sequence of nucleobases from its 5′ end would be the reverse complement of the sequence of the aforementioned plus strand. In other embodiments, the vector genome, when in plus polarity comprises a first AAV2 ITR followed by the DNA sequence of SEQ ID NO:16 positioned 5′ of and operably linked with the DNA sequence of SEQ ID NO:1, and a transcription termination sequence comprising the DNA sequence of SEQ ID NO:17 positioned 3′ of the mini-dystrophin gene, followed by a second AAV2 ITR. Particles comprising the corresponding minus strand are also possible, where the sequence of nucleobases from its 5′ end would be the reverse complement of the sequence of the aforementioned plus strand.
[0219] In certain other embodiments of the vector, the vector genome, when in plus polarity, comprises in 5′ to 3′ order a first AAV2 ITR, a transcriptional regulatory element sequence defined by the DNA sequence of SEQ ID NO:16, a human codon optimized gene sequence for expressing a mini-dystrophin, the gene sequence defined by the DNA sequence of SEQ ID NO:1 in operable linkage with the transcriptional regulatory element, a transcription termination sequence defined by the DNA sequence of SEQ ID NO:17, and a second AAV2 ITR. Particles comprising the corresponding minus strand are also possible, where the sequence of nucleobases from its 5′ end would be the reverse complement of the sequence of the aforementioned plus strand.
[0220] According to a particular non-limiting embodiment, an AAV vector for treating dystrophinopathy, such as DMD, which may be referred to herein as AAV9.hCK.Hopti-Dys3978.spA, comprises a capsid from the AAV9 serotype and a vector genome, which vector genome may be referred to herein as hCK.Hopti-Dys3978.spA, comprising, consisting essentially of, or consisting of, when the genome is in plus polarity, the DNA sequence of SEQ ID NO:18 or, when the genome is in the minus polarity, the reverse-complement of the DNA sequence of SEQ ID NO:18 (that is, when the vector genome sequence is read 5′ to 3′).
Methods of Producing Virus Vectors
[0221] The present disclosure further provides methods of producing AAV vectors. In one particular embodiment, the present disclosure provides a method of producing a recombinant parvovirus particle, comprising providing to a cell permissive for AAV replication and packaging a recombinant AAV vector genome, comprising a mini-dystrophin gene, associated genetic control elements and flanking AAV ITRs, and AAV replication and packaging functions, such as those provided by the AAV rep and cap genes, under conditions sufficient for the replication and packaging of the recombinant AAV particles, whereby rAAV particles are produced by the cell. Conditions sufficient for the replication and packaging of the rAAV particles include without limitation helper functions, such as those from adenovirus and/or herpesvirus. Cells permissive for AAV replication and packaging are known herein as packaging cells or producer cells, terms encompassed by the broader term host cells. The rAAV particle vector genome, replication and packaging functions and, where required, helper functions can be provided via viral or non-viral vectors, such as plasmids, and can exist within the packaging cells stably or transiently, either integrated into the cell's genome or in an episome.
[0222] Recombinant AAV vectors of the disclosure can be made by several methods known to skilled artisans (see, e.g., WO 2013/063379). An exemplary method is described in Grieger, et al. 2015, Molecular Therapy 24(2):287-297, the contents of which are incorporated by reference. Briefly, efficient transfection of HEK293 cells is used as a starting point, wherein an adherent HEK293 cell line from a qualified clinical master cell bank is used to grow in animal component-free suspension conditions in shaker flasks and WAVE bioreactors that allow for rapid and scalable rAAV particle production. Using the triple transfection method (e.g., WO 96/40240), the suspension HEK293 cell line is capable of generating, in some embodiments, greater than 1×10.sup.5 vector genome (vg) containing particles per cell, or greater than 1×10.sup.14 vg/L of cell culture when harvested 48 hours post-transfection. Triple transfection refers to the fact that the packaging cell is transfected with three plasmids: one plasmid encodes the AAV rep and cap genes, another plasmid encodes various helper functions (e.g., adenovirus or HSV proteins such as E1a, E1b, E2a, E4, and VA RNA, and another plasmid encodes the vector genome, i.e., the mini-dystrophin gene and its various control elements flanked by AAV ITRs. To achieve the desired yields, a number of variables can be optimized such as selection of a compatible serum-free suspension media that supports both growth and transfection, selection of a transfection reagent, transfection conditions and cell density. Vectors can be collected from the medium and/or by lysing the cells, and then purified using the classic density gradient ultracentrifugation technique, or using column chromatographic or other techniques.
[0223] The packaging functions include genes for viral vector replication and packaging. Thus, for example, the packaging functions may include, as needed, functions necessary for viral gene expression, viral vector replication, rescue of the viral vector from the integrated state, viral gene expression, and packaging of the viral vector into a viral particle. The packaging functions may be supplied together or separately to the packaging cell using a genetic construct such as a plasmid or an amplicon, a Baculovirus, or HSV helper construct. The packaging functions may exist extrachromosomally within the packaging cell, but may also be integrated into the cell's chromosomal DNA. Examples include genes encoding AAV Rep and Cap proteins. Rep and cap genes can be provided to packaging cell together as part of the same viral or non-viral vector. For example, the rep and cap sequences may be provided by a hybrid adenovirus vector (e.g., inserted into the E1a or E3 regions of a deleted adenovirus vector) or herpesvirus vector, such as an EBV vector. Alternatively, AAV rep and cap genes can be provided separately. Rep and cap genes can also be stably integrated into the genome of a packaging cell, or exist on an episome. Typically, rep and cap genes will not be flanked by ITRs to avoid packaging of these sequences into rAAV vector particles.
[0224] The helper functions include helper virus elements needed for establishing active infection of the packaging cell which is required to initiate packaging of the viral vector. Examples include functions derived from adenovirus, baculovirus and/or herpes virus sufficient to result in packaging of the viral vector. For example, adenovirus helper functions will typically include adenovirus components E1a, E1b, E2a, E4, and VA RNA. The packaging functions may be supplied by infection of the packaging cell with the required virus. Alternatively, use of infectious virus can be avoided, whereby the packaging functions may be supplied together or separately to the packaging cell using a non-viral vector such as a plasmid or an amplicon. See, e.g., pXR helper plasmids as described in Rabinowitz et al., 2002, J. Virol. 76:791, and pDG plasmids described in Grimm et al., 1998, Human Gene Therapy 9:2745-2760. The packaging functions may exist extrachromosomally within the packaging cell, but may also be integrated into the cell's chromosomal DNA (e.g., E1 or E3 in HEK 293 cells).
[0225] Any method of introducing the nucleotide sequence carrying the helper functions into a cellular host for replication and packaging may be employed, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, and liposomes in combination with a nuclear localization signal. In embodiments wherein the helper functions are provided by transfection using a virus vector or infection using a helper virus; standard methods for producing viral infection may be used.
[0226] Any suitable permissive or packaging cell known in the art may be employed in the production of the packaged viral vector. Mammalian cells or insect cells are preferred. Examples of cells useful for the production of packaging cells in the practice of the invention include, for example, human cell lines, such as VERO, WI38, MRCS, A549, HEK 293 cells (which express functional adenoviral E1 under the control of a constitutive promoter), B-50 or any other HeLa cells, HepG2, Saos-2, HuH7, and HT1080 cell lines. In one aspect, the packaging cell is capable of growing in suspension culture, especially in serum-free growth media. In one embodiment, the packaging cell is a HEK293 that grows in suspension in serum free medium. In another embodiment, the packaging cell is the HEK293 cell described in U.S. Pat. No. 9,441,206 and deposited as ATCC No. PTA 13274. Numerous rAAV particle packaging cell lines are known in the art, including, but not limited to, those disclosed in WO 2002/46359.
[0227] Cell lines for use as packaging cells include insect cell lines, particularly when baculoviral vectors are used to introduce the genes required for rAAV particle production as described herein. Any insect cell that allows for replication of AAV and that can be maintained in culture can be used in accordance with the present disclosure. Examples include Spodoptera frugiperda, such as the Sf9 or Sf21 cell lines, Drosophila spp. cell lines, or mosquito cell lines, e.g., Aedes albopictus-derived cell lines.
Titering Vector in Drug Substance or Product
[0228] After AAV vector particles of the disclosure have been produced and purified, they can be titered to prepare compositions for administration to subjects, such as human subjects with muscular dystrophy. AAV vector titering can be accomplished using methods known in the art. In certain embodiments, AAV vector particles can be titered using real time quantitative PCR (qPCR) using primers against sequences in the vector genome, for example, AAV2 ITR sequences if present, or other sequences in the vector genome, to determine the number of vector genome copies per unit volume, such as milliliters (e.g., vg/mL). By performing qPCR in parallel on dilutions of a standard of known concentration, such as a plasmid containing the sequence of the vector genome, a standard curve can be generated permitting the concentration of the AAV vector to be calculated as the number of vector genomes (vg) per unit volume, such as microliters or milliliters. Alternatively, the number of AAV vector particles containing genomes can be determined using dot blot using a suitable probe for the vector genome. These techniques are described further in Gray, S J, et al., Production of recombinant adeno-associated viral vectors and use in in vitro and in vivo administration, Curr Protoc Neurosci (2011) and Werling N J, et al., Gene Ther Meth 26:82-92 (2015). Once the concentration of AAV vector genomes in the stock is determined, it can be diluted into or dialyzed against suitable buffers for use in preparing a composition for administration to subjects.
[0229] In some embodiments, the purified vector preparation is drug substance (DS). Drug substance is a purified preparation of vector that may be suitable for long term frozen storage, but does not contain certain excipients (such as buffers, salts, or detergents, etc.) that may be required to formulate the vector for stable storage under different conditions (for example, liquid or lyophilized) and/or for administration to subjects. In other embodiments, the purified vector preparation is drug product (DP), the final vector formulation including excipients required for administration to subjects. In either of these embodiments, the AAV vector can be AAV9.hCK.Hopti-Dys3978.spA.
[0230] In real time PCR, a fluorescent DNA binding dye or fluorogenic primer is included in the reaction which produces a fluorescent signal proportional to the amount of PCR product (amplicon) generated. As used herein, the term “amplicon” means PCR product intended to be specifically amplified from the template sequence in standards and unknown samples through annealing and elongation of forward and reverse primers as PCR proceeds. It is the amplicon that is detected and quantitated as real time PCR proceeds. As PCR proceeds, the reaction is monitored continuously to detect changes in fluorescent signal output. In the initial stages of PCR, fluorescence does not increase significantly. This stage sets the baseline or background level fluorescence for an amplification plot, which relates fluorescence signal versus cycle number. The baseline, in some embodiments, is taken from the stable and linear background fluorescence during early cycles, such as between cycles 5-15, before amplification begins. The value R can represent fluorescent signal from the reporter. Rn represents R normalized by dividing R by the fluorescent signal from a passive reference dye typically included in the reaction to control for experimental variability unrelated to amplification. Then, ΔRn is determined by subtracting the baseline from Rn.
[0231] As PCR proceeds and the amount of amplicon increases, the fluorescent signal output increases proportionally. A level of fluorescence above background (that is, ΔRn) at a position that is in the log phase (thus, the exponential amplification phase of the experiment) and where all the amplification plots are parallel is chosen and defined as the “threshold” level of fluorescence for the assay. During the exponential phase of target sequence amplification (log linear phase), the cycle number at which the fluorescent signal output first exceeds the threshold is defined as the threshold or quantification cycle (“Ct” or “Cq,” respectively). Other names for this threshold-crossing cycle are crossing point (Cp) or take-off point (TOF). The higher the starting copy number of the target sequence in a standard or unknown sample, the earlier in the reaction (that is, lower Ct value) a fluoresence signal above threshold can be detected.
[0232] By running parallel PCR using serial dilutions of a standard containing a known concentration of the same target sequence as in the unknown sample to be tested, a standard curve can be constructed relating input target sequence copy number to the cycle number at which fluorescence above background is first detected. When cycle data for the unknown sample is determined and compared against the standard curve, the target sequence copy number in the sample can be calculated by interpolation. Use of a standard curve permits “absolute quantitation” of the unknown sample target sequence concentration, assuming the concentration (copy number) of target sequence in the standard can be accurately determined by some independent method. For example, if purified plasmid DNA containing a relevant target sequence is used as the standard, its concentration can be determined by measuring absorbance at 260 nm (A260) and then converting to copy number using the molecular weight of the DNA.
[0233] There are at least two general approaches for using fluorescent dyes to detect amplified target sequence in a standard or sample. One way uses a fluorescent dye, such as SYBR® Green I, which specifically binds to double stranded DNA. As the amount of dsDNA product from PCR accumulates, more dye binds to this product (that is, the amplicon), resulting in increased fluorescent signal output proportional the amount of amplicon being produced. The second approach uses a fluorogenic probe, a third oligonucleotide in the reaction, modified to include a fluorescent reporter dye and a quencher dye attached to the 5′ and 3′ ends of the probe respectively. By interacting with target DNA amplified by PCR, the reporter dye is unquenched, emitting a fluorescent signal proportional to the amount of amplicon generated that can be monitored as the reaction proceeds. Fluorescent dyes can include 6-FAM™, HEX™, TET™, TAMRA™, JOE™, ROX™, Cyanine 3, Cyanine 5, Cyanine 5.5, Cal Fluor® Gold 540, Cal Fluor® Orange 560, Cal Fluor® Red 590, Quasar® 570, Quasar® 670, and TxRd (Sulforhodamine 101-X), whereas quencher dyes can include TAMRA, DABCYL dT, BHQ®-1, BHQ®-2, BHQ®-3, OQ, Iowa Black® FQ, Iowa Black® RQ, with other reporter and quencher dyes being possible.
[0234] An important difference between these approaches is that SYBR Green I dye will detect all double-stranded DNA regardless of sequence, including non-specific reaction products, whereas the fluorogenic probe approach is product specific.
[0235] In some embodiments of qPCR that rely on a fluorogenic probe, the assay uses fluorogenic 5′ nuclease chemistry, sometimes referred to as TaqMan® chemistry, in which a fluorogenic probe enables detection of a specific PCR product as it accumulates during the reaction. Other embodiments include molecular beacon probes and Scorpion probes.
[0236] With TaqMan, a third oligonucleotide is included in PCR, a probe designed to anneal to the target sequence downstream of either of the PCR primers, and constructed to contain a reporter fluorescent dye on the 5′ end and a quencher dye on the 3′ end. While the probe is intact, the quencher dye reduces the fluorescence of the reporter dye by fluorescence resonance energy transfer (FRET). If the target sequence is present in the rection, the probe anneals downstream of one of the primer sites and, as the Taq DNA polymerase extends the primer from its 3′ end, the nucleotides in the probe are progressively cleaved by the 5′ nuclease activity of the enzyme. As a result of this probe digestion, the reporter dye molecule at the 5′ end of the probe is released and its fluorescense is no longer quenched by the quencher dye, thereby increasing the reporter dye signal. The Taq polymerase nuclease activity also fully removes the probe from the target strand, so that presence of the probe in the reaction does not prevent PCR and target amplification from proceeding. With each cyle as PCR proceeds, additional reporter dye molecules are released from their probes, resulting in an increase in fluorescence signal proportional to the amount of amplicon produced. Because the probe is designed to specifically anneal to the target sequence, the TaqMan approach is much less likely (compared to non-specific dsDNA binding dyes) to give rise to false positive signal output relating to non-specific PCR products in the reaction from contaminating template sequences.
[0237] A molecular beacon is a single-stranded bi-labeled fluorescent probe held in a hairpin-loop conformation (around 20 to 25 nt) by complementary stem sequences (around 4 to 6 nt) at both ends of the probe. The 5′ and 3′ ends of the probe contain a reporter and a quencher molecule, respectively. The loop is a single-stranded DNA sequence complementary to the target sequence. The proximity of the reporter and quencher causes the quenching of the natural fluorescence emission of the reporter. Molecular beacons hybridize to their specific target sequence causing the hairpin-loop structure to open and separate the 5′ end reporter from the 3′ end quencher. As the quencher is no longer in proximity to the reporter, fluorescence emission takes place. The measured fluorescence signal is directly proportional to the amount of target DNA. A Scorpions probe consists of a single-stranded bi-labeled fluorescent probe sequence held in a hairpin-loop conformation with a 5′ end reporter and an internal quencher directly linked to the 5′ end of a PCR primer via a blocker (for example, hexathylene glycol). The blocker prevents the polymerase from extending the PCR primer. At the beginning of the qPCR, the polymerase extends the PCR primer and synthesizes the complementary strand of the specific target sequence. During the next cycle, the hairpin-loop unfolds and the loop-region of the probe hybridizes intramolecularly to the newly synthesized target sequence. With the reporter no longer in close proximity to the quencher, fluorescence emission may take place. The fluorescent signal is detected by the qPCR instrument and is directly proportional to the amount of target DNA.
[0238] In preparing the reaction mixtures to carry out qPCR, probes can be added at any concentration determined to provide optimal assay performance. In some embodiments, fluorgenic probes, such as molecular beacon or TaqMan type probes, can be added to a final concentration of 50 to 500 nM, more specifically, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 300, 350, 400, 450, or 500 nM, or some other final concentration between any of the foregoing values.
[0239] To carry out the qPCR assay, a standard stock with a known copy number of target sequence (such as in number of molecules per unit volume, for example molecules/μL) in the unknown sample to be titered is prepared. In some embodiments, the standard stock contains a known concentration of plasmid DNA containing the target sequence, such as the vector genome for AAV9.hCK.Hopti-Dys3978.spA provided by SEQ ID NO:18. Such plasmid can be supercoiled or circular, and in some cases is linearized by cutting with a restriction enzyme.
[0240] Next, the standard is diluted serially in water. Such dilutions can be 10-fold dilutions, or any other number, such as 5-fold or 2-fold dilutions, depending on the concentration of standard in the stock and the concentration of standard desired in each dilution. Any number of serial dilutions can be prepared, such as 10, 9, 8, 7, 6, 5, or 4, again depending on stock concentration and the number of data points with which it is desired to create the standard curve. In some embodiments, a 5 log dilution series of standard is used to ensure that PCR efficiency can be accurately determined. As known in the art, in a graph of Ct on the y-axis versus log of the number of template molecules in the standard on the x-axis, a slope of −3.3 reflects 100% efficiency, meaning PCR doubles the amount of amplicon at each cycle during the exponential phase.
[0241] Carrier DNA, such as salmon sperm DNA, can be added to stabilize the standards at higher dilutions (that is, lower concentrations).
[0242] To titer samples of AAV vector, such as AAV9.hCK.Hopti-Dys3978.spA, samples may be treated with DNase I enzyme to digest and eliminate any plasmid or host cell DNA carried over from the production process, or vector DNA in the sample that is not packaged within vector capsids. Such treatment can reduce background noise from the assay. In some embodiments of the instant assays, after nuclease treatment, AAV vector samples are diluted serially to account for the possibility that the starting concentration will be too high and produce Ct values outside the range of Ct values produced by the standard dilutions that will be used to construct the standard curve.
[0243] Dilutions of standard and unknown sample are then aliquoted into reaction contains, typically wells of a plate having 48, 96, 384, or some other number of wells, or other reaction container known in the art to be suitable to carry out qPCR. Typically, reactions on standards and samples will be run in duplicate, triplicate, quadruplicate, or some other number of replicates to increase the accuracy of the results. Usually, a number of different controls are also included, such as for example a No Template Control (NTC), that is, master mix plus water, as a negative control.
[0244] In some embodiments, a specific dsDNA binding dye, such as SYBR® Green I is included. In other embodiments, a fluorogenic probe, such as molecular beacon or TaqMan type probe is included, to allow monitoring of amplicon formation in real time. A fluorescent reference dye (with different frequency than the DNA binding dye or probe dye, and that does not interact with DNA, such as a ROX dye) can optionally be included to compensate for non-PCR related variations in fluorescence, such as those caused by random volume differences across wells, such as due to pipetting error and sample evaporation, or variations introduced by the reaction plate or thermal cycler. The reference dye signal can be used to normalize all specific fluorescent output to reduce or eliminate such sources of error.
[0245] Once all standards, samples and controls have been added to the reaction plate, the reagents required for PCR are combined, including nuclease free water, PCR master mix, DNA binding dye or fluorogenic probe, forward and reverse DNA primers, reference dye (if used) and mixed thoroughly but gently, such as by repeated pipetting. As explained elsewhere herein, the components and their amounts and final concentrations are amenable to expirical optimization to optimize the reliability and accuracy of the assay according to the knowledge of those of ordinary skill.
[0246] Once the reaction mixture is prepared, an equal volume is added to each well of the reaction plate containing standard dilutions, samples and controls. The contents of each well are then thoroughly mixed together, usually in parallel using a multichannel pipettor. The plate can then be sealed and centrifuged to bring the reaction mixture to the bottom of the wells. Next, the plate is transferred to a qPCR instrument that has been suitably programmed for qPCR. The thermocycler program is then executed, data collected and stored, and then analyzed using the instrument's software package to achieve an estimate of target sequence concentration in the samples by comparison with the standard curve data. Consistent with the knowledge of those of ordinary skill, the quality of the standard and/or sample data can be assessed, outlier values excluded, and the data reanalyzed if desired.
QPCR Assay Design and Validation
[0247] As will be appreciated by those of ordinary skill in the art, a number of different variables are typically considered when designing a qPCR assay for a target of interest. These variables include, among others, the amplicon and primers, detection format (dye or probe), master mix composition, and qPCR instrument programming. Other variables will be familiar to those of ordinary skill.
[0248] Guidelines exist to facilitate the design choice of different components, in particular the primers and amplicon, and computerized algorithms are widely available to assist in this process. After candidate primers and amplicon are designed, it is typically useful to test them empirically in combination with other variables to identify optimum, or at least acceptable, combinations of primers, other reaction ingredients and conditions that permit reliable and sensitive quantification of the desired target sequence. For example, a number of different candidate PCR primer pairs can be tested at different primer concentrations with different PCR master mixes and with different annealing and/or elongation temperatures.
[0249] The theory underlying qPCR quantification assumes a linear relationship between the log of the initial template quantity in the reaction and the Ct value obtained during amplification. Optimized qPCR assays that best approximate this theoretical relationship demonstrate the following characteristics: high amplification efficiency (90-110%, where the slope of a graph of Ct on the y-axis versus log template number on the x-axis is −3.3 represents 100% efficiency); linear standard curve (R.sup.2>0.98); low variability across replicate reactions; no primer dimers; and wide dynamic range.
[0250] After a realtime qPCR assay has been designed, it can be optimized and validated according to the knowledge of those ordinarily skilled in the art. Thus, for example, the specificity of amplification under any particular set of conditions can be tested by melt (disassociation) curve analysis. In this technique, after PCR is complete, temperature of the reaction is gradually increased in a range bracketing the predicted Tm of the amplicon, for example 55-95° C., and fluoresence monitored. As double stranded DNA in the reaction is heat denatured, the fluorscent signal decreases. Usually, when assay conditions support specific amplification, as opposed to non-specific amplification of primer-dimers or products due to adventitious primer binding to target template, the specific amplicon will appear as a single narrow peak in the melt curve plotting the negative first derivative of fluroescence (on the y-axis) versus temperature (on the x-axis). Presence of non-specific amplication products is evidenced by multiple peaks or a broader peak in the melt curve. Primer-dimers, if they exist, will often appear as peaks at lower melt temperatures, for example. Specificity can further be confirmed by visualizing the PCR product using gel electrophoresis with EtBr staining and seeing that it is of the expected size. If size is not sufficiently diagnostic, bands can be isolated and their DNA sequenced to confirm that it matches the expected sequence of the amplicon.
[0251] Optimizing and validating a particular qPCR assay design can also involve assessing its efficiency, or the extent to which the reaction actually doubles the amount of specific product at each cycle during the exponential phase of PCR. Ideally, a 100% efficient reaction doubles the amount of target sequence in each cycle during the exponential phase of amplification. As known in the art, efficiency can be determined by analysis of standard curves representing the relationship between Cq values (on the y-axis) plotted against the base 10 logarithm of concentration (usually expressed as copy number per unit volume) from multiple (5-11) serial dilutions of a standard containing a known number of copies of the template sequence (on the x-axis). Common serial dilution factors are 10-fold, 5-fold, or 2-fold. The slope (m) of the standard curve determined by regression analysis is then used to calculate PCR efficiency (E), using the equation E=10.sup.(−1/m). Percent efficiency is calculated as (E-1)×100. Under ideal circumstances, a standard curve experiment that is a 100% efficient will have slope m=−3.32. PCR efficiency between 90-110% (corresponding to slope between −3.1 and −3.6) is frequently considered acceptable in the art, but in other embodiments 95-105%, 96-104%, 97-103%, 98-102%, or 99-101% efficiency is considered acceptable. Efficiency values greater than 100% are an artifact caused by several variables, including polymerase inhibition. If the standard curve experiment includes a sufficiently diluted standard, the copy number limit of detection and dynamic range of the assay can also be determined. For standard curve analysis, different standards are known in the art, including for example, purified nicked or linearized plasmid of known concentration containing a single copy of the target sequence.
[0252] Multiple replicates of each reaction (usually at least 3) can be performed to determine reproducibility of the assay. Under ideal circumstances, there would be no replicate to replicate variability, in which case the correlation coefficient (R.sup.2) of the slope of the standard curve would equal to 1. A correlation coefficient of at least 0.975 or 0.980 is frequently considered acceptable in the art, but in other embodiments an R.sup.2 of at least 0.985, 0.990, 0.991, 0.992, 0.993, 0.994, 0.995, 0.996, 0.997, 0.998, or 0.999 is used. In some embodiments, Cq values of replicates vary no more than 0.2 standard deviation units for the assay to be considered acceptably reproducible.
[0253] Further information about the parameters that characterize optimized qPCR assay conditions is described in Bustin, S A, et al., Biomol. Detect. Quant. 14:19-28 (2017); Bustin, S A, Methods 50:217-26 (2010); Hilscher, C, et al., Nuc. Acids Res., Sanders, R, et al., Anal. Bioanal. Chem., 406:6471-83 (2014), and Raymaekers, M, et al., J. Clin. Lab. Anal. 23:145-51 (2009), each of which is incorporated by reference.
Primer Design
[0254] Particulary important in designing a qPCR assay for a target of interest are the forward and reverse DNA primers required to generate the amplicon. Ideally, the primers are designed so that the assay is not overly sensitive to variable or suboptimal conditions, such as temperature variations across the thermal cycler block. In other words, the assay will generate relatively consistent data even when reaction conditions vary somewhat from experiment to experiment. It is usually desirable, for example, for primers to perform well over a range of annealing temperatures, although even this guideline may not hold in specific instances when tested empirically. Primers are usually deoxyribonucleic acid oligonucleotides, but can include non-DNA bases, and/or chemical modifications designed to alter or enhance their function in PCR according to the knowledge of those ordinarily skilled in the art. Primers are readily made and purified using standard techniques.
[0255] General guidelines for choosing primers to use in qPCR include selecting pairs of primers that are specific for the target template (that is, will basepair with complementary sequence in the target template with no mismatches), do not form intramolecular hairpin structures, do not form primer dimers, that amplify a relatively short amplicon. In some embodiments, primers for use in real time qPCR have a predicted melting temperature (Tm) of about 50-70° C., such as 50-65° C., for example a predicted Tm of 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70° C., or another temperture. Tm can be calculated using various computer algorithms, as is known in the art. In certain embodiments, the Tm of forward and reverse primers are within about 5° C. of each other, or even less, such as 4, 3, 2, or 1° C. of each other. Tm can be predicted using various computer algorithms. Other guidelines include having GC content of about 30-80%, or 40-60% overall, avoiding runs of identical nucleotides (but if repeats are present, that there be fewer than four consecutive G or C bases), having no more than two G or C bases among the last five nucleotides at the 3′ end, but having one G or C at the 3′ end at the primer. Again, primers departing from these design guidelines may still work in qPCR if confirmed empirically.
[0256] Selection of primers with desired properties can be facilitated by using computerized algorithms. Thus, for example, primers specific for the target template can be identified using NCBI's Primer-BLAST utility, found at the following URL: <https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi>, whereas primers with low tendency to form primer dimers can be identified using the DINAMeIt application, which is part of the UNAFold software package, available at the following URL: <http://unafold.rna.albany.edu/>. Often more than one primer pair (such as 3 or more) is selected according to these or other guidelines known to those of ordinary skill and then tested empirically to determine which candidate pair works best in a particular qPCR format by providing the lowest Ct, no or the least amount of primer dimers, and consistent results over a wide annealing temperature (Ta) range. These factors tend to result in a more reliable qPCR assay that is less sensitive to extraneous variables.
[0257] The forward and reverse primers described above for use in titering AAV vectors of the disclosure by qPCR can be any length suitable for use in qPCR according to the knowledge of those of ordinary skill in the art. Thus, for example, primers can be about 10-45 bp long, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides long, or other lengths. The length of a forward primer can be the same length or a different length than the reverse primer in any particular qPCR assay.
[0258] In some embodiments, forward and reverse primers for qPCR can be 20-24 bases long, have a Tm of about 60° C., or in a range of 57-61° C., and possess about 40-60% GC content.
[0259] The optimal concentration of forward and reverse primers to be included in the PCR mixture can be determined empirically. Thus, a matrix of reactions using different primer concentrations can be set up with standard as template, real time PCR performed, and the Ct for each combination determined. The lowest concentrations yielding a low Ct and high ΔRn can then be chosen for the assay. When using DNA binding dye, such SYBR I Green, to detect amplicon melt curve analysis can be used to confirm whether a single PCR product is amplified. Multiple peaks or shoulders may indicate non-specific product resulting from extension of primer dimers.
[0260] In some embodiments, primer concentrations for use in real time qPCR can range from 50-1200 nM or other ranges, in other embodiments the concentration of forward and/or reverse primer can be about 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or 1200 nM, or some concentration between each of these values, or yet other concentrations as determined to be optimal. In some embodiments, the concentration of forward and reverse primers are the same, but in other embodiments, their concentrations can differ.
[0261] Primer concentrations to be used in any particular real time qPCR assay can be determined according to general guidelines, or optimized empirically, both being within the knowledge of those of ordinary skill in the art. Thus, for example, primer concentrations can be optimized by setting up a matrix experiment that varies the concentration of both forward and reverse primers independently over a range of concentrations, such as 50-800 nM, or some other range, by serial dilutions. Other reaction conditions are maintained constant, so that the effect of primer concentration is isolated. PCR is then run and fluorescence monitored. The combination of forward and reverse primer concentrations (whether the same or different) that yields the lowest Cq value and a sigmoidal fluorescence curve, as well as having low variability among replicates and a negative no template control is usually considered optimal.
Amplicon
[0262] General guidelines for choosing the amplicon to amplify in qPCR include selecting a sequence in the target template that does not contain any or any significant amount of secondary structure, which can be predicing using widely available computer algorithms, such as mfold. Presence of secondary structures in an amplicon can interfere with primer annealing to the amplicon after the initial cycles of PCR, and therefore reduce the efficiency, sensitivity, and reliability of qPCR. Presence of secondary structure can be predicted using computerized algorithms such as Mfold or UNAFold, which are familiar to those of ordinary skill. Related guidelines include avoiding target template that includes palindromic sequences and regions with basepair repeats.
[0263] Another guideline is to choose relatively short template target sequences that will form the amplicon. In so doing, there is increased likelihood that at each cycle amplicon will be completely synthesized, even at the primer annealing temperature, which is usually sub-optimally lower than the temperature at which most thermostable DNA polymerases used in PCR are maximally active. This is particularly true in 2 step thermocycler programs. Choosing shorter amplicons more likely to be fully elongated increases the likelihood that amplified target from prior cycles can serve as template in subsequent rounds of PCR (ideally doubling each cycle during the exponential phase), which makes the assay more reliable and precise.
[0264] In some embodiments of real time qPCR, amplicon size can range about 50-250 basepairs (bp) long, or in more specific embodiments amplicon can be about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 bp long, or intermediate lengths between any of these specifically enumerated lengths. In some instances, it has been observed that shorter amplicons in SYBR Green I-based assays can be difficult to distinguish from primer dimers at lower cycle numbers. Thus, in some embodiments, amplicons for qPCR employing SYBR Green I dye can be chosen to be somewhat longer (such as about 80-150 bp) compared to qPCR employing fluorgenic probes (such as about 60-90 bp) to account for this possible source of error, but these guidelines should not be considered limiting.
[0265] Other guidelines for choosing amplicons include having GC content in the range of 30-80%, in other embodiments 40-60%, or as close to 50% as possible, while avoiding G or C repeats or GC-rich regions, which reportedly can interfere with complete strand dissociation. More information about guidelines for primer and amplicon design and choice are are described in Bustin, S A, et al., Biomol. Detect. Quant. 14:19-28 (2017), which is incorporated by reference.
Probe Design
[0266] Design of fluorogenic probes for use in real time qPCR is within the knowledge of those ordinarily skilled in the art. Probes, for example, should not anneal to sequence overlapping that to which either PCR primer anneals. In other words, probe should be designed to anneal to template sequence located between that to which the primers anneal. In some embodiments, the distance in nucleotides between the end of the forward primer and the beginning of the probe is about 60 basepairs (bp) apart, in other embodiments about 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 bp apart, or some other distance apart.
[0267] Probes for real time qPCR in some embodiments have predicted melting temperatures (Tm) about 5-10° C. above that of the melting temperature of the primers so that as the thermocycler ramps down from the denaturing temperature to the anneal and extension temperature, the fluorogenic probe will anneal to the amplicon before either primer anneals. In some non-limiting embodiments, the Tm of the probe can be 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80° C., or some other Tm.
[0268] The guidelines for probe length are similar to that for primers. Thus, in some embodiments, probes can be about 10-45 bp long, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides long, or other lengths. With longer probes, such as those longer than 30 bp, the quencher dye can be positioned not at the 3′ end, but rather internally, about 18-25 bases from the 5′ end. In some embodiments, dual-labeled probes, such as TaqMan probes, or Molecular Beacons can be 20-30 bases long, whereas Scorpions probes can be 15-25 bases long.
[0269] Other non-limiting guidelines for design of probes include overall GC content of about 30-80%, runs of not more than three identical nucleotides, avoidance of sequences that would cause primer-dimers or hairpin secondary structures (palindromic sequences), greater number of C than G bases, but avoiding having a G nucleotide at the 5′ end of the probe next to the reporter dye, which can cause quenching. Probe sequence should not overlap with or be complementary to either of the primers. Probes are usually deoxyribonucleic acid oligonucleotides, but can include non-DNA bases, and/or chemical modifications (apart from conjugation reporter and quencher dyes) designed to alter or enhance their function according to the knowledge of those ordinarily skilled in the art. For example, a minor groove binding moiety can be chemically attached to the 3′ end of a probe, other modifications also being possible. Probes are readily made and purified using standard techniques.
[0270] Additional information and guidelines for designing qPCR probes can be found in Rodriguez, et al., Design of Primers and Probes for Quantitative Real-Time PCR Methods. In: Basu C. (eds) PCR Primer Design. Methods in Molecular Biology, vol 1275. Humana Press, New York, N.Y. (2015), which is incorporated by reference. Again, however, like for primers, probe design guidelines are not absolute and probe sequences that depart from the guidelines may work if confirmed empirically.
[0271] Like primer concentration the qPCR probe concentration can be optimized empirically. For example, once primer concentrations have been optimized using a probe concentration that should provide good assay sensitivity, such as 250 nM, or some other value, probe concentration can then be independently varied to determine if a higher or lower concentration improves sensitivity using the lowest concentration of target template that is expected to be present when the assay is put into practice. The lowest probe concentration resulting in the highest assay sensivitity (thus, the lowest Cq value with high reproducibility) is usually considered optimum.
PCR Master Mix
[0272] The “master mix” is a premixed combination of reaction components required for PCR to work. Master mixes can be purchased from commercial vendors and stored until use, or a master mix can be prepared from stocks of components required to carryout real time qPCR just prior to setting up a qPCR experiment. There is no requirement that a master mix contain all components necessary for PCR. Rather a master mix can contain just some of the reagents for PCR to which are added the balance of required components from some other stock just prior to carrying out qPCR. Alternatively, a master mix containing just some of the components needed for PCR can be aliquoted to wells of a reaction plate, after which the balance of components needed for PCR can be aliquoted to the wells together or singly in any proportion or order deemed appropriate according the knowledge of those ordinarily skilled in the art.
[0273] Many recipes are known in the art. In many cases, a master mix will include nuclease free water, a thermostable DNA polymerase, a blend of dNTPs (such as dATP, dCTP, dGTP, dTTP, or sometimes dUTP additionally or in place of dTTP to help control for carry over contamination), as well as buffers, detergents, salts and other components, such as metal ions (such as Mg.sup.+2, which is usually added in the form of MgCl.sub.2) required for specific annealing of primer and probe (if used) to template and/or optimal function of the polymerase. Master mixes will usually be concentrated, such as 2× or 5×, or some other concentration, and need to be diluted to achieve 1×final concentration of the master mix components in the final reaction mixture.
[0274] As is well known, the concentration of Mg.sup.+2 in PCR, which is usually added as MgCl.sub.2, can dramatically impact both specificity and yield for a variety of reasons. Insufficient MgCl.sub.2 results in poor yields due to low polymerization rate of DNA polymerase, compromised primer binding and inefficient probe cleavage, whereas excessive MgCl.sub.2 can result in stabilization of nonspecific primer hybridization and therefore reduced specificity. Thus, MgCl.sub.2 concentration can independently be optimized. Exemplary concentrations of MgCl.sub.2 for qPCR are 3-6 mM, but other concentrations are possible.
[0275] Different thermostable DNA polymerases suitable for use in qPCR are known in the art, including the Taq, Pfu, KOD and GBD DNA polymerases. Such enzymes can be used in their wild type form, or modified to improve their performance in terms of thermostability, specificity, proof-reading fidelity, and processivity. In assay embodiments where TaqMan type fluorogenic probes are to be used, the DNA polymerase should have 5′ exonuclease activity. Master mixes can also contain chemical additives designed to improve assay performance, such as DMSO, glycerol, formamide, BSA, ammonium sulfate, PEG, gelatin, non-ionic detergents, betaine and others. The exact composition of a master mix, including which ingredients to choose and their concentration, absolute and relative to other components, for use in the instant assays, is amenable to optimization according to the knowledge of those of ordinary skill in the art. A master mix could also contain a double stranded DNA specific binding dye, such as SYBR I Green and/or a passive reference dye, such as ROX.
PCR Cycling Programs
[0276] Once PCR mixtures have been prepared and aliquoted into reaction plates, the reaction plates are transferred to real time PCR thermal cycler machines, of which many are known in the art. Thermal cyclers are then programmed to carry out any desirable thermal cycler program to melt the template, anneal the PCR primers, and permit the DNA polymerase to extend the primers thereby creating amplicon to be detected using the TaqMan chemistry, SYBR Green dye chemistry, or any other detection method suitable for real time PCR.
[0277] PCR cycling programs for use in titering AAV vectors of the disclosure by pPCR can be designed according to the knowledge of those of ordinary skill. Such programs can be 2-step or 3-step, for example. Two step programs are often used with qPCR methods based on dual-labeled probe, such as TaqMan, and 3 step programs are often used with qPCR methods that rely on DNA binding dyes, or molecular beacons, although the optimal program may depend on other factors and can be confirmed empirically.
[0278] In either format, programs typically commence by raising and holding the temperature of the reaction mixture to 95° C. for time sufficient to melt the template and primers and activate the DNA polymerase, such as 2-10 minutes, or some other time. Then the program causes the cycler to run through a series of temperature cycles to allow annealing of primers to template, extension of primers by the DNA polymerase, and then melting to allow the cycle of annealing and extension to repeat. For example, in a 2 step program, each cycle begins by raising and holding the temperature sufficiently high and for sufficient time to denature DNA, such as 95° C. for 10, 15, 20, 25, 30, 35, 40, or 45 seconds, but other temperatures and times are possible. In the second step, the reaction mixture is cooled rapidly to a temperature low enough to allow the primers to anneal to the template, but high enough that the DNA polymerase is active and can elongate the primers.
[0279] An exemplary annealing temperature for 2 step qPCR is 60° C., although other temperatures are possible, such as 55, 56, 57, 58, 59, 61, 62, 63, 64, or 65° C. The optimal annealing temperature for any set of primers can be determined empirically. Too low an annealing temperature will result in non-specific amplification products, whereas higher temperatures can result in more specific amplification, but with progressively reduced yield of the desired amplicon resulting in higher Cq values and lower reproducibility or efficiency. Without being bound by theory, 60° C. is sometimes recommended as promoting exonuclease activity by the Taq polymerase while discouraging probe displacement. The optimum annealing temperature can be determined by testing identical reactions containing fixed primer concentrations across a range of annealing temperatures (for example, 50-70° C. or 55-65° C.), such as with a temperature gradient block thermocycler instrument. The annealing temperature that resuts in the lowest Cq, highest yield, a negative no template control, high reproducibility between replicates and no non-specific amplification is usually considered optimum. As noted elsewhere herein, specificity can be determined using melt curve and/or gel electrophoresis analysis. The second step temperature is held long enough to permit annealing and elongation, taking into consideration factors such as the amplicon length and processivity of the polymerase. An exemplary time is 1 minute, but other periods are possible, such as 30, 40, 45, 50, 70, 75, 80, or 90 seconds, or some other time. Certain thermocyclers permit faster cyles, such as a 1, 2, or 3 second denaturation step, followed by a 5-30 second anneal/extend step.
[0280] In 3 step programs, the melting first step is the same as in the 2 step program, but the annealing and elongation steps are separated. In such programs, the annealing temperature during the second step can also be optimized as described above for the particular primer sequences chosen for the assay to achieve the best combination of assay specificity, reproducibility and efficiency. Exemplary annealing temperatures in 3 step PCR include 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70° C. In 3 step programs, the second step temperature can be held for time sufficient for annealing to occur, such as 5, 10, 15, 20, 25, 30, 40, 45, 50, 60, 70, 75, 80, or 90 seconds. In the next step, temperature is raised to that at which the DNA polymerase is most active, such 72° C., for time sufficient to extend the primers across the predicted length of the amplication, such as 15, 20, 25, or 30 seconds, or longer, such as a 1 minute for longer amplicons. Other temperatures and/or times for elongation are possible depending on the particular DNA polymerase used in the reaction and amplicon length. For example, the elongation step can occur at 65, 66, 67, 68, 69, 70, 71, or 72° C., for 15, 20, 25, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 seconds, or other temperatures and times based on empirical optimization or predictions based on computer algorithms.
[0281] The cyles of melting, annealing and elongation (whether at one temperature or two) is then repeated for a certain number of cyles to permit amplification and detection of amplicon over a wide range of concentration. An exemplary number of cycles is 40, but other cycle numbers are possible, such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45 cycles.
[0282] The theoretical Tm of the primers may not correspond to the optimum annealing temperature in practice. Thus, in optimizing a qPCR assay, the annealing temperature can be set below the theortical Tm of the primers, for example 5° C. below the predicted Tm, and then a range of increasing annealing temperatures to and above, for example 5° C. above, the theoretical Tm can be tested to determine which one produces the optimal results.
Primers and Probes for Titering Vectors of the Disclosure
[0283] For use in the methods of titering AAV vectors of the disclosure, including AAV9.hCK.Hopti-Dys3978.spA, primers are designed so that they are complementary to subsequences within the vector genome, typically within either the AAV2 ITRs (in the case of the ITR qPCR assays) or the transgene sequence encoding mini-dystrophin protein (in the case of the transgene, or TG, qPCR assays). As understood in the art, forward primers are designed to complement, and therefore anneal, to the antisense (−) DNA strand. As result, the sequence of the forward primer is a subsequence of the sense (+) strand. Reverse primers, however, are designed to complement, and therefore anneal, to the sense (+) DNA strand. As a result, the sequence of the reverse primer is a subsequence of the antisense (−) strand.
[0284] In embodiments of the vector titering assays of the disclosure relating to the ITR qPCR assay, forward and reverse primers are chosen that target the AAV2 inverted terminal repeats present at either end of the vector genome. Further details about qPCR targeting AAV2 ITRs can be found in Aurnhammer, et al., Hum Gene Ther Methods. 2012 February; 23(1):18-28. In ITR qPCR assays where the vector uses AAV2 ITRs, exemplary PCR primer sequences that can be used include forward primers ITR F1 and ITR F2 in Table 15, and reverse primers ITR R1 and ITR R2 in Table 15. Other ITR primer pairs with different sequences are possible, however.
[0285] In embodiments of the vector titering assays of the disclosure relating to the TG qPCR assay, forward and reverse primers are chosen that target the nucleobase sequence encoding the mini-dystrophin protein (sense strand) or its complement (antisense strand).
[0286] In more specific embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1, which is equivalent to the sense strand of a double stranded DNA encoding the mini-dystrophin protein of SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 1-240 from SEQ ID NO:25 (N-terminal Actin Binding Domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 241-252 from SEQ ID NO:25 (QQVSIEAIQEVE) (Gap Sequence 1, separating N-terminal Actin Binding Domain and H1 domain in the mini-dystrophin protein of SEQ ID NO:7) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 253-327 from SEQ ID NO:25 (H1 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 328-336 from SEQ ID NO:25 (KSFGSSLME) (Gap Sequence 2, separating H1 domain and R1 domain in the mini-dystrophin protein of SEQ ID NO:7) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 337-447 from SEQ ID NO:25 (R1 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 448-556 from SEQ ID NO:25 (R2 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 2424-2470 from SEQ ID NO:25 (H3 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 2687-2802 from SEQ ID NO:25 (R22 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 2803-2931 from SEQ ID NO:25 (R23 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 2932-3040 from SEQ ID NO:25 (R24 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 3041-3112 from SEQ ID NO:25 (H4 domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 3113-3299 from SEQ ID NO:25 (Cysteine-Rich domain) that are also present in SEQ ID NO:7. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that encodes for amino acid numbers 3300-3408 from SEQ ID NO:25 (Carboxy-Terminal domain) that are also present in SEQ ID NO:7.
[0287] In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the N-terminal Actin Binding Domain and part or all of the coding sequence for Gap Sequence 1. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part or all of the coding sequence for Gap Sequence 1 and part of the H1 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the N-terminal Actin Binding Domain, all of the coding sequence for Gap Sequence 1 and part of the coding sequence of the H1 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the H1 domain and part or all the coding sequence for Gap Sequence 2. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part or all the coding sequence for Gap Sequence 2 and part of the coding sequence for the R1 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the H1, all of the coding sequence for Gap Sequence 2 and part of the coding sequence of the R1 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the R1 domain and part of the coding sequence for the R2 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the R2 domain and part of the coding sequence for the H3 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the H3 domain and part of the coding sequence for the R22 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the R22 domain and part of the coding sequence for the R23 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the R23 domain and part of the coding sequence for the R24 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the R24 domain and part of the coding sequence for the H4 domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the H4 domain and part of the coding sequence for the Cysteine-Rich domain. In some embodiments, the sequence of the forward primer is a subsequence of the nucleobase sequence of SEQ ID NO:1 that spans part of the coding sequence for the Cysteine-Rich domain and part of the coding sequence for the Carboxy-Terminal domain.
[0288] In some embodiments, the sequence of the reverse primer is a subsequence of the nucleobase sequence of SEQ ID NO:29, the reverse complement of SEQ ID NO:1 and equivalent to the antisense strand of a double stranded DNA encoding the mini-dystrophin protein of SEQ ID NO:7. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the N-terminal Actin Binding Domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for Gap Sequence 1 in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the H1 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for Gap Sequence 2 in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the R1 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the R2 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the H3 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the R22 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the R23 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the R24 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the H4 domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the Cysteine-Rich domain in the sense strand. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the coding sequence for the Carboxy-Terminal domain in the sense strand.
[0289] In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the N-terminal Actin Binding Domain and part or all of the coding sequence for Gap Sequence 1. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part or all of the coding sequence for Gap Sequence 1 and part of the H1 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the N-terminal Actin Binding Domain, all of the coding sequence for Gap Sequence 1 and part of the coding sequence of the H1 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the H1 domain and part or all the coding sequence for Gap Sequence 2. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part or all the coding sequence for Gap Sequence 2 and part of the coding sequence for the R1 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the H1, all of the coding sequence for Gap Sequence 2 and part of the coding sequence of the R1 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the R1 domain and part of the coding sequence for the R2 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the R2 domain and part of the coding sequence for the H3 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the H3 domain and part of the coding sequence for the R22 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the R22 domain and part of the coding sequence for the R23 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the R23 domain and part of the coding sequence for the R24 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the R24 domain and part of the coding sequence for the H4 domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the H4 domain and part of the coding sequence for the Cysteine-Rich domain. In some embodiments, the sequence of the reverse primer is a subsequence of the portion of the nucleobase sequence of SEQ ID NO:29 complementary to the nucleobase sequence in the sense strand that spans part of the coding sequence for the Cysteine-Rich domain and part of the coding sequence for the Carboxy-Terminal domain.
[0290] In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the N-terminal Actin Binding Domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the N-terminal Actin Binding Domain coding sequence. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the H1 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the H1 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the R1 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the R1 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the R2 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the R2 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the H3 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the H3 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the R22 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the R22 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the R23 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the R23 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the R24 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the R24 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the H4 domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the H4 domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the Cysteine-Rich domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the Cysteine-Rich domain. In other embodiments, the forward primer is a subsequence of the portion of SEQ ID NO:1 (sense strand encoding the mini-dystrophin protein of SEQ ID NO:7) that encodes the Carboxy-Terminal domain and the reverse primer is subsequence of the portion of the anti-sense strand (SEQ ID NO:29) complementary to the Carboxy-Terminal domain.
[0291] In other embodiments of methods for titering AAV vectors of the disclosure, including AAV9.hCK.Hopti-Dys3978.spA, primers specific for the mini-dys transgene provided by SEQ ID NO:1 or its complementary sequence are designed to be used in conjunction with probes for real time transgene (TG) qPCR assays that use fluorogenic probe technology, such as TaqMan. Suitable combinations of primers and probes can be designed according to the knowledge of those of ordinary skill in the art, including the guidelines discussed herein.
[0292] Non-limiting examples of sets of primers and probes that can be utilized in vector titering methods of the disclosure are set forth in Table 14. Each set identifies a forward primer sequence and a reverse primer sequence that will produce a relatively short amplicon, as well as a probe sequence that will bind specifically to the amplicon. The nucleobase sequence of the primers and probes referred to in Table 14 are listed in Table 15. The primer and probe names contain two types of information, a letter preceded by a number. The letter indicates whether the sequence is a forward primer (“F”), a reverse primer (“R”) or a probe (“P”), whereas the number indicates the nucleotide position in SEQ ID NO:1 that matches the first (5′-most) base in the forward primer and probe sequences or, in the case of reverse primer sequences, the nucleotide position in SEQ ID NO:1 that is complementary to the first (5′-most) base in the reverse primer sequence.
[0293] The probes listed in Table 14 and Table 15 can, in some embodiments, include reporter and quencher dyes making them suitable for use in dual-label real time qPCR, such as the TaqMan assay format. In these embodiments, the reporter and quencher dyes can be chemically attached to the 5′ and 3′ ends of the probes, respectively, according to the knowledge of those ordinarily skilled. Fluorescent reporter dyes can include 6-FAM™, FAM™, VIC™, NED™, HEX™, TET™, TAMRA™, JOE™, ROX™, Cyanine 3, Cyanine 5, Cyanine 5.5, Cal Fluor® Gold 540, Cal Fluor® Orange 560, Cal Fluor® Red 590, Quasar® 570, Quasar® 670, TxRd (Sulforhodamine 101-X), or others known in the art, whereas quencher dyes can include TAMRA, DABCYL dT, BHQ®-1, BHQ®-2, BHQ®-3, OQ, MGB NFQ, or others.
[0294] Assay conditions for real time qPCR, including concentration of each primer, concentration of probe, annealing temperature, master mix recipe and any other conditions affecting the assay can be optimized for each set of primers and probes accoding to the guidelines for qPCR described herein, or otherwise as would be familiar to those of ordinary skill the art.
[0295] Once the vector titer of the drug substance has been determined using the methods described herein, drug product can be formulated containing a known number of vector genomes per unit volume, such as milliliters. Alternatively, drug substance can be formulated first and the vector titer of the drug product determined afterward. For any particular subject then to be treated, the volume of drug product necessary to achieve a particular desired therapeutic dose of vector (for example, in terms of number of vector genomes per unit body mass, such as kilogram) can then be calculated and administered to a subject in need of treatment.
Methods of Treatment
[0296] The disclosure provides methods for treating a dystrophinopathy by administering to a subject in need of treatment for dystrophinopathy a therapeutically effective dose or amount of an AAV vector of the disclosure, such as, without limitation, the vector known as AAV9.hCK.Hopti-Dys3978.spA. In some embodiments, the dystrophinopathy is a muscular dystrophy, including without limitation Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), DMD-associated dilated cardiomyopathy (DCM), and symptomatic carrier states in females. Thus, in some embodiments, the disclosure provides methods for treating muscular dystrophy by administering to a subject in need of treatment for muscular dystrophy a therapeutically effective dose or amount of an AAV vector of the disclosure, such as, without limitation, the vector known as AAV9.hCK.Hopti-Dys3978.spA. In related embodiments, the disclosure provides methods for treating Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), DMD-associated dilated cardiomyopathy (DCM), and symptomatic carrier states in females, in subjects in need of treatment therefore.
[0297] Also provided is the use of an AAV vector or pharmaceutical composition of the disclosure in the manufacture of a medicament for use in the methods of treatment disclosed herein. In addition, there is provided an AAV vector or pharmaceutical composition of the disclosure for use in a method of treatment disclosed herein.
[0298] Treatment of subjects with a dystrophinopathy, such as DMD, need not result in a cure to be considered effective, where cure is defined as either halting disease progression, or partially or completely restoring the subject's muscle function. Rather a therapeutically effective dose or amount of an AAV vector of the disclosure is one that serves to reduce or ameliorate the symptoms of, slow the progression of, or improve the quality of life of a subject with the dystrophinopathy, such as DMD. According to certain non-limiting embodiments, treatment of subjects with a dystrophinopathy can improve their mobility, delay the time to their loss of ambulation or other mobility, and in the cases of severe dystrophinopathy, such as DMD, extend the life of subjects with the disorder.
[0299] The methods of treatment of the disclosure can be used to treat male or female subjects with a dystrophinopathy, such as DMD. In the case of females, treatment can be provided to symptomatic carriers, or to the rare female subject with full blown disease. The methods of the disclosure can also be used to treat subjects of any age with a dystrophinopathy, including subjects less than 1 year old, or about or at least 1 year old, or about or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 years old or older. Subjects, when treated, may be ambulatory, or non-ambulatory.
[0300] The methods of treatment of the disclosure can be used to treat subjects with a dystrophinopathy regardless of the underlying genetic lesion (for example, deletions, duplications, splice site variants, or nonsense mutations in the dystrophin gene), so long as the lesion results in a reduction or loss in the function of the native human dystrophin gene.
[0301] In certain embodiments of the disclosure, treating a subject with a therapeutically effective dose or amount of an AAV mini-dystrophin vector will reduce tissue concentrations of one or more biomarkers that are associated with the existence or progression of muscular dystrophy.
[0302] According to certain embodiments, the biomarkers are certain enzymes released from damaged skeletal muscle or cardiac muscle cells into the blood (including serum or plasma). Non-limiting examples include creatinine kinase (CK), the transaminases alanine aminotransferase (ALT) and aspartate aminotransferase (AST), and lactic acid dehydrogenase (LDH), the average levels of which are all known to be elevated in subjects with DMD.
[0303] In some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce elevated ALT levels in blood of DMD patients to within about 7-, 6-, 5-, 4-, 3-, or 2-fold greater than that typically found in healthy subjects of similar age and sex. In other embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce elevated AST levels in blood of DMD patients to within about 7-, 6-, 5-, 4-, 3-, or 2-fold greater than that typically found in healthy subjects of similar age and sex. In some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce elevated LDH levels in blood of DMD patients to within about 7-, 6-, 5-, 4-, 3-, or 2-fold greater than that typically found in healthy subjects of similar age and sex. And in some other embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce elevated total CK levels in blood of DMD patients to within about 50-, 48-, 46-, 44-, 42-, 40-, 38-, 36-, 34-, 32-, 30-, 28-, 26-, 24-, 22-, 20-, 18-, 16-, 14-, 12-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or 2-fold greater than that typically found in healthy subjects of similar age and sex. It has also been found that matrix metalloproteinase-9 (MMP-9), an enzyme associated with degradation or remodeling of the extracellular matrix, is elevated in the blood of DMD patients. See, for example, Nadaraja, V D, et al., Neuromusc. Disorders 21:569-578 (2011). Thus, in some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce elevated MMP-9 levels in blood of DMD patients to within about 15-, 14-, 13-, 12-, 11-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or 2-fold greater than that typically found in healthy subjects of similar age and sex.
[0304] In other embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to alter the levels of ALT, AST, LDH, CK and MMP-9 as indicated above alone or in combination with one or more of these same or other biomarkers. Thus, in an exemplary non-limiting embodiment, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the disclosure is effective to reduce ALT and AST, ALT and LDH, AST and CK, or AST and MMP-9, etc.
[0305] In some methods of treatment of the disclosure, an effective dose or amount of an AAV vector is one that improves average subject performance in the 6 minute walk-test (6MWT). The 6MWT has been established as a reproducible and valid measure of muscle function and mobility of human subjects with muscular dystrophy, in particular, DMD. See, for example, McDonald, C M, et al., Muscle Nerve 41(4):500-10 (2010); Henricson, E, et al., PLOS Currents Musc Dys, 8 Jul. 2013; McDonald, C M, et al., Muscle Nerve 48:343-56 (2013). In the test, the distance in meters that a subject can, starting from rest, walk continually and unaided during a 6 minute period is recorded. This distance is also known as the 6 minute walk distance (6MWD). In some applications of the test, an individual subject may be tested more than once over a period of days, and the results averaged. Due to its advantages, the 6MWT has been adopted as a primary clinical endpoint in drug trials involving ambulatory DMD patients. See, for example, Bushby, K, et al., Muscle Nerve 50:477-87 (2014); Mendell, J R, et al., Ann Neurol 79:257-71 (2016); Campbell, C, et al., Muscle Nerve 55(4):458-64 (2017). Usually, in these trials, each subject in the treatment group has his ambulation tested using the 6MWT over a period of months or years to determine if a treatment effect exists.
[0306] According to some embodiments of the methods of treatment of the disclosure, therapeutic efficacy is determined statistically by comparing the treatment effect of AAV vectors of the disclosure on the average 6MWT performance of treated subjects, such as those with DMD, in comparison with the average 6MWT performance of untreated control subjects with the same type of dystrophinopathy, such as DMD. Such controls can have been included in the same studies used to evaluate the therapeutic efficacy of AAV vectors of the disclosure, or can be similar subjects drawn from natural history studies of the progression of DMD or other dystrophinopathies. Controls can be age matched (or stratified, for example and without limitation, into those subjects younger than or older than some threshold age, such as 6, 7, 8, 9, or 10 years), matched for status of prior corticosteroid treatment (that is, yes or no, or length of time of previous treatment), matched for baseline performance in the 6MWT before any treatment (except perhaps with corticosteroids) (or stratified, for example and without limitation, into those subjects whose baseline performance is below and above some threshold, such as 200 m, 250 m, 300 m, 350 m, 400 m, 450 m, or 500 m), or some other attribute determined to be clinically relevant.
[0307] According to certain embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure is effective to increase the average 6MWD of subjects with dystrophinopathy, such as DMD, by about or at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 meters or more compared to similar matched or stratified controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after administration of the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0308] According to certain embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure is effective to increase the average 6MWD of subjects with dystrophinopathy, such as DMD, by about or at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 meters or more compared to similar matched or stratified controls 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, 360, 390, 420, 450, 480, 510, 540, 570, 600, 630, 660, 690 or 720 days after administration of the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0309] As an alternative to the 6MWT, therapeutic efficacy can be expressed as reduction in the time it takes a subject to ascend 4 standard sized stairs, a test known as the 4 stair climb test. This test has been used to assess the effectiveness of corticosteroid treatment in DMD patients. Griggs, R C, et al., Arch Neurol 48(4):383-8 (1991). Thus, according to certain embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure is effective to reduce the average time it takes for subjects with dystrophinopathy, such as DMD, to perform the 4 stair climb test by about or at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, or 4.0 seconds or more compared to similar matched or stratified controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after administration of the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0310] In related embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure is effective to reduce the average time it takes for subjects with dystrophinopathy, such as DMD, to perform the 4 stair climb test by about or at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, or 4.0 seconds or more compared to similar matched or stratified controls 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, 360, 390, 420, 450, 480, 510, 540, 570, 600, 630, 660, 690 or 720 days after administration of the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0311] Therapeutic efficacy can also be expressed as a reduction over time in the percentage of subjects that experience loss of ambulation a specified time after treatment compared to controls. Loss of ambulation is defined as start of continuous reliance on wheelchair use. Thus, according to yet other embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure reduces, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after administration to subjects with dystrophinopathy, such as DMD, the average number of subjects that have lost ambulation by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more compared to similar matched or stratified controls. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0312] In some embodiments of the methods of treatment of the disclosure, a therapeutically effective dose or amount of an AAV vector of the disclosure is effective to delay the onset of one or more symptoms in a subject having a dystrophinopathy, such as DMD. Diagnosis before onset of symptoms can be accomplished through prenatal, perinatal or postnatal genetic testing for mutations in the DMD gene. According to certain embodiments, treatment with an AAV vector of the disclosure is effective to delay onset of one or more symptoms of DMD by at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 26, 28, 30, 32, 34, 35, 36, 38, 40, 42, 44, 45, 46, 48, 50, 52, 54, 55, 56, 28, 60, 62, 64, 65, 66, 68, 70, 72, 74, 75, 76, 78, or 80 months, or more compared to similar matched or stratified controls. As appreciated by those of ordinary skill, early symptoms of DMD include without limitation delay in walking ability (to an average age of about 18 months, compared to an average of 12-15 months in babies without DMD); difficulty jumping, running or climbing stairs; proneness to falling; proximal muscle weakness, evidenced, for example, by exhibiting the Gowers' maneuver when rising from the floor; enlarged calves, due to pseudohypertrophy; waddling gait due to subjects' walking on toes and/or balls of feet; tendency to maintain balance by sticking out bellies and pulling back shoulders; and cognitive impairments, such as diminished receptive language, expressive language, visuospatial ability, fine motor skills, attention, and memory skills. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0313] Therapeutic efficacy can also be expressed as a reduction over time in the percentage of vector treated subjects that experience an increase in the amount of adipose tissue that replaces lean muscle tissue compared to untreated controls. In some embodiments, this progression toward increased adiposity can be determined using MRI analysis of the leg muscles of DMD patients and expressed as the fat fraction (FF), as explained further in Willcocks, R J, et al., Multicenter prospective longitudinal study of magnetic resonance biomarkers in a large Duchenne muscular dystrophy cohort, Ann Neurol 79:535-47 (2016). See also Dixon W T, Simple proton spectroscopic imaging, Radiology 153(1):189-94 (1984). In related embodiments, treatment of DMD subjects with an AAV vector of the disclosure is effective to reduce the average FF in their lower extremities as determined by MRI by about or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after treatment compared to matched controls. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0314] In some embodiments, a therapeutically effective dose or amount of an AAV vector of the disclosure is one that results in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or more of skeletal muscle fibers expressing the mini-dystrophin protein 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after treatment. The percentage of muscle fibers that are positive for mini-dystrophin protein expression may be determined by immunolabeling sections of biopsied muscle from treated subjects with an anti-dystrophin antibody capable of specifically binding the mini-dystrophin protein. Suitable immunolabeling techniques are described in the Examples, and are familiar to those of ordinary skill in the art. Exemplary muscles of treated subjects from which biopsies may be taken include bicep, deltoid, and quadriceps, although other muscles may be biopsied as well. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0315] In some embodiments, a dose or amount of an AAV vector of the disclosure for treating dystrophinopathy, such as muscular dystrophy, such as DMD, is determined to be therapeutically effective and at the same time causes either no cellular (T cell) immune response specific for the mini-dystrophin protein in treated subjects, or in only a low percentage of such subjects. Existence or extent of a T cell response against the mini-dystrophin protein can be determined using the ELISPOT assay to detect peripheral blood mononuclear cells (PBMCs) isolated from subject blood that produce gamma interferon (IFNγ) in response to exposure to an overlapping peptide library covering the mini-dystrophin protein amino acid sequence. In certain embodiments, the threshold for a positive IFNγ response can be set as greater than 50 spot-forming cells per million PBMCs tested. Use of other assays to detect a T cell response against the mini-dystrophin protein are also possible including without limitation detection of T cell infiltrates in biopsies of muscle or other tissues expressing mini-dystrophin protein obtained from vector treated subjects. Subjects can be human subjects or animal subjects, such as animal models of DMD, such as the mdx mouse, mdx rat, or GRMD dog models. In other embodiments, a dose or amount of an AAV vector of the disclosure for treating dystrophinopathy, such as muscular dystrophy, such as DMD, is determined to be therapeutically effective and at the same time causes either no inflammatory response against the capsid, vector genome (or any component thereof), or mini-dystrophin protein expressed by transduced cells, or in only a low percentage of such subjects. Without wishing to be bound by any particular theory of operation, inflammation in response to an AAV vector may be caused by an innate immune response. Inflammation, if any exists, in the muscles of vector treated subjects can be detected using magnetic resonance imaging. See, for example, J Garcia, Skeletal Radiol 29:425-38 (2000) and Schulze, M, et al., Am J Radiol 192:1708-16 (2009).
[0316] Subjects can be human subjects or animal subjects, such as animal models of DMD, such as the mdx mouse, mdx rat, or GRMD dog models. In some of the embodiments described above, existence or absence of cellular immune response or inflammation is determined 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 months after treatment, or some other time after treatment. In related embodiments, a low percentage of subjects exhibiting a cellular immune response to the mini-dystrophin protein would be less than or equal to about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% of subjects administered vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0317] In related embodiments, a dose or amount of an AAV vector of the disclosure for treating dystrophinopathy, such as muscular dystrophy, such as DMD, is therapeutically effective without need for concomitant immune suppression in treated subjects. Thus, in certain embodiments, treatment of a subject with dystrophinopathy, such as DMD, is effective without need to administer to the subject before, during or after treatment with AAV vector one or more immune-suppressing drugs (apart from steroid treatment, which is the current standard of care). Exemplary immune-suppressing drugs include but are not limited to calcineurin inhibitors, such as tacrolimus and cyclosporin, antiproliferative agents, such as mycophenolate, leflunomide, and azathioprine, or mTOR inhibitors, such as sirolimus and everolimus.
[0318] As explored in greater detail in the Examples, efficacy of the AAV vectors of the disclosure, including without limitation the vector designated as AAV9.hCK.Hopti-Dys3978.spA, can be tested in animal models of Duchenne muscular dystrophy, and results used to predict efficacious doses of such vectors in human DMD patients. Various animal models are known in the art, including the mdx mouse model, the Golden Retriever muscular dystrophy model, and more recently, the Dmd.sup.mdx rat model, which is described in greater detail in the Examples.
[0319] Based on the Dmd.sup.mdx rat model, effective doses of AAV vectors of the disclosure, including the vector designated as AAV9.hCK.Hopti-Dys3978.spA, can be established with respect to various biological parameters and aspects of the disease course in the rats.
[0320] Thus, according to certain embodiments of the disclosure, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to reduce serum AST, ALT, LDH, or total creatine kinase levels at 3 months or 6 months post-injection compared to controls.
[0321] In other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to reduce fibrosis in biceps femoris, diaphragm, or heart muscle at 3 months or 6 months post-injection compared to controls.
[0322] In yet other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to increase forelimb grip force at 3 months or 6 months post-injection compared to controls.
[0323] According to other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to reduce muscle fatigue as measured over 5 closely spaced trials testing forelimb grip force at 3 months or 6 months post-injection compared to controls.
[0324] In some other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to increase the left ventricular ejection fraction as measured using echocardiography at 6 months post-injection compared to controls.
[0325] In other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to increase the ratio of the velocity of early to late left ventricular filling (i.e., E/A ratio) as measured using echocardiography at 3 months or 6 months post-injection compared to controls.
[0326] According to some embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1×10.sup.14 vg/kg or 3×10.sup.14 vg/kg is effective to decrease the isovolumetric relaxation time (IVRT) or the time in milliseconds between peak E velocity and its return to baseline (i.e., the E wave deceleration time (DT)) as measured using echocardiography at 3 months or 6 months post-injection compared to controls.
[0327] In each of the foregoing embodiments, the increase or decrease of the physiologic measurement in vector-treated animals compared to control animals can, in some embodiments, be tested for statistical significance. The choice of which statistical test to apply is within the knowledge of those ordinarily skilled in the art. Where a p-value is adopted as the way in which to assess statistical significance, such p-values, once calculated, can be compared to a predefined significance level, and if the p-value is smaller than the significance level, the treatment effect can be determined to be statistically significant. In some embodiments, the significance level can be predefined as 0.25, 0.20, 0.15, 0.10, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, or some other significance level. Thus, in an exemplary non-limiting embodiment, where the significance level is predefined as 0.05, then calculation of a p-value<0.05 would be interpreted to represent a statistically significant difference between vector-treated and control groups.
[0328] In each of the foregoing embodiments, the controls can be age matched animals of the same sex and genetic background that are untreated, or treated only with vehicle and not vector. Other controls are also possible, however.
[0329] In some other embodiments, treatment of Dmd.sup.mdx rats with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 3×10.sup.14 vg/kg is effective to transduce biceps femoris, diaphragm, heart muscle, or other striated muscles, and express the mini-dystrophin protein encoded by the opti-Dys3978 gene without inducing a cellular immune response against the mini-dystrophin protein by 3 months or 6 months post-injection. Cellular immune response against the mini-dystrophin protein can be assessed by isolating splenocytes, or blood lymphocytes, such as peripheral blood mononuclear cells (PBMCs), from test animals, incubating the cells with peptides from an overlapping peptide library covering the mini-dystrophin protein amino acid sequence (for example, peptides 15 amino acids long overlapping by 10 amino acids each) in pools (for example, 5 pools), and determining whether the cells produce gamma interferon (IFNγ) in response to being exposed to the peptides. Production of IFNγ can be determined using the ELISPOT assay according to the knowledge of those ordinarily skilled in the art. See, for example, Smith, J G, et al., Clin Vaccine Immunol 8(5):871-9 (2001), Schmittel A, et al., J Immunol Methods 247:17-24 (2001), and Marino, A T, et al., Measuring immune responses to recombinant AAV gene transfer, Ch. 11, pp. 259-72, Adeno-Associated Virus Methods and Protocols, Ed. R O Snyder and P Moullier, Humana Press (2011). In certain embodiments, the threshold for a positive IFNγ response can be set as greater than 50 spot-forming cells per million cells tested, or in other embodiments, as at least 3-times the number of spot-forming cells detected using a negative control (for example, medium only without added peptides), so that a negative response would be considered below these thresholds.
[0330] In some embodiments of the methods of treatment of the present disclosure, an AAV vector for treating dystrophinopathy, such as DMD, is administered to a subject in need of treatment for dystrophinopathy, such as DMD, jointly with at least a second agent established or believed to be effective for treating dystrophinopathy, such as DMD. Joint administration of the AAV vector means treating a subject before, contemporaneously with, or after treatment of the second agent. According to certain embodiments, the AAV vector is jointly administered with an antisense oligonucleotide that causes exon skipping of the DMD gene, for example of exon 51 of the dystrophin gene, or some other exon of the dystrophin gene. Agents that cause skipping of exon 51 of the dystrophin gene include drisapersen and eteplirsen, but others are possible. In other embodiments, the AAV vector is jointly administered with an agent that inhibits myostatin function in the subject, such as an anti-myostatin antibody, examples of which are provided in U.S. Pat. Nos. 7,888,486, 8,992,913, and 8,415,459. In other embodiments, where the dystrophinopathy of the subject can be attributed to a nonsense mutation in the dystrophin gene, the AAV vector is jointly administered with an agent that promote ribosomal read-through of nonsense mutations, such as ataluren, or with an agent that suppresses premature stop codons, such as an aminoglycoside, such as gentamicin. In other embodiments, the AAV vector is jointly administered with an anabolic steroid, such as oxandrolone. And in yet other embodiments, the AAV vector is jointly administered with a corticosteroid, such as without limitation prednisone, deflazacort, or prednisolone. In some embodiments of these methods, the AAV vector is an AAV9 vector comprising a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA.
[0331] According to certain embodiments of the disclosure, methods of treating human subjects with DMD with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is effective to increase the numbers of muscle fibers that detectably express mini-dystrophin protein 2 months after treatment. In some embodiments the mean number of muscle fibers that detectably express mini-dystrophin is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, the mean number of muscle fibers that detectably express mini-dystrophin after a human DMD subject is treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of 1×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg (where vector titer is determined using a transgene qPCR assay), is at least 38%, and the mean number of muscle fibers that detectably express mini-dystrophin after a human subject is treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is at least 69%. In yet other embodiments, the number of muscle fibers that exhibit increased individual fiber mean intensity (FMI) increases when assayed 2 months after treating human DMD subjects with a dose of AAV9.hCK.Hopti-Dys3978.spA of 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), relative to baseline before such treatment. In some embodiments the human subjects treated with AAV9.hCK.Hopti-Dys3978.spA are ambulant boys between the ages of 5-12 inclusive treated daily with glucocorticoids and negative for neutralizing antibodies against AAV9. In certain embodiments, expression of mini-dystrophin protein is detected in muscle biopsies taken from the biceps femoris muscle of treated subjects. In some embodiments detection of mini-dystrophin expression is accomplished by binding mini-dystrophin protein in biopsied muscle samples from subjects with a fluorescently tagged antibody. Such techniques are within the knowledge of those of ordinary skill in the art.
[0332] In other embodiments of the disclosure, methods of treating human subjects with DMD with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg 2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is effective to increase the concentration of mini-dystrophin protein in muscle 2 months after treatment. In some embodiments, the mean concentration of mini-dystrophin protein is at least 500 femtomoles/milligram (fmol/mg) protein, or at least 600 fmol/mg, 700 fmol/mg, 800 fmol/mg, 900 fmol/mg, 1000 fmol/mg, 1100 fmol/mg, or 1200 fmol/mg protein. In other embodiments, concentration of mini-dystrophin in muscle from individual subjects treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is at least 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 fmol/mg protein 2 months after treatment. In yet other embodiments, the mean concentration of mini-dystrophin protein is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% that of the mean concentration of wild type dystrophin protein in pooled skeletal muscle samples taken from at least 20 human pediatric subjects lacking any evident muscle disease (i.e., normal standard). In some embodiments, the mean concentration of mini-dystrophin protein expressed in muscle after human DMD subjects are treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of 1×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg (where vector titer is determined using a transgene qPCR assay), is at least 23.6% compared to normal standard levels of dystrophin, and the mean concentration of mini-dystrophin protein expressed in muscle after human DMD subjects are treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is at least 29.5% compared to normal standard levels of dystrophin. In some embodiments the human subjects treated with AAV9.hCK.Hopti-Dys3978.spA are ambulant boys between the ages of 5-12 inclusive treated daily with glucocorticoids and negative for neutralizing antibodies against AAV9. In certain embodiments, concentration of mini-dystrophin protein is measured in muscle biopsies taken from the biceps femoris muscle of treated subjects. Methods for measuring mini-dystrophin or dystrophin concentration in muscle samples from treated subjects or normal controls respectively are known by those of ordinary skill in the art.
[0333] In some other embodiments of the disclosure, methods of treating human subjects with DMD with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is effective to reduce creatinine kinase (CK) blood or serum levels at 30 days or later after treatment compared to baseline CK levels before treatment. In some embodiments, CK levels are reduced at 30 days or later after treatment by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% relative to the CK levels in subjects prior to treatment with AAV9.hCK.Hopti-Dys3978.spA. In some embodiments the human subjects treated with AAV9.hCK.Hopti-Dys3978.spA are ambulant boys between the ages of 5-12 inclusive treated daily with glucocorticoids and negative for neutralizing antibodies against AAV9.
[0334] According to other embodiments of the disclosure, methods of treating human subjects with DMD with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), is effective to increase performance of the subjects on the North Star Ambulatory Assessment (NSAA). The NSAA is a scale for assessing motor function in ambulant children affected with DMD and is widely used for monitoring the progression of the disease in individuals and populations. As usually implemented, the NDAA consists of 17 functional tests, such as ability to stand and run, each of which can be scored 2, 1, or 0, with lower scores correlating to diminished functional ability on the specific task. The subscores are then summed and can range from 0 to 34. Additional information about the NSAA can be found for example in Mazzone et al., Neuromuscular Disorders 20(11):712-716 (2010) and Ricotti et al., J. Neurol, Neurosurg & Psych 87(2):149-155 (2016), which are incorporated by reference. While individuals are highly variable in their performance, on average, by the time children with DMD reach 7 years of age, their performance on the NSAA has reached its maximum and begins to decline. In some embodiments, by one year after being treated with a dose of AAV9.hCK.Hopti-Dys3978.spA of about 1×10.sup.14 vg/kg or about 3×10.sup.14 vg/kg (where vector titer is determined using an ITR qPCR assay), or of about 0.67×10.sup.14 vg/kg or about 2×10.sup.14 vg/kg (or a range approximating 2×10.sup.14 vg/kg, such as 1.80×10.sup.14 vg/kg-2.20×10.sup.14 to vg/kg, 1.85×10.sup.14 vg/kg-2.15×10.sup.14 vg/kg, 1.90×10.sup.14 vg/kg-2.10×10.sup.14 vg/kg, or 1.95×10.sup.14 vg/kg-2.05×10.sup.14 vg/kg) (where vector titer is determined using a transgene qPCR assay), human subjects with DMD aged 7 years or older experience a mean improved performance on the NSAA of at least 1.5 points, 2 points, 2.5 points, 3 points, 3.5 points, 4 points, 4.5 points, 5 points, 5.5 points, 6 points, 6.5 points, 7 points, 7.5 points, 8 points, 8.5 points, 9 points, 9.5 points, or 10 points. In some embodiments the human subjects treated with AAV9.hCK.Hopti-Dys3978.spA are ambulant boys between the ages of 5-12 inclusive treated daily with glucocorticoids and negative for neutralizing antibodies against AAV9.
Pharmaceutical Formulations and Modes of Administration
[0335] Virus vectors and capsids according to the present invention find use in both veterinary and human medical applications. Suitable subjects include both avians and mammals. The term “avian” as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets, and the like. The term “mammal” as used herein includes, but is not limited to, humans, non-human primates, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. Human subjects include neonates, infants, juveniles and adults. Optionally, the subject is “in need of” the methods of the present invention, e.g., because the subject has or is believed at risk for a disorder including those described herein or that would benefit from the delivery of a polynucleotide including those described herein. As a further option, the subject can be a laboratory animal and/or an animal model of disease.
[0336] In particular embodiments, the present invention provides a pharmaceutical composition comprising a virus vector (such as an rAAV particle) and/or capsid of the invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier will be respirable, and optionally can be in solid or liquid particulate form.
[0337] By “pharmaceutically acceptable” it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.
[0338] One aspect of the present invention is a method of transferring a polynucleotide encoding mini-dystrophin to a cell in vitro. The virus vector may be introduced into the cells at the appropriate multiplicity of infection according to standard transduction methods suitable for the particular target cells. Titers of virus vector to administer can vary, depending upon the target cell type and number, and the particular virus vector, and can be determined by those of skill in the art without undue experimentation. In representative embodiments, at least about 10.sup.3 infectious units, more preferably at least about 10.sup.5 infectious units are introduced to the cell.
[0339] The cell(s) into which the virus vector is introduced can be of any type, including but not limited to muscle cells (e.g., skeletal muscle cells, cardiac muscle cells, smooth muscle cells and/or diaphragm muscle cells), stem cells, germ cells, and the like. In representative embodiments, the cell can be any progenitor cell. As a further possibility, the cell can be a stem cell (e.g., muscle stem cell). Moreover, the cell can be from any species of origin, as indicated above.
[0340] The virus vector can be introduced into cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the virus vector is introduced therein, and the cells are then administered back into the subject. Methods of removing cells from subject for manipulation ex vivo, followed by introduction back into the subject are known in the art (see, e.g., U.S. Pat. No. 5,399,346). Alternatively, the recombinant virus vector can be introduced into cells from a donor subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof (i.e., a “recipient” subject).
[0341] Suitable cells for ex vivo gene delivery are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10.sup.2 to about 10.sup.8 cells or at least about 10.sup.3 to about 10.sup.6 cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the virus vector are administered to the subject in a treatment effective or prevention effective amount in combination with a pharmaceutical carrier.
[0342] A further aspect of the invention is a method of administering the virus vector to subjects. Administration of the virus vectors and/or capsids according to the present invention to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the virus vector and/or capsid is delivered in a treatment effective or prevention effective dose in a pharmaceutically acceptable carrier.
[0343] Dosages of the virus vector and/or capsid to be administered to a subject depend upon the mode of administration, the disease or condition to be treated and/or prevented, the individual subject's condition, the particular virus vector or capsid, and the nucleic acid to be delivered, and the like, and can be determined in a routine manner. Exemplary doses for achieving therapeutic effects are titers of at least about 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, 10.sup.14, 10.sup.15 transducing units, optionally about 10.sup.8-10.sup.13 transducing units.
[0344] In particular embodiments, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, yearly, etc.
[0345] In certain embodiments, an AAV vector or particle of the disclosure can be administered to a subject in compositions comprising empty AAV capsids of the same or a different serotype. Empty capsids are AAV capsids comprising the typical arrangement and ratios of VP1, VP2 and VP3 capsid proteins, but do not contain a vector genome. Without wishing to be bound by any particular theory of operation, it is hypothesized that the presence of empty capsids can reduce the immune response against the capsid of the AAV vector, and thereby increase transduction efficiency. Empty capsids can occur naturally in a preparation of AAV vector, or be added in known quantities to achieve known ratios of empty capsids to AAV vector (that is, capsids containing vector genomes). Preparation, purification and quantitation of empty capsids is within the knowledge of those ordinarily skilled in the art. Compositions comprising AAV vectors of the disclosure and empty capsids can be formulated with an excess of empty capsids relative to AAV vectors, or an excess of genome containing AAV vectors relative to empty capsids. Thus, in some embodiments, compositions of the disclosure comprise AAV vectors of the disclosure and empty capsids of the same or a different serotype, wherein the ratio of empty capsids to AAV vectors is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10 to 1, or some other ratio.
[0346] In other embodiments, the disclosure provides exemplary efficacious doses of AAV vector particles for treating dystrophinopathy, such as muscular dystrophy, such as DMD, quantified as vector genomes (vg) per kilogram of subject body weight (kg), abbreviated vg/kg. According to certain embodiments, an efficacious dose of an AAV vector of the disclosure, including those comprising an AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated as AAV9.hCK.Hopti-Dys3978.spA, is about 1×10.sup.12 vg/kg, 2×10.sup.12 vg/kg, 3×10.sup.12 vg/kg, 4×10.sup.12 vg/kg, 5×10.sup.12 vg/kg, 6×10.sup.12 vg/kg, 7×10.sup.12 vg/kg, 8×10.sup.12 vg/kg, 9×10.sup.12 vg/kg, 1×10.sup.13 vg/kg, 2×10.sup.13 vg/kg, 3×10.sup.13 vg/kg, 4×10.sup.13 vg/kg, 5×10.sup.13 vg/kg, 6×10.sup.13 vg/kg, 7×10.sup.13 vg/kg, 8×10.sup.13 vg/kg, 9×10.sup.13 vg/kg, 1×10.sup.14 vg/kg, 1.5×10.sup.14 vg/kg, 2×10.sup.14 vg/kg, 2.5×10.sup.14 vg/kg, 3×10.sup.14 vg/kg, 3.5×10.sup.14 vg/kg, 4×10.sup.14 vg/kg, 5×10.sup.14 vg/kg, 6×10.sup.14 vg/kg, 7×10.sup.14 vg/kg, 8×10.sup.14 vg/kg, or 9×10.sup.14 vg/kg, or some other dose. In any of these embodiments, the AAV vector may be administered to a subject in a pharmaceutically acceptable composition alone, or with empty capsids of the same capsid serotype at an empty capsid to vector ratio of about 0.5:1, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, or some other ratio.
[0347] Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intracranial, intramuscular (including administration to skeletal, diaphragm and/or cardiac muscle), intrapleural, intracerebral, and intra-articular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intra-lymphatic, and the like, as well as direct tissue or organ injection (e.g., to skeletal muscle, cardiac muscle, or diaphragm muscle).
[0348] Administration can be to any site in a subject, including, without limitation, a site selected from the group consisting of a skeletal muscle, a smooth muscle, the heart, and the diaphragm.
[0349] Administration to skeletal muscle according to the present invention includes but is not limited to administration to skeletal muscle in the limbs (e.g., upper arm, lower arm, upper leg, and/or lower leg), back, neck, head (e.g., tongue), thorax, abdomen, pelvis/perineum, and/or digits. Suitable skeletal muscles include but are not limited to abductor digiti minimi (in the hand), abductor digiti minimi (in the foot), abductor hallucis, abductor ossis metatarsi quinti, abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anconeus, anterior scalene, articularis genus, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, coracobrachialis, corrugator supercilii, deltoid, depressor anguli oris, depressor labii inferioris, digastric, dorsal interossei (in the hand), dorsal interossei (in the foot), extensor carpi radialis brevis, extensor carpi radialis longus, extensor carpi ulnaris, extensor digiti minimi, extensor digitorum, extensor digitorum brevis, extensor digitorum longus, extensor hallucis brevis, extensor hallucis longus, extensor indicis, extensor pollicis brevis, extensor pollicis longus, flexor carpi radialis, flexor carpi ulnaris, flexor digiti minimi brevis (in the hand), flexor digiti minimi brevis (in the foot), flexor digitorum brevis, flexor digitorum longus, flexor digitorum profundus, flexor digitorum superficialis, flexor hallucis brevis, flexor hallucis longus, flexor pollicis brevis, flexor pollicis longus, frontalis, gastrocnemius, geniohyoid, gluteus maximus, gluteus medius, gluteus minimus, gracilis, iliocostalis cervicis, iliocostalis lumborum, iliocostalis thoracis, illiacus, inferior gemellus, inferior oblique, inferior rectus, infraspinatus, interspinalis, intertransversi, lateral pterygoid, lateral rectus, latissimus dorsi, levator anguli oris, levator labii superioris, levator labii superioris alaeque nasi, levator palpebrae superioris, levator scapulae, long rotators, longissimus capitis, longissimus cervicis, longissimus thoracis, longus capitis, longus colli, lumbricals (in the hand), lumbricals (in the foot), masseter, medial pterygoid, medial rectus, middle scalene, multifidus, mylohyoid, obliquus capitis inferior, obliquus capitis superior, obturator externus, obturator internus, occipitalis, omohyoid, opponens digiti minimi, opponens pollicis, orbicularis oculi, orbicularis oris, palmar interossei, palmaris brevis, palmaris longus, pectineus, pectoralis major, pectoralis minor, peroneus brevis, peroneus longus, peroneus tertius, piriformis, plantar interossei, plantaris, platysma, popliteus, posterior scalene, pronator quadratus, pronator teres, psoas major, quadratus femoris, quadratus plantae, rectus capitis anterior, rectus capitis lateralis, rectus capitis posterior major, rectus capitis posterior minor, rectus femoris, rhomboid major, rhomboid minor, risorius, sartorius, scalenus minimus, semimembranosus, semispinalis capitis, semispinalis cervicis, semispinalis thoracis, semitendinosus, serratus anterior, short rotators, soleus, spinalis capitis, spinalis cervicis, spinalis thoracis, splenius capitis, splenius cervicis, sternocleidomastoid, sternohyoid, sternothyroid, stylohyoid, subclavius, subscapularis, superior gemellus, superior oblique, superior rectus, supinator, supraspinatus, temporalis, tensor fascia lata, teres major, teres minor, thoracis, thyrohyoid, tibialis anterior, tibialis posterior, trapezius, triceps brachii, vastus intermedius, vastus lateralis, vastus medialis, zygomaticus major, and zygomaticus minor, and any other suitable skeletal muscle as known in the art.
[0350] The virus vector can be delivered to skeletal muscle by intravenous administration, intra-arterial administration, intraperitoneal administration, limb perfusion, (optionally, isolated limb perfusion of a leg and/or arm; see, e.g. Arruda et al., (2005) Blood 105: 3458-3464), and/or direct intramuscular injection. In particular embodiments, the virus vector and/or capsid is administered to a limb (arm and/or leg) of a subject (e.g., a subject with muscular dystrophy such as DMD) by limb perfusion, optionally isolated limb perfusion (e.g., by intravenous or intra-articular administration. In embodiments of the invention, the virus vectors and/or capsids of the invention can advantageously be administered without employing “hydrodynamic” techniques. Tissue delivery (e.g., to muscle) of prior art vectors is often enhanced by hydrodynamic techniques (e.g., intravenous/intravenous administration in a large volume), which increase pressure in the vasculature and facilitate the ability of the vector to cross the endothelial cell barrier. In particular embodiments, the viral vectors and/or capsids of the invention can be administered in the absence of hydrodynamic techniques such as high volume infusions and/or elevated intravascular pressure (e.g., greater than normal systolic pressure, for example, less than or equal to a 5%, 10%, 15%, 20%, 25% increase in intravascular pressure over normal systolic pressure). Such methods may reduce or avoid the side effects associated with hydrodynamic techniques such as edema, nerve damage and/or compartment syndrome.
[0351] Administration to cardiac muscle includes administration to the left atrium, right atrium, left ventricle, right ventricle and/or septum. The virus vector and/or capsid can be delivered to cardiac muscle by intravenous administration, intra-arterial administration such as intra-aortic administration, direct cardiac injection (e.g., into left atrium, right atrium, left ventricle, right ventricle), and/or coronary artery perfusion.
[0352] Administration to diaphragm muscle can be by any suitable method including intravenous administration, intra-arterial administration, and/or intra-peritoneal administration.
[0353] Administration to smooth muscle can be by any suitable method including intravenous administration, intra-arterial administration, and/or intra-peritoneal administration. In one embodiment, administration can be to endothelial cells present in, near, and/or on smooth muscle.
[0354] Delivery to a target tissue can also be achieved by delivering a depot comprising the virus vector and/or capsid. In representative embodiments, a depot comprising the virus vector and/or capsid is implanted into skeletal, smooth, cardiac and/or diaphragm muscle tissue or the tissue can be contacted with a film or other matrix comprising the virus vector and/or capsid. Such implantable matrices or substrates are described in U.S. Pat. No. 7,201,898.
[0355] In particular embodiments, a virus vector according to the present invention is administered to skeletal muscle, diaphragm muscle and/or cardiac muscle (e.g., to treat and/or prevent muscular dystrophy).
[0356] In representative embodiments, the invention is used to treat and/or prevent disorders of skeletal, cardiac and/or diaphragm muscle.
[0357] In a representative embodiment, the invention provides a method of treating and/or preventing muscular dystrophy in a subject in need thereof, the method comprising: administering a treatment or prevention effective amount of a virus vector of the invention to a mammalian subject, wherein the virus vector comprises a heterologous nucleic acid encoding dystrophin, a mini-dystrophin, or a micro-dystrophin. In particular embodiments, the virus vector can be administered to skeletal, diaphragm and/or cardiac muscle as described elsewhere herein.
[0358] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the virus vector and/or virus capsids of the invention in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the virus vector and/or virus capsid can be delivered adhered to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. 2004-0013645).
[0359] Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.
Example 1
Synthesis of Codon-Optimized Human Mini-Dystrophin Genes
[0360] Previously we generated a number of miniature versions of human dystrophin gene by PCR cloning of human muscle dystrophin cDNA, generating mini-dystrophin genes that have large deletions in the central rod domain and nearly complete deletion of the C-terminal region of the dystrophin coding sequence (Wang et al., Proc. Natl. Acad. Sci., USA 97:13714 (2000); U.S. Pat. Nos. 7,001,761 and 7,510,867). These mini-dystrophin genes were tested to be highly functional in vivo in DMD mdx mouse models (Watchko et al., Human Gene Therapy 13:1451 (2002)). One of these mini-dystrophin proteins, named Δ3990, was described in U.S. Pat. No. 7,510,867 under SEQ ID NO:6. The protein sequence of Δ3990 and the DNA encoding it are provided herein by SEQ ID NO:27 and SEQ ID NO:28, respectively.
[0361] A modification of the Δ3990 mini-dystrophin was also designed, codon-optimized, and tested for activity. This new human mini-dystrophin, called Dys3978, is 1325 amino acids in length, and includes the following portions or subdomains from wildtype full-length human muscle dystrophin (SEQ ID NO:25): the N-terminus and actin-binding domain (ABD), hinge H1, rods R1 and R2, hinge H3, rods R22, R23 and R24, hinge H4, the cysteine-rich domain (CR domain) and part of the carboxy-terminal domain (CT domain). The amino acid sequence of this protein is provided by SEQ ID NO:7 and is illustrated schematically in
[0362] The gene encoding Dys3978 was constructed by combining subsequences from the wildtype dystrophin coding sequence corresponding to the protein subdomains described above. The resulting gene is provided by SEQ ID NO:26. To increase the expression of Dys3978, the gene sequence was codon-optimized using human codon algorithms. The resulting human codon-optimized gene, called Hopti-Dys3978, is provided as SEQ ID NO:1. A canine codon-optimized gene encoding Dys3978, called Copti-Dys3978, was also generated, the sequence of which is provided as SEQ ID NO:3. An alignment comparing the DNA sequences of Hopti-Dys3978 and the non-codon-optimized gene encoding Δ3990 is provided in
[0363] Among other changes, codon-optimization of the gene encoding Dys3978 increased total GC content from about 46% in the non-codon-optimized gene to about 61% in the human codon-optimized gene (i.e., Hopti-Dys3978). Increasing GC content can result in increased mRNA levels in mammalian cells. See, for example, Grzegorz, K, et al., PLoS Biol, 4(6):e180 (2006); and Newman, Z R, et al., PNAS, E1362-71 (2016). Codon-optimization also increased the codon adaptation index (CAI) and included addition of a Kozak consensus transcription initiation recognition site at the beginning of the coding sequence.
[0364] To examine if human codon optimization could enhance gene expression, the Hopti-Dys3978 gene was cloned into an AAV vector expression cassette containing the constitutively active CMV promoter and a small synthetic polyadenylation (polyA) signal sequence (SEQ ID NO: 6). After transfection into human HEK 293 cells, the vector plasmid containing the Hopti-Dys3978 gene showed surprisingly greater protein expression than the non-optimized gene encoding Dys3978, as determined qualitatively using immunofluorescent staining and Western blot against dystrophin protein (
[0365] A gene encoding a human mini-dystrophin similar in structure to Dys3978, except that hinge H3 is absent, was also generated and codon-optimized. This gene, called Hopti-Dys3837 (SEQ ID NO: 2) encodes a human mini-dystrophin protein of 1278 amino acids called Dys3837 (SEQ ID NO: 8), which is also illustrated schematically in
[0366] For other experiments described herein, the human and canine codon-optimized Dys3978 genes were placed under the control of one of two different synthetic muscle-specific promoter and enhancer combinations derived from the muscle creatine kinase gene identified below:
[0367] 1) Synthetic hybrid muscle-specific promoter (hCK) (SEQ ID NO: 4); and
[0368] 2) Synthetic hybrid muscle-specific promoter plus (hCKplus) (SEQ ID NO: 5);
[0369] For use in the experiments, the following vectors were constructed using standard molecular cloning techniques. The gene expression cassettes of the specified promoter, mini-dystrophin gene and polyA sequence were cloned into an AAV vector plasmid backbone containing AAV2 inverted terminal repeats (ITRs) flanking the expression cassette.
TABLE-US-00001 1) AAV-CMV-Hopti-Dys3978 2) (SEQ ID NO: 9) AAV-hCK-Hopti-Dys3978 3) (SEQ ID NO: 10) AAV-hCK-Hopti-Dys3837 4) (SEQ ID NO: 11) AAV-hCKplus-Hopti-Dys3837 5) (SEQ ID NO: 12) AAV-hCK-Copti-Dys3978
Example 2
CMV-Hopti-Dys3978 in Dystrophin/Utrophin Double Knockout Mice
[0370] The loss of dystrophin in the patients of Duchenne muscular dystrophy (DMD) results in devastating skeletal muscle degeneration and cardiomyopathy. Mdx mice lacking only dystrophin have a much milder phenotype, whereas double knockout (dKO) mice lacking both dystrophin and its homolog utrophin exhibit the similarly severe dystrophic clinical signs seen in DMD patients. It was previously demonstrated that intraperitoneal injection in neonatal homozygous dKO mice with 3×10.sup.11 vg/mouse of AAV1-CMV-Δ3990 (not codon-optimized) was able to partially restore growth, functions and prolong life-span for a few months (50% survival rate at 22 weeks) (see
TABLE-US-00002 TABLE 1 Mini-dystrophin restores fertility of dKO mice Breeding pairs: Pair #1: T-dKO male X T-dKO female 5 pups Pair #2: T-dKO male X T-dKO female 4 pups Pair #3: T-dKO male X T-dKO female 0 pups Pair #4: mdx male X T-dKO female 5 pups Pair #5: mdx male X T-dKO female 6 pups
[0371] The untreated dKO mice are completely infertile. However fertility was restored by AAV-CMV-Hopti-Dys3978 in both males and females of treated dKO (T-dKO) mice.
[0372] The results described above demonstrate that systemic delivery of codon-optimized Hopti-Dys3978 gene was more efficacious than the non-codon optimized Δ3990 gene.
[0373] Importantly, great improvement in cardiac functions was also observed. Therapeutic effects in the heart were evaluated at 4 months of age by hemodynamic analysis using the Millar Pressure-volume system. Untreated dKO mice barely survived over 4 months. The very small body size, kyphosis and severe muscle and cardiac dysfunctions made dKO mice too sick to tolerate the hemodynamic analysis procedure. Therefore, the AAV9-treated dKO mice were compared with untreated, age-matched mdx mice which had much milder phenotypes due to an intact utrophin gene, which is known to compensate for lack of dystrophin in this model. While measurement by echocardiography showed mdx mice had no apparent cardiac deficit under baseline condition when compared with C57/B10 wildtype mice, they did show apparent deficits as measured by hemodynamics at the baseline (
Example 3
hCK-Hopti-Dys3978 in Mdx Mice
[0374] To examine if the hybrid synthetic muscle-specific promoter hCK was able to effectively drive Dys3978 gene expression, it was compared with the same construct driven by the strong non-specific CMV promoter. Immunofluorescent staining of mini-dystrophin expression in mdx mice following tail vein injection of the respective vectors showed that the two promoters, i.e., hCK and CMV, delivered equivalent expression levels in muscle and heart (
Example 4
CMV-Hopti-Dys3978 in DMD Canine Model Gold Retriever Muscular Dystrophy (GRMD) Dogs
[0375] Based on studies in the mdx mice and dystrophin/utrophin double KO (dKO) mice, the same vector, AAV9-CMV-Hopti-Dys3978 was tested in the golden retriever muscular dystrophy (GRMD) dog, a large animal DMD model. Specifically, the vector was administered to a 2.5-month-old GRMD dog, “Jelly,” and then followed for more than 8 years post injection.
[0376] Experimental procedures: GRMD dog “Jelly” (2.5 months old female; 6.3 kg; serum CK: 20262 units/L before treatment) was injected with AAV9-CMV-Hopti-Dys3978 vector at a dose of 1×10.sup.13 vg/kg via the right hind limb. Under general anesthesia, a rubber tourniquet was positioned at the proximal pelvic extremity (the groin area) to cover a majority of muscles in the right hind limb. The AAV9 vector was injected via the great saphenous vein using a Harvard pump set at injection speed 1 ml/sec. The vector volume was 20 ml/kg body weight (130 ml total). The tourniquet was released after 10 minutes accounting from the start of injection. Muscles in the injected limb became harder as revealed by palpation. MRI images on the hind limbs were collected at about 1 hour post injection and confirmed vector fluid in the injected limb (
[0377] Results: Immunofluorescent (IF) staining showed long-term mini-dystrophin expression in a majority of muscle samples examined up to final necropsy. Interestingly, the injected limb initially (at 2 months post-injection biopsy) had lower expression than the non-injected limb, suggesting procedure-related inflammation and partial inactivation of the CMV promoter (
[0378] Contractile force measurement showed partial improvement when compared to the untreated dogs (
Example 5
hCK-Copti-Dys3978 in GRMD Dog
[0379] In this study, AAV9-hCK-Copti-Dys3978 vector (a modified creatine kinase promoter driving a canine codon-optimized human mini-dystrophin 3978) was used in a GRMD dog named “Dunkin.” The gene encodes the same human mini-dystrophin Dys3978 protein used in other studies, but was canine codon-optimized. The DNA sequence is 94% identical to the human codon-optimized gene. Transfection experiments in human HEK 293 cells comparing CK-Copti-Dys3978 (canine codon-optimized) and CK-Hopti-Dys3978 (human codon-optimized) revealed essentially the same level of expression. Multiple experiments comparing both constructs in mdx mice also showed essentially the same expression levels.
[0380] Experimental procedure: GRMD dog “Dunkin” (female, 2.5 m old, 6.5 kg) was intravenously injected with AAV9-hCK-Copti-Dys3978 vector at the dose of 4×10.sup.13 vg/kg via the great saphenous vein. The dog was not sedated during injection. There was no noticeable adverse reaction or behavior change. A muscle biopsy was done 4 months post vector injection and necropsy was done at 14 months post injection.
[0381] Results: Very high level and nearly uniform mini-dystrophin expression was observed by immunofluorescent staining of mini-dystrophin 3978 on skeletal muscle samples from 4-month post injection biopsy (
[0382] Significantly high levels of mini-dystrophin in cardiac muscles was also observed by IF staining (
[0383] Western blot analysis confirmed the IF staining results. In the skeletal muscles, the mini-dystrophin levels were mostly higher than the normal level of wildtype dystrophin from the normal dog control (
[0384] Expression of Dys3978 from the canine codon-optimized gene Copti-Dys3978 effectively restored dystrophin associated protein complex including gamma-sarcoglycan (
[0385] Quantitative PCR of vector DNA copy numbers showed a consistent trend to the mini-dystrophin protein expression levels (
[0386] There was no innate or cellular immune responses found in all the samples examined. This is very different from the results of AAV9-CMV-opH-dys3978, suggesting the muscle-specific hCK promoter was not only strong but also safer than the CMV promoter.
[0387] Dystrophic pathology was largely ameliorated as shown by H&E staining for histology of the heart (
Example 6
Preparation of AAV9.hCK.Hopti-Dys3978.spA Vector for In Vivo Experiments
[0388] The AAV9.hCK.Hopti-Dys3978.spA vector used in Dmd.sup.mdx rat studies described further in Examples 7, 8 and 9 includes an AAV9 capsid and an expression cassette designed to express a miniaturized version of human dystrophin protein including the N-terminus region, hinge 1 (H1), rod 1 (R1), rod 2 (R2), hinge 3 (H3), rod 22 (R22), rod 23 (R23), rod 24 (R24), hinge 4 (H4), cysteine-rich (CR) domain, and portion of the carboxy-terminal (CT) domain from full length human Dp427m dystrophin protein (SEQ ID NO:25), which are domains minimally required for function. The protein sequence of the mini-dystrophin protein is provided as the amino acid sequence of SEQ ID NO:7, which is encoded by the human codon-optimized DNA sequence provided as the nucleic acid sequence of SEQ ID NO:1. The vector genome of the AAV9.hCK.Hopti-Dys3978.spA vector is provided as the nucleic acid sequence of SEQ ID NO:18, or its reverse complement when the single-stranded genome is packaged in its minus polarity.
[0389] The vector genome comprises 5′ and 3′ flanking AAV2 inverted terminal repeats (ITRs) (having the DNA sequence of SEQ ID NO:14 or SEQ ID NO:15, respectively), a synthetic hybrid enhancer and promoter derived from the creatine kinase (CK) gene to serve as a muscle specific transcription regulatory element (hCK; having the DNA sequence of SEQ ID NO:16), a 3978 base pair long human codon-optimized gene encoding the human mini-dystrophin protein described above (i.e., the Hopti-Dys3978 gene), and a small synthetic transcription termination sequence including a polyadenylation (polyA) signal (spA; having the DNA sequence of SEQ ID NO:17).
[0390] Vector was manufactured using the triple transfection technique and a serum free non-adherent cell line derived from HEK 293 cells. The plasmids used included a helper plasmid to express adenovirus helper proteins required for efficient replication and packaging of the vector, a packaging plasmid expressing the AAV2 rep gene and the AAV9 capsid proteins, and a third plasmid containing the sequence of the expression cassette described above.
[0391] Cells were grown and expanded from a working cell bank sample, and once sufficient volume and cell density had been reached, the cells were transfected using a transfection reagent. After incubation to permit vector production from the transfected cells, the cells were lysed to release vector, the lysate clarified, and vector purified using a nuclease treatment step to remove contaminating nucleic acids, followed by iodixanol step gradient centrifugation, anion exchange chromatography, dialysis against the formulation buffer, sterile filtration, and then storage at 2-8° C.
Example 7
Effects of Single Dose of AAV9.hCK.Hopti-Dys3978.spA in a Rat Model of DMD
[0392] This example describes testing AAV9.hCK.Hopti-Dys3978.spA in a recently developed Dmd.sup.mdx rat model, which has certain advantages compared to the classic mdx mouse and GRMD dog models. Larcher, T., et al., Characterization of dystrophin deficient rats: a new model for Duchenne muscular dystrophy. PLoS One. 2014; 9(10):e110371. In particular, in the Dmd.sup.mdx rat model, the skeletal and cardiac disease are both present at an early stage and develop in a sequential manner similar to the disease progression seen in humans.
[0393] In these studies, male Dmd.sup.mdx rats 5-6 weeks of age were systemically administered by IV injection into tail veins a single dose (1×10.sup.14 vector genomes per kilogram body weight, or vg/kg) of Dys3978 vector suspended in PBS. As a control, wild-type (“WT”) rats from the same genetic background (Sprague Dawley) were also treated in this way. All procedures were conducted blinded to the rat genotype or treatment cohort to avoid bias. Three Dmd.sup.mdx rats and 4 WT rats were treated with vector, whereas 3 Dmd.sup.mdx rats and 2 WT rats were administered PBS only as a negative control (mock treatment). Three months post-injection, animals were euthanized and underwent necropsy for tissue analysis by histology and immunocytochemistry for dystrophin protein expression.
[0394] For histopathological evaluation, tissue samples were fixed in 10% neutral buffered formalin, embedded in paraffin wax, and 5-μm-thick sectioned before staining with hematoxylin eosin saffron (HES). For dystrophin immunolabelling, additional samples (liver, heart, biceps femoris, pectoralis and diaphragm muscles) were frozen and 8-μm-thick sectioned. Mouse monoclonal antibody NCL-DYSB for dystrophin (Novocastra Laboratories, Newcastle on Tyne, UK) was used for both dystrophin and mini-dystrophin protein detection (1:50), since this antibody does not distinguish between full length wild type dystrophin and the engineered mini-dystrophin. All necropsies and histological observations were performed in blinded fashion.
[0395] By histological examination, no lesions were observed in skeletal or cardiac muscle of PBS and vector treated WT rats. In all Dmd.sup.mdx rats, skeletal muscle fiber lesions showing individual necrosis, clusters of regenerative small fibers, scattered giant hyaline fibers, anisocytosis, centronucleation, endomysial fibrosis and sporadic adiposis were present and characteristic of DMD skeletal muscle. The incidence and intensity of these lesions was globally decreased in Dmd.sup.mdx rats treated with vector compared to those treated only PBS. In the heart, lesions of multifocal necrosis, mononuclear cell focal infiltration and mild focal extensive fibrosis were present in one of the Dmd.sup.mdx rats (rat 49) treated with PBS, which is characteristic of DMD cardiac muscle. In all the Dmd.sup.mdx rats treated with vector, cardiac muscle presentation was similar and showed mild mononuclear cell focal infiltration as seen in the Dmd.sup.mdx rat receiving PBS, but in contrast, no fibrotic foci were observed in the hearts of the vector treated Dmd.sup.mdx rats.
[0396] Using immunocytochemistry, WT rats displayed subsarcolemmal dystrophin detected in skeletal, diaphragm and cardiac muscle fibers, and localization of dystrophin detected did not differ between rats treated with vector compared to only PBS. However, mini-dystrophin detection in the vector treated WT rats could not be confirmed using this assay because the anti-dystrophin antibody used could not distinguish between wild type dystrophin and the mini-dystrophin protein. By contrast, one of the Dmd.sup.mdx rats (rat 49) displayed rare skeletal muscle fibers (from about 5% to 10%) with subsarcolemmal dystrophin detectable, which is in accordance with the previous description of the presence of scattered revertant fibers in this model with a frequency of about 5% (Larcher et al., PlosOne, 2014). However no dystrophin was detected in diaphragm or cardiac muscle fibers from this rat. In all Dys3978 vector treated Dmd.sup.mdx rats, subsarcolemmal dystrophin was also detected in about 80% to 95% of skeletal muscle fibers, about 30% to 50% in diaphragm muscle fibers, and about 70% to 80% in heart muscle fibers, although no systematic counting performed. In these rats, very rare skeletal muscle fibers (1 or 2 per muscle section) displayed some cytoplasmic interfibrillar dystrophin. In both vector treated WT and Dmd.sup.mdx rats, there was no evidence of inflammatory cell infiltrates or increased necrosis that might indicate that a cellular immune response had been stimulated by vector transduction, or production of the mini-dystrophin.
[0397] In sum, 3 months after systemic administration of 1×10.sup.14 vg/kg of AAV9.hCK.opti-Dys3978.spA vector, no histological alteration of the muscle tissues was observed in WT rats treated with vector compared to PBS, suggesting that expression of the mini-dystrophin protein was well tolerated in healthy animals. Furthermore, vector treatment of the Dmd.sup.mdx rats resulted in a significant and generalized detection of mini-dystrophin in fibers of all muscles studied (biceps femoris, pectoralis, diaphragm and heart) with a pattern of subsarcolemmal localization similar to that in WT rat muscles. The expression of mini-dystrophin Dys3978 from the vector was associated with reduction in fibrosis and necrosis (
Example 8
Effects of Increasing Doses of AAV9.hCK.Hopti-Dys3978.spA in Dmd.SUP.mdx .Rats Determined at 3 Months and 6 Months Post-Injection
[0398] This example describes the results of treating Dmd.sup.mdx rats, an animal model for Duchenne muscular dystrophy, with increasing doses of AAV9.hCK.Hopti-Dys3978.spA, and measuring the effects at 3 months and 6 months after administration.
[0399] Rats were dosed at 7-8 weeks of age by IV injection into the dorsal penile vein, which resulted in systemic administration of the test articles. Four different vector doses were tested in 10-12 Dmd.sup.mdx rats: 1×10.sup.13 vg/kg (5 rats at the 3 month time point and 6 rats at the 6 month time point), 3×10.sup.13 vg/kg (6 rats at the 3 month time point and 5 rats at the 6 month time point), 1×10.sup.14 vg/kg (7 rats at the 3 month time point and 6 rats at the 6 month time point), and 3×10.sup.14 vg/kg (5 rats at the 3 month time point and 5 rats at the 6 month time point). In addition, Dmd.sup.mdx rats and WT rats each received vehicle only (1× PBS, 215 mM NaCl, 1.25% human serum albumin, 5% (w/v) sorbitol) as a negative control (6 Dmd.sup.mdx rats at the 3 month time point, 4 Dmd.sup.mdx rats at the 6 month time point, 5 WT rats at the 3 month time point, and 7 WT rats at the 6 month time point). Five untreated (that is, no vector and no vehicle either) Dmd.sup.mdx rats were also included as further negative controls. At 3 months and 6 months post-injection, rats from each test arm were euthanized and necropsied to take tissue samples for further analysis. Prior to sacrifice, cardiac function and grip strength tests were carried out in the test animals to assess the effect of vector treatment on DMD disease progression.
[0400] Note that vector doses may be represented in two different numerically equivalent ways in the text and figures. Thus, “1×10.sup.13” is equivalent to “1E13,” “3×10.sup.13” is equivalent to “3E13,” “1×10.sup.14” is equivalent to “1E14,” and “3×10.sup.14” is equivalent to “3E14.”
Body Weight
[0401] After treatment and prior to sacrifice, rats in each treatment arm were weighed daily for the first week, and weekly thereafter until sacrifice. The average weight of all rats in each treatment arm is listed in Table 2 (pre-injection until 9 weeks post-injection) and Table 3 (weeks 10-25 post-injection) and are graphed against time in
TABLE-US-00003 TABLE 2 MEAN WEIGHTS (g) W −1 D 0 D + 1 D + 2 D + 3 D + 4 D + 5 D + 6 D + 7 W + 2 WT + Buffer 200.0 237.9 231.7 237.9 247.1 253.1 262.1 268.7 276.6 325.0 (n = 12 until W + 13, then n = 7) SEM 10.7 10.5 10.1 10.1 10.1 9.8 10.0 10.4 10.7 10.8 DMD + Buffer 180.4 207.4 203.4 208.8 214.5 221.5 229.8 235.4 244.3 286.3 (n = 10 until W + 13, then n = 4) SEM 11.9 12.3 11.9 12.6 12.4 13.0 12.4 10.1 12.6 15.1 DMD + 1E13 vg/kg 173.4 206.4 205.8 208.4 216.7 223.8 229.8 236.8 243.1 286.3 (n = 11 until W + 13, then n = 6) SEM 10.3 8.3 7.9 7.5 7.9 7.2 7.6 7.8 8.7 9.5 DMD + 3E13 vg/kg 180.2 210.8 206.3 209.1 217.6 224.9 230.9 237.2 245.2 297.7 (n = 11 until W + 13, then n = 5) SEM 11.9 10.9 10.1 10.9 11.3 10.5 10.6 10.7 11.0 13.4 DMD + 1E14 vg/kg 178.2 209.4 204.3 210.5 213.0 220.1 225.3 232.5 244.5 288.2 (n = 13 until W + 13, then n = 6) SEM 9.6 7.9 7.5 7.7 7.5 7.4 7.0 76 9.9 9.6 DMD + 1E14 vg/kg w/o HSA (n = 5 230.1 234.9 224.5 233.7 238.7 245.3 243.0 252.7 254.9 300.6 until W + 13) SEM 10.2 9.9 9.3 9.3 9.5 9.5 9.3 9.8 10.4 13.0 DMD + 3E14 vg/kg 161.8 198.8 193.2 197.1 202.3 208.8 212.8 220.6 223.7 272.6 (n = 10 until W + 12, then n = 5) SEM 6.1 7.5 8.8 9.9 9.3 8.9 8.7 8.7 8.5 8.2 MEAN WEIGHTS (g) W + 3 W + 4 W + 5 W + 6 W + 7 W + 8 W + 9 WT + Buffer 361.8 388.8 410.2 428.8 449.6 663.4 682.1 (n = 12 until W + 13, then n = 7) SEM 11.7 11.9 13.6 18.8 15.4 15.5 14.1 DMD + Buffer 318.4 340.5 358.7 374.4 389.1 403.6 418.6 (n = 10 until W + 13, then n = 4) SEM 17.7 18.7 19.4 20.3 21.3 21.0 22.3 DMD + 1E13 vg/kg 325.6 346.5 368.6 388.1 403.8 419.5 439.1 (n = 11 until W + 13, then n = 6) SEM 12.6 13.2 14.2 15.6 18.1 16.7 16.2 DMD + 3E13 vg/kg 329.5 357.3 380.8 398.4 416.7 432.9 448.2 (n = 11 until W + 13, then n = 5) SEM 13.5 15.3 16.9 17.1 18.0 19.4 19.1 DMD + 1E14 vg/kg 329.6 356.6 375.9 395.7 413.4 431.5 448.6 (n = 13 until W + 13, then n = 4) SEM 11.7 12.3 12.2 12.4 12.7 13.8 13.3 DMD + 1E14 vg/kg w/o HSA (n = 5 331.7 352.7 370.3 382.2 392.3 421.3 428.5 until W + 13) SEM 15.4 15.8 17.1 18.1 16.3 17.2 22.7 DMD + 3E14 vg/kg 316.2 350.7 373.0 393.3 414.9 429.2 446.8 (n = 10 until W + 12, then n = 5) SEM 8.7 10.5 11.1 13.9 12.6 14.4 14.7
TABLE-US-00004 TABLE 3 MEAN WEIGHTS (g) W + 10 W + 11 W + 12 W + 13 W + 14 W + 15 W + 16 W + 17 W + 18 WT + Buffer 490.7 505.2 509.1 516.8 514.0 527.8 545.0 553.8 562.2 (n = 12 until W + 13, then n = 7) SEM 14.0 12.4 13.2 13.3 18.8 19.6 19.2 18.5 19.4 DMD + Buffer 423.0 435.2 428.2 430.3 430.2 440.6 452.7 461.8 464.8 (n = 10 until W + 13, then n = 4) SEM 22.8 21.8 17.4 21.6 30.5 32.3 37.7 39.4 39.2 DMD + 1E13 vg/kg 444.8 452.5 453.5 464.5 453.2 457.7 469.9 481.3 484.8 (n = 11 until W + 13, then n = 6) SEM 16.6 17.2 15.4 17.7 17.4 17.2 18.7 17.6 18.3 DMD + 3E13 vg/kg 458.2 467.4 469.7 476.1 465.8 478.5 489.1 496.9 505.2 (n = 11 until W + 13, then n = 5) SEM 20.2 19.4 20.7 23.1 28.9 31.4 34.2 34.2 35.3 DMD + 1E14 vg/kg 459.3 472.7 478.0 483.2 482.1 492.5 504.5 513.6 525.0 (n = 13 until W + 13, then n = 6) SEM 12.7 12.3 11.8 12.2 13.1 14.1 14.3 13.0 14.8 DMD + 1E14 vg/kg w/o HSA (n = 5 430.2 464.5 469.1 470.3 N/A N/A N/A N/A N/A until W + 13) SEM 20.4 18.0 16.7 16.1 N/A N/A N/A N/A N/A DMD + 3E14 vg/kg 457.4 475.3 483.9 502.1 515.9 519.1 532.8 547.1 552.6 (n = 10 until W + 12, then n = 5) SEM 14.8 15.0 15.6 17.9 26.7 24.9 27.2 27.4 27.2 MEAN WEIGHTS (g) W + 19 W + 20 W + 21 W + 22 W + 23 W + 24 W + 25 WT + Buffer 572.0 577.2 581.9 586.9 597.3 513.8 593.4 (n = 12 until W + 13, then n = 7) SEM 18.8 21.6 27.9 24.1 23.1 19.5 26.6 DMD + Buffer 463.5 464.9 463.0 465.8 467.1 467.4 444.8 (n = 10 until W + 13, then n = 4) SEM 42.7 43.6 46.5 46.6 46.2 46.6 34.9 DMD + 1E13 vg/kg 491.7 490.1 496.3 491.6 501.3 513.3 467.2 (n = 11 until W + 13, then n = 6) SEM 21.2 23.7 24.2 27.0 27.7 35.8 36.4 DMD + 3E13 vg/kg 510.7 512.6 517.4 519.7 526.6 525.7 507.0 (n = 11 until W + 13, then n = 5) SEM 39.4 38.9 38.3 37.7 38.5 35.6 30.4 DMD + 1E14 vg/kg 532.7 530.6 541.9 545.9 554.9 539.7 551.3 (n = 13 until W + 13, then n = 6) SEM 15.4 13.8 14.8 15.4 14.5 9.2 15.1 DMD + 1E14 vg/kg w/o HSA (n = 5 N/A N/A N/A N/A N/A N/A N/A until W + 13) SEM N/A N/A N/A N/A N/A N/A N/A DMD + 3E14 vg/kg 558.0 558.1 565.9 566.4 577.0 577.6 566.9 (n = 10 until W + 12, then n = 5) SEM 27.4 27.3 27.3 28.8 29.7 29.2 28.5
Quantification of Vector Transduction and RNA and Protein Expression in Dmd.sup.mdx Rats Treated with AAV9.hCK.Hopti-Dys3978.spA Vector
[0402] Materials and Methods
[0403] Standard molecular biology techniques were used to quantitate the transgene copy number by quantitative PCR (qPCR), relative expression levels of the mini-dystrophin mRNA transcripts by reverse transcriptase qPCR (RT-qPCR), and the amount of mini-dystrophin protein expression qualitatively by Western blot analysis.
[0404] For qPCR, genomic DNA (gDNA) was purified from tissues using the Gentra Puregene kit from Qiagen. Samples were then analyzed using a StepOne Plus™ Real Time PCR System(Applied Biosystems®, Thermo Fisher Scientific) using 50 ng gDNA in duplicate. All reactions were performed in duplex in a final volume of 20 μL containing template DNA, Premix Ex taq (Ozyme), 0.3 μL of ROX reference Dye (Ozyme), 0.2 μmol/L of each primer and 0.1 μmol/L of Taqman® probe.
[0405] Vector copy numbers were determined using primers and probe designed to amplify a region of the mini-dystrophin transgene:
TABLE-US-00005 Forward: SEQ ID NO: 19 5′-CCAACAAAGTGCCCTACTACATC-3′ Reverse: SEQ ID NO: 20 5′-GGTTGTGCTGGTCCAGGGCGT-3′ Probe: SEQ ID NO: 21 5′-FAM-CCGAGCTGTATCAGAGCCTGGCC-TAMRA-3′
[0406] Endogenous gDNA copy numbers were determined using primers and probe designed to amplify the rat HPRT1 gene:
TABLE-US-00006 Forward: SEQ ID NO: 22 5′-GCGAAAGTGGAAAAGCCAAGT-3′ Reverse: SEQ ID NO: 23 5′-GCCACATCAACAGGACTCTTGTAG-3′ Probe: SEQ ID NO: 24 5′-JOE-CAAAGCCTAAAAGACAGCGGCAAGTTGAAT-TAMRA-3′
[0407] For each sample, threshold cycle (Ct) values were compared with those obtained with different dilutions of linearized standard plasmids (containing either the mini-dystrophin expression cassette or the rat HPRT1 gene). The absence of qPCR inhibition in the presence of gDNA was checked by analyzing 50 ng of gDNA extracted from tissues samples from a control animal, spiked with different dilutions of standard plasmid. Duplex qPCR (amplification of the 2 sequences in the same reaction) was used and results were expressed in vector genome per diploid genome (vg/dg). The sensitivity of the test was 0.003 vg/dg.
[0408] For RT-qPCR, total RNA was extracted from tissue samples with TRIzol® reagent (Thermo Fisher Scientific), and then treated with RNAse-free DNAse I from the TURBO DNA-free kit (Thermo Fischer Scientific). Total RNA (500 ng) was reverse transcribed using random primers (Thermo Fischer Scientific) and M-MLV reverse transcriptase (Thermo Fischer Scientific) in a final volume of 25 μL. Duplex qPCR analysis was then performed 1/15-diluted cDNA using the same mini-dystrophin and rat HPRT1 specific primers and probes as for the quantification of transgene copy numbers by qPCR. The absence of qPCR inhibition in the presence of cDNA was checked by analyzing cDNA obtained from tissues samples from a control animal spiked with different dilutions of standard plasmid. For each RNA sample, Ct values were compared with those obtained with different dilutions of standard plasmids (containing either the mini-dystrophin expression cassette or the rat HPRT1 gene). Results were expressed in relative quantities (RQ):
RQ=2.sup.−ΔCt=2.sup.−(Ct target−Ct endogenous control)
[0409] For each RNA sample, the absence of DNA contamination was also confirmed by analysis of “cDNA-like samples” obtained without addition of reverse transcriptase in the reaction mix.
[0410] For Western blot analysis of expressed protein levels, total proteins were extracted from tissue samples using RIPA buffer containing a protease inhibitor cocktail (Sigma-Aldrich). Protein extracts, 50 μg for biceps femoris, heart and diaphragm, or 100 μg for liver, were loaded on a NuPAGE® Novex 3-8% Tris Acetate gel and analyzed using the NuPAGE® large protein blotting kit (Thermo Fischer Scientific). A final concentration of 200 mM DTT was used to reduce proteins before loading. Membranes were then blocked in 5% skim milk, 1% NP40 (Sigma-Aldrich) in TBST (tris-buffered saline, 0.1% Tween 20) and hybridized with an anti-dystrophin antibody specific for exons 10 and 11 of the dystrophin protein (1:100, MANEX 1011C monoclonal antibody) and with a secondary anti-mouse IgG HRP-conjugated antibody (1:2000, Dako). For protein loading control, the same membrane was also hybridized with an anti-rat alpha-tubulin antibody (1:10000, Sigma) and with a secondary anti-mouse IgG HRP-conjugated antibody (1:2000, Dako). Immunoblots were visualized by ECL Chemiluminescent analysis system (Thermo Fisher Scientific).
[0411] Human Mini-Dystrophin Transgene Copy Numbers at 3 and 6 Months Post-Injection
[0412] Results of testing for transgene copy numbers (as vector genomes per diploid genome (vg/dg)) in whole blood, spleen, heart, biceps femoris, pectoralis, diaphragm, and liver in Dmd.sup.mdx rats treated with vector and vehicle, and in WT rats administered vehicle only are described in the tables below. Data at 3 months post-injection is provided in Table 4, and at 6 months post-injection is provided in Table 5. Data are the mean of results from individual test animals.
TABLE-US-00007 TABLE 4 3 Months Post-Injection DMD + DMD + DMD + DMD + DMD + WT + 1 × 10.sup.13 3 × 10.sup.13 1 × 10.sup.14 3 × 10.sup.14 vehicle vehicle vg/kg vg/kg vg/kg vg/kg Whole blood <0.002 <0.002 <0.002 <0.002 <0.002 <0.002 Spleen <0.002 <0.002 <0.002 0.010 0.005 0.013 Heart (basal part) <0.002 <0.002 0.090 0.270 0.670 4.350 Biceps femoris <0.002 <0.002 <0.002 0.070 0.260 1.700 Pectoralis <0.002 <0.002 0.010 0.030 0.400 0.760 Diaphragm <0.002 <0.002 0.003 0.030 2.410 2.810 Liver (central lobe) <0.002 <0.002 0.830 5.460 30.780 112.880
TABLE-US-00008 TABLE 5 6 Months Post-Injection DMD + DMD + DMD + DMD + DMD + WT + 1 × 10.sup.13 3 × 10.sup.13 1 × 10.sup.14 3 × 10.sup.14 vehicle vehicle vg/kg vg/kg vg/kg vg/kg Whole blood <0.002 <0.002 <0.002 <0.002 <0.002 <0.002 Spleen <0.002 <0.002 <0.002 <0.002 <0.002 0.010 Heart (basal part) <0.002 <0.002 0.160 0.140 1.460 5.380 Biceps femoris <0.002 <0.002 0.009 0.020 0.390 1.400 Pectoralis <0.002 <0.002 0.006 0.020 0.530 0.800 Diaphragm <0.002 <0.002 0.00 0.010 4.850 1.270 Liver (central lobe) <0.002 <0.002 1.080 8.130 30.490 82.230
[0413] No qPCR signal was detected in the Dmd.sup.mdx or WT rats injected with vehicle only, confirming that these animals had not received any vector, and no qPCR signal was detected in whole blood at 3 and 6 months post-injection.
[0414] Mini-dystrophin DNA was detected in Dmd.sup.mdx rats that had been injected with vector at both 3 and 6 months post-injection. Transgene copy numbers in the tissues under study followed a pattern of prevalence of liver>heart>biceps femoris≈diaphragm≈pectoralis>spleen. Of the tissues analyzed, liver was by far the most efficiently transduced, with vector copy numbers reaching up to an average of 80-110 vg/dg in rats administered with 3×10.sup.14 vg/kg vector. Vector copy numbers in liver were 7-45 fold higher than in heart and 40-300 fold higher than in biceps femoris, diaphragm, or pectoralis muscles. In heart, vector copy numbers averaged about 1.0 vg/dg in rats dosed with 1×10.sup.14 vg/kg vector and about 5.0 vg/dg in rats dosed with 3×10.sup.14 vg/kg vector. At a dose of 1×10.sup.14 vg/kg, transgene copy numbers in biceps femoris and pectoralis were similar and never exceeded about 0.5 vg/dg. When the vector dose increased to 3×10.sup.14 vg/kg, the average transgene copy number increased to about 1.2 vg/dg. The data was particularly variable for diaphragm due to certain unusually high results among 4 animals that had received the two highest dose levels of vector, in which the transgene copy numbers ranged from about 9-15 vg/dg. If these outlying data points are excluded, then the transduction efficiency of diaphragm is relatively low at both the 3 and 6 month time points, with transgene copy numbers averaging about 0.2-0.4 vg/dg at the 1×10.sup.14 vg/kg dose and about 1.05-1.3 vg/dg at the 3×10.sup.14 vg/kg dose.
[0415] Human Mini-Dystrophin mRNA Expression at 3 and 6 Months Post-Injection
[0416] Two to four animals per treatment arm were randomly chosen for analysis by RT-qPCR to quantify levels of human mini-dystrophin mRNA transcripts in samples of biceps femoris, diaphragm, heart, spleen, and liver obtained at sacrifice. The results obtained from test animals sacrificed at 3 months and 6 months post-injection are provided in Table 6 and Table 7, respectively. Data is expressed in relative quantities (RQ) of mini-dystrophin mRNA relative to mRNA from the rat HPRT1 gene.
[0417] No transcripts were detected in any tissue from animals in the negative control arms (WT rats and Dmd.sup.mdx rats treated with vehicle), or in spleen of animals treated with vector, regardless of dose. In all other tissues examined, vector-derived transcripts were detected, the levels of which tended to increase in a dose-responsive manner, although with some variability in the data. Transcript levels in the tissues followed the pattern biceps femoris>heart≈diaphragm>liver. As discussed above, liver was the most transduced tissue among those sampled, with vector copy numbers varying about 60-130 fold higher than in biceps femoris muscle. Despite this, the level of mini-dystrophin mRNA in liver was about 5-15 fold lower than in biceps femoris, evidence of the highly muscle-specific activity of the promoter used in the vectors.
TABLE-US-00009 TABLE 6 3 Months Post-Injection Rat 5 Rat 6 Rat 7 Rat 8 Rat 1 Rat 2 Rat 3 Rat 4 RQ RQ RQ RQ RQ RQ RQ RQ DMD + DMD + DMD + DMD + DMD + DMD + WT + Wt + 1 × 10.sup.13 1 × 10.sup.13 3 × 10.sup.13 3 × 10.sup.13 vehicle vehicle vehicle vehicle vg/kg vg/kg vg/kg vg/kg Spleen <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 Biceps femoris <0.03 <0.03 <0.03 <0.03 2.6 0.9 7.8 7.2 Heart (basal part) <0.03 <0.03 <0.03 <0.03 1.7 1.8 3.3 1.4 Diaphragm <0.03 <0.03 <0.03 <0.03 0.2 0.3 1.6 2.7 Liver (central lobe) <0.03 <0.03 <0.03 <0.03 0.1 0.2 0.7 0.8 Rat 9 Rat 10 Rat 11 Rat 12 Rat 13 Rat 14 RQ RQ RQ RQ RQ RQ DMD + DMD + DMD + DMD + DMD + DMD + 1 × 10.sup.14 1 × 10.sup.14 1 × 10.sup.14 1 × 10.sup.14 3 × 10.sup.14 3 × 10.sup.14 vg/kg vg/kg vg/kg vg/kg vg/kg vg/kg Spleen <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 Biceps femoris 23.8 18.4 40.9 79.6 33.1 33.3 Heart (basal part) 4.5 4.5 3.2 6.5 9.6 12.4 Diaphragm 13.6 5.1 4.2 23.2 9.7 18.8 Liver (central lobe) 2.2 4.7 3.8 0.8 7.4 3.3
TABLE-US-00010 TABLE 7 6 Months Post-Injection Rat 19 Rat 20 Rat 21 Rat 22 Rat 23 Rat 24 Rat 25 Rat 26 Rat 15 Rat 16 Rat 17 Rat 18 RQ RQ RQ RQ RQ RQ RQ RQ RQ RQ RQ RQ DMD + DMD + DMD + DMD + DMD + DMD + DMD + DMD + DMD + DMD + WT + WT + 1 × 10.sup.13 1 × 10.sup.13 3 × 10.sup.13 3 × 10.sup.13 1 × 10.sup.14 1 × 10.sup.14 3 × 10.sup.14 3 × 10.sup.14 vehicle vehicle vehicle vehicle vg/kg vg/kg vg/kg vg/kg vg/kg vg/kg vg/kg vg/kg Spleen <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 <0.03 Biceps femoris <0.03 <0.03 <0.03 <0.03 0.6 0.3 3.0 8.9 15.8 24.2 64.0 19.7 Heart (basal <0.03 <0.03 <0.03 <0.03 1.2 1.6 1.3 1.4 3.7 4.3 9.2 6.1 part) Diaphragm <0.03 <0.03 <0.03 <0.03 0.5 0.1 1.4 1.1 4.5 8.0 19.7 17.1 Liver (central <0.03 <0.03 <0.03 <0.03 0.1 0.1 0.2 0.5 0.7 0.6 4.6 2.1 lobe)
[0418] Human Mini-Dystrophin Protein Expression at 3 and 6 Months Post-Injection
[0419] The same animals randomly selected for analysis to determine human mini-dystrophin mRNA levels were also analyzed to determine mini-dystrophin protein levels using Western blot. No mini-dystrophin protein was detected in any tissue from animals in the negative control arms (WT rats and Dmd.sup.mdx rats treated with vehicle). At both the 3 and 6 month time points, mini-dystrophin protein was detected in biceps femoris, heart and diaphragm of Dmd.sup.mdx rats dosed with vector. At the lowest dose tested (1×10.sup.13 vg/kg), mini-dystrophin protein was detected less frequently in the tissue samples compared to rats dosed with vector at higher levels. These results are summarized qualitatively in Table 8.
TABLE-US-00011 TABLE 8 Biceps Heart (basal Rat Time Dose femoris part) Diaphragm 5 3 mo 1 × 10.sup.13 vg/kg + + + 6 3 mo 1 × 10.sup.13 vg/kg − + − 7 3 mo 3 × 10.sup.13 vg/kg + + + 8 3 mo 3 × 10.sup.13 vg/kg + + + 9 3 mo 1 × 10.sup.14 vg/kg + + + 10 3 mo 1 × 10.sup.14 vg/kg + + + 11 3 mo 1 × 10.sup.14 vg/kg + + + 12 3 mo 1 × 10.sup.14 vg/kg + − + 13 3 mo 3 × 10.sup.14 vg/kg + + + 14 3 mo 3 × 10.sup.14 vg/kg + + + 19 6 mo 1 × 10.sup.13 vg/kg + + − 20 6 mo 1 × 10.sup.13 vg/kg − + − 21 6 mo 3 × 10.sup.13 vg/kg + + + 22 6 mo 3 × 10.sup.13 vg/kg + + − 23 6 mo 1 × 10.sup.14 vg/kg + + + 24 6 mo 1 × 10.sup.14 vg/kg + + + 25 6 mo 3 × 10.sup.14 vg/kg + + + 26 6 mo 3 × 10.sup.14 vg/kg + + +
[0420] There was a positive correlation between the amount of protein detected by Western blot and the vector dose, as well as the amount of mini-dystrophin mRNA in the same tissue samples. A mini-dystrophin mRNA RQ of approximately 1.5 was required to permit detection of the protein. Consistent with the low levels of mini-dystrophin transcript measured in liver, no mini-dystrophin protein was detected in this tissue, even at the highest vector dose used.
Histopathological Assessment
[0421] Immediately after sacrifice of WT and Dmd.sup.mdx rats, tissue samples were obtained for histopathological and immunocytochemical analysis.
[0422] Materials and Methods
[0423] Tissue samples vehicle treated WT rats, vehicle and vector treated Dmd.sup.mdx rats were obtained during whole necropsy evaluation at 3 and 6 months post-injection. Samples were also obtained from untreated Dmd.sup.mdx rats sacrificed at 7-9 weeks of age to serve as a baseline comparison. Tissues were immediately fixed in formalin for histopathology or snap frozen for immunohistochemistry (immunolabeling) and stored until processing. For histopathology, tissue samples were fixed in 10% neutral buffered formalin, embedded in paraffin wax, and sectioned (5 μm) before staining with hematoxylin eosin saffron (HES) stain. An additional section of paraffin embedded heart tissue was stained to visualize collagen with picrosirius red F3B (Sigma-Aldrich Chimie SARL, Lyon, FR). To identify dystrophin and connective tissue by immunolabeling, samples were frozen and sectioned (8 μm). A mouse monoclonal antibody, NCL-DYSB (1:50, Novocastra Laboratories, Newcastle on Tyne, UK), that specifically binds to rat dystrophin as well as human mini-dystrophin opti-Dys3978 was used in immunolabeling studies to visualize dystrophin protein. Alexa Fluor 555 wheat germ agglutinin (WGA) conjugate (1:500, Molecular Probes, Eugene, Oreg.) was used to visualize connective tissue. Nuclei were stained with DRAQ5 (1:1000, BioStatus Ltd, Shepshed, UK). Necropsies and histological examination were performed blinded.
[0424] Quantification of the picrosirius positive areas in heart sections was performed using Nikon Imaging Software (Nikon, Champigny sur Marne, France). Quantification of DYSB positive fibers and WGA positive areas was performed using ImageJ open source image processing software (v 2.0.0-rc-49/1.51a).
[0425] Results
[0426] Histopathological Analysis of DMD Lesions in Muscle at 3 and 6 Months Post-Injection
[0427] Tissue samples stained for histology were examined microscopically and lesions related to the DMD phenotype systematically recorded. Lesions in skeletal and cardiac muscle were scored semi-quantitatively as illustrated in
[0428] Total lesion scores of individual rats and averages grouped by treatment arm at 3 months post-injection are shown in
[0429] Statistical analysis of lesion scores (by multiple paired comparisons using Dunn's test) revealed the following differences among treatment arms. In samples of biceps femoris muscles at 3 months post-injection, there were no significant differences in lesion scores between WT rats treated with vehicle and Dmd.sup.mdx rats treated with vector at the two highest doses (1×10.sup.14 and 3×10.sup.14 vg/kg) and at 6 months post-injection, there were no significant differences between WT treated with vehicle and Dmd.sup.mdx rats treated with vector at any of the four doses tested. In samples of pectoralis muscle and diaphragm at 3 months post-injection there were no significant differences in lesion scores between vehicle treated WT rats and Dmd.sup.mdx rats treated with the three highest vector doses tested (3×10.sup.13, 1×10.sup.14 and 3×10.sup.14 vg/kg) and at 6 months post-injection, there were no significant differences in scores between WT rats treated with vehicle and Dmd.sup.mdx rats treated with all four vector doses. Finally, in heart muscle, at both time points, there were no significant differences in lesion scores between vehicle treated WT rats and Dmd.sup.mdx rats treated with all four doses of vector.
[0430] Histomorphometry at 3 and 6 Months Post-Injection
[0431] After labeling tissue samples with the DYSB antibody, which specifically binds to both rat dystrophin and the human mini-dystrophin expressed from the vector, the percentage of positively stained muscle fibers in three randomly selected microscopic fields from each rat was calculated for biceps femoris, diaphragm, and cardiac muscles. In addition, the area in three randomly selected microscopic fields staining positively with WGA conjugate was calculated to determine the extent of connective tissue fibrosis in frozen tissue samples from biceps femoris and diaphragm. In a related analysis, the amount of connective tissue (collagen) in transverse sections of heart was determined by quantifying the area staining positive with picrosirius red in histological preparations. Results from these studies are provided in
[0432]
[0433]
[0434]
[0435] Statistical analysis (ANOVA analysis and Fisher's post-hoc bilateral test) of the data demonstrated that at both 3 and 6 months post-injection, there was a significant difference in dystrophin labeling in biceps femoris and heart between Dmd.sup.mdx rats treated with vehicle and Dmd.sup.mdx rats treated at all vector doses. In diaphragm, differences at 3 months post-injection were significant at the two highest doses tested, whereas at 6 months post-injection, the differences were significant at the three highest doses tested. Comparison between WT rats treated with vehicle and Dmd.sup.mdx rats treated with 3×10.sup.14 vg/kg revealed no significant difference in biceps femoris muscle at 3 months post-injection or in cardiac muscle at 6 months post-injection.
[0436] In muscles from WT rats treated with vehicle, all muscle fibers displayed intense homogeneous subsarcolemmal labeling with the DYSB antibody. In muscles from Dmd.sup.mdx rats treated with vehicle, a small percentage of scattered revertant fibers displayed similar labeling (at 3 and 6 months post-injection, respectively: biceps femoris, 3.7±2.4% and 7.3±2.3%; diaphragm, 0.7±1.5% and 5.8±1.3%; cardiac muscle, 0.0±0.0% and 0.1±0.1%). In Dmd.sup.mdx rats administered vector, the percentage of fibers staining positive for dystrophin was increased in all observed muscles with fibers displaying weak to intense subsarcolemmal labeling. Labeling of two thirds of the fiber was required to be considered positive. At both 3 and 6 month time points, the percentage of dystrophin-positive fibers was similar between biceps femoris and cardiac muscle, which was higher than in diaphragm. In Dmd.sup.mdx rats treated with vector, the number and size of the fibrotic foci measured by the area occupied by connective tissue was reduced in skeletal muscle, and the intensity of fibrosis decreased in heart muscle.
[0437] In untreated Dmd.sup.mdx rats sacrificed at 7-9 weeks of age, no fibrosis was evident in biceps femoris or heart muscle, but there was already significant connective tissue expansion in diaphragm. Compared to WT rats, vehicle treated Dmd.sup.mdx rats displayed focal or generalized thickening of the endomysial and perimysial space in skeletal muscle, which is indicative of fibrosis. In the heart, these rats displayed scattered and extensive fibrotic foci in ventricular and septal subepicardial regions. In severe cases, transmural fibrosis was observed that altered the shape of the heart. Compared with Dmd.sup.mdx rats treated with vehicle, there was a significant reduction in the number and size of fibrotic foci at 3 months post-injection in the biceps femoris of Dmd.sup.mdx rats treated with 3×10.sup.13 vg/kg vector and higher doses, and at 6 months post-injection in the diaphragm of Dmd.sup.mdx rats treated with 3×10.sup.14 vg/kg vector. In heart, significant differences in fibrosis were found between Dmd.sup.mdx rats treated with vehicle and Dmd.sup.mdx rats treated at all vector doses at both time points. At 3 months post-injection, no significant difference in fibrosis was observed between WT rats treated with vehicle and Dmd.sup.mdx rats treated with vector at a dose of 3×10.sup.13 vg/kg and higher. The amount of fibrosis observed and vector dose were negatively correlated (p=0.019 for biceps femoris; p=0.004 for diaphragm; and p=0.003 for cardiac muscle, all by linear regression).
[0438] In Dmd.sup.mdx rats treatment with vector induced mini-dystrophin expression in all muscles analyzed (biceps femoris, diaphragm, and heart), and the percentage of fibers expressing mini-dystrophin was positively correlated with vector dose (p<0.001 by linear regression). The number of mini-dystrophin-positive fibers in vector treated Dmd.sup.mdx rats was higher in biceps femoris and heart than in diaphragm, suggesting some heterogeneity in biodistribution or expression efficacy. Mini-dystrophin expression was similar in terms of its subsarcolemmal localization, regardless dose, and no abnormal localization was detected even at the highest dose analyzed, 3×10.sup.14 vg/kg. In some fibers, discontinuous dystrophin staining was detected along the sarcolemma, although the frequency of this observation decreased with increasing vector dose.
[0439] Comparison of the number of mini-dystrophin positive muscle fibers between 3 and 6 months post-injection revealed no significant differences among treatment arms for biceps femoris. In diaphragm, there was a significant increase between 3 and 6 months post-injection at the 1×10.sup.14 vg/kg dose, whereas in heart muscle, there was a significant increase between the two time points at the doses 1×10.sup.13, 3×10.sup.13, and 1×10.sup.14 vg/kg.
[0440] The incidence and degree of certain classic DMD related muscle lesions varied among the treatment groups. For example, there were fewer necrotic or degenerative fibers vector treated Dmd.sup.mdx rats compared to those that received only vehicle, and newly regenerated fibers were observed in all Dmd.sup.mdx rats, but their number tended to decrease as vector dose was increased.
Grip Force and Muscle Fatigue Measurements
[0441] Forelimb grip force of Dmd.sup.mdx rats injected with vehicle or increasing doses of vector were tested 3 and 6 months post-injection. WT rats injected with vehicle were included as negative controls. Rats were injected when they were 7-9 weeks old so that grip force testing was conducted when they were about 4.5 and 7.5 months old. Maximum grip force and grip force after repeated trials as an indication of fatigue were both measured.
[0442] Materials and Methods
[0443] A grip meter (Bio-GT3, BIOSEB, France) attached to a force transducer was used to measure the peak force generated when rats were placed with their forepaws on the T-bar and gently pulled backward until they released their grip. Five tests were performed in sequence with a short latency (20-40 seconds) between each test, and the reduction in strength between the first and the last determination taken as an index of fatigue. Results are expressed in grams (g) and are normalized to the body weight (g/g BW). Grip test measurements were performed by an experimenter blind to genotype and treatment arm. Data are presented as the mean±SEM, and evaluated statistically using the non-parametric Kruskal-Wallis test to analyze differences between groups. Where significant overall effects were detected, differences between groups were assessed using Dunn's post-hoc test. Evolution of grip force was analyzed using the Friedman test, followed by Dunn's post-hoc test. All data analyses were performed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, Calif.). In figures, significant differences at confidence levels of 95%, 99%, and 99.9% are represented by one, two and three symbols, respectively.
[0444] Results
[0445] Results of grip force tests for rats sacrificed at 3 months post-injection are provided in Table 9 and Table 10. As shown in Table 9, vehicle treated Dmd.sup.mdx rats exhibited a reduction in absolute grip strength (i.e., not corrected for body mass differences) compared to vehicle treated WT rats (decrease of 24±2%). By contrast, Dmd.sup.mdx rats that were treated with vector exhibited a dose-dependent increase in absolute grip strength compared to vehicle treated Dmd.sup.mdx rat controls. At the two lowest doses, 1×10.sup.13 and 3×10.sup.13 vg/kg, grip force increased by 13±7% and 24±8%, respectively, but did not reach statistical significance, while at the two highest doses, 1×10.sup.14 and 3×10.sup.14 vg/kg, grip force increased by 40±9% and 55±6%, respectively, which did reach statistical significance (p<0.01 and p<0.001, respectively). Also as shown in Table 9, when forelimb grip force was corrected for differences in body mass, there was no statistically significant difference between grip force of WT and Dmd.sup.mdx rats when both were treated with vehicle. However, there was a dose responsive increase in relative grip force of vector treated Dmd.sup.mdx rats compared with Dmd.sup.mdx rats treated with vehicle, which reached statistical significance at the two highest doses tested, 1×10.sup.14 and 3×10.sup.14 vg/kg (27±8% increase, p<0.05, and 39±6% increase, p<0.001, respectively).
[0446] Forelimb grip force was also measured during five closely spaced repeated trials to determine the extent to which vector treatment might affect the muscle fatigue known to occur in the Dmd.sup.mdx rat model. As shown in
[0447] In contrast, a dose-dependent improvement was observed in vector treated Dmd.sup.mdx rats compared to similar rats treated only with vehicle. As indicated in Table 10, at the two lowest doses tested (1×10.sup.13 and 3×10.sup.13 vg/kg) there was delay before a decrease in grip strength manifested, suggesting a reduction in fatigue, at least early in the trials. However, at the lower doses, by the fifth trial, there was still not a statistically significant difference between grip strength of the vector treated Dmd.sup.mdx rats and Dmd.sup.mdx rats treated only with vehicle. Nevertheless, a strong trend toward waning reduction in grip strength was apparent even at these lower doses. At the two highest doses, 1×10.sup.14 and 3×10.sup.14 vg/kg, the Dmd.sup.mdx rats showed no statistically significant difference in the extent of fatigue compared to WT rats treated with vehicle. In other words, after five trials, these vector treated Dmd.sup.mdx rats were indistinguishable from wild type. In fact, in all trials, the mean grip force of Dmd.sup.mdx rats treated with the highest vector dose was higher than that of WT controls, although the difference was not statistically significant.
[0448] Results of grip force tests for rats sacrificed at 6 months post-injection are provided in Table 11 and Table 12. As shown in Table 11, vehicle treated Dmd.sup.mdx rats exhibited a reduction in grip strength (i.e., not corrected for body mass differences) compared to vehicle treated WT rats (decrease of 38±3% in absolute grip force). This difference was statistically significant when measured in absolute terms, but not when measured in relative terms. By contrast, Dmd.sup.mdx rats that were treated with vector exhibited a dose-dependent increase in absolute grip strength compared to vehicle treated Dmd.sup.mdx rat controls. At the two lowest doses, 1×10.sup.13 and 3×10.sup.13 vg/kg, grip force increased by 20±5% and 21±6%, respectively, but did not reach statistical significance, while at the two highest doses, 1×10.sup.14 and 3×10.sup.14 vg/kg, grip force increased by 39±9% and 41±5%, respectively, which did reach statistical significance (p<0.05 and p<0.01, respectively).
[0449] Similar to the Dmd.sup.mdx rats sacrificed 3 months after injection, vehicle treated Dmd.sup.mdx rats sacrificed at 6 months post-injection also exhibited a substantial decrease of forelimb strength between the first and fifth trials (reduction of 57±3%) (
[0450] In contrast, a dose-dependent improvement was observed in vector treated Dmd.sup.mdx rats compared to similar rats treated only with vehicle. As indicated in Table 12, while the two lowest doses (1×10.sup.13 and 3×10.sup.13 vg/kg) did not significantly impact the decline in grip strength over multiple trials, at the two highest doses (1×10.sup.14 and 3×10.sup.14 vg/kg), the Dmd.sup.mdx rats showed no statistically significant difference in the extent of fatigue compared to WT rats treated with vehicle. Further, at the highest dose, the grip force of vector treated Dmd.sup.mdx rats was statistically significantly higher than Dmd.sup.mdx rats treated with vehicle at every trial. In other words, after five trials, these vector treated Dmd.sup.mdx rats were indistinguishable from wild type. In fact, in all trials, the mean grip force of Dmd.sup.mdx rats treated with the highest vector dose was higher than that of WT controls, although the difference was not statistically significant.
[0451] Based on these studies, it is evident that at both 3 and 6 months post-injection, a vector dose of 1×10.sup.14 vg/kg was sufficient to reverse the reduction in grip force exhibited by Dmd.sup.mdx rats and the muscle fatigue caused by multiple closely spaced grip force tests. Furthermore, a vector dose of 3×10.sup.14 vg/kg actually improved grip force and fatigue resistance in the Dmd.sup.mdx rats to a level that exceeded WT rats of the same genetic background.
TABLE-US-00012 TABLE 9 Grip Force at 4.5 Months of Age (3 Months Post-Injection) Genotype WT DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx Treatment — — AAV9- AAV9- AAV9- AAV9- optidys3978 optidys3978 optidys3978 optidys3978 Dose (vg/kg) — — 1E+13 3E+13 1E+14 3E+14 Body weight (g) 510.0 ± 12.2 438.1 ± 22.0* 462.7 ± 16.2 469.1 ± 21.0 477.2 ± 11.3.sup. 482.9 ± 15.8 Maximum forelimb grip force g 1743.1 ± 77.2 1318.8 ± 41.8* 1493.6 ± 87.3 1640.1 ± 102.7 1848.5 ± 124.8.sup.¤¤ 2044.2 ± 83.1.sup.¤¤ g/g BW 3.43 ± 0.15 3.06 ± 0.14 3.15 ± 0.19 3.50 ± 0.19 −3.87 ± 0.24.sup. .sup. 4.24 ± 0.13* n 12 10 11 11 11 10 Animal body weight (g); maximum absolute forelimb grip force (g); and relative forelimb grip force (g/g of body weight) Values are mean ± SEM n: number of animals tested *p < 0.05 vs WT .sup.¤ p < 0.05, .sup.¤¤p < 0.01 vs Dma.sup.mdx treated with vehicle
TABLE-US-00013 TABLE 10 Grip Force Fatigue at 4.5 Months of Age (3 Months Post-Injection) Genotype WT DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx Treatment — — AAV9- AAV9- AAV9- AAV9- optidys3978 optidys3978 optidys3978 optidys3978 Dose (vg/kg) — — 1E+13 3E+13 1E+14 3E+14 Relative forelimb grip force g/g BW Trial 1 2.98 ± 0.23 2.97 ± 0.14 .sup. 3.14 ± 0.16 3.16 ± 0.18 3.35 ± 0.31 3.65 ± 0.13.sup.¤ Trial 2 2.92 ± 0.21 2.44 ± 0.31.sup.§ 2.86 ± 0.23 2.98 ± 0.25 3.35 ± 0.29 3.70 ± 0.13.sup.¤¤ Trial 3 2.89 ± 0.20 1.79 ± 0.26.sup.§§§ .sup. 2.52 ± 0.31.sup.§ .sup. 3.02 ± 0.28.sup.¤ .sup. 3.07 ± 0.28.sup.¤ 3.66 ± 0.26.sup.¤¤¤ Trial 4 3.09 ± 0.16 1.45 ± 0.24**.sup.§§§ .sup. 1.81 ± 0.27*.sup.§§§ .sup. 2.32 ± 0.23.sup.§§§ .sup. 3.14 ± 0.31.sup.¤¤ 3.84 ± 0.24.sup.¤¤¤ Trial 5 3.08 ± 0.20 1.10 ± 0.17***.sup.§§§ .sup. 1.66 ± 0.18**.sup.§§§ .sup. 12.12 ± 0.25.sup.§§§ .sup. 2.82 ± 0.26.sup.¤¤¤ 3.59 ± 0.22.sup.¤¤¤ Total decrease 6.13 ± 5.21 −63.53 ± 5.49***.sup. −46.65 ± 5.88*** −33.23 ± 7.04* .sup. −7.35 ± 11.83.sup.¤¤ −1.70 ± 4.95.sup.¤¤¤ Trial 5 vs Trial 1 (% Trial 1) n 11 10 11 11 11 10 Relative forelimb grip force (g/g of body weight) and decrease in grip force between 1st and 5th trials expressed as percent decrease from 1st trial Values are mean ± SEM n: number of animals tested *p < 0.05, **p < 0.01, ***p < 0.001 vs WT .sup.¤p < 0.05, .sup.¤¤p < 0.01, .sup.¤¤¤p < 0.001 vs Dmd.sup.mdx treated with vehicle .sup.§p < 0.05, .sup.§§§p < 0.001 vs 1st trial
TABLE-US-00014 TABLE 11 Grip Force at 7.5 Months of Age (6 Months Post-Injection) Genotype WT DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx Treatment — — AAV9- AAV9- AAV9- AAV9- optidys3978 optidys3978 optidys3978 optidys3978 Dose (vg/kg) — — 1E+13 3E+13 1E+14 3E+14 Body weight (g) 601.3 24.3 464.7 48.8 502.6 29.1 527.6 38.0 556.1 14.4 577.6 29.2 Maximum forelimb grip force g 2142.7 98.0 1324.0 73.6* 1760.0 150.7 1825.4 72.8 2223.8 122.9.sup.¤¤ 2350.0 134.1.sup.¤ g/g BW 3.59 0.21 2.90 0.17 3.48 0.16 3.50 0.16 .sup. 4.02 0.26.sup.¤ 4.07 0.15.sup.¤¤ n 7 4 6 6 6 5 Animal body weight (g); maximum absolute forelimb grip force (g); and relative forelimb grip force (g/g of body weight) Values are mean ± SEM n: number of animals tested *p < 0.05 vs WT .sup.¤¤p < 0.01; .sup.¤¤¤ p < 0.001 vs Dmd.sup.mdx treated with vehicle
TABLE-US-00015 TABLE 12 Grip Force Fatigue at 7.5 Months of Age (6 Months Post-Injection) Genotype WT DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx DMD.sup.mdx Treatment — — AAV9- AAV9- AAV9- AAV9- optidys3978 optidys3978 optidys3978 optidys3978 Dose (vg/kg) — — 1E+13 3E+13 1E+14 3E+14 Relative forelimb grip force g/g BW Trial 1 3.48 ± 0.23 2.86 ± 0.18 3.27 ± 0.23 3.44 ± 0.20 3.60 ± 0.32 .sup. 4.00 ± 0.14.sup.¤¤ Trial 2 3.22 ± 0.30 2.58 ± 0.27 3.07 ± 0.20 3.21 ± 0.12 3.31 ± 0.34 3.78 ± 0.12.sup.¤ Trial 3 3.45 ± 0.19 2.07 ± 0.26*.sup.§§ .sup. 2.46 ± 0.32.sup.§ .sup. 2.40 ± 0.35.sup.§§ .sup. 3.72 ± 0.33.sup.¤ 3.66 ± 0.14.sup.¤ Trial 4 3.01 ± 0.16 .sup. 1.52 ± 0.17*.sup.§§§ .sup. 2.19 ± 0.27.sup.§§ .sup. 1.83 ± 0.14.sup.§§§ 3.00 ± 0.38 .sup. 3.76 ± 0.20.sup.¤¤¤ Trial 5 3.01 ± 0.16 .sup. 1.24 ± 0.14*.sup.§§§ .sup. 1.87 ± 0.33.sup.§§§ .sup. 1.63 ± 6.16.sup.§§§ .sup. 2.91 ± 0.51.sup.¤ .sup. 3.54 ± 0.21.sup.§¤¤ Total decrease trial 5 −12.27 ± 5.56 −56.61 ± 3.52 −39.55 ± 13.94 −50.81 ± 8.11 −19.48 ± 11.88 −11.11 ± 5.69 .sup. vs Trial 1 (% Trial 1) n 7 4 6 5 6 5 Relative forelimb grip force (g/g of body weight) and decrease in grip force between 1st and 5th trials expressed as percent decrease from 1st trial Values are mean ± SEM n: number of animals tested *p < 0.05 vs WT .sup.¤p < 0.05, .sup.¤¤p < 0.01, .sup.¤¤¤p < 0.001 vs Dmd.sup.mdx treated with vehicle .sup.§p < 0.05, .sup.§§p < 0.01, .sup.§§§p < 0.001 vs 1st trial
Cardiac Function
[0452] Cardiac function of Dmd.sup.mdx rats and WT controls were tested 3 and 6 months post-injection (about 5 and 8 months of age, respectively) to determine if vector treatment could improve the structural or functional effects on heart of the muscular dystrophy disease process in the rat DMD model. Using two-dimensional echocardiography, free wall diastolic thickness, LV end-diastolic diameter, LV ejection fraction, and E/A ratio were measured 3 and 6 months post-injection.
[0453] Materials and Methods
[0454] Echocardiographic measurements were conducted by an experimenter blind as to genotype and treatment arm. Two-dimensional (2D) echocardiography was performed on test animals using a Vivid 7 Dimension ultrasound (GE Healthcare) with a 14-MHz transducer. To observe possible structural remodeling, left ventricular end-diastolic diameter and free wall end-diastolic thickness were measured during diastole from long and short-axis images obtained with M-mode echocardiography. Systolic function was assessed by the ejection fraction, and diastolic function was determined by taking trans-mitral flow measurements of ventricular filling velocity using pulsed Doppler in an apical four-chamber orientation to determine the E/A ratio, isovolumetric relaxation time, and the E wave deceleration time, indicators of diastolic dysfunction explained further below.
[0455] The E/A ratio is the ratio of the peak velocity of blood movement from the left atrium to the left ventricle during two stages of atrial emptying and ventricular filling. Blood is transferred from the left atrium to the left ventricle in two steps. In the first, the blood in the left atrium moves passively into the ventricle below when the mitral valve opens due to negative pressure created by the relaxing ventricle. The speed at which the blood moves during this initial action is called the “E,” for early, ventricular filling velocity. Later in time, the left atrium contracts to eject any remaining blood in the atrium, and the speed at which the blood moves at this stage is called the “A,” for atrium, ventricular filling velocity. The E/A ratio is the ratio of the early (E) to late (A) ventricular filling velocities. In healthy heart, the E/A ratio is greater than 1. In Duchenne myopathy, however, the left ventricular wall becomes stiff, reducing ventricular relaxation and pull on atrial blood, thereby slowing the early (E) filling velocity and lowering the E/A ratio. The isovolumetric relaxation time (IVRT) is the interval between the closure of the aortic valve to onset of ventricular filling by opening of the mitral valve, or the time until ventricular filling starts after relaxation begins. Longer than normal IVRT indicates poor ventricular relaxation, which has been described in both human DMD patients (R C Bahler et al., J Am Soc Echocardiogr 18(6), 666-73 (2005); L W Markham et al., J Am Soc Echocardiogr 19(7), 865-71 (2006)) and the DMD dog model (V Chetboul et al., Eur Heart J 25(21), 1934-39 (2004); V Chetboul et al., Am J Vet Res 65(10), 1335-41 (2004)), and precede the dilated cardiomyopathy associated with DMD. Lastly, the E wave deceleration time (DT) corresponds to the time in milliseconds between peak E velocity and its return to baseline, an increase in which is indicative of a diastolic dysfunction.
[0456] Results
[0457] At both 3 and 6 months post-injection, no significant differences in free wall diastolic thickness between WT rats and Dmd.sup.mdx rats, both treated with vehicle, indicating that this measurement was not informative regarding disease course in this model at the ages examined. At 6 months, but not 3 months, post-injection, however, there was a trend toward increasing left ventricular end-diastolic diameter in Dmd.sup.mdx rats treated with vehicle compared to WT controls, which was reversed when the Dmd.sup.mdx rats were treated with vector, although statistical significance was not reached (
[0458] To assess systolic function, left ventricular (LV) ejection fraction was measured. No difference was found in Dmd.sup.mdx rats 3 months post-injection, but at 6 months post-injection, Dmd.sup.mdx rats administered vehicle only exhibited reduced LV ejection fraction that was prevented by treatment with vector, although the difference was statistically significant only at one of the lower doses, 3×10.sup.13 vg/kg (
[0459] To assess diastolic dysfunction, Doppler echocardiography was used to measure early (E) and late diastolic (A) velocities, the E/A ratio, isovolumetric relaxation time (IVRT), and deceleration time (DT). At 3 months post-injection there was a statistically significant reduction in the E/A ratio for Dmd.sup.mdx rats treated with vehicle compared to WT controls, and a trend suggesting return to a normal E/A ratio in Dmd.sup.mdx rats treated with the highest vector dose, 3×10.sup.14 vg/kg, although the difference did not reach statistical significance (
[0460] At 3 months post-injection, IVRT was elevated in Dmd.sup.mdx rats treated with vehicle compared to WT controls, and there was a slight trend suggesting a dose responsive reduction in IVRT in Dmd.sup.mdx rats treated with vector, although none of the differences in the data reached statistical significance (
[0461] Finally, DT could only be measured in older rats due to technical difficulties with an anesthesia protocol. When examined at 6 months post-injection, however, DT was significantly elevated in Dmd.sup.mdx rats treated with vehicle compared to WT controls, and there was a strong trend toward restoration to normal values after vector treatment at all doses tested (
[0462] Despite variability in the data, the results of these studies strongly suggest the existence of diastolic dysfunction in the hearts of 5 and 8 month old Dmd.sup.mdx rats, which could be at least partially reversed by treatment with AAV9.hCK.Hopti-Dys3978.spA vector.
Blood Chemistry
[0463] Prior to treatment and at the time of sacrifice, blood samples from the rats were taken and stored for eventual analysis. Tests were carried out to determine serum concentrations of urea, creatinine, alkaline phosphatase (ALK), alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), creatine kinase (CK), troponin I, and antibodies against the mini-dystrophin protein and AAV9 capsid. ALT, AST, CK, and LDH are all enzymes released into the blood from damaged muscle cells, and are known to be elevated in human DMD patients.
[0464] At 3 months and 6 months post-injection, the levels of urea, creatinine, ALK, total serum proteins, total bilirubin and troponin I were not significantly different between the different experimental groups. By contrast, AST, ALT, LDH and total CK levels were all elevated in vehicle treated Dmd.sup.mdx rats compared to WT rats and responded with varying degrees to vector treatment.
[0465] At both 3 and 6 months post-injection, AST levels were elevated in Dmd.sup.mdx rats treated with vehicle compared to WT rats, although due to variability in the data, significance existed only at the 6 month time point. When Dmd.sup.mdx rats were treated with vector, a trend towards lower AST levels (albeit with wide inter-individual variability) was observed in the 1×10.sup.14 and 3×10.sup.14 vg/kg dose groups at 3 months post-injection and in the 3×10.sup.14 vg/kg dose group at 6 months post-injection. Again, due to variability in the data, these differences did not reach statistical significance. These results are shown in
[0466] The pattern of ALT, LDH, and total CK levels all responded to age and vector treatment in similar ways. At 3 months post-injection, ALT, LDH and total CK levels were all significantly elevated in Dmd.sup.mdx rats treated with vehicle compared to WT rats. Treating the Dmd.sup.mdx rats with the mini-dystrophin vector resulted in a trend suggesting a dose responsive reduction in ALT, LDH and total CK levels relative to vehicle treated Dmd.sup.mdx rats, which in some cases achieved statistical significance. These results are shown in
[0467] Total CK levels within treatment arms were also compared on the day of injection and 3 and 6 months after. As shown in
[0468] Differences in CK isoenzymes were also observed. Before dosing, the CK-MM isoform predominated in Dmd.sup.mdx rats (mean>90%), whereas the CK-MM and CK-BB isoforms were comparable in WT rats (mean 40-60%), and CK-MB levels were higher in WT than in Dmd.sup.mdx rats (4-6% versus≈1%). At 3 and 6 months post-injection, Dmd.sup.mdx rats treated with vector doses above 1×10.sup.13 vg/kg showed a slight increase in the proportion of the CK-BB isoform and a slight decrease in the proportion of the CK-MM isoform, with a trend towards a dose-related effect. No clear alteration in the proportion of the CK-MB isoform was observed in vector treated Dmd.sup.mdx rats.
Immunology
[0469] The humoral and cellular immune response in Dmd.sup.mdx rats treated with AAV9.hCK.Hopti-Dys3978.spA vector were measured before treatment and at 3 and 6 months post-injection and compared to negative and positive controls. Serum samples were obtained before injection of vehicle or vector, and at euthanasia 3 months post-injection. Splenocytes for analysis of T cell response were harvested at euthanasia at 3 and 6 months post-injection.
[0470] Humoral response to expression of the mini-dystrophin protein was assessed qualitatively by Western blot analysis of sera obtained from the test animals and diluted 1:500. Sera from all rats, whether WT or Dmd.sup.mdx, were negative for antibodies against mini-dystrophin protein when administered vehicle, or prior to receiving vector. By contrast most Dmd.sup.mdx rats treated with vector, even at the lowest dose of 1×10.sup.13 vg/kg, produced IgG antibodies that bound mini-dystrophin in Western blots. Between 80%-100% of Dmd.sup.mdx rats sacrificed at 3 months post-injection, and between 60%-100% of Dmd.sup.mdx rats sacrificed at 6 months post-injection produced IgG specific for the mini-dystrophin protein depending on dose.
[0471] Presence of antibodies to the AAV9 vector capsid was tested by ELISA. Serum from WT and Dmd.sup.mdx rats treated with vehicle had no detectable IgG that reacted with AAV9. By contrast, all rats treated with vector, regardless of dose or whether sacrificed 3 or 6 months post-injection, produced anti-AAV9 IgG with a titer higher than 1:10240, the highest dilution tested. Neutralizing antibodies against AAV9 were also tested with a cell transduction inhibition assay using a recombinant AAV9 vector that expresses LacZ reporter gene detected using a luminometer. The titer was defined as the lowest dilution that inhibited transduction>50%. Neutralizing antibodies against AAV9 were detected in the serum from all Dmd.sup.mdx rats that had received vector, regardless of dose or whether sacrificed 3 or 6 months post-injection, but not in the same animals prior to injection or WT and Dmd.sup.mdx rats that had received vehicle only. Titers ranged from 1:5000 to 1:500000 with no clear dose effect.
[0472] Presence of a cellular immune response to vector was evaluated using an IFNγ ELISpot assay on splenocytes isolated from vehicle treated WT and Dmd.sup.mdx rats, and Dmd.sup.mdx rats that had received vector. T cell response to the human mini-dystrophin protein expressed by the vector genome was tested using an overlapping peptide bank covering the whole sequence of opti-dys3978 protein (length of 15 amino acids, overlap of 10 amino acids, total of 263 peptides) and a rat specific IFNγ-ELISpot.sup.BASIC kit (Mabtech). Negative control consisted of unstimulated splenocytes and positive control consisted of cells stimulated with the mitogen concanavalin A. IFNγ secretion was quantified as the number of spot-forming cells (SFC) per 10.sup.6 cells, and a positive response was defined as >50 SFC/10.sup.6 cells or at least 3-fold the value obtained for the negative control. No specific T cell response against any peptide sequences derived from the mini-dystrophin protein was found in splenocytes obtained from any of the test animals, at either 3 months or 6 months post-injection, including from Dmd.sup.mdx rats treated at the highest vector dose of 3×10.sup.14 vg/kg.
[0473] T cell response against the AAV9 capsid was also tested using the IFNγ ELISpot assay screened against peptide sequences derived from AAV9 (15-mers overlapping by 10 amino acids divided into 3 pools). There was a positive IFNγ response in between 16%-60% of vector treated Dmd.sup.mdx rats sacrificed at 3 months post-injection, and between 16%-66% of vector treated Dmd.sup.mdx rats sacrificed at 6 months post-injection, that was positively correlated with vector dose. By contrast, all WT and Dmd.sup.mdx rats treated with vehicle were negative for T cell response against AAV9 capsid.
Example 9
Grip Strength in Older Dmd.SUP.mdx .Rats Treated with AAV9.hCK.Hopti-Dys3978.spA
[0474] The studies described in Example 8, above, were initiated in young rats 7-9 weeks of age. This example describes muscle function analysis of older Dmd.sup.mdx rats first treated with the AAV9.hCK.Hopti-Dys3978.spA vector when they were 4 months of age and 6 months of age, respectively. The average life span of Sprague Dawley rats is 24-36 months. The goal of these experiments was to determine if treatment with vector later in a Dmd.sup.mdx rat's life might be effective. Positive results would suggest that treating older human DMD patients, such as older children, adolescents, or even young adults, with vector might also improve their muscle function.
[0475] The experiments described in this example were conducted using similar materials and methods as those described in Example 8. More specifically, Dmd.sup.mdx rats at 4 and 6 months of age (n=6 for each age group) were separately treated with 1×10.sup.14 vg/kg of AAV9.hCK.Hopti-Dys3978.spA vector. As negative controls, WT rats and Dmd.sup.mdx rats (n=6 for each age group) 4 months and 6 months of age were separately treated with vehicle only. At 3 months post-injection, rats were tested for grip strength as described previously. As with the younger rats, maximum forelimb grip strength and grip strength over multiple repeated trials with short latency periods between each trial were tested. The latter test was intended to measure muscle fatigue.
[0476] As shown in ” indicates a statistically significant difference between vector versus vehicle treated Dmd.sup.mdx rats (p<0.01).
[0477] With respect to muscle fatigue, as shown in ” indicates a statistically significant difference between vector versus vehicle treated Dmd.sup.mdx rats (p<0.01); and “§ § ” and “§ § § ” indicate a statistically significant difference between vehicle treated Dmd.sup.mdx rats at the 4th and 5th grip tests, respectively, compared to the 1st grip test (at p<0.01 and p<0.001, respectively).
[0478] As shown in ” indicates a statistically significant difference between vector versus vehicle treated Dmd.sup.mdx rats (p<0.05).
[0479] With respect to muscle fatigue, as shown in ” indicates a statistically significant difference between vector versus vehicle treated Dmd.sup.mdx rats (p<0.05); and “§§ ” indicates a statistically significant difference between vehicle treated Dmd.sup.mdx rats at the 5th grip test compared to the 1st grip test (p<0.01).
Example 10
Clinical Trial of Human DMD Patients Treated with AAV9.hCK.Hopti-Dys3978.spA
[0480] A Phase 1b clinical trial of the AAV9.hCK.Hopti-Dys3978.spA vector in human DMD patients was designed and initiated. The design of the trial is illustrated in
[0481] Preliminary results from the first 9 patients, which range in age from 6-12 years (mean 8.2 years) and body weight from 18-42 kg (mean 27 kg), treated in the Phase 1 b trial (3 in Cohort 1 and 6 in Cohort 2) are now reported as of 2 months and 12 months after treatment.
[0482] Preliminary results from muscle biopsies of the biceps taken 2 months after dosing show detectable mini-dystrophin immunofluorescence signals in a mean 38% fibers from participants in Cohort 1 and a mean 69% fibers from participants in Cohort 2. Images of immunofluorescently labeled preparations from muscle biopsies of the three patients in Cohort 2 are shown in
[0483] Digital image analysis was applied to the images of immunofluorescently labeled biopsy samples to assess the range of mini-dystrophin expression in the samples.
[0484] An immunoaffinity liquid chromatography tandem mass spectrometry (LCMS) method was developed to measure dystrophin and mini-dystrophin concentrations in patient samples and normal controls. In the method, biopsied muscle tissue is digested with proteolytic enzymes. A peptide with a sequence uniquely present in both human dystrophin and mini-dystrophin is purified from the digested muscle tissue using antibodies specific for the peptide. The purified peptide is then quantified using liquid chromatography mass spectrometry. Because this is a new technique, it was validated by measuring relative levels of dystrophin in muscle biopsies (20 from each group) from untreated DMD patients (mean age 6 years), untreated Becker muscular dystrophy (BMD) patients (mean age 8 years) and non-dystrophic pediatric controls (mean age 10 years). The results are shown in
[0485]
[0486]
[0487] Creatine kinase (CK) is a muscle enzyme that is released into the blood when muscle is damaged. In DMD patients, blood CK concentrations can be used to monitor muscle membrane integrity and disease progression. The DMD patients treated with vector so far exhibited a mean reduction of blood CK concentration of 20% and 73% in Cohort 1 and Cohort 2, respectively, with a range of +22% CK (patient in Cohort 1) to −85% CK (a patient in Cohort 2).
[0488] The NorthStar Ambulatory Assessment (NSAA), a widely accepted and validated rating scale of muscle function in ambulant children with DMD, was used to assess muscle function in patients in the clinical trial. NSAA data of at least a year duration for two patients from Cohort 1 is shown in
[0489] Additional functional data for the first 6 patients is presented in
[0490] As disease progresses, dying muscle cells are replaced by fat and fibrotic tissue in the muscles of DMD patients. To further test of the effect of vector in the DMD patients in the clinical study, MRI analysis was used to measure the fat fraction over time. MR scans were acquired without compressing thigh tissue, whole thigh scans were segmented to identify muscle and fat, and the the mean Dixon fat fraction was computed over all voxels in the entire segmented muscle. Data among study subjects was compared to an external placebo control with the same age, weight and muscle function eligibility data for the gene therapy study and that was analyzed using the MRI method.
[0491] Preliminary safety results showed that the most common adverse events suspected to be related to AAV9.hCK.Hopti-Dys3978.spA vector are nausea, vomiting, decreased appetite, tiredness and/or fever, which occurred in 40% or more of study subjects. Nausea and vomiting symptoms were managed with oral antiemetics for 3 of the subjects, but one was hospitalized for 2 days for intravenous antiemetics and replacement fluids. In all cases, vomiting and fever symptoms resolved within 2 to 5 days and the other symptoms resolved within 1 to 3 weeks.
[0492] Immune responses occurred in subjects and varied in specificity and magnitude as measured by neutralizing antibody levels and T-cell responses on enzyme-linked immune absorbent spot (ELISPOT). One of the subjects, however, developed a rapid antibody response with activation of the complement system associated with acute kidney injury, hemolysis, and reduced platelet count. This subject was promptly admitted to a pediatric intensive care unit and received intermittent hemodialysis, as well as 2 intravenous doses of a complement inhibitor, eculizumab. He was discharged from the hospital after 11 days and his renal function returned to normal within 15 days. A second subject developed thrombocytopenia with signs of hemolysis and reversible nephropathy associated with complement activation. This subject was admitted and treated by transfusion with platelets and 1 IV dose of eculizumab. Discharged after one night, the subject's platelets normalized within 14 days. None of the other subjects had immune-related clinical events. Thus far, no evidence of liver damage has been observed, nor a clinically meaningful anti-dystrophin response in the treated subjects.
Example 11
Methods of Titering AAV9.hCK.Hopti-Dys3978.spA
[0493] The titer of AAV9.hCK.Hopti-Dys3978.spA in samples of drug substance (DS) or drug product (DP), expressed as number of vector genomes per milliliter (vg/mL), can be determined by quantitative PCR (qPCR), which can be carried out in at least two ways. One way, called ITR qPCR, uses PCR primers that specifically hybridize with sequences in the inverted terminal repeats (ITR) present at each end of the vector genome. A second way, called transgene qPCR (TG qPCR), uses PCR primers designed to specifically hybridize with target sequences present in the vector genome transgene encoding the mini-dys protein. Although the amount of vector genome in any particular DS or DP sample does not change, the different qPCR assay formats described here can result in different apparent titers, which should be taken into account when calculating the amount of DP needed to achieve a certain dose for subjects being treated with the vector.
Real Time Qpcr Using Itr Primers
[0494] For the ITR qPCR assay, samples of AAV9.hCK.Hopti-Dys3978.spA and assay standard are first treated with DNase I to digest vector DNA outside of the vector capsid, followed by treating samples and the assay standard with proteinase K to digest the vector capsids. The AAV assay standard is diluted to 1.0E13 vg/mL in DNase I working solution containing 30,000 U/mL DNase I. Next 5 μL of standard at 1.0E13 vg/mL or 5 μL of test sample is added to 95 μL of DNase I working solution in triplicate or quadruplicate, respectively. Standard and samples are heated to 37° C. for 60 minutes followed by a hold at 4° C. for at least 5 minutes and then 6 μL of 0.5 M EDTA is added to quench each reaction.
[0495] To digest the capsid, 120 μL of proteinase K working solution containing 1 mg/mL proteinase K is added to the standard and each sample and they are heated to 55° C. for 60 minutes, then 95° C. for 10 minutes, followed by a hold at 4° C. for at least 5 minutes. The digested standard and samples may be held at 2 to 8° C. for up to 24 hours.
[0496] The standard curve is prepared with two 10-fold serial dilutions followed by ten 2-fold serial dilutions in nuclease-free water. The 11 point standard curve has concentrations ranging from 2.16E6 to 2.21E9 vg/mL in the PCR reaction. Samples are prepared for qPCR using a series of 10-fold serial dilutions in nuclease-free water. Final sample dilution factors of 1/45,200, 1/452,000 and 1/4,520,000 are tested in the qPCR assay, but additional dilutions may be performed if needed.
[0497] The PCR reactions include 20 μL master mix (12.5 μL SYBR® Green master mix; 1.25 μL of forward and reverse primer mix (10 μM each primer); 6.25 μL nuclease-free water) and 5 μL standard, sample, or water for the non-template control (NTC). The qPCR instrument settings are Stage 1 (1 cycle): 95° C. for 10 minutes; Stage 2 (7 cycles): 95° C. for 10 seconds, 65° C. 10 for seconds, 72° C. for 10 seconds; Stage 3 (38 cycles): 95° C. for 10 seconds, 62° C. for 10 seconds, 72° C. for 31 seconds. Roche Light-Cycler 480 and Applied Biosystems 7500 Real Time PCR instruments are suitable for use in this method.
[0498] Data analysis is performed by plotting the Cp (crossing point, Roche) or Ct (cycle threshold, Applied Biosystems) values (y-axis) of the standard triplicate values versus the AAV concentrations (vg/mL, x-axis). Linear regression analysis is performed for the standard curve. The Roche Light-Cycler 480 system calculates the standard curve efficiency and standard curve error for the standard curve fit. The Applied Biosystems 7500 system calculates the R.sup.2 value for the standard curve fit. Sample and NTC concentrations are determined by interpolation of the sample Cp or Ct values from standard curve.
[0499] Dixon's Q-Test is used for outlier analysis. If the standard curve does not pass assay acceptance criteria, outlier analysis is performed as follows. For each standard dilution (n=3), the greatest suspect value is identified and Q is calculated using the equation Q=(Suspect Value−Nearest Value)/(Suspect Value−Farthest Value). The same calculation is performed for the lowest suspect value. If Q is determined to be ≥0.941 (95% confidence) for either calculation then the value is to be rejected as a statistical outlier and not used for further calculations. Only one value may be rejected for each of the standards so that a n=2 is applied for all further calculations.
[0500] Dixon's Q-Test is also used to identify sample outliers. Each complete data set of each sample dilution has 4 values (n=4). The same calculations described for the standard values are performed for the sample values. If Q is determined to be ≥0.829 (95% confidence) for either calculation then the value is to be rejected as a statistical outlier and not used for further calculations. Only one value may be rejected for each of the specified sample sets so that a n=3 is applied for all further calculations.
[0501] To calculate the vector genome titer in units of vg/mL for each sample, the quantity for each sample replicate is first calculated by multiplying the sample concentration by the dilution factor. Next the mean quantity is calculated for each set of samples that falls within the standard curve using the following equation (e.g., for 8 replicates). If at least one replicate is above the top standard in the standard curve and it is not an outlier by Dixon's Q-Test, then none of the replicates for that dilution are included in the calculation of the mean. Standard deviation and percent relative standard deviation (% RSD) are calculated for each set of sample dilutions that fall within the standard curve.
[0502] These assay criteria are for the purpose of judging that each assay has been performed correctly and that the systems (instruments, reagents, etc.) are performing properly as defined during method development. If the assay acceptance criteria are not met, this is evidence that the assay is not typical and the test is to be repeated.
[0503] Assay acceptance criteria when using the Roche Light-Cycler 480 system include the following: standard curve efficiency acceptable range is 1.85 to 2.05; standard curve error is no greater than 0.070; background level for the NTC wells are less than the lowest standard values; slope of the standard curve must be between −3.8 to −3.0. If assay acceptance criteria are not met, the standard and sample dilutions can be prepared from the digestion plate and retested within 24 hours of the completed digestion.
[0504] Assay acceptance criteria when using the Applied Biosystems 7500 system include the following: R.sup.2 of the standard curve must be 0.98; background level for the NTC wells are less than the lowest standard values; slope of the standard curve must be between −3.8 to −3.0; if assay acceptance criteria are not met, the standard and sample dilutions can be prepared from the digestion plate and retested within 24 hours of the completed digestion.
[0505] Sample acceptance criteria include the following: % RSD of each mean test sample measurement set that is equal to or greater than the quantitation limit must be ≤30. If the sample acceptance criterion is not met, the standard and sample dilutions can be prepared from the digestion plate and retested within 24 hours of the completed digestion.
[0506] Applying the ITR qPCR method described above, four drug product batches of AAV9.hCK.Hopti-Dys3978.spA are tested. Batch 1 is found to contain 3.67E13 vector genomes per milliliter (vg/mL), Batch 2 is found to contain 7.93E13 vg/mL, Batch 3 is found to contain 8.08E13 vg/mL, and Batch 4 is found to contain 9.71E13 vg/mL.
Real Time QPCR Using Transgene Primers and Probes
[0507] For the TG qPCR assay, samples of AAV9.hCK.Hopti-Dys3978.spA are first treated with DNase I enzyme to digest unpackaged AAV DNA and contaminating plasmid and genomic DNA. Samples are then treated with an EDTA, NaCl, and sarcosyl solution and heat to inactivate the DNase and denature the capsids to release the packaged vector genomes. A standard curve is prepared by serial dilution of a preparation containing a known concentration (copy number) of linearized plasmid containing the vector genome sequence. Three independent dilutions of each test sample along with an AAV control, a linearized plasmid positive control, a DNAse I control, a non-template control, a blank (assay diluent) and the standards are added to a 96-well reaction plate in triplicate. A qPCR master mix containing transgene-specific primers and a fluorescent labeled probe is added to all the sample wells. An amplicon corresponding to a portion of the mini-dystrophin transgene in the AAV9.hCK.Hopti-Dys3978.spA vector genome sequence is amplified and accumulated during each cycle of PCR, the amount being directly proportional to the fluorescence signal. Quantitation of amplicon is performed during the exponential phase of the reaction starting with the cycle when amplification of the target sequence is first detected over an established signal threshold.
[0508] The concentration of the single stranded target sequence from the test sample is interpolated from the linear regression of the double stranded plasmid standard curve preparation. Vector genome titer is calculated in copies/mL and finally, reported in viral genome per milliliter (vg/mL) of AAV9.hCK.Hopti-Dys3978.spA using the appropriate conversion factors.
[0509] Ten microliters of each AAV9.hCK.Hopti-Dys3978.spA test sample, AAV control and stock plasmid standard (DNase I digestion control) is mixed with 190 μL of DNase I working solution (2632 U/mL) and incubated at ambient temperature for 45-75 minutes. Next 12 μL of 0.5 M EDTA and 240 μL of 1.11 M NaCl, 1.11% sarkosyl are added and the solution is mixed and incubated at 95° C. for 9-11 minutes followed by cooling at 2-8° C. for at least 5 minutes. Test samples and the AAV control are further diluted 1/1,000, 1/10,000 and 1/100,000 in assay diluent (2 μg/mL salmon sperm DNA, 0.0009% poloxamer 188) for final sample dilution factors of 1/45,200, 1/452,000 and 1/4,520,000. The DNase I digestion control is further diluted 1/100 in assay diluent. The standard curve is prepared by diluting plasmid standard in assay diluent to the following concentrations: 1.75E10, 3.50E9, 7.00E8, 1.40E8, 2.80E7, 5.60E6, 1.12E6 copies double stranded DNA per mL.
[0510] The triplicate PCR reactions each include 15 μL master mix (12.5 μL Universal Master Mix; 0.5 μL of forward and reverse transgene-specific primer mix (10 μM forward primer and 10 μM reverse primer); 0.125 μL of 20 μM dual-labeled probe; 1.875 μL nuclease-free water) and 10 μL standard, test sample at three dilutions, AAV control at three dilutions, water for the non-template control, assay diluent, DNAse I digestion control, or plasmid control. The qPCR instrument settings are Stage 1 (1 cycle): 50° C. for 2 minutes; Stage 2 (1 cycle): 95° C. for 10 minutes; Stage 3 (40 cycles): 95° C. for 15 seconds, 60° C. for 60 seconds. An Applied Biosystems 7500 Real Time PCR instrument is used in this method.
[0511] Data analysis is performed by plotting the mean Ct (cycle threshold) values (y-axis) of each standard versus the log of the plasmid standard concentrations (copies/mL, x-axis). Linear regression analysis is performed for the standard curve and the R.sup.2 value and slope are calculated for the standard curve fit. The mean of the triplicate Ct values for the lowest standard, the non-template control, the assay diluent and the DNase I digestion control are calculated. Test sample, AAV control and control concentrations are determined by interpolation of their Ct values from the standard curve. The mean, standard deviation and relative standard deviation of the triplicate concentration values (copies/mL) for the plasmid control are calculated. The dilution-corrected vector genome titer values (vg/mL) are calculated for each sample and AAV control replicate within the assay range by multiplying the sample concentration (copies/mL) by the dilution factor and by a factor of two to account for the two vector genomes (single stranded DNA) for each plasmid genome (double stranded DNA).
[0512] For each assay plate, the vector genome titer for each sample and the AAV control is calculated from three replicates tested at three dilution factors for up to nine values. If at least one replicate of a single dilution factor is outside the standard curve range then the titer values for the sample at that dilution factor are not included in the calculation. The mean, standard deviation and relative standard deviation are calculated for the dilution-corrected titer values. The mean titer value is reported in units of viral genome per milliliter (vg/mL).
[0513] For drug substance and drug product release testing, the mean, standard deviation, and relative standard deviation are calculated for three independent assay instances to generate a reportable result. For stability testing, a vector genome titer result is obtained from a single assay instance.
[0514] These assay criteria are for evaluating that each assay has been performed correctly and that the systems (instruments, reagents, etc.) are performing properly as defined during method development. If the assay acceptance criteria are not met, this is evidence that the assay is not typical and the test is to be repeated. Assay acceptance criteria include the following: standard curve must have a coefficient of determination (R.sup.2)≥0.98; slope of the standard curve must be between −3.8 to −3.0; mean Ct values for the DNase I digestion control, blank (assay diluent) and non-template control (water) must be greater than the mean Ct value of the lowest standard or undetermined; % RSD of the mean AAV control and plasmid control results must be ≤30; mean titer of the plasmid control (in copies/mL) must be within the range specified for the specific lot; mean titer of the AAV control (in vg/mL) must be within the range specified for the specific lot. If assay acceptance criteria are not met, the test sample and AAV control sample dilutions can be retested within 24 hours of preparation, or digested samples may be rediluted within 5 days of preparation.
[0515] Sample acceptance criteria include the following: for each assay, the % RSD of each mean test sample set that is within the assay range must be ≤30. If the test sample acceptance criterion is not met, the test sample and AC sample dilutions can be retested within 24 hours or preparation, or digested samples may be re-diluted within 5 days of preparation.
[0516] For DS and DP release testing, the % RSD of each mean test result from three independent assay instances must be ≤25.
[0517] Applying the transgene qPCR method described above, the same four drug product batches of AAV9.hCK.Hopti-Dys3978.spA are tested as were tested using the ITR qPCR assay. Batch 1 is found to contain 2.18E13 vector genomes per milliliter (vg/mL), Batch 2 is found to contain 5.71E13 vg/mL, Batch 3 is found to contain 5.72E13 vg/m L, and Batch 4 is found to contain 5.91E13 vg/mL.
[0518] The transgene qPCR method is therefore seen to result in lower apparent titers compared to the ITR qPCR method, such that a titer measured using the ITR qPCR method can be converted to a titer measured using the transgene qPCR method by dividing the ITR qPCR titer by 1.5. This same conversion factor can be used to determine dose. Thus, for example, if a therapeutic dose of AAV9.hCK.Hopti-Dys3978.spA drug product is defined as about 1E14 vg/kg or about 3E14 vg/kg, where the titer is determined using an ITR qPCR assay, then the equivalent dose of the drug product would be about 0.67E14 vg/kg or about 2E14 vg/kg if the titer is determined using a transgene qPCR assay.
TABLE-US-00016 TABLE 13 TABLE OF SEQUENCES SEQ ID DESCRIPTION AND NO SEQUENCE SEQ ID DNA sequence of human codon-optimized gene encoding human mini- NO: 1 dystrophin 3978 (Hopti-Dys3978) atgctttggt gggaggaagt ggaggactgc tacgagagag aggacgtgca gaagaaaacc 60 ttcaccaagt gggtgaacgc ccagttcagc aagttcggca agcagcacat cgagaacctg 120 ttcagcgacc tgcaggatgg caggagactg ctggacctgc tggagggcct gaccggccag 180 aagctgccca aggagaaggg cagcaccaga gtgcacgccc tgaacaacgt gaacaaggcc 240 ctgagagtgc tgcagaacaa caacgtggac ctggtgaaca tcggcagcac cgacatcgtg 300 gacggcaacc acaagctgac cctgggcctg atctggaaca tcatcctgca ctggcaggtg 360 aagaacgtga tgaagaacat catggccggc ctgcagcaga ccaacagcga gaagatcctg 420 ctgagctggg tgaggcagag caccagaaac tacccccagg tgaacgtgat caacttcacc 480 acctcctgga gcgacggcct ggccctgaac gccctgatcc acagccacag acccgacctg 540 ttcgactgga acagcgtggt gtgtcagcag agcgccaccc agagactgga gcacgccttc 600 aacatcgcca gataccagct gggcatcgag aagctgctgg accccgagga cgtggacacc 660 acctaccccg acaagaaaag catcctcatg tacattacca gcctgttcca ggtgctgccc 720 cagcaggtgt ccatcgaggc catccaggaa gtggaaatgc tgcccaggcc ccccaaagtg 780 accaaggagg agcacttcca gctgcaccac cagatgcact acagccagca gatcacagtg 840 agcctggccc agggctatga gagaaccagc agccccaagc ccagattcaa gagctacgcc 900 tacacccagg ccgcctacgt gaccacctcc gaccccacca gaagcccctt ccccagccag 960 cacctggagg cccccgagga caagagcttc ggcagcagcc tgatggagag cgaagtgaac 1020 ctggacagat accagaccgc cctggaggaa gtgctgtcct ggctgctgag cgccgaggac 1080 accctgcagg cccagggcga gatcagcaac gacgtggaag tggtgaagga ccagttccac 1140 acccacgagg gctacatgat ggatctgacc gcccaccagg gcagagtggg caatatcctg 1200 cagctgggca gcaagctgat cggcaccggc aagctgagcg aggacgagga gaccgaagtg 1260 caggagcaga tgaacctgct gaacagcaga tgggagtgcc tgagagtggc cagcatggag 1320 aagcagagca acctgcacag agtgctgatg gacctgcaga accagaagct gaaggagctg 1380 aacgactggc tgaccaagac cgaggagcgg accagaaaga tggaggagga gcccctgggc 1440 cccgacctgg aggacctgaa gagacaggtg cagcagcaca aagtgctgca ggaggacctg 1500 gagcaggagc aggtgcgcgt gaacagcctg acccacatgg tggtggtcgt ggacgagagc 1560 agcggcgacc acgccacagc cgccctggaa gagcagctga aagtgctggg cgacagatgg 1620 gccaatattt gtaggtggac cgaggacaga tgggtgctgc tgcaggacca gcccgacctg 1680 gcccctggcc tgaccaccat cggcgccagc cccacccaga ccgtgaccct ggtgacccag 1740 cccgtggtga caaaggagac cgccatcagc aagctggaga tgcccagctc cctgatgctg 1800 gaagtgccca cccaccgcct gctccagcag ttccccctgg acctggagaa gttcctggcc 1860 tggctgaccg aggccgaaac caccgccaat gtgctccagg acgccactag aaaggagagg 1920 ctgctggagg acagcaaggg cgtgaaagag ctgatgaagc agtggcagga tctgcagggc 1980 gaaatcgagg cccacaccga cgtgtaccac aacctggacg agaacagcca gaagattctg 2040 aggagcctgg agggcagcga cgacgccgtc ctgctccaga ggaggctgga caacatgaac 2100 ttcaagtgga gcgagctgcg gaagaagagc ctgaacatcc ggagccacct ggaagccagc 2160 agcgaccagt ggaagagact gcacctgagc ctgcaggagc tgctggtgtg gctgcagctg 2220 aaggacgacg agctgagcag acaggccccc atcggcggcg acttccccgc cgtgcagaag 2280 cagaacgacg tgcaccgggc cttcaagagg gagctgaaaa ccaaggaacc cgtgatcatg 2340 agcaccctgg agacagtgcg gatcttcctg accgagcagc ccctggaggg actggagaag 2400 ctgtaccagg agcccagaga gctgcccccc gaggagagag cccagaacgt gaccaggctg 2460 ctgagaaagc aggccgagga agtgaatacc gagtgggaga agctgaatct gcacagcgcc 2520 gactggcaga gaaagatcga cgagaccctg gagagactcc aggaactgca ggaagccacc 2580 gacgagctgg acctgaagct gagacaggcc gaagtgatca agggcagctg gcagcctgtg 2640 ggcgatctgc tgatcgactc cctgcaggat cacctggaga aagtgaaggc cctgcggggc 2700 gagatcgccc ccctgaagga gaatgtgagc cacgtgaacg acctggccag acagctgacc 2760 accctgggca tccagctgag cccctacaac ctgagcacac tggaggatct gaacacccgg 2820 tggaaactgc tgcaggtggc cgtggaggat agagtgaggc agctgcacga agcccacaga 2880 gacttcggcc ctgcctccca gcacttcctg agcaccagcg tgcagggccc ctgggagaga 2940 gccatctccc ccaacaaagt gccctactac atcaaccacg agacccagac cacctgctgg 3000 gaccacccta agatgaccga gctgtatcag agcctggccg acctgaacaa tgtgcggttc 3060 agcgcctaca gaaccgccat gaagctgcgg agactgcaga aggccctgtg cctggatctg 3120 ctgagcctga gcgccgcctg cgacgccctg gaccagcaca acctgaagca gaatgaccag 3180 cccatggaca tcctgcagat catcaactgc ctgaccacaa tctacgaccg gctggaacag 3240 gagcacaaca acctggtgaa tgtgcccctg tgcgtggaca tgtgcctgaa ttggctgctg 3300 aacgtgtacg acaccggcag gaccggcaga atccgcgtgc tgagcttcaa gaccggcatc 3360 atcagcctgt gcaaggccca cctggaggat aagtaccgct acctgttcaa gcaggtggcc 3420 agcagcaccg gcttctgcga tcagaggaga ctgggcctgc tgctgcacga tagcatccag 3480 atccctaggc agctgggcga agtggccagc tttggcggca gcaacatcga gccctctgtg 3540 aggagctgct tccagttcgc caacaacaag cccgagatcg aggccgccct gttcctggac 3600 tggatgaggc tggagcctca gagcatggtg tggctgcctg tgctgcacag agtggccgcc 3660 gccgagaccg ccaagcacca ggccaagtgc aatatctgca aggagtgccc catcatcggc 3720 ttccggtaca ggagcctgaa gcacttcaac tacgacatct gccagagctg ctttttcagc 3780 ggcagagtgg ccaagggcca caaaatgcac taccccatgg tggagtactg cacccccacc 3840 acctccggcg aggatgtgag agacttcgcc aaagtgctga agaataagtt ccggaccaag 3900 cggtactttg ccaagcaccc caggatgggc tacctgcccg tgcagaccgt gctggaaggc 3960 gacaacatgg 3978 SEQ ID DNA sequence of human codon-optimized gene encoding human mini- NO: 2 dystrophin 3837 (Hopti-Dys3837) atgctttggt gggaggaagt ggaggactgc tacgagagag aggacgtgca gaagaaaacc 60 ttcaccaagt gggtgaacgc ccagttcagc aagttcggca agcagcacat cgagaacctg 120 ttcagcgacc tgcaggatgg caggagactg ctggacctgc tggagggcct gaccggccag 180 aagctgccca aggagaaggg cagcaccaga gtgcacgccc tgaacaacgt gaacaaggcc 240 ctgagagtgc tgcagaacaa caacgtggac ctggtgaaca tcggcagcac cgacatcgtg 300 gacggcaacc acaagctgac cctgggcctg atctggaaca tcatcctgca ctggcaggtg 360 aagaacgtga tgaagaacat catggccggc ctgcagcaga ccaacagcga gaagatcctg 420 ctgagctggg tgaggcagag caccagaaac tacccccagg tgaacgtgat caacttcacc 480 acctcctgga gcgacggcct ggccctgaac gccctgatcc acagccacag acccgacctg 540 ttcgactgga acagcgtggt gtgtcagcag agcgccaccc agagactgga gcacgccttc 600 aacatcgcca gataccagct gggcatcgag aagctgctgg accccgagga cgtggacacc 660 acctaccccg acaagaaaag catcctcatg tacattacca gcctgttcca ggtgctgccc 720 cagcaggtgt ccatcgaggc catccaggaa gtggaaatgc tgcccaggcc ccccaaagtg 780 accaaggagg agcacttcca gctgcaccac cagatgcact acagccagca gatcacagtg 840 agcctggccc agggctatga gagaaccagc agccccaagc ccagattcaa gagctacgcc 900 tacacccagg ccgcctacgt gaccacctcc gaccccacca gaagcccctt ccccagccag 960 cacctggagg cccccgagga caagagcttc ggcagcagcc tgatggagag cgaagtgaac 1020 ctggacagat accagaccgc cctggaggaa gtgctgtcct ggctgctgag cgccgaggac 1080 accctgcagg cccagggcga gatcagcaac gacgtggaag tggtgaagga ccagttccac 1140 acccacgagg gctacatgat ggatctgacc gcccaccagg gcagagtggg caatatcctg 1200 cagctgggca gcaagctgat cggcaccggc aagctgagcg aggacgagga gaccgaagtg 1260 caggagcaga tgaacctgct gaacagcaga tgggagtgcc tgagagtggc cagcatggag 1320 aagcagagca acctgcacag agtgctgatg gacctgcaga accagaagct gaaggagctg 1380 aacgactggc tgaccaagac cgaggagcgg accagaaaga tggaggagga gcccctgggc 1440 cccgacctgg aggacctgaa gagacaggtg cagcagcaca aagtgctgca ggaggacctg 1500 gagcaggagc aggtgcgcgt gaacagcctg acccacatgg tggtggtcgt ggacgagagc 1560 agcggcgacc acgccacagc cgccctggaa gagcagctga aagtgctggg cgacagatgg 1620 gccaatattt gtaggtggac cgaggacaga tgggtgctgc tgcaggacac ccaccgcctg 1680 ctccagcagt tccccctgga cctggagaag ttcctggcct ggctgaccga ggccgaaacc 1740 accgccaatg tgctccagga cgccactaga aaggagaggc tgctggagga cagcaagggc 1800 gtgaaagagc tgatgaagca gtggcaggat ctgcagggcg aaatcgaggc ccacaccgac 1860 gtgtaccaca acctggacga gaacagccag aagattctga ggagcctgga gggcagcgac 1920 gacgccgtcc tgctccagag gaggctggac aacatgaact tcaagtggag cgagctgcgg 1980 aagaagagcc tgaacatccg gagccacctg gaagccagca gcgaccagtg gaagagactg 2040 cacctgagcc tgcaggagct gctggtgtgg ctgcagctga aggacgacga gctgagcaga 2100 caggccccca tcggcggcga cttccccgcc gtgcagaagc agaacgacgt gcaccgggcc 2160 ttcaagaggg agctgaaaac caaggaaccc gtgatcatga gcaccctgga gacagtgcgg 2220 atcttcctga ccgagcagcc cctggaggga ctggagaagc tgtaccagga gcccagagag 2280 ctgccccccg aggagagagc ccagaacgtg accaggctgc tgagaaagca ggccgaggaa 2340 gtgaataccg agtgggagaa gctgaatctg cacagcgccg actggcagag aaagatcgac 2400 gagaccctgg agagactcca ggaactgcag gaagccaccg acgagctgga cctgaagctg 2460 agacaggccg aagtgatcaa gggcagctgg cagcctgtgg gcgatctgct gatcgactcc 2520 ctgcaggatc acctggagaa agtgaaggcc ctgcggggcg agatcgcccc cctgaaggag 2580 aatgtgagcc acgtgaacga cctggccaga cagctgacca ccctgggcat ccagctgagc 2640 ccctacaacc tgagcacact ggaggatctg aacacccggt ggaaactgct gcaggtggcc 2700 gtggaggata gagtgaggca gctgcacgaa gcccacagag acttcggccc tgcctcccag 2760 cacttcctga gcaccagcgt gcagggcccc tgggagagag ccatctcccc caacaaagtg 2820 ccctactaca tcaaccacga gacccagacc acctgctggg accaccctaa gatgaccgag 2880 ctgtatcaga gcctggccga cctgaacaat gtgcggttca gcgcctacag aaccgccatg 2940 aagctgcgga gactgcagaa ggccctgtgc ctggatctgc tgagcctgag cgccgcctgc 3000 gacgccctgg accagcacaa cctgaagcag aatgaccagc ccatggacat cctgcagatc 3060 atcaactgcc tgaccacaat ctacgaccgg ctggaacagg agcacaacaa cctggtgaat 3120 gtgcccctgt gcgtggacat gtgcctgaat tggctgctga acgtgtacga caccggcagg 3180 accggcagaa tccgcgtgct gagcttcaag accggcatca tcagcctgtg caaggcccac 3240 Gtggaggata agtaccgcta cctgttcaag caggtggcca gcagcaccgg cttctgcgat 3300 cagaggagac tgggcctgct gctgcacgat agcatccaga tccctaggca gctgggcgaa 3360 gtggccagct ttggcggcag caacatcgag ccctctgtga ggagctgctt ccagttcgcc 3420 aacaacaagc ccgagatcga ggccgccctg ttcctggact ggatgaggct ggagcctcag 3480 agcatggtgt ggctgcctgt gctgcacaga gtggccgccg ccgagaccgc caagcaccag 3540 gccaagtgca atatctgcaa ggagtgcccc atcatcggct tccggtacag gagcctgaag 3600 cacttcaact acgacatctg ccagagctgc tttttcagcg gcagagtggc caagggccac 3660 aaaatgcact accccatggt ggagtactgc acccccacca cctccggcga ggatgtgaga 3720 gacttcgcca aagtgctgaa gaataagttc cggaccaagc ggtactttgc caagcacccc 3780 aggatgggct acctgcccgt gcagaccgtg ctggaaggcg acaacatgga gacctga 3837 SEQ ID DNA sequence of canine codon-optimized gene encoding human mini- NO: 3 dystrophin 3978 (Copti-Dys3978) atgctttggt gggaggaagt ggaggactgc tacgagcggg aggacgtgca gaagaaaacc 60 ttcaccaagt gggtgaacgc ccagttcagc aagttcggca agcagcacat cgagaacctg 120 ttcagcgacc tgcaggacgg caggcggctg ctggacctcc tggaaggcct gaccggccag 180 aagctgccca aagagaaggg cagcaccagg gtgcacgccc tgaacaacgt gaacaaggcc 240 ctgagggtgc tgcagaacaa caacgtggac ctggtgaaca tcggcagcac cgacatcgtg 300 gacggcaacc acaagctgac cctgggcctg atctggaaca tcatcctgca ctggcaggtc 360 aagaacgtga tgaagaacat catggccggc ctgcagcaga ccaacagcga gaagatcctg 420 ctgtcctggg tgcggcagag caccaggaac tacccccagg tcaacgtgat caacttcacc 480 acctcttgga gcgacggcct ggccctgaac gccctgatcc acagccacag gcccgacctg 540 ttcgactgga acagcgtggt gtgccagcag agcgccaccc agaggetgga acacgccttc 600 aacatcgcca gataccagct gggcatcgag aagctgctgg atcccgagga cgtggacacc 660 acctaccccg acaagaaaag catcctcatg tacatcacca gcctgttcca ggtgctgccc 720 cagcaggtgt ccatcgaggc catccaggaa gtggagatgc tgcccaggcc ccccaaggtc 780 accaaagagg aacacttcca gctgcaccac cagatgcact acagccagca gatcaccgtg 840 agcctggccc agggctacga gaggaccagc agccccaagc ccaggttcaa gagctacgcc 900 tacacccagg ccgcctacgt gaccacctcc gaccccacca ggtccccctt ccccagccag 960 catctcgaag cccccgagga caagagcttc ggcagcagcc tgatggaaag cgaggtgaac 1020 ctggacagat accagaccgc cctggaagaa gtgctgtctt ggctgctgtc cgccgaggac 1080 accctgcagg cccagggcga gatcagcaac gacgtggagg tcgtgaagga ccagttccac 1140 acccacgagg gctacatgat ggacctgacc gcccaccagg gcagagtggg caacatcctg 1200 cagctgggca gcaagctgat cggcaccggc aagctgtccg aggacgagga aaccgaggtg 1260 caggaacaga tgaacctgct gaacagcaga tgggagtgcc tgagggtggc cagcatggaa 1320 aagcagagca acctgcacag ggtgctgatg gatctgcaga accagaagct caaagagctg 1380 aacgactggc tgaccaagac cgaggaaagg acccggaaga tggaagagga acccctgggc 1440 cccgatctcg aagatctgaa gaggcaggtg cagcagcaca aggtgctgca ggaagatctc 1500 gaacaggaac aggtccgggt caacagcctg acccacatgg tcgtggtggt ggacgagagc 1560 agcggcgacc acgccaccgc tgccctggaa gagcagctga aggtgctggg cgacagatgg 1620 gccaacatct gccggtggac cgaggacaga tgggtcctcc tgcaggacca gcccgacctg 1680 gcccctggcc tgacaaccat cggcgccagc cccacccaga ccgtgaccct ggtgacccag 1740 cccgtggtga ccaaagagac cgccatcagc aagctggaaa tgcccagctc cctgatgctg 1800 gaagtgccca cccacaggct cctccagcag ttccccctgg acctggaaaa gttcctggcc 1860 tggctgaccg aggccgagac caccgccaac gtgctgcagg acgccaccag gaaagagagg 1920 ctgctggaag atagcaaggg cgtgaaagag ctgatgaagc agtggcagga cctgcagggg 1980 gagattgagg cccacaccga cgtgtaccac aacctggacg agaacagcca gaaaatcctg 2040 agaagcctgg aaggcagcga cgacgccgtg ctgctgcaga ggcggctgga caacatgaac 2100 ttcaagtgga gcgagctgag gaagaagagc ctgaacatca ggtcccatct ggaagccagc 2160 agcgaccagt ggaagaggct gcacctgagc ctgcaggaac tgctcgtctg gctgcagctg 2220 aaagacgacg agctgtccag gcaggccccc atcggcggcg acttccccgc cgtgcagaaa 2280 cagaacgacg tgcacagggc cttcaagcgg gagctgaaaa ccaaagagcc cgtgatcatg 2340 agcaccctgg aaaccgtgag gatcttcctg accgagcagc ccctggaagg actggaaaag 2400 ctgtaccagg aacccagaga gctgcccccc gaggaacggg cccagaacgt gaccaggctg 2460 ctgagaaagc aggccgagga agtgaacacc gagtgggaga agctgaacct gcactccgcc 2520 gactggcaga ggaagatcga cgagaccctg gaaaggctcc aggaactgca ggaagccacc 2580 gacgagctgg acctgaagct gagacaggcc gaggtgatca agggcagctg gcagcccgtg 2640 ggcgacctgc tgatcgactc cctgcaggat cacctggaaa aagtgaaggc cctgcggggc 2700 gagatcgccc ccctgaaaga gaacgtcagc cacgtcaacg acctggccag gcagctgacc 2760 accctgggca tccagctgtc cccctacaac ctgtccaccc tggaagatct gaacacaagg 2820 tggaagctgc tgcaggtggc cgtggaggac agagtgaggc agctgcacga ggcccacagg 2880 gacttcggcc ctgcctccca gcacttcctg agcaccagcg tgcagggccc ctgggagagg 2940 gccatctccc ccaacaaggt gccctactac atcaaccacg agacccagac cacctgctgg 3000 gaccacccta agatgaccga gctgtaccag tccctggccg acctgaacaa tgtgcggttc 3060 agcgcctacc ggaccgccat gaagctgagg cggctgcaga aagccctgtg cctggatctg 3120 ctgtccctga gcgccgcctg cgacgccctg gaccagcaca acctgaagca gaacgaccag 3180 cccatggata tcctgcagat catcaactgt ctgaccacca tctacgacag gctggaacag 3240 gaacacaaca acctggtcaa cgtgcccctg tgcgtggaca tgtgcctgaa ctggctgctg 3300 aacgtgtacg acaccggcag gaccggccgg atcagggtgc tgtccttcaa gaccggcatc 3360 atcagcctgt gcaaggccca cctggaagat aagtaccgct acctgttcaa gcaggtggcc 3420 agctctaccg gcttctgcga ccagcggagg ctgggcctgc tgctgcacga cagcatccag 3480 atcccccggc agctgggcga ggtggcctcc ttcggcggca gcaacatcga gcccagcgtg 3540 cggagctgct tccagttcgc caacaacaag cccgagatcg aggccgccct gttcctggac 3600 tggatgcggc tggaacccca gagcatggtc tggctgcccg tgctgcacag agtggctgcc 3660 gccgagaccg ccaagcacca ggccaagtgc aacatctgca aagagtgccc catcatcggc 3720 ttcaggtaca gaagcctgaa gcacttcaac tacgacatct gccagagctg tttcttcagc 3780 ggcagggtgg ccaagggcca caaaatgcac taccccatgg tggagtactg cacccccacc 3840 acctccggcg aggacgtgag ggacttcgcc aaggtgctga agaataagtt ccggaccaag 3900 cggtacttcg ccaaacaccc caggatgggc tacctgcccg tgcagaccgt gctggaaggc 3960 gacaacatgg aaacctga 3978 SEQ ID DNA sequence of synthetic hybrid muscle-specific promoter hCK NO: 4 gaattcggta ccccactacg ggtttaggct gcccatgtaa ggaggcaagg cctggggaca 60 cccgagatgc ctggttataa ttaacccaga catgtggctg CCCCCCCCCC ccccaacacc 120 tgctgcctct aaaaataacc ctgtccctgg tggatcccct gcatgcgaag atcttcgaac 180 aaggctgtgg gggactgagg gcaggctgta acaggcttgg gggccagggc ttatacgtgc 240 ctgggactcc caaagtatta ctgttccatg ttcccggcga agggccagct gtcccccgcc 300 agctagactc agcacttagt ttaggaacca gtgagcaagt cagcccttgg ggcagcccat 360 acaaggccat ggggctgggc aagctgcacg cctgggtccg gggtgggcac ggtgcccggg 420 caacgagctg aaagctcatc tgctctcagg ggcccctccc tggggacagc ccctcctggc 480 tagtcacacc ctgtaggctc ctctatataa cccaggggca caggggctgc cctcattcta 540 ccaccacctc cacagcacag acagacactc aggagccagc cagcgtcgag cggccgatcc 600 gccacc 606 SEQ ID DNA sequence of synthetic hybrid muscle-specific promoter hCKplus NO: 5 gaattcggta ccccactacg ggtctaggct gcccatgtaa ggaggcaagg cctggggaca 60 cccgagatgc ctggttataa ttaaccccaa cacctgctgc cccccccccc ccaacacctg 120 ctgcctctaa aaataaccct gtccctggtg gatcccctgc atgccccact acgggtttag 180 gctgcccatg taaggaggca aggcctgggg acacccgaga tgcctggtta taattaaccc 240 agacatgtgg ctgccccccc cccccccaac acctgctgcc tctaaaaata accctgtccc 300 tggtggatcc cctgcatgcg aagatcttcg aacaaggctg tgggggactg agggcaggct 360 gtaacaggct tgggggccag ggcttatacg tgcctgggac tcccaaagta ttactgttcc 420 atgttcccgg cgaagggcca gctgtccccc gccagctaga ctcagcactt agtttaggaa 480 ccagtgagca agtcagccct tggggcagcc catacaaggc catggggctg ggcaagctgc 540 acgcctgggt ccggggtggg cacggtgccc gggcaacgag ctgaaagctc atctgctctc 600 aggggcccct ccctggggac agcccctcct ggctagtcac accctgtagg ctcctctata 660 taacccaggg gcacaggggc tgccctcatt ctaccaccac ctccacagca cagacagaca 720 ctcaggagcc agccagcgtc gagcggccga tccgccacc 759 SEQ ID DNA sequence of small synthetic polyadenylation element NO: 6 tgaggagctc gagaggccta ataaagagct cagatgcatc gatcagagtg tgttggtttt 60 ttgtgtg 67 SEQ ID Amino acid sequence encoded by Hopti-Dys3978 gene (Dys3978 protein) NO: 7 MLWWEEVEDC YEREDVQKKT FTKWVNAQFS KFGKQHIENL FSDLQDGRRL LDLLEGLTGQ 60 KLPKEKGSTR VHALNNVNKA LRVLQNNNVD LVNIGSTDIV DGNHKLTLGL IWNIILHWQV 120 KNVMKNIMAG LQQTNSEKIL LSWVRQSTRN YPQVNVINFT TSWSDGLALN ALIHSHRPDL 180 FDWNSVVCQQ SATQRLEHAF NIARYQLGIE KLLDPEDVDT TYPDKKSILM YITSLFQVLP 240 QQVSIEAIQE VEMLPRPPKV TKEEHFQLHH QMHYSQQITV SLAQGYERTS SPKPRFKSYA 300 YTQAAYVTTS DPTRSPFPSQ HLEAPEDKSF GSSLMESEVN LDRYQTALEE VLSWLLSAED 360 TLQAQGEISN DVEVVKDQFH THEGYMMDLT AHQGRVGNIL QLGSKLIGTG KLSEDEETEV 420 QEQMNLLNSR WECLRVASME KQSNLHRVLM DLQNQKLKEL NDWLTKTEER TRKMEEEPLG 480 PDLEDLKRQV QQHKVLQEDL EQEQVRVNSL THMVVVVDES SGDHATAALE EQLKVLGDRW 540 ANICRWTEDR WVLLQDQPDL APGLTTIGAS PTQTVTLVTQ PVVTKETAIS KLEMPSSLML 600 EVPTHRLLQQ FPLDLEKFLA WLTEAETTAN VLQDATRKER LLEDSKGVKE LMKQWQDLQG 660 EIEAHTDVYH NLDENSQKIL RSLEGSDDAV LLQRRLDNMN FKWSELRKKS LNIRSHLEAS 720 SDQWKRLHLS LQELLVWLQL KDDELSRQAP IGGDFPAVQK QNDVHRAFKR ELKTKEPVIM 780 STLETVRIFL TEQPLEGLEK LYQEPRELPP EERAQNVTRL LRKQAEEVNT EWEKLNLHSA 840 DWQRKIDETL ERLQELQEAT DELDLKLRQA EVIKGSWQPV GDLLIDSLQD HLEKVKALRG 900 EIAPLKENVS HVNDLARQLT TLGIQLSPYN LSTLEDLNTR WKLLQVAVED RVRQLHEAHR 960 DFGPASQHFL STSVQGPWER AISPNKVPYY INHETQTTCW DHPKMTELYQ SLADLNNVRF 1020 SAYRTAMKLR RLQKALCLDL LSLSAACDAL DQHNLKQNDQ PMDILQIINC LTTIYDRLEQ 1080 EHNNLVNVPL CVDMCLNWLL NVYDTGRTGR IRVLSFKTGI ISLCKAHLED KYRYLFKQVA 1140 SSTGFCDQRR LGLLLHDSIQ IPRQLGEVAS FGGSNIEPSV RSCFQFANNK PEIEAALFLD 1200 WMRLEPQSMV WLPVLHRVAA AETAKHQAKC NICKECPIIG FRYRSLKHFN YDICQSCFFS 1260 GRVAKGHKMH YPMVEYCTPT TSGEDVRDFA KVLKNKFRTK RYFAKHPRMG YLPVQTVLEG 1320 DNMET 1325 SEQ ID Amino acid sequence encoded by Hopti-Dys3837 gene (Dys3837 protein) NO: 8 MLWWEEVEDC YEREDVQKKT FTKWVNAQFS KFGKQHIENL FSDLQDGRRL LDLLEGLTGQ 60 KLPKEKGSTR VHALNNVNKA LRVLQNNNVD LVNIGSTDIV DGNHKLTLGL IWNIILHWQV 120 KNVMKNIMAG LQQTNSEKIL LSWVRQSTRN YPQVNVINFT TSWSDGLALN ALIHSHRPDL 180 FDWNSVVCQQ SATQRLEHAF NIARYQLGIE KLLDPEDVDT TYPDKKSILM YITSLFQVLP 240 QQVSIEAIQE VEMLPRPPKV TKEEHFQLHH QMHYSQQITV SLAQGYERTS SPKPRFKSYA 300 YTQAAYVTTS DPTRSPFPSQ HLEAPEDKSF GSSLMESEVN LDRYQTALEE VLSWLLSAED 360 TLQAQGEISN DVEVVKDQFH THEGYMMDLT AHQGRVGNIL QLGSKLIGTG KLSEDEETEV 420 QEQMNLLNSR WECLRVASME KQSNLHRVLM DLQNQKLKEL NDWLTKTEER TRKMEEEPLG 480 PDLEDLKRQV QQHKVLQEDL EQEQVRVNSL THMVVVVDES SGDHATAALE EQLKVLGDRW 540 ANICRWTEDR WVLLQDTHRL LQQFPLDLEK FLAWLTEAET TANVLQDATR KERLLEDSKG 600 VKELMKQWQD LQGEIEAHTD VYHNLDENSQ KILRSLEGSD DAVLLQRRLD NMNFKWSELR 660 KKSLNIRSHL EASSDQWKRL HLSLQELLVW LQLKDDELSR QAPIGGDFPA VQKQNDVHRA 720 FKRELKTKEP VIMSTLETVR IFLTEQPLEG LEKLYQEPRE LPPEERAQNV TRLLRKQAEE 780 VNTEWEKLNL HSADWQRKID ETLERLQELQ EATDELDLKL RQAEVIKGSW QPVGDLLIDS 840 LQDHLEKVKA LRGEIAPLKE NVSHVNDLAR QLTTLGIQLS PYNLSTLEDL NTRWKLLQVA 900 VEDRVRQLHE AHRDFGPASQ HFLSTSVQGP WERAISPNKV PYYINHETQT TCWDHPKMTE 960 LYQSLADLNN VRFSAYRTAM KLRRLQKALC LDLLSLSAAC DALDQHNLKQ NDQPMDILQI 1020 INCLTTIYDR LEQEHNNLVN VPLCVDMCLN WLLNVYDTGR TGRIRVLSFK TGIISLCKAH 1080 LEDKYRYLFK QVASSTGFCD QRRLGLLLHD SIQIPRQLGE VASFGGSNIE PSVRSCFQFA 1140 NNKPEIEAAL FLDWMRLEPQ SMVWLPVLHR VAAAETAKHQ AKCNICKECP IIGFRYRSLK 1200 HFNYDICQSC FFSGRVAKGH KMHYPMVEYC TPTTSGEDVR DFAKVLKNKF RTKRYFAKHP 1260 RMGYLPVQTV LEGDNMET 1278 SEQ ID DNA sequence of a human-codon optimized human mini-dystrophin 3978 NO: 9 (Hopti-Dys3978) gene expression cassette ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctagatc tgaattcggt accccactac gggtttaggc 180 tgcccatgta aggaggcaag gcctggggac acccgagatg cctggttata attaacccag 240 acatgtggct gccccccccc cccccaacac ctgctgcctc taaaaataac cctgtccctg 300 gtggatcccc tgcatgcgaa gatcttcgaa caaggctgtg ggggactgag ggcaggctgt 360 aacaggcttg ggggccaggg cttatacgtg cctgggactc ccaaagtatt actgttccat 420 gttcccggcg aagggccagc tgtcccccgc cagctagact cagcacttag tttaggaacc 480 agtgagcaag tcagcccttg gggcagccca tacaaggcca tggggctggg caagctgcac 540 gcctgggtcc ggggtgggca cggtgcccgg gcaacgagct gaaagctcat ctgctctcag 600 gggcccctcc ctggggacag cccctcctgg ctagtcacac cctgtaggct cctctatata 660 acccaggggc acaggggctg ccctcattct accaccacct ccacagcaca gacagacact 720 caggagccag ccagcgtcga gcggccgatc cgccaccatg ctttggtggg aggaagtgga 780 ggactgctac gagagagagg acgtgcagaa gaaaaccttc accaagtggg tgaacgccca 840 gttcagcaag ttcggcaagc agcacatcga gaacctgttc agcgacctgc aggatggcag 900 gagactgctg gacctgctgg agggcctgac cggccagaag ctgcccaagg agaagggcag 960 caccagagtg cacgccctga acaacgtgaa caaggccctg agagtgctgc agaacaacaa 1020 cgtggacctg gtgaacatcg gcagcaccga catcgtggac ggcaaccaca agctgaccct 1080 gggcctgatc tggaacatca tcctgcactg gcaggtgaag aacgtgatga agaacatcat 1140 ggccggcctg cagcagacca acagcgagaa gatcctgctg agctgggtga ggcagagcac 1200 cagaaactac ccccaggtga acgtgatcaa cttcaccacc tcctggagcg acggcctggc 1260 cctgaacgcc ctgatccaca gccacagacc cgacctgttc gactggaaca gcgtggtgtg 1320 tcagcagagc gccacccaga gactggagca cgccttcaac atcgccagat accagctggg 1380 catcgagaag ctgctggacc ccgaggacgt ggacaccacc taccccgaca agaaaagcat 1440 cctcatgtac attaccagcc tgttccaggt gctgccccag caggtgtcca tcgaggccat 1500 ccaggaagtg gaaatgctgc ccaggccccc caaagtgacc aaggaggagc acttccagct 1560 gcaccaccag atgcactaca gccagcagat cacagtgagc ctggcccagg gctatgagag 1620 aaccagcagc cccaagccca gattcaagag ctacgcctac acccaggccg cctacgtgac 1680 cacctccgac cccaccagaa gccccttccc cagccagcac ctggaggccc ccgaggacaa 1740 gagcttcggc agcagcctga tggagagcga agtgaacctg gacagatacc agaccgccct 1800 ggaggaagtg ctgtcctggc tgctgagcgc cgaggacacc ctgcaggccc agggcgagat 1860 cagcaacgac gtggaagtgg tgaaggacca gttccacacc cacgagggct acatgatgga 1920 tctgaccgcc caccagggca gagtgggcaa tatcctgcag ctgggcagca agctgatcgg 1980 caccggcaag ctgagcgagg acgaggagac cgaagtgcag gagcagatga acctgctgaa 2040 cagcagatgg gagtgcctga gagtggccag catggagaag cagagcaacc tgcacagagt 2100 gctgatggac ctgcagaacc agaagctgaa ggagctgaac gactggctga ccaagaccga 2160 ggagcggacc agaaagatgg aggaggagcc cctgggcccc gacctggagg acctgaagag 2220 acaggtgcag cagcacaaag tgctgcagga ggacctggag caggagcagg tgcgcgtgaa 2280 cagcctgacc cacatggtgg tggtcgtgga cgagagcagc ggcgaccacg ccacagccgc 2340 cctggaagag cagctgaaag tgctgggcga cagatgggcc aatatttgta ggtggaccga 2400 ggacagatgg gtgctgctgc aggaccagcc cgacctggcc cctggcctga ccaccatcgg 2460 cgccagcccc acccagaccg tgaccctggt gacccagccc gtggtgacaa aggagaccgc 2520 catcagcaag ctggagatgc ccagctccct gatgctggaa gtgcccaccc accgcctgct 2580 ccagcagttc cccctggacc tggagaagtt cctggcctgg ctgaccgagg ccgaaaccac 2640 cgccaatgtg ctccaggacg ccactagaaa ggagaggctg ctggaggaca gcaagggcgt 2700 gaaagagctg atgaagcagt ggcaggatct gcagggcgaa atcgaggccc acaccgacgt 2760 gtaccacaac ctggacgaga acagccagaa gattctgagg agcctggagg gcagcgacga 2820 cgccgtcctg ctccagagga ggctggacaa catgaacttc aagtggagcg agctgcggaa 2880 gaagagcctg aacatccgga gccacctgga agccagcagc gaccagtgga agagactgca 2940 cctgagcctg caggagctgc tggtgtggct gcagctgaag gacgacgagc tgagcagaca 3000 ggcccccatc ggcggcgact tccccgccgt gcagaagcag aacgacgtgc accgggcctt 3060 caagagggag ctgaaaacca aggaacccgt gatcatgagc accctggaga cagtgcggat 3120 cttcctgacc gagcagcccc tggagggact ggagaagctg taccaggagc ccagagagct 3180 gccccccgag gagagagccc agaacgtgac caggctgctg agaaagcagg ccgaggaagt 3240 gaataccgag tgggagaagc tgaatctgca cagcgccgac tggcagagaa agatcgacga 3300 gaccctggag agactccagg aactgcagga agccaccgac gagctggacc tgaagctgag 3360 acaggccgaa gtgatcaagg gcagctggca gcctgtgggc gatctgctga tcgactccct 3420 gcaggatcac ctggagaaag tgaaggccct gcggggcgag atcgcccccc tgaaggagaa 3480 tgtgagccac gtgaacgacc tggccagaca gctgaccacc ctgggcatcc agctgagccc 3540 ctacaacctg agcacactgg aggatctgaa cacccggtgg aaactgctgc aggtggccgt 3600 ggaggataga gtgaggcagc tgcacgaagc ccacagagac ttcggccctg cctcccagca 3660 cttcctgagc accagcgtgc agggcccctg ggagagagcc atctccccca acaaagtgcc 3720 ctactacatc aaccacgaga cccagaccac ctgctgggac caccctaaga tgaccgagct 3780 gtatcagagc ctggccgacc tgaacaatgt gcggttcagc gcctacagaa ccgccatgaa 3840 gctgcggaga ctgcagaagg ccctgtgcct ggatctgctg agcctgagcg ccgcctgcga 3900 cgccctggac cagcacaacc tgaagcagaa tgaccagccc atggacatcc tgcagatcat 3960 caactgcctg accacaatct acgaccggct ggaacaggag cacaacaacc tggtgaatgt 4020 gcccctgtgc gtggacatgt gcctgaattg gctgctgaac gtgtacgaca ccggcaggac 4080 cggcagaatc cgcgtgctga gcttcaagac cggcatcatc agcctgtgca aggcccacct 4140 ggaggataag taccgctacc tgttcaagca ggtggccagc agcaccggct tctgcgatca 4200 gaggagactg ggcctgctgc tgcacgatag catccagatc cctaggcagc tgggcgaagt 4260 ggccagcttt ggcggcagca acatcgagcc ctctgtgagg agctgcttcc agttcgccaa 4320 caacaagccc gagatcgagg ccgccctgtt cctggactgg atgaggctgg agcctcagag 4380 catggtgtgg ctgcctgtgc tgcacagagt ggccgccgcc gagaccgcca agcaccaggc 4440 caagtgcaat atctgcaagg agtgccccat catcggcttc cggtacagga gcctgaagca 4500 cttcaactac gacatctgcc agagctgctt tttcagcggc agagtggcca agggccacaa 4560 aatgcactac cccatggtgg agtactgcac ccccaccacc tccggcgagg atgtgagaga 4620 cttcgccaaa gtgctgaaga ataagttccg gaccaagcgg tactttgcca agcaccccag 4680 gatgggctac ctgcccgtgc agaccgtgct ggaaggcgac aacatggaga cctgatgagg 4740 agctcgagag gcctaataaa gagctcagat gcatcgatca gagtgtgttg gttttttgtg 4800 tgagatctag gaacccctag tgatggagtt ggccactccc tctctgcgcg ctcgctcgct 4860 cactgaggcc gcccgggcaa agcccgggcg tcgggcgacc tttggtcgcc cggcctcagt 4920 gagcgagcga gcgcgcagag agggagtggc caa 4953 SEQ ID DNA sequence of AAV-hCK-Hopti-Dys3837 gene expression cassette NO: 10 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctagatc tgaattcggt accccactac gggtttaggc 180 tgcccatgta aggaggcaag gcctggggac acccgagatg cctggttata attaacccag 240 acatgtggct gccccccccc cccccaacac ctgctgcctc taaaaataac cctgtccctg 300 gtggatcccc tgcatgcgaa gatcttcgaa caaggctgtg ggggactgag ggcaggctgt 360 aacaggcttg ggggccaggg cttatacgtg cctgggactc ccaaagtatt actgttccat 420 gttcccggcg aagggccagc tgtcccccgc cagctagact cagcacttag tttaggaacc 480 agtgagcaag tcagcccttg gggcagccca tacaaggcca tggggctggg caagctgcac 540 gcctgggtcc ggggtgggca cggtgcccgg gcaacgagct gaaagctcat ctgctctcag 600 gggcccctcc ctggggacag cccctcctgg ctagtcacac cctgtaggct cctctatata 660 acccaggggc acaggggctg ccctcattct accaccacct ccacagcaca gacagacact 720 caggagccag ccagcgtcga gcggccgatc cgccaccatg ctttggtggg aggaagtgga 780 ggactgctac gagagagagg acgtgcagaa gaaaaccttc accaagtggg tgaacgccca 840 gttcagcaag ttcggcaagc agcacatcga gaacctgttc agcgacctgc aggatggcag 900 gagactgctg gacctgctgg agggcctgac cggccagaag ctgcccaagg agaagggcag 960 caccagagtg cacgccctga acaacgtgaa caaggccctg agagtgctgc agaacaacaa 1020 cgtggacctg gtgaacatcg gcagcaccga catcgtggac ggcaaccaca agctgaccct 1080 gggcctgatc tggaacatca tcctgcactg gcaggtgaag aacgtgatga agaacatcat 1140 ggccggcctg cagcagacca acagcgagaa gatcctgctg agctgggtga ggcagagcac 1200 cagaaactac ccccaggtga acgtgatcaa cttcaccacc tcctggagcg acggcctggc 1260 cctgaacgcc ctgatccaca gccacagacc cgacctgttc gactggaaca gcgtggtgtg 1320 tcagcagagc gccacccaga gactggagca cgccttcaac atcgccagat accagctggg 1380 catcgagaag ctgctggacc ccgaggacgt ggacaccacc taccccgaca agaaaagcat 1440 cctcatgtac attaccagcc tgttccaggt gctgccccag caggtgtcca tcgaggccat 1500 ccaggaagtg gaaatgctgc ccaggccccc caaagtgacc aaggaggagc acttccagct 1560 gcaccaccag atgcactaca gccagcagat cacagtgagc ctggcccagg gctatgagag 1620 aaccagcagc cccaagccca gattcaagag ctacgcctac acccaggccg cctacgtgac 1680 cacctccgac cccaccagaa gccccttccc cagccagcac ctggaggccc ccgaggacaa 1740 gagcttcggc agcagcctga tggagagcga agtgaacctg gacagatacc agaccgccct 1800 ggaggaagtg ctgtcctggc tgctgagcgc cgaggacacc ctgcaggccc agggcgagat 1860 cagcaacgac gtggaagtgg tgaaggacca gttccacacc cacgagggct acatgatgga 1920 tctgaccgcc caccagggca gagtgggcaa tatcctgcag ctgggcagca agctgatcgg 1980 caccggcaag ctgagcgagg acgaggagac cgaagtgcag gagcagatga acctgctgaa 2040 cagcagatgg gagtgcctga gagtggccag catggagaag cagagcaacc tgcacagagt 2100 gctgatggac ctgcagaacc agaagctgaa ggagctgaac gactggctga ccaagaccga 2160 ggagcggacc agaaagatgg aggaggagcc cctgggcccc gacctggagg acctgaagag 2220 acaggtgcag cagcacaaag tgctgcagga ggacctggag caggagcagg tgcgcgtgaa 2280 cagcctgacc cacatggtgg tggtcgtgga cgagagcagc ggcgaccacg ccacagccgc 2340 cctggaagag cagctgaaag tgctgggcga cagatgggcc aatatttgta ggtggaccga 2400 ggacagatgg gtgctgctgc aggacaccca ccgcctgctc cagcagttcc ccctggacct 2460 ggagaagttc ctggcctggc tgaccgaggc cgaaaccacc gccaatgtgc tccaggacgc 2520 cactagaaag gagaggctgc tggaggacag caagggcgtg aaagagctga tgaagcagtg 2580 gcaggatctg cagggcgaaa tcgaggccca caccgacgtg taccacaacc tggacgagaa 2640 cagccagaag attctgagga gcctggaggg cagcgacgac gccgtcctgc tccagaggag 2700 gctggacaac atgaacttca agtggagcga gctgcggaag aagagcctga acatccggag 2760 ccacctggaa gccagcagcg accagtggaa gagactgcac ctgagcctgc aggagctgct 2820 ggtgtggctg cagctgaagg acgacgagct gagcagacag gcccccatcg gcggcgactt 2880 ccccgccgtg cagaagcaga acgacgtgca ccgggccttc aagagggagc tgaaaaccaa 2940 ggaacccgtg atcatgagca ccctggagac agtgcggatc ttcctgaccg agcagcccct 3000 ggagggactg gagaagctgt accaggagcc cagagagctg ccccccgagg agagagccca 3060 gaacgtgacc aggctgctga gaaagcaggc cgaggaagtg aataccgagt gggagaagct 3120 gaatctgcac agcgccgact ggcagagaaa gatcgacgag accctggaga gactccagga 3180 actgcaggaa gccaccgacg agctggacct gaagctgaga caggccgaag tgatcaaggg 3240 cagctggcag cctgtgggcg atctgctgat cgactccctg caggatcacc tggagaaagt 3300 gaaggccctg cggggcgaga tcgcccccct gaaggagaat gtgagccacg tgaacgacct 3360 ggccagacag ctgaccaccc tgggcatcca gctgagcccc tacaacctga gcacactgga 3420 ggatctgaac acccggtgga aactgctgca ggtggccgtg gaggatagag tgaggcagct 3480 gcacgaagcc cacagagact tcggccctgc ctcccagcac ttcctgagca ccagcgtgca 3540 gggcccctgg gagagagcca tctcccccaa caaagtgccc tactacatca accacgagac 3600 ccagaccacc tgctgggacc accctaagat gaccgagctg tatcagagcc tggccgacct 3660 gaacaatgtg cggttcagcg cctacagaac cgccatgaag ctgcggagac tgcagaaggc 3720 cctgtgcctg gatctgctga gcctgagcgc cgcctgcgac gccctggacc agcacaacct 3780 gaagcagaat gaccagccca tggacatcct gcagatcatc aactgcctga ccacaatcta 3840 cgaccggctg gaacaggagc acaacaacct ggtgaatgtg cccctgtgcg tggacatgtg 3900 cctgaattgg ctgctgaacg tgtacgacac cggcaggacc ggcagaatcc gcgtgctgag 3960 cttcaagacc ggcatcatca gcctgtgcaa ggcccacctg gaggataagt accgctacct 4020 gttcaagcag gtggccagca gcaccggctt ctgcgatcag aggagactgg gcctgctgct 4080 gcacgatagc atccagatcc ctaggcagct gggcgaagtg gccagctttg gcggcagcaa 4140 catcgagccc tctgtgagga gctgcttcca gttcgccaac aacaagcccg agatcgaggc 4200 cgccctgttc ctggactgga tgaggctgga gcctcagagc atggtgtggc tgcctgtgct 4260 gcacagagtg gccgccgccg agaccgccaa gcaccaggcc aagtgcaata tctgcaagga 4320 gtgccccatc atcggcttcc ggtacaggag cctgaagcac ttcaactacg acatctgcca 4380 gagctgcttt ttcagcggca gagtggccaa gggccacaaa atgcactacc ccatggtgga 4440 gtactgcacc cccaccacct ccggcgagga tgtgagagac ttcgccaaag tgctgaagaa 4500 taagttccgg accaagcggt actttgccaa gcaccccagg atgggctacc tgcccgtgca 4560 gaccgtgctg gaaggcgaca acatggagac etgatgagga gctcgagagg cctaataaag 4620 agctcagatg catcgatcag agtgtgttgg ttttttgtgt gagatctagg aacccctagt 4680 gatggagttg gccactccct ctctgcgcgc tcgctcgctc actgaggccg cccgggcaaa 4740 gcccgggcgt cgggcgacct ttggtcgccc ggcctcagtg agcgagcgag cgcgcagaga 4800 gggagtggcc aa 4812 SEQ ID DNA sequence of AAV-hCKplus-Hopti-Dys3837 gene expression cassette NO: 11 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctagatc tgaattcggt accccactac gggtctaggc 180 tgcccatgta aggaggcaag gcctggggac acccgagatg cctggttata attaacccca 240 acacctgctg CCCCCCCCCC cccaacacct gctgcctcta aaaataaccc tgtccctggt 300 ggatcccctg catgccccac tacgggttta ggctgcccat gtaaggaggc aaggcctggg 360 gacacccgag atgcctggtt ataattaacc cagacatgtg gctgcccccc ccccccccaa 420 cacctgctgc ctctaaaaat aaccctgtcc ctggtggatc ccctgcatgc gaagatcttc 480 gaacaaggct gtgggggact gagggcaggc tgtaacaggc ttgggggcca gggcttatac 540 gtgcctggga ctcccaaagt attactgttc catgttcccg gcgaagggcc agctgtcccc 600 cgccagctag actcagcact tagtttagga accagtgagc aagtcagccc ttggggcagc 660 ccatacaagg ccatggggct gggcaagctg cacgcctggg tccggggtgg gcacggtgcc 720 cgggcaacga gctgaaagct catctgctct caggggcccc tccctgggga cagcccctcc 780 tggctagtca caccctgtag gctcctctat ataacccagg ggcacagggg ctgccctcat 840 tctaccacca cctccacagc acagacagac actcaggagc cagccagcgt cgagcggccg 900 atccgccacc atgctttggt gggaggaagt ggaggactgc tacgagagag aggacgtgca 960 gaagaaaacc ttcaccaagt gggtgaacgc ccagttcagc aagttcggca agcagcacat 1020 cgagaacctg ttcagcgacc tgcaggatgg caggagactg ctggacctgc tggagggcct 1080 gaccggccag aagctgccca aggagaaggg cagcaccaga gtgcacgccc tgaacaacgt 1140 gaacaaggcc ctgagagtgc tgcagaacaa caacgtggac ctggtgaaca tcggcagcac 1200 cgacatcgtg gacggcaacc acaagctgac cctgggcctg atctggaaca tcatcctgca 1260 ctggcaggtg aagaacgtga tgaagaacat catggccggc ctgcagcaga ccaacagcga 1320 gaagatcctg ctgagctggg tgaggcagag caccagaaac tacccccagg tgaacgtgat 1380 caacttcacc acctcctgga gcgacggcct ggccctgaac gccctgatcc acagccacag 1440 acccgacctg ttcgactgga acagcgtggt gtgtcagcag agcgccaccc agagactgga 1500 gcacgccttc aacatcgcca gataccagct gggcatcgag aagctgctgg accccgagga 1560 cgtggacacc acctaccccg acaagaaaag catcctcatg tacattacca gcctgttcca 1620 ggtgctgccc cagcaggtgt ccatcgaggc catccaggaa gtggaaatgc tgcccaggcc 1680 ccccaaagtg accaaggagg agcacttcca gctgcaccac cagatgcact acagccagca 1740 gatcacagtg agcctggccc agggctatga gagaaccagc agccccaagc ccagattcaa 1800 gagctacgcc tacacccagg ccgcctacgt gaccacctcc gaccccacca gaagcccctt 1860 ccccagccag cacctggagg cccccgagga caagagcttc ggcagcagcc tgatggagag 1920 cgaagtgaac ctggacagat accagaccgc cctggaggaa gtgctgtcct ggctgctgag 1980 cgccgaggac accctgcagg cccagggcga gatcagcaac gacgtggaag tggtgaagga 2040 ccagttccac acccacgagg gctacatgat ggatctgacc gcccaccagg gcagagtggg 2100 caatatcctg cagctgggca gcaagctgat cggcaccggc aagctgagcg aggacgagga 2160 gaccgaagtg caggagcaga tgaacctgct gaacagcaga tgggagtgcc tgagagtggc 2220 cagcatggag aagcagagca acctgcacag agtgctgatg gacctgcaga accagaagct 2280 gaaggagctg aacgactggc tgaccaagac cgaggagcgg accagaaaga tggaggagga 2340 gcccctgggc cccgacctgg aggacctgaa gagacaggtg cagcagcaca aagtgctgca 2400 ggaggacctg gagcaggagc aggtgcgcgt gaacagcctg acccacatgg tggtggtcgt 2460 ggacgagagc agcggcgacc acgccacagc cgccctggaa gagcagctga aagtgctggg 2520 cgacagatgg gccaatattt gtaggtggac cgaggacaga tgggtgctgc tgcaggacac 2580 ccaccgcctg ctccagcagt tccccctgga cctggagaag ttcctggcct ggctgaccga 2640 ggccgaaacc accgccaatg tgctccagga cgccactaga aaggagaggc tgctggagga 2700 cagcaagggc gtgaaagagc tgatgaagca gtggcaggat ctgcagggcg aaatcgaggc 2760 ccacaccgac gtgtaccaca acctggacga gaacagccag aagattctga ggagcctgga 2820 gggcagcgac gacgccgtcc tgctccagag gaggctggac aacatgaact tcaagtggag 2880 cgagctgcgg aagaagagcc tgaacatccg gagccacctg gaagccagca gcgaccagtg 2940 gaagagactg cacctgagcc tgcaggagct gctggtgtgg ctgcagctga aggacgacga 3000 gctgagcaga caggccccca tcggcggcga cttccccgcc gtgcagaagc agaacgacgt 3060 gcaccgggcc ttcaagaggg agctgaaaac caaggaaccc gtgatcatga gcaccctgga 3120 gacagtgcgg atcttcctga ccgagcagcc cctggaggga ctggagaagc tgtaccagga 3180 gcccagagag ctgccccccg aggagagagc ccagaacgtg accaggctgc tgagaaagca 3240 ggccgaggaa gtgaataccg agtgggagaa gctgaatctg cacagcgccg actggcagag 3300 aaagatcgac gagaccctgg agagactcca ggaactgcag gaagccaccg acgagctgga 3360 cctgaagctg agacaggccg aagtgatcaa gggcagctgg cagcctgtgg gcgatctgct 3420 gatcgactcc ctgcaggatc acctggagaa agtgaaggcc ctgcggggcg agatcgcccc 3480 cctgaaggag aatgtgagcc acgtgaacga cctggccaga cagctgacca ccctgggcat 3540 ccagctgagc ccctacaacc tgagcacact ggaggatctg aacacccggt ggaaactgct 3600 gcaggtggcc gtggaggata gagtgaggca gctgcacgaa gcccacagag acttcggccc 3660 tgcctcccag cacttcctga gcaccagcgt gcagggcccc tgggagagag ccatctcccc 3720 caacaaagtg ccctactaca tcaaccacga gacccagacc acctgctggg accaccctaa 3780 gatgaccgag ctgtatcaga gcctggccga cctgaacaat gtgcggttca gcgcctacag 3840 aaccgccatg aagctgcgga gactgcagaa ggccctgtgc ctggatctgc tgagcctgag 3900 cgccgcctgc gacgccctgg accagcacaa cctgaagcag aatgaccagc ccatggacat 3960 cctgcagatc atcaactgcc tgaccacaat ctacgaccgg ctggaacagg agcacaacaa 4020 cctggtgaat gtgcccctgt gcgtggacat gtgcctgaat tggctgctga acgtgtacga 4080 caccggcagg accggcagaa tccgcgtgct gagcttcaag accggcatca tcagcctgtg 4140 caaggcccac Gtggaggata agtaccgcta cctgttcaag caggtggcca gcagcaccgg 4200 cttctgcgat cagaggagac tgggcctgct gctgcacgat agcatccaga tccctaggca 4260 gctgggcgaa gtggccagct ttggcggcag caacatcgag ccctctgtga ggagctgctt 4320 ccagttcgcc aacaacaagc ccgagatcga ggccgccctg ttcctggact ggatgaggct 4380 ggagcctcag agcatggtgt ggctgcctgt gctgcacaga gtggccgccg ccgagaccgc 4440 caagcaccag gccaagtgca atatctgcaa ggagtgcccc atcatcggct tccggtacag 4500 gagcctgaag cacttcaact acgacatctg ccagagctgc tttttcagcg gcagagtggc 4560 caagggccac aaaatgcact accccatggt ggagtactgc acccccacca cctccggcga 4620 ggatgtgaga gacttcgcca aagtgctgaa gaataagttc cggaccaagc ggtactttgc 4680 caagcacccc aggatgggct acctgcccgt gcagaccgtg ctggaaggcg acaacatgga 4740 gacctgatga ggagctcgag aggcctaata aagagctcag atgcatcgat cagagtgtgt 4800 tggttttttg tgtgagatct aggaacccct agtgatggag ttggccactc cctctctgcg 4860 cgctcgctcg ctcactgagg ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg 4920 cccggcctca gtgagcgagc gagcgcgcag agagggagtg gccaa 4965 SEQ ID DNA sequence of AAV-hCK-Copti-Dys3978 gene expression cassette NO: 12 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctcagat ctgaattcgg taccccacta cgggtttagg 180 ctgcccatgt aaggaggcaa ggcctgggga cacccgagat gcctggttat aattaaccca 240 gacatgtggc tgcccccccc ccccccaaca cctgctgcct ctaaaaataa ccctgtccct 300 ggtggatccc ctgcatgcga agatcttcga acaaggctgt gggggactga gggcaggctg 360 taacaggctt gggggccagg gcttatacgt gcctgggact cccaaagtat tactgttcca 420 tgttcccggc gaagggccag ctgtcccccg ccagctagac tcagcactta gtttaggaac 480 cagtgagcaa gtcagccctt ggggcagccc atacaaggcc atggggctgg gcaagctgca 540 cgcctgggtc cggggtgggc acggtgcccg ggcaacgagc tgaaagctca tctgctctca 600 ggggcccctc cctggggaca gcccctcctg gctagtcaca ccctgtaggc tcctctatat 660 aacccagggg cacaggggct gccctcattc taccaccacc tccacagcac agacagacac 720 tcaggagcca gccagcgtcg agcggccgcc accatgcttt ggtgggagga agtggaggac 780 tgctacgagc gggaggacgt gcagaagaaa accttcacca agtgggtgaa cgcccagttc 840 agcaagttcg gcaagcagca catcgagaac ctgttcagcg acctgcagga cggcaggcgg 900 ctgctggacc tcctggaagg cctgaccggc cagaagctgc ccaaagagaa gggcagcacc 960 agggtgcacg ccctgaacaa cgtgaacaag gccctgaggg tgctgcagaa caacaacgtg 1020 gacctggtga acatcggcag caccgacatc gtggacggca accacaagct gaccctgggc 1080 ctgatctgga acatcatcct gcactggcag gtcaagaacg tgatgaagaa catcatggcc 1140 ggcctgcagc agaccaacag cgagaagatc ctgctgtcct gggtgcggca gagcaccagg 1200 aactaccccc aggtcaacgt gatcaacttc accacctctt ggagcgacgg cctggccctg 1260 aacgccctga tccacagcca caggcccgac ctgttcgact ggaacagcgt ggtgtgccag 1320 cagagcgcca cccagaggct ggaacacgcc ttcaacatcg ccagatacca gctgggcatc 1380 gagaagctgc tggatcccga ggacgtggac accacctacc ccgacaagaa aagcatcctc 1440 atgtacatca ccagcctgtt ccaggtgctg ccccagcagg tgtccatcga ggccatccag 1500 gaagtggaga tgctgcccag gccccccaag gtcaccaaag aggaacactt ccagctgcac 1560 caccagatgc actacagcca gcagatcacc gtgagcctgg cccagggcta cgagaggacc 1620 agcagcccca agcccaggtt caagagctac gcctacaccc aggccgccta cgtgaccacc 1680 tccgacccca ccaggtcccc cttccccagc cagcatctcg aagcccccga ggacaagagc 1740 ttcggcagca gcctgatgga aagcgaggtg aacctggaca gataccagac cgccctggaa 1800 gaagtgctgt cttggctgct gtccgccgag gacaccctgc aggcccaggg cgagatcagc 1860 aacgacgtgg aggtcgtgaa ggaccagttc cacacccacg agggctacat gatggacctg 1920 accgcccacc agggcagagt gggcaacatc ctgcagctgg gcagcaagct gatcggcacc 1980 ggcaagctgt ccgaggacga ggaaaccgag gtgcaggaac agatgaacct gctgaacagc 2040 agatgggagt gcctgagggt ggccagcatg gaaaagcaga gcaacctgca cagggtgctg 2100 atggatctgc agaaccagaa gctcaaagag ctgaacgact ggctgaccaa gaccgaggaa 2160 aggacccgga agatggaaga ggaacccctg ggccccgatc tcgaagatct gaagaggcag 2220 gtgcagcagc acaaggtgct gcaggaagat ctcgaacagg aacaggtccg ggtcaacagc 2280 ctgacccaca tggtcgtggt ggtggacgag agcagcggcg accacgccac cgctgccctg 2340 gaagagcagc tgaaggtgct gggcgacaga tgggccaaca tctgccggtg gaccgaggac 2400 agatgggtcc tcctgcagga ccagcccgac ctggcccctg gcctgacaac catcggcgcc 2460 agccccaccc agaccgtgac cctggtgacc cagcccgtgg tgaccaaaga gaccgccatc 2520 agcaagctgg aaatgcccag ctccctgatg ctggaagtgc ccacccacag gctcctccag 2580 cagttccccc tggacctgga aaagttcctg gcctggctga ccgaggccga gaccaccgcc 2640 aacgtgctgc aggacgccac caggaaagag aggctgctgg aagatagcaa gggcgtgaaa 2700 gagctgatga agcagtggca ggacctgcag ggggagattg aggcccacac cgacgtgtac 2760 cacaacctgg acgagaacag ccagaaaatc ctgagaagcc tggaaggcag cgacgacgcc 2820 gtgctgctgc agaggcggct ggacaacatg aacttcaagt ggagcgagct gaggaagaag 2880 agcctgaaca tcaggtccca tctggaagcc agcagcgacc agtggaagag gctgcacctg 2940 agcctgcagg aactgctcgt ctggctgcag ctgaaagacg acgagctgtc caggcaggcc 3000 cccatcggcg gcgacttccc cgccgtgcag aaacagaacg acgtgcacag ggccttcaag 3060 cgggagctga aaaccaaaga gcccgtgatc atgagcaccc tggaaaccgt gaggatcttc 3120 ctgaccgagc agcccctgga aggactggaa aagctgtacc aggaacccag agagctgccc 3180 cccgaggaac gggcccagaa cgtgaccagg ctgctgagaa agcaggccga ggaagtgaac 3240 accgagtggg agaagctgaa cctgcactcc gccgactggc agaggaagat cgacgagacc 3300 ctggaaaggc tccaggaact gcaggaagcc accgacgagc tggacctgaa gctgagacag 3360 gccgaggtga tcaagggcag ctggcagccc gtgggcgacc tgctgatcga ctccctgcag 3420 gatcacctgg aaaaagtgaa ggccctgcgg ggcgagatcg cccccctgaa agagaacgtc 3480 agccacgtca acgacctggc caggcagctg accaccctgg gcatccagct gtccccctac 3540 aacctgtcca ccctggaaga tctgaacaca aggtggaagc tgctgcaggt ggccgtggag 3600 gacagagtga ggcagctgca cgaggcccac agggacttcg gccctgcctc ccagcacttc 3660 ctgagcacca gcgtgcaggg cccctgggag agggccatct cccccaacaa ggtgccctac 3720 tacatcaacc acgagaccca gaccacctgc tgggaccacc ctaagatgac cgagctgtac 3780 cagtccctgg ccgacctgaa caatgtgcgg ttcagcgcct accggaccgc catgaagctg 3840 aggcggctgc agaaagccct gtgcctggat ctgctgtccc tgagcgccgc ctgcgacgcc 3900 ctggaccagc acaacctgaa gcagaacgac cagcccatgg atatcctgca gatcatcaac 3960 tgtctgacca ccatctacga caggctggaa caggaacaca acaacctggt caacgtgccc 4020 ctgtgcgtgg acatgtgcct gaactggctg ctgaacgtgt acgacaccgg caggaccggc 4080 cggatcaggg tgctgtcctt caagaccggc atcatcagcc tgtgcaaggc ccacctggaa 4140 gataagtacc gctacctgtt caagcaggtg gccagctcta ccggcttctg cgaccagcgg 4200 aggctgggcc tgctgctgca cgacagcatc cagatccccc ggcagctggg cgaggtggcc 4260 tccttcggcg gcagcaacat cgagcccagc gtgcggagct gcttccagtt cgccaacaac 4320 aagcccgaga tcgaggccgc cctgttcctg gactggatgc ggctggaacc ccagagcatg 4380 gtctggctgc ccgtgctgca cagagtggct gccgccgaga ccgccaagca ccaggccaag 4440 tgcaacatct gcaaagagtg ccccatcatc ggcttcaggt acagaagcct gaagcacttc 4500 aactacgaca tctgccagag ctgtttcttc agcggcaggg tggccaaggg ccacaaaatg 4560 cactacccca tggtggagta ctgcaccccc accacctccg gcgaggacgt gagggacttc 4620 gccaaggtgc tgaagaataa gttccggacc aagcggtact tcgccaaaca ccccaggatg 4680 ggctacctgc ccgtgcagac cgtgctggaa ggcgacaaca tggaaacctg ataacacgcg 4740 tcgactcgag aggcctaata aagagctcag atgcatcgat cagagtgtgt tggttttttg 4800 tgtgagatct aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg 4860 ctcactgagg ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca 4920 gtgagcgagc gagcgcgcag agagggagtg gccaa 4955 SEQ ID Amino acid sequence of AAV9 capsid VP1 protein NO: 13 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY KYLGPGNGLD 60 KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ 120 AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE 180 SVPDPQPIGE PPAAPSGVGS LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI 240 TTSTRTWALP TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR 300 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY QLPYVLGSAH 360 EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF PSQMLRTGNN FQFSYEFENV 420 PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT INGSGQNQQT LKFSVAGPSN MAVQGRNYIP 480 GPSYRQQRVS TTVTQNNNSE FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS 540 LIFGKQGTGR DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG 600 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK NTPVPADPPT 660 AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYYKSNN VEFAVNTEGV 720 YSEPRPIGTR YLTRNL 736 SEQ ID Left AAV2 ITR NO: 14 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcct 145 SEQ ID Right AAV2 ITR NO: 15 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120 gagcgcgcag agagggagtg gccaa 145 SEQ ID DNA sequence of synthetic muscle-specific enhancer and promoter NO: 16 ccactacggg tctaggctgc ccatgtaagg aggcaaggcc tggggacacc cgagatgcct 60 ggttataatt aacccagaca tgtggctgcc cccccccccc ccaacacctg ctgcctctaa 120 aaataaccct gtccctggtg gatcccctgc atgcgaagat cttcgaacaa ggctgtgggg 180 gactgagggc aggctgtaac aggcttgggg gccagggctt atacgtgcct gggactccca 240 aagtattact gttccatgtt cccggcgaag ggccagctgt cccccgccag ctagactcag 300 cacttagttt aggaaccagt gagcaagtca gcccttgggg cagcccatac aaggccatgg 360 ggctgggcaa gctgcacgcc tgggtccggg gtgggcacgg tgcccgggca acgagctgaa 420 agctcatctg ctctcagggg cccctccctg gggacagccc ctcctggcta gtcacaccct 480 gtaggctcct ctatataacc caggggcaca ggggctgccc tcattctacc accacctcca 540 cagcacagac agacactcag gagccagcca gcgtcga 577 SEQ ID DNA sequence of transcription terminator NO: 17 aggcctaata aagagctcag atgcatcgat cagagtgtgt tggttttttg tgtg 54 SEQ ID DNA sequence of AAV9.hCK.Hopti-Dys3978.spA vector genom NO: 18 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctcagat ctgaattcgg taccccacta cgggtctagg 180 ctgcccatgt aaggaggcaa ggcctgggga cacccgagat gcctggttat aattaaccca 240 gacatgtggc tgcccccccc ccccccaaca cctgctgcct ctaaaaataa ccctgtccct 300 ggtggatccc ctgcatgcga agatcttcga acaaggctgt gggggactga gggcaggctg 360 taacaggctt gggggccagg gcttatacgt gcctgggact cccaaagtat tactgttcca 420 tgttcccggc gaagggccag ctgtcccccg ccagctagac tcagcactta gtttaggaac 480 cagtgagcaa gtcagccctt ggggcagccc atacaaggcc atggggctgg gcaagctgca 540 cgcctgggtc cggggtgggc acggtgcccg ggcaacgagc tgaaagctca tctgctctca 600 ggggcccctc cctggggaca gcccctcctg gctagtcaca ccctgtaggc tcctctatat 660 aacccagggg cacaggggct gccctcattc taccaccacc tccacagcac agacagacac 720 tcaggagcca gccagcgtcg agcggccgat ccgccaccat gctttggtgg gaggaagtgg 780 aggactgcta cgagagagag gacgtgcaga agaaaacctt caccaagtgg gtgaacgccc 840 agttcagcaa gttcggcaag cagcacatcg agaacctgtt cagcgacctg caggatggca 900 ggagactgct ggacctgctg gagggcctga ccggccagaa gctgcccaag gagaagggca 960 gcaccagagt gcacgccctg aacaacgtga acaaggccct gagagtgctg cagaacaaca 1020 acgtggacct ggtgaacatc ggcagcaccg acatcgtgga cggcaaccac aagctgaccc 1080 tgggcctgat ctggaacatc atcctgcact ggcaggtgaa gaacgtgatg aagaacatca 1140 tggccggcct gcagcagacc aacagcgaga agatcctgct gagctgggtg aggcagagca 1200 ccagaaacta cccccaggtg aacgtgatca acttcaccac ctcctggagc gacggcctgg 1260 ccctgaacgc cctgatccac agccacagac ccgacctgtt cgactggaac agcgtggtgt 1320 gtcagcagag cgccacccag agactggagc acgccttcaa catcgccaga taccagctgg 1380 gcatcgagaa gctgctggac cccgaggacg tggacaccac ctaccccgac aagaaaagca 1440 tcctcatgta cattaccagc ctgttccagg tgctgcccca gcaggtgtcc atcgaggcca 1500 tccaggaagt ggaaatgctg cccaggcccc ccaaagtgac caaggaggag cacttccagc 1560 tgcaccacca gatgcactac agccagcaga tcacagtgag cctggcccag ggctatgaga 1620 gaaccagcag ccccaagccc agattcaaga gctacgccta cacccaggcc gcctacgtga 1680 ccacctccga ccccaccaga agccccttcc ccagccagca cctggaggcc cccgaggaca 1740 agagcttcgg cagcagcctg atggagagcg aagtgaacct ggacagatac cagaccgccc 1800 tggaggaagt gctgtcctgg ctgctgagcg ccgaggacac cctgcaggcc cagggcgaga 1860 tcagcaacga cgtggaagtg gtgaaggacc agttccacac ccacgagggc tacatgatgg 1920 atctgaccgc ccaccagggc agagtgggca atatcctgca gctgggcagc aagctgatcg 1980 gcaccggcaa gctgagcgag gacgaggaga ccgaagtgca ggagcagatg aacctgctga 2040 acagcagatg ggagtgcctg agagtggcca gcatggagaa gcagagcaac ctgcacagag 2100 tgctgatgga cctgcagaac cagaagctga aggagctgaa cgactggctg accaagaccg 2160 aggagcggac cagaaagatg gaggaggagc ccctgggccc cgacctggag gacctgaaga 2220 gacaggtgca gcagcacaaa gtgctgcagg aggacctgga gcaggagcag gtgcgcgtga 2280 acagcctgac ccacatggtg gtggtcgtgg acgagagcag cggcgaccac gccacagccg 2340 ccctggaaga gcagctgaaa gtgctgggcg acagatgggc caatatttgt aggtggaccg 2400 aggacagatg ggtgctgctg caggaccagc ccgacctggc ccctggcctg accaccatcg 2460 gcgccagccc cacccagacc gtgaccctgg tgacccagcc cgtggtgaca aaggagaccg 2520 ccatcagcaa gctggagatg cccagctccc tgatgctgga agtgcccacc caccgcctgc 2580 tccagcagtt ccccctggac ctggagaagt tcctggcctg gctgaccgag gccgaaacca 2640 ccgccaatgt gctccaggac gccactagaa aggagaggct gctggaggac agcaagggcg 2700 tgaaagagct gatgaagcag tggcaggatc tgcagggcga aatcgaggcc cacaccgacg 2760 tgtaccacaa cctggacgag aacagccaga agattctgag gagcctggag ggcagcgacg 2820 acgccgtcct gctccagagg aggctggaca acatgaactt caagtggagc gagctgcgga 2880 agaagagcct gaacatccgg agccacctgg aagccagcag cgaccagtgg aagagactgc 2940 acctgagcct gcaggagctg ctggtgtggc tgcagctgaa ggacgacgag ctgagcagac 3000 aggcccccat cggcggcgac ttccccgccg tgcagaagca gaacgacgtg caccgggcct 3060 tcaagaggga gctgaaaacc aaggaacccg tgatcatgag caccctggag acagtgcgga 3120 tcttcctgac cgagcagccc ctggagggac tggagaagct gtaccaggag cccagagagc 3180 tgccccccga ggagagagcc cagaacgtga ccaggctgct gagaaagcag gccgaggaag 3240 tgaataccga gtgggagaag ctgaatctgc acagcgccga ctggcagaga aagatcgacg 3300 agaccctgga gagactccag gaactgcagg aagccaccga cgagctggac ctgaagctga 3360 gacaggccga agtgatcaag ggcagctggc agcctgtggg cgatctgctg atcgactccc 3420 tgcaggatca cctggagaaa gtgaaggccc tgcggggcga gatcgccccc ctgaaggaga 3480 atgtgagcca cgtgaacgac ctggccagac agctgaccac cctgggcatc cagctgagcc 3540 cctacaacct gagcacactg gaggatctga acacccggtg gaaactgctg caggtggccg 3600 tggaggatag agtgaggcag ctgcacgaag cccacagaga cttcggccct gcctcccagc 3660 acttcctgag caccagcgtg cagggcccct gggagagagc catctccccc aacaaagtgc 3720 cctactacat caaccacgag acccagacca cctgctggga ccaccctaag atgaccgagc 3780 tgtatcagag cctggccgac ctgaacaatg tgcggttcag cgcctacaga accgccatga 3840 agctgcggag actgcagaag gccctgtgcc tggatctgct gagcctgagc gccgcctgcg 3900 acgccctgga ccagcacaac ctgaagcaga atgaccagcc catggacatc ctgcagatca 3960 tcaactgcct gaccacaatc tacgaccggc tggaacagga gcacaacaac ctggtgaatg 4020 tgcccctgtg cgtggacatg tgcctgaatt ggctgctgaa cgtgtacgac accggcagga 4080 ccggcagaat ccgcgtgctg agcttcaaga ccggcatcat cagcctgtgc aaggcccacc 4140 tggaggataa gtaccgctac ctgttcaagc aggtggccag cagcaccggc ttctgcgatc 4200 agaggagact gggcctgctg ctgcacgata gcatccagat ccctaggcag ctgggcgaag 4260 tggccagctt tggcggcagc aacatcgagc cctctgtgag gagctgcttc cagttcgcca 4320 acaacaagcc cgagatcgag gccgccctgt tcctggactg gatgaggctg gagcctcaga 4380 gcatggtgtg gctgcctgtg ctgcacagag tggccgccgc cgagaccgcc aagcaccagg 4440 ccaagtgcaa tatctgcaag gagtgcccca tcatcggctt ccggtacagg agcctgaagc 4500 acttcaacta cgacatctgc cagagctgct ttttcagcgg cagagtggcc aagggccaca 4560 aaatgcacta ccccatggtg gagtactgca cccccaccac ctccggcgag gatgtgagag 4620 acttcgccaa agtgctgaag aataagttcc ggaccaagcg gtactttgcc aagcacccca 4680 ggatgggcta cctgcccgtg cagaccgtgc tggaaggcga caacatggag acctgatgag 4740 gagctcgaga ggcctaataa agagctcaga tgcatcgatc agagtgtgtt ggttttttgt 4800 gtgagatctg aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg 4860 ctcactgagg ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca 4920 gtgagcgagc gagcgcgcag agagggagtg gccaa 4955 SEQ ID DNA sequence of PCR forward primer for mini-dystrophin gene NO: 19 ccaacaaagt gccctactac atc 23 SEQ ID DNA sequence of PCR reverse primer for mini-dystrophin gene NO: 20 ggttgtgctg gtccagggcg t 21 SEQ ID DNA sequence of probe for mini-dystrophin gene NO: 21 ccgagctgta tcagagcctg gcc 23 SEQ ID DNA sequence of PCR forward primer for rat HPRT1 gene NO: 22 gcgaaagtgg aaaagccaag t 21 SEQ ID DNA sequence of PCR reverse primer for rat HPRT1 gene NO: 23 gccacatcaa caggactctt gtag 24 SEQ ID DNA sequence of probe for rat HPRT1 gene NO: 24 caaagcctaa aagacagcgg caagttgaat 30 SEQ ID Amino acid sequence of human muscle dystrophin (Dp427m isoform) NO: 25 MLWWEEVEDC YEREDVQKKT FTKWVNAQFS KFGKQHIENL FSDLQDGRRL LDLLEGLTGQ 60 KLPKEKGSTR VHALNNVNKA LRVLQNNNVD LVNIGSTDIV DGNHKLTLGL IWNIILHWQV 120 KNVMKNIMAG LQQTNSEKIL LSWVRQSTRN YPQVNVINFT TSWSDGLALN ALIHSHRPDL 180 FDWNSVVCQQ SATQRLEHAF NIARYQLGIE KLLDPEDVDT TYPDKKSILM YITSLFQVLP 240 QQVSIEAIQE VEMLPRPPKV TKEEHFQLHH QMHYSQQITV SLAQGYERTS SPKPRFKSYA 300 YTQAAYVTTS DPTRSPFPSQ HLEAPEDKSF GSSLMESEVN LDRYQTALEE VLSWLLSAED 360 TLQAQGEISN DVEVVKDQFH THEGYMMDLT AHQGRVGNIL QLGSKLIGTG KLSEDEETEV 420 QEQMNLLNSR WECLRVASME KQSNLHRVLM DLQNQKLKEL NDWLTKTEER TRKMEEEPLG 480 PDLEDLKRQV QQHKVLQEDL EQEQVRVNSL THMVVVVDES SGDHATAALE EQLKVLGDRW 540 ANICRWTEDR WVLLQDILLK WQRLTEEQCL FSAWLSEKED AVNKIHTTGF KDQNEMLSSL 600 QKLAVLKADL EKKKQSMGKL YSLKQDLLST LKNKSVTQKT EAWLDNFARC WDNLVQKLEK 660 STAQISQAVT TTQPSLTQTT VMETVTTVTT REQILVKHAQ EELPPPPPQK KRQITVDSEI 720 RKRLDVDITE LHSWITRSEA VLQSPEFAIF RKEGNFSDLK EKVNAIEREK AEKFRKLQDA 780 SRSAQALVEQ MVNEGVNADS IKQASEQLNS RWIEFCQLLS ERLNWLEYQN NIIAFYNQLQ 840 QLEQMTTTAE NWLKIQPTTP SEPTAIKSQL KICKDEVNRL SGLQPQIERL KIQSIALKEK 900 GQGPMFLDAD FVAFTNHFKQ VFSDVQAREK ELQTIFDTLP PMRYQETMSA IRTWVQQSET 960 KLSIPQLSVT DYEIMEQRLG ELQALQSSLQ EQQSGLYYLS TTVKEMSKKA PSEISRKYQS 1020 EFEEIEGRWK KLSSQLVEHC QKLEEQMNKL RKIQNHIQTL KKWMAEVDVF LKEEWPALGD 1080 SEILKKQLKQ CRLLVSDIQT IQPSLNSVNE GGQKIKNEAE PEFASRLETE LKELNTQWDH 1140 MCQQVYARKE ALKGGLEKTV SLQKDLSEMH EWMTQAEEEY LERDFEYKTP DELQKAVEEM 1200 KRAKEEAQQK EAKVKLLTES VNSVIAQAPP VAQEALKKEL ETLTTNYQWL CTRLNGKCKT 1260 LEEVWACWHE LLSYLEKANK WLNEVEFKLK TTENIPGGAE EISEVLDSLE NLMRHSEDNP 1320 NQIRILAQTL TDGGVMDELI NEELETFNSR WRELHEEAVR RQKLLEQSIQ SAQETEKSLH 1380 LIQESLTFID KQLAAYIADK VDAAQMPQEA QKIQSDLTSH EISLEEMKKH NQGKEAAQRV 1440 LSQIDVAQKK LQDVSMKFRL FQKPANFEQR LQESKMILDE VKMHLPALET KSVEQEVVQS 1500 QLNHCVNLYK SLSEVKSEVE MVIKTGRQIV QKKQTENPKE LDERVTALKL HYNELGAKVT 1560 ERKQQLEKCL KLSRKMRKEM NVLTEWLAAT DMELTKRSAV EGMPSNLDSE VAWGKATQKE 1620 IEKQKVHLKS ITEVGEALKT VLGKKETLVE DKLSLLNSNW IAVTSRAEEW LNLLLEYQKH 1680 METFDQNVDH ITKWIIQADT LLDESEKKKP QQKEDVLKRL KAELNDIRPK VDSTRDQAAN 1740 LMANRGDHCR KLVEPQISEL NHRFAAISHR IKTGKASIPL KELEQFNSDI QKLLEPLEAE 1800 IQQGVNLKEE DFNKDMNEDN EGTVKELLQR GDNLQQRITD ERKREEIKIK QQLLQTKHNA 1860 LKDLRSQRRK KALEISHQWY QYKRQADDLL KCLDDIEKKL ASLPEPRDER KIKEIDRELQ 1920 KKKEELNAVR RQAEGLSEDG AAMAVEPTQI QLSKRWREIE SKFAQFRRLN FAQIHTVREE 1980 TMMVMTEDMP LEISYVPSTY LTEITHVSQA LLEVEQLLNA PDLCAKDFED LFKQEESLKN 2040 IKDSLQQSSG RIDIIHSKKT AALQSATPVE RVKLQEALSQ LDFQWEKVNK MYKDRQGRFD 2100 RSVEKWRRFH YDIKIFNQWL TEAEQFLRKT QIPENWEHAK YKWYLKELQD GIGQRQTVVR 2160 TLNATGEEII QQSSKTDASI LQEKLGSLNL RWQEVCKQLS DRKKRLEEQK NILSEFQRDL 2220 NEFVLWLEEA DNIASIPLEP GKEQQLKEKL EQVKLLVEEL PLRQGILKQL NETGGPVLVS 2280 APISPEEQDK LENKLKQTNL QWIKVSRALP EKQGEIEAQI KDLGQLEKKL EDLEEQLNHL 2340 LLWLSPIRNQ LEIYNQPNQE GPFDVQETEI AVQAKQPDVE EILSKGQHLY KEKPATQPVK 2400 RKLEDLSSEW KAVNRLLQEL RAKQPDLAPG LTTIGASPTQ TVTLVTQPVV TKETAISKLE 2460 MPSSLMLEVP ALADFNRAWT ELTDWLSLLD QVIKSQRVMV GDLEDINEMI IKQKATMQDL 2520 EQRRPQLEEL ITAAQNLKNK TSNQEARTII TDRIERIQNQ WDEVQEHLQN RRQQLNEMLK 2580 DSTQWLEAKE EAEQVLGQAR AKLESWKEGP YTVDAIQKKI TETKQLAKDL RQWQTNVDVA 2640 NDLALKLLRD YSADDTRKVH MITENINASW RSIHKRVSER EAALEETHRL LQQFPLDLEK 2700 FLAWLTEAET TANVLQDATR KERLLEDSKG VKELMKQWQD LQGEIEAHTD VYHNLDENSQ 2760 KILRSLEGSD DAVLLQRRLD NMNFKWSELR KKSLNIRSHL EASSDQWKRL HLSLQELLVW 2820 LQLKDDELSR QAPIGGDFPA VQKQNDVHRA FKRELKTKEP VIMSTLETVR IFLTEQPLEG 2880 LEKLYQEPRE LPPEERAQNV TRLLRKQAEE VNTEWEKLNL HSADWQRKID ETLERLQELQ 2940 EATDELDLKL RQAEVIKGSW QPVGDLLIDS LQDHLEKVKA LRGEIAPLKE NVSHVNDLAR 3000 QLTTLGIQLS PYNLSTLEDL NTRWKLLQVA VEDRVRQLHE AHRDFGPASQ HFLSTSVQGP 3060 WERAISPNKV PYYINHETQT TCWDHPKMTE LYQSLADLNN VRFSAYRTAM KLRRLQKALC 3120 LDLLSLSAAC DALDQHNLKQ NDQPMDILQI INCLTTIYDR LEQEHNNLVN VPLCVDMCLN 3180 WLLNVYDTGR TGRIRVLSFK TGIISLCKAH LEDKYRYLFK QVASSTGFCD QRRLGLLLHD 3240 SIQIPRQLGE VASFGGSNIE PSVRSCFQFA NNKPEIEAAL FLDWMRLEPQ SMVWLPVLHR 3300 VAAAETAKHQ AKCNICKECP IIGFRYRSLK HFNYDICQSC FFSGRVAKGH KMHYPMVEYC 3360 TPTTSGEDVR DFAKVLKNKF RTKRYFAKHP RMGYLPVQTV LEGDNMETPV TLINFWPVDS 3420 APASSPQLSH DDTHSRIEHY ASRLAEMENS NGSYLNDSIS PNESIDDEHL LIQHYCQSLN 3480 QDSPLSQPRS PAQILISLES EERGELERIL ADLEEENRNL QAEYDRLKQQ HEHKGLSPLP 3540 SPPEMMPTSP QSPRDAELIA EAKLLRQHKG RLEARMQILE DHNKQLESQL HRLRQLLEQP 3600 QAEAKVNGTT VSSPSTSLQR SDSSQPMLLR VVGSQTSDSM GEEDLLSPPQ DTSTGLEEVM 3660 EQLNNSFPSS RGRNTPGKPM REDTM 3685 SEQ ID DNA sequence of non-codon-optimized gene encoding human mini- NO: 26 dystrophin Dys3987 atgctttggt gggaagaagt agaggactgt tatgaaagag aagatgttca aaagaaaaca 60 ttcacaaaat gggtaaatgc acaattttct aagtttggga agcagcatat tgagaacctc 120 ttcagtgacc tacaggatgg gaggcgcctc ctagacctcc tcgaaggcct gacagggcaa 180 aaactgccaa aagaaaaagg atccacaaga gttcatgccc tgaacaatgt caacaaggca 240 ctgcgggttt tgcagaacaa taatgttgat ttagtgaata ttggaagtac tgacatcgta 300 gatggaaatc ataaactgac tcttggtttg atttggaata taatcctcca ctggcaggtc 360 aaaaatgtaa tgaaaaatat catggctgga ttgcaacaaa ccaacagtga aaagattctc 420 ctgagctggg tccgacaatc aactcgtaat tatccacagg ttaatgtaat caacttcacc 480 accagctggt ctgatggcct ggctttgaat gctctcatcc atagtcatag gccagaccta 540 tttgactgga atagtgtggt ttgccagcag tcagccacac aacgactgga acatgcattc 600 aacatcgcca gatatcaatt aggcatagag aaactactcg atcctgaaga tgttgatacc 660 acctatccag ataagaagtc catcttaatg tacatcacat cactcttcca agttttgcct 720 caacaagtga gcattgaagc catccaggaa gtggaaatgt tgccaaggcc acctaaagtg 780 actaaagaag aacattttca gttacatcat caaatgcact attctcaaca gatcacggtc 840 agtctagcac agggatatga gagaacttct tcccctaagc ctcgattcaa gagctatgcc 900 tacacacagg ctgcttatgt caccacctct gaccctacac ggagcccatt tccttcacag 960 catttggaag ctcctgaaga caagtcattt ggcagttcat tgatggagag tgaagtaaac 1020 ctggaccgtt atcaaacagc tttagaagaa gtattatcgt ggcttctttc tgctgaggac 1080 acattgcaag cacaaggaga gatttctaat gatgtggaag tggtgaaaga ccagtttcat 1140 actcatgagg ggtacatgat ggatttgaca gcccatcagg gccgggttgg taatattcta 1200 caattgggaa gtaagctgat tggaacagga aaattatcag aagatgaaga aactgaagta 1260 caagagcaga tgaatctcct aaattcaaga tgggaatgcc tcagggtagc tagcatggaa 1320 aaacaaagca atttacatag agttttaatg gatctccaga atcagaaact gaaagagttg 1380 aatgactggc taacaaaaac agaagaaaga acaaggaaaa tggaggaaga gcctcttgga 1440 cctgatcttg aagacctaaa acgccaagta caacaacata aggtgcttca agaagatcta 1500 gaacaagaac aagtcagggt caattctctc actcacatgg tggtggtagt tgatgaatct 1560 agtggagatc acgcaactgc tgctttggaa gaacaactta aggtattggg agatcgatgg 1620 gcaaacatct gtagatggac agaagaccgc tgggttcttt tacaagacca gcctgaccta 1680 gctcctggac tgaccactat tggagcctct cctactcaga ctgttactct ggtgacacaa 1740 cctgtggtta ctaaggaaac tgccatctcc aaactagaaa tgccatcttc cttgatgttg 1800 gaggtaccta ctcatagatt actgcaacag ttccccctgg acctggaaaa gtttcttgcc 1860 tggcttacag aagctgaaac aactgccaat gtcctacagg atgctacccg taaggaaagg 1920 ctcctagaag actccaaggg agtaaaagag ctgatgaaac aatggcaaga cctccaaggt 1980 gaaattgaag ctcacacaga tgtttatcac aacctggatg aaaacagcca aaaaatcctg 2040 agatccctgg aaggttccga tgatgcagtc ctgttacaaa gacgtttgga taacatgaac 2100 ttcaagtgga gtgaacttcg gaaaaagtct ctcaacatta ggtcccattt ggaagccagt 2160 tctgaccagt ggaagcgtct gcacctttct ctgcaggaac ttctggtgtg gctacagctg 2220 aaagatgatg aattaagccg gcaggcacct attggaggcg actttccagc agttcagaag 2280 cagaacgatg tacatagggc cttcaagagg gaattgaaaa ctaaagaacc tgtaatcatg 2340 agtactcttg agactgtacg aatatttctg acagagcagc ctttggaagg actagagaaa 2400 ctctaccagg agcccagaga gctgcctcct gaggagagag cccagaatgt cactcggctt 2460 ctacgaaagc aggctgagga ggtcaatact gagtgggaaa aattgaacct gcactccgct 2520 gactggcaga gaaaaataga tgagaccctt gaaagactcc aggaacttca agaggccacg 2580 gatgagctgg acctcaagct gcgccaagct gaggtgatca agggatcctg gcagcccgtg 2640 ggcgatctcc tcattgactc tctccaagat cacctcgaga aagtcaaggc acttcgagga 2700 gaaattgcgc ctctgaaaga gaacgtgagc cacgtcaatg accttgctcg ccagcttacc 2760 actttgggca ttcagctctc accgtataac ctcagcactc tggaagacct gaacaccaga 2820 tggaagcttc tgcaggtggc cgtcgaggac cgagtcaggc agctgcatga agcccacagg 2880 gactttggtc cagcatctca gcactttctt tccacgtctg tccagggtcc ctgggagaga 2940 gccatctcgc caaacaaagt gccctactat atcaaccacg agactcaaac aacttgctgg 3000 gaccatccca aaatgacaga gctctaccag tctttagctg acctgaataa tgtcagattc 3060 tcagcttata ggactgccat gaaactccga agactgcaga aggccctttg cttggatctc 3120 ttgagcctgt cagctgcatg tgatgccttg gaccagcaca acctcaagca aaatgaccag 3183 cccatggata tcctgcagat tattaattgt ttgaccacta tttatgaccg cctggagcaa 2400 gagcacaaca atttggtcaa cgtccctctc tgcgtggata tgtgtctgaa ctggctgctg 3300 aatgtttatg atacgggacg aacagggagg atccgtgtcc tgtcttttaa aactggcatc 3360 atttccctgt gtaaagcaca tttggaagac aagtacagat accttttcaa gcaagtggca 3420 agttcaacag gattttgtga ccagcgcagg ctgggcctcc ttctgcatga ttctatccaa 3480 attccaagac agttgggtga agttgcatcc tttgggggca gtaacattga gccaagtgtc 3540 cggagctgct tccaatttgc taataataag ccagagatcg aagcggccct cttcctagac 3600 tggatgagac tggaacccca gtccatggtg tggctgcccg tcctgcacag agtggctgct 3660 gcagaaactg ccaagcatca ggccaaatgt aacatctgca aagagtgtcc aatcattgga 3720 ttcaggtaca ggagtctaaa gcactttaat tatgacatct gccaaagctg ctttttttct 3780 ggtcgagttg caaaaggcca taaaatgcac tatcccatgg tggaatattg cactccgact 3840 acatcaggag aagatgttcg agactttgcc aaggtactaa aaaacaaatt tcgaaccaaa 3900 aggtattttg cgaagcatcc ccgaatgggc tacctgccag tgcagactgt cttagagggg 3960 gacaacatgg aaacttag 3978 SEQ ID Amino acid sequence of human mini-dystrophin protein Δ3990 NO: 27 MVWWEEVEDC YEREDVQKKT FTKWVNAQFS KFGKQHIENL FSDLQDGRRL LDLLEGLTGQ 60 KLPKEKGSTR VHALNNVNKA LRVLQNNNVD LVNIGSTDIV DGNHKLTLGL IWNIILHWQV 120 KNVMKNIMAG LQQTNSEKIL LSWVRQSTRN YPQVNVINFT TSWSDGLALN ALIHSHRPDL 180 FDWNSVVCQQ SATQRLEHAF NIARYQLGIE KLLDPEDVDT TYPDKKSILM YITSLFQVLP 240 QQVSIEAIQE VEMLPRPPKV TKEEHFQLHH QMHYSQQITV SLAQGYERTS SPKPRFKSYA 300 YTQAAYVTTS DPTRSPFPSQ HLEAPEDKSF GSSLMESEVN LDRYQTALEE VLSWLLSAED 360 TLQAQGEISN DVEVVKDQFH THEGYMMDLT AHQGRVGNIL QLGSKLIGTG KLSEDEETEV 420 QEQMNLLNSR WECLRVASME KQSNLHRVLM DLQNQKLKEL NDWLTKTEER TRKMEEEPLG 480 PDLEDLKRQV QQHKVLQEDL EQEQVRVNSL THMVVVVDES SGDHATAALE EQLKVLGDRW 540 ANICRWTEDR WVLLQDQPDL APGLTTIGAS PTQTVTLVTQ PVVTKETAIS KLEMPSSLML 600 EVPTHRLLQQ FPLDLEKFLA WLTEAETTAN VLQDATRKER LLEDSKGVKE LMKQWQDLQG 660 EIEAHTDVYH NLDENSQKIL RSLEGSDDAV LLQRRLDNMN FKWSELRKKS LNIRSHLEAS 720 SDQWKRLHLS LQELLVWLQL KDDELSRQAP IGGDFPAVQK QNDVHRAFKR ELKTKEPVIM 780 STLETVRIFL TEQPLEGLEK LYQEPRELPP EERAQNVTRL LRKQAEEVNT EWEKLNLHSA 840 DWQRKIDETL ERLQELQEAT DELDLKLRQA EVIKGSWQPV GDLLIDSLQD HLEKVKALRG 900 EIAPLKENVS HVNDLARQLT TLGIQLSPYN LSTLEDLNTR WKLLQVAVED RVRQLHEAHR 960 DFGPASQHFL STSVQGPWER AISPNKVPYY INHETQTTCW DHPKMTELYQ SLADLNNVRF 1020 SAYRTAMKLR RLQKALCLDL LSLSAACDAL DQHNLKQNDQ PMDILQIINC LTTIYDRLEQ 1080 EHNNLVNVPL CVDMCLNWLL NVYDTGRTGR IRVLSFKTGI ISLCKAHLED KYRYLFKQVA 1140 SSTGFCDQRR LGLLLHDSIQ IPRQLGEVAS FGGSNIEPSV RSCFQFANNK PEIEAALFLD 1200 WMRLEPQSMV WLPVLHRVAA AETAKHQAKC NICKECPIIG FRYRSLKHFN YDICQSCFFS 1260 GRVAKGHKMH YPMVEYCTPT TSGEDVRDFA KVLKNKFRTK RYFAKHPRMG YLPVQTVLEG 1320 DNMETPDTM 1329 SEQ ID DNA sequence of human mini-dystrophin gene Δ3990 NO: 28 atggtttggt ggaagaagt agaggactgt tatgaaagag aagatgttca aaagaaaaca 60 ttcacaaaat gggtaaatgc acaattttct aagtttggga agcagcatat tgagaacctc 120 ttcagtgacc tacaggatgg gaggcgcctc ctagacctcc tcgaaggcct gacagggcaa 180 aaactgccaa aagaaaaagg atccacaaga gttcatgccc tgaacaatgt caacaaggca 240 ctgcgggttt tgcagaacaa taatgttgat ttagtgaata ttggaagtac tgacatcgta 300 gatggaaatc ataaactgac tcttggtttg atttggaata taatcctcca ctggcaggtc 360 aaaaatgtaa tgaaaaatat catggctgga ttgcaacaaa ccaacagtga aaagattctc 420 ctgagctggg tccgacaatc aactcgtaat tatccacagg ttaatgtaat caacttcacc 480 accagctggt ctgatggcct ggctttgaat gctctcatcc atagtcatag gccagaccta 540 tttgactgga atagtgtggt ttgccagcag tcagccacac aacgactgga acatgcattc 600 aacatcgcca gatatcaatt aggcatagag aaactactcg atcctgaaga tgttgatacc 660 acctatccag ataagaagtc catcttaatg tacatcacat cactcttcca agttttgcct 720 caacaagtga gcattgaagc catccaggaa gtggaaatgt tgccaaggcc acctaaagtg 780 actaaagaag aacattttca gttacatcat caaatgcact attctcaaca gatcacggtc 840 agtctagcac agggatatga gagaacttct tcccctaagc ctcgattcaa gagctatgcc 900 tacacacagg ctgcttatgt caccacctct gaccctacac ggagcccatt tccttcacag 960 catttggaag ctcctgaaga caagtcattt ggcagttcat tgatggagag tgaagtaaac 1020 ctggaccgtt atcaaacagc tttagaagaa gtattatcgt ggcttctttc tgctgaggac 1080 acattgcaag cacaaggaga gatttctaat gatgtggaag tggtgaaaga ccagtttcat 1140 actcatgagg ggtacatgat ggatttgaca gcccatcagg gccgggttgg taatattcta 1200 caattgggaa gtaagctgat tggaacagga aaattatcag aagatgaaga aactgaagta 1260 caagagcaga tgaatctcct aaattcaaga tgggaatgcc tcagggtagc tagcatggaa 1320 aaacaaagca atttacatag agttttaatg gatctccaga atcagaaact gaaagagttg 1380 aatgactggc taacaaaaac agaagaaaga acaaggaaaa tggaggaaga gcctcttgga 1440 cctgatcttg aagacctaaa acgccaagta caacaacata aggtgcttca agaagatcta 1500 gaacaagaac aagtcagggt caattctctc actcacatgg tggtggtagt tgatgaatct 1560 agtggagatc acgcaactgc tgctttggaa gaacaactta aggtattggg agatcgatgg 1620 gcaaacatct gtagatggac agaagaccgc tgggttcttt tacaagacca gcctgaccta 1680 gctcctggac tgaccactat tggagcctct cctactcaga ctgttactct ggtgacacaa 1740 cctgtggtta ctaaggaaac tgccatctcc aaactagaaa tgccatcttc cttgatgttg 1800 gaggtaccta ctcatagatt actgcaacag ttccccctgg acctggaaaa gtttcttgcc 1860 tggcttacag aagctgaaac aactgccaat gtcctacagg atgctacccg taaggaaagg 1920 ctcctagaag actccaaggg agtaaaagag ctgatgaaac aatggcaaga cctccaaggt 1980 gaaattgaag ctcacacaga tgtttatcac aacctggatg aaaacagcca aaaaatcctg 2040 agatccctgg aaggttccga tgatgcagtc ctgttacaaa gacgtttgga taacatgaac 2100 ttcaagtgga gtgaacttcg gaaaaagtct ctcaacatta ggtcccattt ggaagccagt 2160 tctgaccagt ggaagcgtct gcacctttct ctgcaggaac ttctggtgtg gctacagctg 2220 aaagatgatg aattaagccg gcaggcacct attggaggcg actttccagc agttcagaag 2280 cagaacgatg tacatagggc cttcaagagg gaattgaaaa ctaaagaacc tgtaatcatg 2340 agtactcttg agactgtacg aatatttctg acagagcagc ctttggaagg actagagaaa 2400 ctctaccagg agcccagaga gctgcctcct gaggagagag cccagaatgt cactcggctt 2460 ctacgaaagc aggctgagga ggtcaatact gagtgggaaa aattgaacct gcactccgct 2520 gactggcaga gaaaaataga tgagaccctt gaaagactcc aggaacttca agaggccacg 2580 gatgagctgg acctcaagct gcgccaagct gaggtgatca agggatcctg gcagcccgtg 2640 ggcgatctcc tcattgactc tctccaagat cacctcgaga aagtcaaggc acttcgagga 2700 gaaattgcgc ctctgaaaga gaacgtgagc cacgtcaatg accttgctcg ccagcttacc 2760 actttgggca ttcagctctc accgtataac ctcagcactc tggaagacct gaacaccaga 2820 tggaagcttc tgcaggtggc cgtcgaggac cgagtcaggc agctgcatga agcccacagg 2880 gactttggtc cagcatctca gcactttctt tccacgtctg tccagggtcc ctgggagaga 2940 gccatctcgc caaacaaagt gccctactat atcaaccacg agactcaaac aacttgctgg 3000 gaccatccca aaatgacaga gctctaccag tctttagctg acctgaataa tgtcagattc 3060 tcagcttata ggactgccat gaaactccga agactgcaga aggccctttg cttggatctc 3120 ttgagcctgt cagctgcatg tgatgccttg gaccagcaca acctcaagca aaatgaccag 3180 cccatggata tcctgcagat tattaattgt ttgaccacta tttatgaccg cctggagcaa 3240 gagcacaaca atttggtcaa cgtccctctc tgcgtggata tgtgtctgaa ctggctgctg 3300 aatgtttatg atacgggacg aacagggagg atccgtgtcc tgtcttttaa aactggcatc 3360 atttccctgt gtaaagcaca tttggaagac aagtacagat accttttcaa gcaagtggca 3420 agttcaacag gattttgtga ccagcgcagg ctgggcctcc ttctgcatga ttctatccaa 3480 attccaagac agttgggtga agttgcatcc tttgggggca gtaacattga gccaagtgtc 3540 cggagctgct tccaatttgc taataataag ccagagatcg aagcggccct cttcctagac 3600 tggatgagac tggaacccca gtccatggtg tggctgcccg tcctgcacag agtggctgct 3660 gcagaaactg ccaagcatca ggccaaatgt aacatctgca aagagtgtcc aatcattgga 3720 ttcaggtaca ggagtctaaa gcactttaat tatgacatct gccaaagctg ctttttttct 3780 ggtcgagttg caaaaggcca taaaatgcac tatcccatgg tggaatattg cactccgact 3840 acatcaggag aagatgttcg agactttgcc aaggtactaa aaaacaaatt tcgaaccaaa 3900 aggtattttg cgaagcatcc ccgaatgggc tacctgccag tgcagactgt cttagagggg 3960 gacaacatgg aaactcccga cacaatgtag 3990 SEQ ID Antisense (-) strand of DNA sequence of human codon-optimized gene encoding NO: 29 human mini-dystrophin 3978 (Hopti-Dys3978) tcaggtctccatgttgtcgccttccagcacggtctgcacgggcaggtagcccatcctggg gtgcttggcaaagtaccgcttggtccggaacttattcttcagcactttggcgaagtctct cacatcctcgccggaggtggtgggggtgcagtactccaccatggggtagtgcattttgtg gcccttggccactctgccgctgaaaaagcagctctggcagatgtcgtagttgaagtgctt caggctcctgtaccggaagccgatgatggggcactccttgcagatattgcacttggcctg gtgcttggcggtctcggcggcggccactctgtgcagcacaggcagccacaccatgctctg aggctccagcctcatccagtccaggaacagggcggcctcgatctcgggcttgttgttggc gaactggaagcagctcctcacagagggctcgatgttgctgccgccaaagctggccacttc gcccagctgcctagggatctggatgctatcgtgcagcagcaggcccagtctcctctgatc gcagaagccggtgctgctggccacctgcttgaacaggtagcggtacttatcctccaggtg ggccttgcacaggctgatgatgccggtcttgaagctcagcacgcggattctgccggtcct gccggtgtcgtacacgttcagcagccaattcaggcacatgtccacgcacaggggcacatt caccaggttgttgtgctcctgttccagccggtcgtagattgtggtcaggcagttgatgat ctgcaggatgtccatgggctggtcattctgcttcaggttgtgctggtccagggcgtcgca ggcggcgctcaggctcagcagatccaggcacagggccttctgcagtctccgcagcttcat ggcggttctgtaggcgctgaaccgcacattgttcaggtcggccaggctctgatacagctc ggtcatcttagggtggtcccagcaggtggtctgggtctcgtggttgatgtagtagggcac tttgttgggggagatggctctctcccaggggccctgcacgctggtgctcaggaagtgctg ggaggcagggccgaagtctctgtgggcttcgtgcagctgcctcactctatcctccacggc cacctgcagcagtttccaccgggtgttcagatcctccagtgtgctcaggttgtaggggct cagctggatgcccagggtggtcagetgtctggccaggtcgttcacgtggctcacattetc cttcaggggggcgatctcgccccgcagggccttcactttctccaggtgatcctgcaggga gtcgatcagcagatcgcccacaggctgccagctgcccttgatcacttcggcctgtctcag cttcaggtccagctcgtcggtggcttcctgcagttcctggagtctctccagggtctcgtc gatctttctctgccagtcggcgctgtgcagattcagcttctcccactcggtattcacttc ctcggcctgctttctcagcagcctggtcacgttctgggctctctcctcggggggcagctc tctgggctcctggtacagcttctccagtccctccaggggctgctcggtcaggaagatccg cactgtctccagggtgctcatgatcacgggttccttggttttcagctccctcttgaaggc ccggtgcacgtcgttctgcttctgcacggcggggaagtcgccgccgatgggggcctgtct getcagetcgtcgtccttcagctgcagccacaccagcagctcctgcaggctcaggtgcag tctcttccactggtcgctgctggcttccaggtggctccggatgttcaggctcttcttccg cagctcgctccacttgaagttcatgttgtccagcctcctctggagcaggacggcgtcgtc gctgccctccaggctcctcagaatcttctggctgttctcgtccaggttgtggtacacgtc ggtgtgggcctcgatttcgccctgcagatcctgccactgctteatcagetctttcacgcc cttgctgtcctccagcagcctctcctttctagtggcgtcctggagcacattggcggtggt ttcggcctcggtcagccaggccaggaacttctccaggtccagggggaactgctggagcag gcggtgggtgggcacttccagcatcagggagctgggcatctccagcttgctgatggcggt ctcctttgtcaccacgggctgggtcaccagggtcacggtctgggtggggctggcgccgat ggtggtcaggccaggggccaggtcgggctggtcctgcagcagcacccatctgtcctcggt ccacctacaaatattggcccatctgtcgcccagcactttcagctgctcttccagggcggc tgtggcgtggtcgccgctgctctcgtccacgaccaccaccatgtgggtcaggctgttcac gcgcacctgctcctgctccaggtcctcctgcagcactttgtgctgctgcacctgtctctt caggtcctccaggtcggggcccaggggctcctcctccatctttctggtccgctcctcggt cttggtcagccagtcgttcagctccttcagcttctggttctgcaggtccatcagcactct gtgcaggttgctctgcttctccatgctggccactctcaggcactcccatctgctgttcag caggttcatctgctcctgcacttcggtctcctcgtcctcgctcagcttgccggtgccgat cagcttgctgcccagctgcaggatattgcccactctgccctggtgggcggtcagatccat catgtagccctcgtgggtgtggaactggtccttcaccacttccacgtcgttgctgatctc gccctgggcctgcagggtgtcctcggcgctcagcagccaggacagcacttcctccagggc ggtctggtatctgtccaggttcacttcgctctccatcaggctgctgccgaagctcttgtc ctcgggggcctccaggtgctggctggggaaggggcttctggtggggtcggaggtggtcac gtaggcggcctgggtgtaggcgtagctcttgaatctgggcttggggctgctggttctctc atagccctgggccaggctcactgtgatctgctggctgtagtgcatctggtggtgcagctg gaagtgctcctccttggtcactttggggggcctgggcagcatttccacttcctggatggc ctcgatggacacctgctggggcagcacctggaacaggctggtaatgtacatgaggatgct tttcttgtcggggtaggtggtgtccacgtcctcggggtccagcagcttctcgatgcccag ctggtatctggcgatgttgaaggcgtgctccagtctctgggtggcgctctgctgacacac cacgctgttccagtcgaacaggtcgggtctgtggctgtggatcagggcgttcagggccag gccgtcgctccaggaggtggtgaagttgatcacgttcacctgggggtagtttctggtgct ctgcctcacccagctcagcaggatcttctcgctgttggtctgctgcaggccggccatgat gttcttcatcacgttcttcacctgccagtgcaggatgatgttccagatcaggcccagggt cagcttgtggttgccgtccacgatgtcggtgctgccgatgttcaccaggtccacgttgtt gttctgcagcactctcagggccttgttcacgttgttcagggcgtgcactctggtgctgcc cttctccttgggcagcttctggccggtcaggccctccagcaggtccagcagtctcctgcc atcctgcaggtcgctgaacaggttctcgatgtgctgcttgccgaacttgctgaactgggc gttcacccacttggtgaaggttttcttctgcacgtcctctctctcgtagcagtcctccac ttcctcccaccaaagcat
TABLE-US-00017 TABLE 14 Primer-Probe Set No. Forward Primer Probe Reverse Primer 1 15 F 77 P 132 R 2 38 F 82 P 126 R 3 42 F 77 P 131 R 4 98 F 156 P 275 R 5 113 F 156 P 241 R 6 178 F 205 P 259 R 7 240 F 283 P 356 R 8 256 F 384 P 430 R 9 333 F 382 P 422 R 10 397 F 431 P 488 R 11 398 F 431 P 487 R 12 400 F 420 P 489 R 13 739 F 773 P 836 R 14 740 F 773 P 837 R 15 805 F 828 P 894 R 16 805 F 850 P 903 R 17 1009 F 1072 P 1118 R 18 1010 F 1072 P 1121 R 19 1042 F 1072 P 1127 R 20 1102 F 1128 P 1173 R 21 1112 F 1221 P 1273 R 22 1112 F 1157 P 1201 R 23 1143 F 1221 P 1307 R 24 1177 F 1221 P 1335 R 25 1288 F 1311 P 1370 R 26 1316 F 1341 P 1399 R 27 1345 F 1387 P 1434 R 28 1351 F 1387 P 1475 R 29 1370 F 1407 P 1476 R 30 1406 F 1437 P 1495 R 31 1408 F 1437 P 1497 R 32 1585 F 1607 P 1645 R 33 1609 F 1688 P 1769 R 34 1750 F 1804 P 1929 R 35 1838 F 1868 P 1927 R 36 1910 F 1934 P 1986 R 37 1955 F 1985 P 2028 R 38 2116 F 2138 P 2237 R 39 2218 F 2285 P 2379 R 40 2319 F 2367 P 2408 R 41 2349 F 2399 P 2453 R 42 2434 F 2504 P 2573 R 43 2450 F 2504 P 2552 R 44 2470 F 2492 P 2549 R 45 2483 F 2492 P 2547 R 46 2485 F 2525 P 2574 R 47 2533 F 2574 P 2623 R 48 2601 F 2623 P 2690 R 49 2602 F 2623 P 2691 R 50 2604 F 2624 P 2736 R 51 2652 F 2673 P 2737 R 52 2720 F 2746 P 2809 R 53 2721 F 2746 P 2805 R 54 2721 F 2746 P 2810 R 55 2776 F 2825 P 2865 R 56 2786 F 2828 P 2868 R 57 2950 F 2970 P 3028 R 58 2955 F 2972 P 3027 R 59 2970 F 3016 P 3059 R 60 2971 F 3017 P 3060 R 61 2972 F 3017 P 3061 R 62 3041 F 3086 P 3130 R 63 3148 F 3178 P 3238 R 64 3149 F 3178 P 3237 R 65 3166 F 3208 P 3255 R 66 3206 F 3237 P 3306 R 67 3218 F 3238 P 3304 R 68 3218 F 3264 P 3307 R 69 3220 F 3264 P 3309 R 70 3273 F 3302 P 3362 R 71 3285 F 3324 P 3375 R 72 3286 F 3324 P 3375 R 73 3462 F 3515 P 3557 R 74 3538 F 3570 P 3610 R 75 3587 F 3658 P 3748 R 76 3677 F 3709 P 3765 R 77 3729 F 3749 P 3880 R 78 3755 F 3845 P 3915 R
TABLE-US-00018 TABLE 15 SEQ ID Name Sequence (5′ to 3′) NO 15 F GGAAGTGGAGGACTGCTACG 30 38 F GAGAGGACGTGCAGAAGAAA 31 42 F GGACGTGCAGAAGAAAACCT 32 77 P ACGCCCAGTTCAGCAAGTTCGGC 33 82 P CAGTTCAGCAAGTTCGGCAAGCAG 34 98 F GCAAGCAGCACATCGAGAAC 35 113 F AGAACCTGTTCAGCGACCTG 36 126 R GCTGAACAGGTTCTCGATGT 37 131 R AGGTCGCTGAACAGGTTCTC 38 132 R CAGGTCGCTGAACAGGTTCT 39 156 P CCTGCTGGAGGGCCTGACCGG 40 178 F CAGAAGCTGCCCAAGGAGAA 41 205 P ACCAGAGTGCACGCCCTGAACA 42 240 F CCTGAGAGTGCTGCAGAACA 43 241 R GGGCCTTGTTCACGTTGTTC 44 256 F AACAACAACGTGGACCTGGT 45 259 R TGTTCTGCAGCACTCTCAGG 46 275 R ACCAGGTCCACGTTGTTGTT 47 283 P GGCAGCACCGACATCGTGGACGG 48 333 F CTGGAACATCATCCTGCACTG 49 356 R TGCCAGTGCAGGATGATGTT 50 382 P ATGGCCGGCCTGCAGCAGAC 51 384 P GGCCGGCCTGCAGCAGACCA 52 397 F CAGACCAACAGCGAGAAGAT 53 398 F AGACCAACAGCGAGAAGA 54 400 F ACCAACAGCGAGAAGATCCT 55 420 P GCTGAGCTGGGTGAGGCAGAGCA 56 422 R AGCAGGATCTTCTCGCTGTT 57 430 R CCCAGCTCAGCAGGATCTTC 58 431 P TGAGGCAGAGCACCAGAAACTACC 59 487 R AGGAGGTGGTGAAGTTGAT 60 488 R CAGGAGGTGGTGAAGTTGAT 61 489 R CCAGGAGGTGGTGAAGTTGA 62 739 F GCCATCCAGGAAGTGGAAAT 63 740 F CCATCCAGGAAGTGGAAATG 64 773 P CCAAAGTGACCAAGGAGGAGCACT 65 805 F CACCACCAGATGCACTACAG 66 805 F CACCACCAGATGCACTACAG 67 828 P GCAGATCACAGTGAGCCTGGCCCA 68 836 R GTGATCTGCTGGCTGTAGTG 69 837 R TGTGATCTGCTGGCTGTA 70 850 P CAGGGCTATGAGAGAACCAGCAGC 71 894 R GCTCTTGAATCTGGGCTTGG 72 903 R GTAGGCGTAGCTCTTGAATCTG 73 1009 F AGCGAAGTGAACCTGGACAG 74 1010 F GCGAAGTGAACCTGGACAGA 75 1042 F CTGGAGGAAGTGCTGTCCTG 76 1072 P GCCGAGGACACCCTGCAGGCC 77 1102 F ATCAGCAACGACGTGGAAGT 78 1112 F ACGTGGAAGTGGTGAAGGAC 79 1118 R TCCACGTCGTTGCTGATCTC 80 1121 R ACTTCCACGTCGTTGCTGAT 81 1127 R TTCACCACTTCCACGTCGTT 82 1128 P GGACCAGTTCCACACCCACGAGG 83 1143 F CCACGAGGGCTACATGATGG 84 1157 P TGATGGATCTGACCGCCCACCAGG 85 1173 R GGCGGTCAGATCCATCATGT 86 1177 F CAGGGCAGAGTGGGCAATAT 87 1201 R GCAGGATATTGCCCACTCTG 88 1221 P CGGCACCGGCAAGCTGAGCG 89 1273 R TCATCTGCTCCTGCACTTCG 90 1288 F AGATGGGAGTGCCTGAGAGT 91 1307 R ACTCTCAGGCACTCCCATCT 92 1311 P CAGCATGGAGAAGCAGAGCAACCTG 93 1316 F TGGAGAAGCAGAGCAACCTG 94 1335 R CAGGTTGCTCTGCTTCTCCA 95 1341 P AGTGCTGATGGACCTGCAGAACCA 96 1345 F CTGATGGACCTGCAGAACCA 97 1351 F GACCTGCAGAACCAGAAGCT 98 1370 F TGAAGGAGCTGAACGACTGG 99 1370 R AGCTTCTGGTTCTGCAGGTC 100 1387 P TGGCTGACCAAGACCGAGGAGCG 101 1399 R TCTTGGTCAGCCAGTCGTTC 102 1406 F AGCGGACCAGAAAGATGGAG 103 1407 P GCGGACCAGAAAGATGGAGGAGGAGCC 104 1408 F CGGACCAGAAAGATGGAGGA 105 1434 R GGGCTCCTCCTCCATCTTTC 106 1437 P GGGCCCCGACCTGGAGGACC 107 1475 R TGCTGCACCTGTCTCTTCAG 108 1476 R CTGCTGCACCTGTCTCTTCA 109 1495 R CCTCCTGCAGCACTTTGTG 110 1497 R GTCCTCCTGCAGCACTTTG 111 1585 F CTGGAAGAGCAGCTGAAAG 112 1607 P TGGGCGACAGATGGGCCAATATTT 113 1609 F GGCGACAGATGGGCCAATAT 114 1645 R CCTCGGTCCACCTACAAATA 115 1688 P GCCTGACCACCATCGGCGCCA 116 1750 F ACAAAGGAGACCGCCATCAG 117 1769 R CTGATGGCGGTCTCCTTTGT 118 1804 P GTGCCCACCCACCGCCTGCT 119 1838 F TGGACCTGGAGAAGTTCCTG 120 1868 P CCGAGGCCGAAACCACCGCC 121 1910 F GAAAGGAGAGGCTGCTGGAG 122 1927 R CCAGCAGCCTCTCCTTTCTA 123 1929 R CTCCAGCAGCCTCTCCTTTC 124 1934 P GCAAGGGCGTGAAAGAGCTGATGAAG 125 1955 F TGAAGCAGTGGCAGGATCTG 126 1985 P TCGAGGCCCACACCGACGTG 127 1986 R GATTTCGCCCTGCAGATCCT 128 2028 R GCTGTTCTCGTCCAGGTTGT 129 2116 F CTGCGGAAGAAGAGCCTGAA 130 2138 P TCCGGAGCCACCTGGAAGCCA 131 2218 F CTGAAGGACGACGAGCTGAG 132 2237 R CTCAGCTCGTCGTCCTTCAG 133 2285 P ACGACGTGCACCGGGCCTTCA 134 2319 F AACCAAGGAACCCGTGATCA 135 2349 F GGAGACAGTGCGGATCTTCC 136 2367 P CCTGACCGAGCAGCCCCTGGA 137 2379 R CTGCTCGGTCAGGAAGATCC 138 2399 P AGCTGTACCAGGAGCCCAGAGAGCT 139 2408 R TGGTACAGCTTCTCCAGTCC 140 2434 F GAGAGAGCCCAGAACGTGAC 141 2450 F TGACCAGGCTGCTGAGAAAG 142 2453 R GTCACGTTCTGGGCTCTCTC 143 2470 F CAGGCCGAGGAAGTGAATAC 144 2483 F TGAATACCGAGTGGGAGAAG 145 2485 F AATACCGAGTGGGAGAAGCT 146 2492 P AGTGGGAGAAGCTGAATCTGCACA 147 2504 P TGAATCTGCACAGCGCCGACTGG 148 2525 P GGCAGAGAAAGATCGACGAGACCCTGG 149 2533 F AAGATCGACGAGACCCTGGA 150 2547 R GGTCTCGTCGATCTTTCTCT 151 2549 R AGGGTCTCGTCGATCTTTCT 152 2552 R TCCAGGGTCTCGTCGATCTT 153 2573 R TCCTGCAGTTCCTGGAGTCT 154 2574 P AGCCACCGACGAGCTGGACCT 155 2574 R TTCCTGCAGTTCCTGGAGTC 156 2601 F GAGACAGGCCGAAGTGATCA 157 2602 F AGACAGGCCGAAGTGATCAA 158 2604 F ACAGGCCGAAGTGATCAAGG 159 2623 P GGCAGCTGGCAGCCTGTGGG 160 2623 R CCTTGATCACTTCGGCCTGT 161 2624 P GCAGCTGGCAGCCTGTGGG 162 2652 F GATCGACTCCCTGCAGGATC 163 2673 P CCTGGAGAAAGTGAAGGCCCTGCGG 164 2690 R GCCTTCACTTTCTCCAGGTG 165 2691 R GGCCTTCACTTTCTCCAGGT 166 2720 F AGAATGTGAGCCACGTGAAC 167 2721 F GAATGTGAGCCACGTGAACG 168 2736 R CACGTGGCTCACATTCTCCT 169 2737 R TCACGTGGCTCACATTCTCC 170 2746 P GCCAGACAGCTGACCACCCTGGG 171 2776 F CTGAGCCCCTACAACCTGAG 172 2786 F ACAACCTGAGCACACTGGAG 173 2805 R CTCCAGTGTGCTCAGGTTGT 174 2809 R GATCCTCCAGTGTGCTCAGG 175 2810 R AGATCCTCCAGTGTGCTCAG 176 2825 P AACTGCTGCAGGTGGCCGTGG 177 2828 P TGCTGCAGGTGGCCGTGGAGG 178 2865 R CAGCTGCCTCACTCTATCCT 179 2868 R GTGCAGCTGCCTCACTCTAT 180 2950 F CCCAACAAAGTGCCCTACTA 181 2955 F CAAAGTGCCCTACTACATCAAC 182 2970 F CATCAACCACGAGACCCAGA 183 2970 P CATCAACCACGAGACCCAGACCAC 184 2971 F ATCAACCACGAGACCCAGAC 185 2972 F TCAACCACGAGACCCAGAC 186 2972 P TCAACCACGAGACCCAGACCAC 187 3016 P ACCGAGCTGTATCAGAGCCTGGCC 188 3017 P CCGAGCTGTATCAGAGCCTGGCCG 189 3027 R ATACAGCTCGGTCATCTTAGG 190 3028 R GATACAGCTCGGTCATCTTAGG 191 3041 F ACCTGAACAATGTGCGGTTC 192 3059 R AACCGCACATTGTTCAGGTC 193 3060 R GAACCGCACATTGTTCAGGT 194 3061 R TGAACCGCACATTGTTCAGG 195 3086 P TGCGGAGACTGCAGAAGGCCCT 196 3130 R TCAGGCTCAGCAGATCCAG 197 3148 F CTGGACCAGCACAACCTGAA 198 3149 F TGGACCAGCACAACCTGAAG 199 3166 F AAGCAGAATGACCAGCCCAT 200 3178 P CAGCCCATGGACATCCTGCAGATCA 201 3206 F ACTGCCTGACCACAATCTAC 202 3208 P TGCCTGACCACAATCTACGACCGGC 203 3218 F CAATCTACGACCGGCTGGAA 204 3220 F ATCTACGACCGGCTGGAAC 205 3237 P ACAGGAGCACAACAACCTGGTGAA 206 3237 R TTCCAGCCGGTCGTAGATTG 207 3238 P CAGGAGCACAACAACCTGGTGAATGTG 208 3238 R GTTCCAGCCGGTCGTAGATT 209 3255 R CAGGTTGTTGTGCTCCTGTT 210 3264 P GCCCCTGTGCGTGGACATGTGC 211 3273 F CGTGGACATGTGCCTGAATT 212 3285 F CCTGAATTGGCTGCTGAACG 213 3286 F CTGAATTGGCTGCTGAACGT 214 3302 P ACGTGTACGACACCGGCAGGACC 215 3304 R CGTTCAGCAGCCAATTCAGG 216 3306 R CACGTTCAGCAGCCAATTC 217 3307 R ACACGTTCAGCAGCCAATTC 218 3309 R GTACACGTTCAGCAGCCAAT 219 3324 P CGGCAGAATCCGCGTGCTGAGC 220 3362 R ATGATGCCGGTCTTGAAGCT 221 3375 R CTTGCACAGGCTGATGATGC 222 3462 F GCTGCACGATAGCATCCAGA 223 3515 P GCGGCAGCAACATCGAGCCCT 224 3538 F GTGAGGAGCTGCTTCCAGTT 225 3557 R AACTGGAAGCAGCTCCTCAC 226 3570 P GCCCGAGATCGAGGCCGCCC 227 3587 F CCCTGTTCCTGGACTGGATG 228 3610 R GCCTCATCCAGTCCAGGAAC 229 3658 P GCCGCCGAGACCGCCAAGCA 230 3677 F ACCAGGCCAAGTGCAATATC 231 3709 P CCCATCATCGGCTTCCGGTACA 232 3729 F CAGGAGCCTGAAGCACTTCA 233 3748 R TGAAGTGCTTCAGGCTCCTG 234 3749 P ACTACGACATCTGCCAGAGCTGCTT 235 3755 F ACATCTGCCAGAGCTGCTTT 236 3765 R CTGGCAGATGTCGTAGTTGAAG 237 3845 P CCGGCGAGGATGTGAGAGACTTCGC 238 3880 R TCAGCACTTTGGCGAAGTCT 239 3915 R CTTGGCAAAGTACCGCTTGG 240 ITR F1 GGAACCCCTAGTGATGGAGTT 241 ITR F2 AACATGCTACGCAGAGAGGGAGTGG 242 ITR R1 CGGCCTCAGTGAGCGA 243 ITR R2 CATGAGACAAGGAACCCCTAGTGATGGAG 244
[0519] The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.