ALL-IN-ONE AAV VECTORS FOR TREATING CORONAVIRUS-INDUCED DISEASES

20230242914 · 2023-08-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel approach for treating coronavirus infections, particularly infections caused by MERS-CoV, SARS-CoV and SARS-CoV-2 variants. Based on effectively targeting and cleaving single stranded RNA viruses, the present invention provides Cas13d guide RNAs, to guide the Cas13d protein to a target site in the genome of humanized Coronaviridae that is conserved between MERS-CoV, SARS-CoV and SARS-CoV-2. The disclosed invention further provides an AAV vector comprising such a Cas13d guide RNA expression cassette as well as a Cas13d for treating coronavirus infections, especially COVID-19 infections.

Claims

1. A guide RNA for use with a Cas13 protein having a size of less than 1000 amino acids, wherein the guide RNA target site is a sequence comprised by a SARS-CoV-2 genome.

2. The guide RNA according to claim 1, wherein the guide RNA target site is a sequence that is conserved between genomes of human-associated viruses of Coronaviridae.

3. The guide RNA according to claim 2, wherein the guide RNA target site is a sequence conserved between the respective genomes of SARS-CoV-2, MERS-CoV and SARS-CoV.

4. The guide RNA according to claim 3, wherein the guide RNA target site is a sequence comprised by one or more of the Orf1ab, S, E, M and N region in the genomes of SARS-CoV-2, MERS-CoV and SARS-CoV.

5. The guide RNA according to claim 1, wherein the guide RNA sequence comprises a sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:39.

6. The guide RNA according to claim 5, wherein the guide RNA sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 4, 6, 11-16, and 31.

7. The guide RNA according to claim 5, wherein the guide RNA sequence comprises a sequence selected from the group consisting of SEQ ID NOs 4, 7, 15, 23, 27, and 31.

8. A nucleic acid molecule comprising a sequence encoding a Cas13d protein and a guide RNA expression cassette encoding a guide RNA according to any of claims 1-6 and comprising a U6 promotor.

9. The nucleic acid molecule according to claim 8 encoding more than one guide RNA according to claims 1-7.

10. The nucleic acid molecule according to claim 9, encoding guide RNAs comprising the sequences of SEQ ID NOs: 4, 7, and 15; SEQ ID NOs: 15, 23, and 31; SEQ ID NOs: 15, 27, and 31; SEQ ID NOs: 23, 27, and 31; SEQ ID NOs: 4, 15, 23, 27, and 31; SEQ ID NOs: 4, 7, 27, and 31; SEQ ID NOs: 4, 23, and 31; SEQ ID NOs: 7, 27, and 31; SEQ ID NOs: 4, 7, 15, 23, 27, and 31; or SEQ ID NOs: 29, 30, and 31.

11. The nucleic acid molecule according to claim 10, encoding guide RNAs comprising the sequences of SEQ ID NOs: 4, 7, and 15; SEQ ID NOs: 4, 15, 23, 27, and 31; and SEQ ID NOs: 4, 7, 27, and 31.

12. The nucleic acid molecule according to any one of claims 8-11, wherein the nucleic acid molecule is a plasmid.

13. The nucleic acid molecule according to claim 12, wherein the nucleic acid molecule is a single plasmid.

14. The nucleic acid molecule of any one of claims 8-13, wherein said Cas13d protein encoded by said sequence does not comprise a nuclear localization signal (NLS).

15. The nucleic acid molecule of any one of claims 8-14, wherein said Cas13d protein encoded by said sequence is a fusion protein comprising an N-terminal binding domain (N-NTD) of the nucleocapsid protein of SARS-CoV-2.

16. The nucleic acid molecule according to any one of claims 13-15, wherein the nucleic acid molecule is obtainable by inserting a spacer sequence of a guide RNA according to any of claims 1-7 into plasmid pAAV2-U6-gRNA-CMV-Cas13d of SEQ ID NO:40; or by inserting at least one spacer sequence of at least one guide RNA according to any of claims 1-7 into plasmid pAAV2-U6-gRNA-CMV-Cas13d-array-triguide of SEQ ID NO:41, plasmid pAAV-U6-gRNA-quadguide-CMV-Cas13d-V3-basic of SEQ ID NO:42, plasmid pAAV-U6-gRNA-CMV-Cas13d-Sapl of SEQ ID NO:43, or plasmid pAAV-U6-gRNA-CMV-Cas13d-NTD-Aarl of SEQ ID NO:44.

17. An AAV vector comprising the nucleic acid molecule of any one of claims 8-16.

18. The AAV vector according to claim 17, wherein the AAV vector is an AAV2 or AAV9 vector.

19. The AAV vector according to claim 18, wherein the AAV vector backbone has been reduced in size.

20. An adenoviral vector comprising the nucleic acid molecule of any one of claims 8-16.

21. A pharmaceutical composition comprising the AAV vector of any one of claims 17-19 or the adenoviral vector of claim 20.

22. A pharmaceutical composition comprising at least one guide RNA of any one of claims 1-7 and at least one mRNA encoding a Cas13 protein.

23. The pharmaceutical composition according to claim 22, wherein said Cas13 protein is a Cas13d protein or a Cas13a protein.

24. The pharmaceutical composition according to any one of claims 21-23, wherein said Cas13d protein encoded by said mRNA does not comprise a nuclear localization signal (NLS).

25. The pharmaceutical composition according to any one of claims 21-24, wherein said Cas13d protein encoded by said mRNA is a fusion protein comprising an N-terminal binding domain (N-NTD) of the nucleocapsid protein of SARS-CoV-2.

26. A method of treating a human-associated virus caused disease or syndrome, comprising administering an AAV vector according to any of claims 17-19, an adenoviral vector according to claim 20, or a pharmaceutical composition according to any one of claims 21-25 to a patient in need thereof.

27. The method according to claim 26, wherein the disease or syndrome is the result of an infection with a coronavirus that is genetically related to the group consisting of MERS-CoV, SARS-CoV and SARS-CoV-2.

28. The method according to claim 27, wherein the disease is COVID-19.

29. The method according to any one of claims 26-28, wherein the Cas13 upon expression cleaves the human-associated virus.

30. The method according to any one of claims 26-29, wherein the AAV vector, the adenoviral vector, or the pharmaceutical composition is administered via the upper respiratory tract, preferably intranasally or intratracheally or in an aerosol composition through an inhaler or nebulizer.

31. The method according to any one of claims 26-30, wherein the AAV vector, the adenoviral vector, or the pharmaceutical composition is administered through a ventilator.

32. The method according to any one of claims 26-31, wherein the AAV vector, the adenoviral vector, or the pharmaceutical composition is administered to the myocardium.

33. An AAV vector according to any one of claims 17-19 for use in treating a human-associated virus caused disease or syndrome.

34. An adenoviral vector according to claim 20 for use in treating a human-associated virus caused disease or syndrome.

35. A pharmaceutical composition according to any one of claims 21-25 for use in treating a human-associated virus caused disease or syndrome.

36. The AAV vector for the use of claim 33, the adenoviral vector for the use of claim 34, or the pharmaceutical composition for the use of claim 35, wherein the disease or syndrome is the result of an infection with a coronavirus that is genetically related to the group consisting of MERS-CoV, SARS-CoV and SARS-CoV-2.

37. The AAV vector, the adenoviral vector, or the pharmaceutical composition for the use of claim 36, wherein the disease is COVID-19.

38. The AAV vector, the adenoviral vector, or the pharmaceutical composition for the use of any one of claims 33-37, wherein the Cas13 upon expression cleaves the human-associated virus.

39. The AAV vector, the adenoviral vector, or the pharmaceutical composition for the use of any one of claims 33-38, wherein the AAV vector or the pharmaceutical composition is to be administered via the upper respiratory tract, preferably intranasally or intratracheally or in an aerosol composition through an inhaler or nebulizer.

40. The AAV vector, the adenoviral vector, or the pharmaceutical composition for the use of any one of claims 33-39, wherein the AAV vector or the pharmaceutical composition is to be administered through a ventilator.

41. The AAV vector, the adenoviral vector, or the pharmaceutical composition for the use of any one of claims 33-40, wherein the AAV vector or the pharmaceutical composition is to be administered to the myocardium.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0047] FIG. 1 shows a phylogenetic tree schematic of the seven presently known Cas13 proteins, for example, as reported in [3].

[0048] FIG. 2 is a schematic illustrating an alignment of genomes derived from SARS-CoV-2, SARS-CoV, and MERS-CoV. The short dashes below the alignment indicate the location of the Cas13d guide RNAs that are designed to target the conserved sequence regions between the genomes SARS-CoV-2, SARS-CoV and MERS-CoV.

[0049] FIG. 3 shows a vector map of the AAV2 plasmid comprising the Cas13d encoding sequence as well as a Cas13d guide RNA expression cassette pAAV2-U6-gRNA-CMV-Cas13d. FIG. 3A: Vector map featuring a single guide RNA (see SEQ ID NO:40). FIG. 3B: Vector map illustrating three insertion sites for the guide RNA spacer sequences (see SEQ ID NO:41).

[0050] FIG. 4 illustrates a sequence alignment of the respective genomes derived from SARS-CoV-2, SARS-CoV and MERS-CoV as well as the sequences used for the alignment.

[0051] FIG. 5 shows the inhibitory efficiency of single guide RNA constructs of the invention in a luciferase reporter assay.

[0052] FIG. 6A shows a first experimental design for testing guide RNA constructs of the invention in SARS-CoV-2-infected human epithelial lungs cells. FIG. 6B shows the inhibitory efficiency of several combinations of guide RNA constructs in the experimental design of FIG. 6A.

[0053] FIG. 7A shows a second experimental design for testing guide RNA constructs of the invention in SARS-CoV-2-infected human epithelial lungs cells. FIG. 7B shows the inhibitory efficiency of several combinations of guide RNA constructs in the experimental design of FIG. 7A.

[0054] FIG. 8 shows the inhibitory efficiency of several combinations of guide RNA constructs and multi-guide RNA constructs in the experimental design of FIG. 7A.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0055] AAV vector: The term “AAV vector” as used herein refers to an adeno-associated virus (AAV) capable of introducing a nucleic acid sequence into target cells. The vector may comprise a sequence encoding Cas13d and/or a guide RNA expression cassette encoding a guide RNA and comprising a U6 promoter.

[0056] Vector backbone: The term “vector backbone” refers to the native nucleic acid sequences of an AAV vector.

[0057] Cas13d: As used herein, the term “Cas13d” refers to a Cas endonuclease of a CRISPR/Cas13d system, including the RfxCas13d endonuclease.

[0058] Conserved: The term “conserved” herein refers to sequences or sequence portions within viral genomes of certain members of the Coronaviridae family that are shared by at least two other members of the Coronaviridae family.

[0059] Coronavirus: The term “coronavirus” as used herein refers to any virus of the family of Coronaviridae. A coronavirus that is capable of infecting human cells is also referred to herein as a human-associated coronavirus.

[0060] COVID-19: The term “COVID-19” as used herein refers to the disease known as Coronavirus Disease 2019, which is caused by an infection from SARS-CoV-2, a type of coronavirus.

[0061] Derivative: The term “derivative” as used herein refers to a virus that is closely related to a virus as described herein. In particular, a virus is a derivative of another virus if their respective genomes show a sequence similarity of at least 50%.

[0062] Guide RNA: The term “guide RNA” is used herein to designate a component of a CRISPR/Cas system. In the present case, “guide RNA” refers to a guide RNA of a CRISPR/Cas13 system, for instance, a Cas13d protein. A guide RNA is a non-coding short RNA sequence that “guides” the Cas protein to its target and cleavage site. The guide RNA comprises a nucleic acid sequence that binds to a complementary target site in a target nucleic acid sequence. By way of example, the target nucleic acid of Cas13d is a single stranded RNA sequence.

[0063] Human-associated virus: The term “human-associated virus” refers to any virus that is capable of infecting a human cell.

[0064] Infection: The term “infection” as used herein refers to the invasion of bodily tissues of an organism by pathogenic agents, the multiplication of such agents, as well as the reaction of the host tissue to the pathogenic agents and the toxins they produce. As used herein, the term “infection” refers to a viral infection of a cell.

[0065] Lower respiratory tract: As used herein, this term refers to the portion of the larynx below the vocal folds, trachea, bronchi, bronchioles and the lungs, including the respiratory bronchioles, alveolar ducts, alveolar sacs, and alveoli.

[0066] MERS: The term “MERS” refers to the disease Middle East Respiratory Syndrome, which is a disease or syndrome caused by an infection from MERS-CoV, a type of coronavirus.

[0067] SARS: The term “SARS” refers to the disease known as Severe Acute Respiratory Syndrome, which is caused by an infection from SARS-CoV, a type of coronavirus.

[0068] Transduction: The term “transduction” as used herein refers to the deliberate introduction of nucleic acids into a cell by means of a viral vehicle. In particular, “transduction” refers to the introduction of an AAV vector into a cell.

[0069] Upper respiratory tract: As used herein, this term refers to nose and nasal passages, paranasal sinuses, the pharynx, and the portion of the larynx above the vocal folds.

Exemplary Advantages of the Invention

[0070] The presently disclosed invention relates to the targeting and cleaving of a viral genome, for example, in the case of a coronavirus a single stranded RNA genome, using a Cas13 protein, preferably a Cas13d protein, to thereby inhibit or eliminate the replication capacity of the virus.

[0071] The invention therefore provides a guide RNA for guiding a Cas13 protein, preferably a Cas13d protein, to a respective target and cleavage site in the viral genome. The inventors designed the instant guide RNAs based on an observation that coronaviruses transmitted from animals to humans have one or more conserved regions in common, and that these conserved regions may be responsible for the highly infectious capacity attributable to such human-associated coronaviruses. Specifically, the present inventors identified and characterized 31 different guide RNA sequences targeting those highly conserved regions of the respective viral sequences (SEQ ID NO:1 to SEQ ID NO:31).

[0072] In the presently known families of Cas proteins, the Class II, Type VI Cas13 is the RNA targeting endonuclease having the smallest size, of approximately 930 amino acids. Cas13d has been shown to possess a high level of catalytic activity and specificity in mammalian cells. Thus, Cas13d appears to be particularly suitable for efficacious transduction and specific targeting and degradation of single stranded RNA viruses, such as coronaviruses.

[0073] The invention further provides an AAV vector comprising these guide RNAs as well as a sequence encoding a Cas13 protein having less than 1000 amino acids, preferably a Cas13d. AAV vectors have widely been used for gene delivery approaches. However, in contrast to common AAV transduction systems, the AAV vector nucleic acids used in the present invention are one-component systems. Consequently, all elements required for transduction of the target cells and expression of the relevant proteins are comprised by a single vector nucleic acid, thereby facilitating the transduction procedure. In order to further expedite transduction and increase transduction efficacy, the vector nucleic acid is also reduced to a minimal size. Such all-in-one AAV-Cas13-gRNA constructs show superior efficiency and fewer side effects compared to conventional two vector nucleic acid systems. Since AAV2 vectors have shown high transduction capacity in the lung during a Phase III clinical trial, the AAV vectors disclosed herein are preferably based on AAV2 vectors.

[0074] The present AAV vectors may comprise either coding sequences for a single Cas13, preferably Cas13d, guide RNA, or a combination of two or more Cas13, preferably Cas13d, guide RNAs as described herein. Using more than one guide RNA may further increase efficacy in targeting and cleaving the virus. In addition, a combination of several guide RNAs may also increase the efficacy and specificity in targeting further mutated viruses, for instance, derivatives of the viruses described herein.

[0075] Suitable guide RNA spacer sequences of the present invention have been designed based on sequence alignments of several human-associated Coronaviridae strains (SEQ ID NO:1 to SEQ ID NO:31). Especially taking MERS-CoV into consideration for the design of the guide RNAs, which shows less sequence similarity to the other two closely related coronaviruses SARS-CoV and SARS-CoV-2, allows for the identification of those regions of the viral genome that enable the virus to target human cells. These guide RNA spacer sequences as well as other spacer sequences designed accordingly allow for the specific targeting and cleavage also of Coronaviridae strains that might only become clinically relevant in the future.

EMBODIMENTS OF THE INVENTION

[0076] The current outbreak of COVID-19 caused by an infection with the newly identified SARS-CoV-2 has already led to nearly 1.000.000 infections and 50.000 deaths worldwide in only a few months. Although there is apparently an urgent need, an effective drug is to date not available and the development of a vaccine is estimated to take about 12-18 months. Thus, promising new therapy approaches are highly demanded.

[0077] Newly identified SARS-CoV-2 belongs to the family of Coronaviridae, a large family of single stranded positive sense RNA viruses. Viruses from the Coronaviridae family typically infect the respiratory system and are considered responsible for a number of human illnesses and diseases ranging from the common cold to more severe diseases such as MERS (MERS-CoV) and SARS (SARS-CoV)[1]. SARS-CoV-2 has been reported to contain 10 different proteins (ORF1ab, S, ORF3a, E, M, ORF6, ORF7a, ORFS, N, ORF10) (GenBank entry MN908947.3). A sequence alignment between the genomes derived from MERS-CoV, SARS-CoV and SARS-CoV-2 is shown in FIG. 4.

[0078] The recently identified and evolved CRISPR/Cas systems have revolutionized gene editing by providing a highly effective, specific and simple system for gene modification in eukaryotic cells. A caspase (Cas) as an effector protein, and a guide RNA for guiding the Cas protein to a specific target sequence within a nucleic acid represent the only required components of a system that allows for the precise cleavage of nucleic acids and/or the genetic modification of cells or even entire organisms [4].

[0079] Within the known families of Cas proteins, the Class II, Type VI Cas13 has been recently discovered and classified as four different subtypes: Cas13a, Cas13b, Cas13c and Cas13d [5]. Cas13d is small in size, shows high catalytic activity and specificity in mammalian cells, and targets and cleaves single stranded RNA. Hence, Cas13d offers an exciting new approach for combating viral invasion by degrading single stranded viral RNA.

[0080] However, a major obstacle in using Cas13d for combating viral infections is the delivery of the Cas protein and its guide RNA into (infected) cells.

[0081] Adeno-associated viruses are non-enveloped, single-stranded DNA viruses of the Parvoviridae family. Several serotypes have been identified, among which AAV2 is likely the best known. Adeno-associated viruses exhibit certain characteristics making them an effective gene delivery tool, such as low pathogenicity and low immunogenicity, while being broadly tropic [6].

[0082] Thus, the present invention provides a novel therapeutic approach for treating human-associated coronavirus-induced diseases and/or syndromes, particularly COVID-19, by administering to the patient an AAV vector comprising a sequence encoding for a Cas13d protein, as well as a Cas13d guide RNA for targeting specific target sites within the viral genome in order to cleave the target sequence and degrade the virus. The invention further provides such guide RNAs that are engineered to interact with highly promising target sites within the viral genome.

[0083] Guide RNAs

[0084] Cas13 guide RNAs, preferably Cas13d guide RNAs, of the present invention are directed to single stranded RNA target sequences within the genomes of human-associated coronaviruses or derivatives thereof. The target site of the guide RNAs disclosed herein are specifically directed to the conserved sequences and/or sequence portions of several members of the Coronaviridae family, preferably between MERS-CoV, SARS-CoV and SARS-CoV-2.

[0085] Typical Cas13d guide RNAs target a 22-30 nt target sequence (spacer) [2]. Thus, the guide RNA of the present invention may be directed to any 22-30 nt target sequence within a coronavirus genome. Typical guide RNAs as used herein are discussed in Konermann et al. [3].

[0086] Guide RNA sequences of the present invention are designed according to one of the following design approaches:

[0087] (1) A sequence alignment of the genome sequences of different strains of coronaviruses, preferably of SARS-CoV-2, SARS-CoV and MERS-CoV, is produced. Spacer sequences of 22-30 nt are designed such that the seed region perfectly matches to regions of 100% overlap between the aligned viral genome sequences. The remainder of the spacer sequence is identical to at least one of the viral sequences, preferably SARS-CoV2, but may only partially match the remaining sequences. Thus, according to this approach, the cutting efficiency is particularly high against all three coronaviruses, while affinity of the guide RNA is maximized for the virus to which the spacer sequence perfectly matches.

[0088] (2) A sequence alignment of the genome sequences of different strains of coronaviruses, preferably of SARS-CoV-2, SARS-CoV and MERS-CoV, is produced. Spacer sequences of 22-30 nt are designed such that the seed region perfectly matches at least one of the viral sequences, preferably SARS-CoV-2. In contrast to the first approach, mismatches in the seed region of the spacer sequence to the respective target sequences within some of the viral sequences are tolerated. Guide RNA spacer sequences designed by this approach have very high binding affinities, but have reduced cutting efficiency against those viruses to which the spacer sequence does not perfectly match.

[0089] (3) A sequence alignment of the genome sequences of different strains of coronaviruses, preferably of SARS-CoV-2, SARS-CoV and MERS-CoV is produced. Spacer sequences of 22-30 nt are designed such that the guide RNA spacer sequences have the best overall fit for all members of the Coronaviridae family that have been subjected to sequence alignment. Based on the requirement that the guide RNA spacer sequences have 100% sequence similarity to respective target sequences of all the aligned coronavirus members in the seed region, an overall sequence similarity of the guide RNA spacer sequences to the respective sequences in the aligned coronavirus members of up to 95% is achievable. This approach allows for the highest probability of the guide RNAs to also target future coronavirus variants.

[0090] Thus, in one embodiment, the guide RNA is directed to a target sequence within conserved regions of genomes of viruses of the Coronoviridae family, preferably that of human-associated coronaviruses.

[0091] In a preferred embodiment, the guide RNA is directed to a target sequence within conserved regions of genomes of MERS-CoV, SARS-CoV and SARS-CoV-2 or derivatives thereof.

[0092] In a preferred embodiment, the guide RNA is directed to a target sequence within the SARS-CoV-2 genome or derivatives thereof.

[0093] In a preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 1-39 or combinations thereof, as shown in Table 1 herein.

[0094] The guide RNA may, for example, comprise a spacer sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39, or any combination thereof.

[0095] In another preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 1-31, or combinations thereof.

[0096] The guide RNA spacer sequence may, for example, comprise a spacer sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30 or SEQ ID NO:31, or any combination thereof.

[0097] In an even more preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 3, 4, 11-20, 22, 29 or 31, or combinations thereof.

[0098] The guide RNA spacer sequence may for example comprise a spacer sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:29 or SEQ ID NO:31, or combinations thereof.

[0099] In a most preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 3, 4, 11, 12, 19, 20, 22 or 29, or combinations thereof.

[0100] The guide RNA spacer sequence may for example comprise a spacer sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:29, or combinations thereof.

[0101] In another most preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 13-18 or 31.

[0102] In another most preferred embodiment, the guide RNA comprises a spacer sequence of any of SEQ ID NOs: 4, 6, 11-16, and 31.

[0103] Particularly suitable guide RNAs include the spacer sequences of any of SEQ ID NOs: 4, 7, 15, 23, 27, and 31.

[0104] The guide RNA spacer sequence may, for example, comprise a spacer sequence of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:31, or combinations thereof.

TABLE-US-00001 TABLE 1 Guide RNA spacer sequences of the invention SEQUENCE GUIDE RNA NO. SPACER NAME GUIDE RNA SPACER SEQUENCE APPROACH SEQ ID NO: 1 gRNA_XX-O-1 AACAATTGTATGTGACAAGTATTTCTT 2 of EX. 2 SEQ ID NO: 2 gRNA_XX-O-2 TACACGTTCACCTAAGTTGGCGTATAC 2 of EX. 2 SEQ ID NO: 3 gRNA_XX-O-3 AGAGAAAGTGTGTCTCTTAACTACAAAG 1 of EX. 2 SEQ ID NO: 4 gRNA_XX-O-4 CGGGTTTGACAGTTTGAAAAGCAACATT 1 of EX. 2 SEQ ID NO: 5 gRNA_XX-O-5 AATTTGCTTGTTCCAATTACTACAGTA 2 of EX. 2 SEQ ID NO: 6 gRNA_XX-O-6 TTAGGATAATCCCAACCCATAAGGTGA 2 of EX. 2 SEQ ID NO: 7 gRNA_XX-O-7 TGCATTAACATTGGCCGTGACAGCTTG 2 of EX. 2 SEQ ID NO: 8 gRNA_XX-O-8 CTGTGTCAACATCTCTATTTCTATAGA 2 of EX. 2 SEQ ID NO: 9 gRNA_XX-O-9 ACTTAAAGTTCTTTATGCTAGCCACTA 2 of EX. 2 SEQ ID NO: 10 gRNA_XX-O-10 CATTGAGAAATGTTTACGCAAATATGC 2 of EX. 2 SEQ ID NO: 11 gRNA_XX-O-11 AGCTCTATTCTTTGCACTAATGGCATAC 1 of EX. 2 SEQ ID NO: 12 gRNA_XX-O-12 ACAAATGTTAAAAACACTATTAGCATAA 1 of EX. 2 SEQ ID NO: 13 gRNA_XX-O-13 GAGCTCTATTCTTTGCACTAAT 3 of EX. 2 SEQ ID NO: 14 gRNA_XX-O-14 GCATACTTAAGATTCATTTGAGT 3 of EX. 2 SEQ ID NO: 15 gRNA_XX-O-15 ACTCTTACCAGTACCAGGTGGTCC 3 of EX. 2 SEQ ID NO: 16 gRNA_XX-O-16 CAGCATTACCATCCTGAGCAAAGAA 3 of EX. 2 SEQ ID NO: 17 gRNA_XX-O-17 TGTTGGGTATAAGCCAGTAATT 3 of EX. 2 SEQ ID NO: 18 gRNA_XX-O-18 GAGCCCTGTGATGAATCAACAGT 3 of EX. 2 SEQ ID NO: 19 gRNA_XX-S-1 AAAACACTTGAAATTGCACCAAAATTG 1 of EX. 2 SEQ ID NO: 20 gRNA_XX-S-2 AGCCTCAACTTTGTCAAGACGTGAAAG 1 of EX. 2 SEQ ID NO: 21 gRNA_XX-S-3 GCCTGTGATCAACCTATCAATTTGCAC 2 of EX. 2 SEQ ID NO: 22 gRNA_XX-S-4 TTTGATTGTCCAAGTACACACTCTGAC 1 of EX. 2 SEQ ID NO: 23 gRNA_XX-E-1 TAGTGTAACTAGCAAGAATACCACGAA 2 of EX. 2 SEQ ID NO: 24 gRNA_XX-E-2 ACGCACACAATCGAAGCGCAGTAAGGA 2 of EX. 2 SEQ ID NO: 25 gRNA_XX-E-3 TTTAGACCAGAAGATCAGGAACTCTAG 2 of EX. 2 SEQ ID NO: 26 gRNA_XX-E-4 AATACCACGAAAGCAAGAAAAAGAAGT 2 of EX. 2 SEQ ID NO: 27 gRNA_XX-M-1 GTAAACAGCAGCAAGCACAAAACAAGC 2 of EX. 2 SEQ ID NO: 28 gRNA_XX-M-2 GCTGCGAAGCTCCCAATTTGTAATAAG 2 of EX. 2 SEQ ID NO: 29 gRNA_XX-N-1 TGGGGGCAAATTGTGCAATTTGCGGCC 1 of EX. 2 SEQ ID NO: 30 gRNA_XX-N-2 TGAGGAACGAGAAGAGGCTTGACTGCC 2 of EX. 2 SEQ ID NO: 31 gRNA_XX-N-3 TCAGCAGCAGATTTCTTAGTGA 3 of EX. 2 SEQ ID NO: 32 gRNA_Q-4-1 ATATATGTGGTACCATGTCACC [9] SEQ ID NO: 33 gRNA_Q-4-2 ATTACCTTCATCAAAATGCCTT [9] SEQ ID NO: 34 gRNA_Q-4-3 CTTGATTATCTAATGTCAGTAC [9] SEQ ID NO: 35 gRNA_Q-4-4 AAGAATCTACAACAGGAACTCC [9] SEQ ID NO: 36 gRNA_Q-8-1 GAAGAGGCTTGACTGCCGCCTC [9] SEQ ID NO: 37 gRNA_Q-8-2 GCCTGGAGTTGAATTTCTTGAA [9] SEQ ID NO: 38 gRNA_Q-8-3 GTTGTTGTTGGCCTTTACCAGA [9] SEQ ID NO: 39 gRNA_Q-8-4 GCCTCAGCAGCAGATTTCTTAG [9]

[0105] Of the above listed spacer sequences, those referred to as gRNA_XX-O-1 to gRNA_XX-O-18 target the ORF1ab gene, the gRNA_XX-S-1 to gRNA_XX-S-4 sequences target the “S” spike protein gene, the gRNA_XX-E-1 to gRNA_XX-E-4 sequences target the envelope protein gene, the gRNA_XX-M-1 to gRNA_XX-M-2 sequences target the membrane protein gene, and the gRNA_XX-N-1 to gRNA_XX-N-3 target the nucleocapsid protein gene.

[0106] Cas13d

[0107] According to the present invention, Cas13, preferably Cas13d, is selected as the endonuclease for cleaving and targeting coronavirus genomes. Due to its small size and high targeting and cleavage efficacy and specificity in mammalian cells, this CRISPR/Cas member appears particularly well-suited for an anti-viral approach.

[0108] Cas13d, like the other Cas13 family enzymes, has the property to independently process its own CRISPR arrays into mature guide RNAs that contain a 30 base pair 5′ direct repeat followed by a variable 3′ spacer that ranges from 22 to 30 bp in length.

[0109] To date, seven different Cas13d proteins have been identified (FIG. 1): EsCas13d, RffCas13d, UrCas13d, RaCas13d, P1E0 Cas13d, Adm Cas13d and RfxCas13d. Among these Cas13d variants, RfxCas13d has been reported to show high RNA knock-down efficacy with minimal off-target activity [2].

[0110] Thus, in some embodiments, any Cas13d endonuclease may be used.

[0111] In preferred embodiments, RfxCas13d endonuclease is used.

[0112] AAV Vector Comprising a Sequence Encoding Cas13d and Comprising a Guide RNA Expression Cassette

[0113] An AAV vector of the present invention comprises a Cas13d guide RNA expression cassette and a sequence encoding a Cas13d protein. The AAV vector serves as a vehicle for the transport of the CRISPR/Cas13d system into a cell, including those infected with a virus.

[0114] AAV vectors represent a well-known gene delivery tool suitable for a variety of applications. Dependent on the respective AAV serotype, AAV vectors exhibit remarkable tropism and thus allow for the directed transduction of target cells. For example, AAV9 has proven to show a tropism for myocardial cells and thus, AAV9 based vectors are considered suitable for gene delivery to these cells (see, e.g., EP Patent No. 3 132 041 to Kupatt et al.). Similarly, AAV2-based vectors have shown potential for treating cystic fibrosis in humans, as discussed by Guggino et al. [7] (see also [8]).

[0115] AAV vectors have a packaging limit of only around 4.7 kb, which, for most transduction approaches, entails the use of more than one vector in order to allow for the transfer of all genetic elements required.

[0116] However, by selecting the relatively small Cas13d and, where necessary, additionally removing dispensable elements from the AAV vector, the present invention provides a single AAV vector comprising all of the elements required for the expression of Cas13d and its guide RNA in a transduced cell.

[0117] Similarly, other Cas13 proteins that do not exceed the packaging size of the AAV vector may be used. Thus, Cas13 proteins having less than 1000 amino acids are well-suited for the vectors according to the present invention.

[0118] An exemplary schematic map of the AAV2 vector plasmid encoding Cas13d and a guide RNA is depicted in FIG. 3A and FIG. 3B.

[0119] The AAV vector of the present invention may be based on a number of AAV serotypes, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.

[0120] In preferred embodiments, the AAV vector is based on AAV1, AAV2, AAV5 or AAV9.

[0121] In even more preferred embodiments, the AAV vector is based on AAV2.

[0122] In another even more preferred embodiment, the AAV vector is based on AAV9.

[0123] In most preferred embodiments, the AAV vector plasmid is pAAV2-U6-gRNA-CMV-Cas13d (see SEQ ID NO:40).

[0124] In another preferred embodiment, the AAV vector plasmid is pAAV2-U6-gRNA-CMV-Cas13d-array-triguide (see SEQ ID NO:41) which allows insertion of three gRNA sequences.

[0125] In another preferred embodiment, the AAV vector plasmid is pAAV-U6-gRNA-quadguide-CMV-Cas13d-V3-basic (see SEQ ID NO:42) which allows insertion of four guide RNA sequences. Generation of an AAV vector using the vector plasmid of SEQ ID NO:42 will lead to the packaging of 5064 bp of DNA, having the sequence of SEQ ID NO: 45 into the AAV vector.

[0126] It is possible to reduce the size of the AAV vector cargo by not including nuclear localization sequences (NLSs) in the encoded sequence of the Cas13d protein. SARS-CoV-2 proliferation occurs in the cytosol. Thus, by using a Cas13d protein without NLSs, the accumulation of Cas13d in the cytosol can be enhanced, while at the same time the size of the protein and the construct encoding it is reduced. A suitable vector plasmid encoding a Cas13d protein without NLSs is pAAV-U6-gRNA-CMV-Cas13d-Sapl (see SEQ ID NO:43). Generation of an AAV vector using the vector plasmid of SEQ ID NO:43 will lead to the packaging of 4833 bp of DNA, having the sequence of SEQ ID NO: 46 into the AAV vector.

[0127] Preferably, the AAV vector contains less than 5 kb of DNA. Packaging efficiency and expression in cells drops down significantly at sizes larger than 5 kb [11].

[0128] In order to further promote the binding of the Cas13d protein to the SARS-CoV-2 genome, an N-terminal RNA binding domain (N-NTD) can be fused to the Cas13d protein. N-NTD is the RNA-binding domain of the SARS-CoV-2 nucleocapsid (N) protein. The main function of nucleocapsid protein during infection is to bind the viral RNA and form a helical ribonucleoprotein (RNP) complex, in order to protect the viral genome and maintain reliable viral replication. The N-terminal binding domain (N-NTD) of the nucleocapsid protein captures the viral RNA genome and the C-terminal domain anchors the RNP complex to the viral membrane via its interaction with M protein. Thus, a fusion of N-NTD to the Cas13d protein is expected to promote formation of a complex including Cas13d and the viral genome, and thus to guide the Cas13d into spatial proximity with the viral genome. A suitable vector plasmid encoding a Cas13d protein with N-NTD fused to its C-terminus is pAAV-U6-gRNA-CMV-Cas13d-NTD-Aarl (see SEQ ID NO:44). Generation of an AAV vector using the vector plasmid of SEQ ID NO:44 will lead to the packaging of 5238 bp of DNA, having the sequence of SEQ ID NO: 47 into the AAV vector.

[0129] Depending on which respective serotype the AAV vector of the instant invention is based on, the AAV vector may show a tropism for certain cell types, tissues and organs harboring these cell types.

[0130] Thus, the AAV vector of the present invention may be directed to various cell types and organs in the human body by selecting a specific serotype of the AAV vector.

[0131] In preferred embodiments, the AAV vector shows a tropism for, and is directed to, cells of the human respiratory system.

[0132] In even more preferred embodiments, the AAV vector is an AAV2 vector directed to cells of the human respiratory system.

[0133] In another preferred embodiment, the AAV vector is directed to human myocardial cells.

[0134] In even more preferred embodiments, the AAV vector is an AAV9 vector directed to cells of the human myocardium.

[0135] AAV vectors of the present invention may encode a single Cas13d guide RNA or a combination of several guide RNAs. Thus, an AAV vector may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 or 39 guide RNAs.

[0136] In preferred embodiments, the AAV vector encodes a single guide RNA.

[0137] In another preferred embodiment, the AAV vector encodes two guide RNAs.

[0138] In the most preferred embodiments, the AAV vector encodes three, four, or five guide RNAs. Preferably, the spacer sequences of the guide RNAs target different genes of the SARS-CoV-2 genome.

[0139] Suitable combinations of guide RNAs for use in the present invention have the spacer sequences of SEQ ID NOs: 4, 7, and 15; SEQ ID NOs: 15, 23, and 31; SEQ ID NOs: 15, 27, and 31; SEQ ID NOs: 23, 27, and 31; SEQ ID NOs: 4, 15, 23, 27, and 31; SEQ ID NOs: 4, 7, 27, and 31; SEQ ID NOs: 4, 23, and 31; SEQ ID NOs: 7, 27, and 31; SEQ ID NOs: 4, 7, 15, 23, 27, and 31; and SEQ ID NOs: 29, 30, and 31.

[0140] Particularly preferred guide RNAs for use in the present invention have the spacer sequences of SEQ ID NOs: 4, 7, and 15; SEQ ID NOs: 4, 15, 23, 27, and 31; and SEQ ID NOs: 4, 7, 27, and 31.

[0141] In preferred embodiments, the AAV vector encodes the combination of guide RNAs under the same promoter.

[0142] AAV Vectors Encoding Cas13d and Cas13d Guide RNA for Treating Viral Infections

[0143] The present invention provides a novel therapeutic approach for treating human-associated coronavirus infections. By introducing an AAV vector into cells, and upon Cas13 expression, the Cas13 is guided by a guide RNA to a target sequence within the viral genome, for cleavage and thus disruption to the genomic sequence. In cells already infected cells Cas13 with a coronavirus, the viral sequence is cleaved leading to viral degradation and inhibition of any additional spread of viral contamination. In cells not yet infected, expression of the Cas13 guide RNA system offers a protective mechanism to such cells by immediately degrading the viral genetic material upon entry into the cell.

[0144] In order to reach a target cell, the AAV vector is delivered into tissues and organs harboring the target cells.

[0145] According to current reports, coronavirus-caused diseases mainly manifest in the respiratory system of the infected subjects, leading to mild to severe respiratory symptoms and reactions. In particular, the MERS, SARS, and COVID-19 corona variants commonly lead to lung inflammation, pulmonary distress, and acute respiratory syndrome, often caused or driven by cytokine storms of the overpowering immune system. Other scientific publications report findings suggesting that at least the COVID-19 variant may also adversely affect the myocardium in some patients. Consequently, during patient treatment, the AAV vector is delivered to the respiratory system, in particular the lungs, and/or the myocardium as indicated.

[0146] Thus, in one embodiment, the AAV vector for treating human-associated coronavirus-induced disease is administered to the respiratory system of the patient.

[0147] In another embodiment, the AAV vector is administered to the lower respiratory tract of the patient.

[0148] In a preferred embodiment, the AAV vector is administered to the upper respiratory tract by means of inhalation.

[0149] The AAV vector may be administered directly to the trachea tissue.

[0150] In an embodiment of specifically treating MERS, SARS, and/or COVID-19, the AAV vector may be administered to the upper respiratory tract of the patient.

[0151] In another embodiment of treating MERS, SARS, and/or COVID-19, the AAV vector may be administered to the lower respiratory tract of the patient.

[0152] The AAV vector comprising the guide RNA expression cassette and encoding the Cas13d sequence may be comprised by a composition.

[0153] In an embodiment, the composition may be in the form of a tablet, capsule, syrup, film, liquid, solution, powder, paste, aerosol, injection, cream, gel, lotion or drops.

[0154] In another embodiment, the composition is in the form of an aerosol and administered through an inhaler, nebulizer or vaporizer.

[0155] In preferred embodiments, the composition is in the form of an aerosol and administered through an inhaler.

[0156] In an even more preferred embodiment, the composition is in the form of an aerosol and administered through an inhaler to the upper respiratory tract.

[0157] In another preferred embodiment, AAV vector or a composition comprising same is administered to the patient through a ventilator.

[0158] Adenoviral Vectors

[0159] All aspects of the present invention can also be practiced with adenoviral vectors instead of AAV vectors. Adenoviral vectors have the advantage of a higher packaging size limitation.

[0160] Accordingly, an adenoviral vector may comprise a sequence encoding Cas13d and a guide RNA expression cassette. The adenoviral vector may be delivered to target cells and may be used to treat human-associated coronavirus infections, such as a SARS-CoV-2 infection.

[0161] Delivery of Guide RNAs and Cas13d Protein Independently of Viral Vectors

[0162] Guide RNAs of the present invention can also be delivered to target cells without the use of viral vectors. For instance, the method described in reference [10] may be used, involving the delivery of Cas13 mRNA generated by in vitro transcription concomitantly with synthetic guide RNAs. A molar ratio of guide RNA to Cas13d mRNA of 50:1 may be used. The mRNA and guide RNAs may be delivered by means of vesicles.

[0163] The present invention provides a method for treating human-associated coronavirus infections, such as a SARS-CoV-2 infection, by the delivery of synthetic guide RNAs and an mRNA encoding a Cas13 protein to the respiratory tract of a patient in need thereof. Details of this method are described in reference [10]. The Cas13 protein may be a Cas13a protein. The Cas13 protein may be a Cas13d protein. The mRNA and guide RNAs may be delivered by means of vesicles.

EXAMPLES

Example 1

[0164] The use of the AAV vectors disclosed herein represents a promising new therapeutic approach for the prevention and/or treatment of coronavirus-induced diseases and syndromes. Therefore, a number of clinical trials are presently ongoing to test the suitability of these vector vehicles in treating a variety of diseases. Clinical trials as well as the respective AAV vector tested are indicated in Table 2 below.

TABLE-US-00002 TABLE 2 AAV vectors involved in clinical trials Clinical Trial No. Subject NCT00976352 AAVI Vector Carrying Wildtype GAA Gene for Treating Pompe Disease NCT00749957; AAV2 Vector Carrying Wildtype RPE65 Gene for NCT03496012 Treating Leber Congenital Amaurosis; AAV Vector Carrying Wildtype REP1 Gene for Treating Choroideremia NCT03489291 AAV5 Vector Carrying Padua Variant of FIX cDNA for Treating Hemophilia A NCT03362502 AAV9 Vector Carrying a Truncated Human Dystrophin Gene (Mini-Dystrophin) for Treating Duchenne Muscular Dystrophy

Example 2—Design of Guide RNA Sequences

[0165] In order to create an AAV vector encoding a Cas13d and a guide RNA for treating human-associated coronavirus-induced disease, guide RNA spacer sequences were designed.

[0166] Similar to the cases involving SARS-CoV and MERS-CoV, the SARS-CoV-2, the pathogen that causes COVID-19, has successfully survived the transmission from animal to human. Based on this observation, the inventors considered that there should be highly conserved regions existing between the genomes of SARS-CoV, MERS-CoV and SARS-CoV-2 that are responsible for the high pathogenicity and infectious properties of these viruses in humans. The inventors also concluded that such conserved genomic regions offer a promising target site for CRISPR/Cas-mediated cleavage, involving a guide RNA that guides a Cas13 protein, preferably a Cas13d protein, to its target and cleavage site to thereby cleave and degrade the viral nucleic acid.

[0167] Thus, a sequence alignment of the nucleic acid sequences derived from the SARS-CoV, MERS-CoV and SARS-CoV-2 coronavirus variants was created and five highly conserved regions were identified: ORF1ab, S, E, M and N (see FIG. 4). Thirty-one guide RNA spacer sequences were identified targeting the conserved regions and represent highly promising targets for pathogen cleavage and degradation (SEQ ID NO:1 to SEQ ID NO:31).

[0168] In order to identify similar sequences between all three SARS-CoV-2, SARS-CoV and MERS-CoV variants, three main approaches are used:

[0169] (1) In a first approach, spacer sequences are identified that comprise a seed sequence containing a 7 base pair region precisely overlapping between the sequences of all three virus genomes. This sequence was included as the seed region (15.sup.th-21.sup.st base of a guide RNA spacer sequence; [2]) of the guide RNA spacer sequences. The remainder of this spacer sequence perfectly matches the SARS-CoV-2 sequence, but only partially matches the MERS-CoV and SARS-CoV variants. The seed region is considered the critical sequence for the targeting specificity of a guide RNA of Cas13d. Consequently, in case of a mismatch of the critical seed sequence with the target sequence, Cas13d cannot cleave the target sequence. Thus, with this approach, the best cutting efficiency is achieved against all three coronaviruses, while affinity of the guide RNA is maximized for SARS-CoV-2.

[0170] (2) In a second approach, by increasing sequence similarity between the guide RNA spacer sequence and the respective target sequence over the entire length of the spacer sequence, the binding affinity of the spacer sequence to the viral RNA is increased. Different from the first approach, mismatches in the seed region of the spacer sequence to respective target sequences within SARS-CoV and MERS-CoV have been tolerated. However a 100% sequence similarity between the seed region sequence and a respective target sequence in SARS-CoV-2 is given. Guide RNA spacer sequences designed by this approach have very high binding affinities, but show reduced cutting efficiency against MERS-CoV and SARS-CoV.

[0171] (3) In a third approach, guide RNAs are identified that afford the best overall fit for all three members of the coronavirus family. Based on the requirement that the guide RNA spacer sequences have 100% sequence similarity to respective target sequences of all three coronavirus members in the seed region, an overall sequence similarity of the guide RNA spacer sequences to respective sequences in the three coronavirus members of up to 95% was achieved. This approach allows for the highest probability of the guide RNAs to also target future coronavirus variants.

[0172] The above identified guide RNA spacer sequences have been aligned with all human-associated viral transcripts of SARS-CoV-2 known to date. Spacer sequences showing a high target sequence specificity, and thus reducing the risk of potential therapy-induced side effects, have been selected therefrom and each inserted into a pAAV-U6-gRNA-CMV-Cas13d plasmid comprising inter alio a U6 promoter for the guide RNA expression cassette as well as a sequence encoding the Cas13d protein (see also SEQ ID NO:1 to SEQ ID NO:40).

Example 3—Evaluation of Efficiency of Single Guide RNA Sequences

[0173] The inhibitory potency of the 39 gRNAs of Table 1 was assessed in a luciferase assay by the co-transfection of pMir-reporter and all-in-one Cas13 guide constructs. A guide RNA targeting LacZ was used as the negative control.

[0174] The first screening experiments were performed with non-infectious materials. The 39 guide RNAs (gRNAs) target 6 different regions: gRNA_XX-O-1 to gRNA_XX-O-18 target the ORF1ab gene, the gRNA_XX-S-1 to gRNA_XX-S-4 sequences target the “S” spike protein gene, the gRNA_XX-E-1 to gRNA_XX-E-4 sequences target the envelope protein gene, the gRNA_XX-M-1 to gRNA_XX-M-2 sequences target the membrane protein gene, and the gRNA_XX-N-1 to gRNA_XX-N-3 target the nucleocapsid protein gene. Thus, we cloned the 6 regions by PCR and inserted them into the pMIR vector (a 3′-UTR luciferase vector). Hereby 6 luciferase constructs designated as pMIR-report-SARS-COV-2-fragment 1-6 were obtained. To assess the inhibitory potency of each gRNA, human embryonic kidney (HEK293) cells were co-transfected with the all-in-one Cas13 guide construct and its corresponding pMIR reporter construct. The LacZ guide was used as the negative control. Out of 39 gRNAs, 7 guides were selected in the end to make further experiments (highlighted in red in FIG. 5).

Example 4—Testing the Cas13-Guide RNA System in SARS-CoV-2-Infected Human Epithelial Lungs Cells

[0175] Experimental Design 1

[0176] To assess the inhibitory effect of our system, we first packed each of several guide RNA constructs into AAV2 viruses. Each AAV was applied with a titer of 10,000 vg/cell (viral genomes per cell) to transduce human bronchial epithelial Calu-3 cells (40,000 cells/well), which is a typical cell line for coronavirus in vitro studies, with different combinations of guide RNA constructs. After 72 hours, the AAV-transduced cells were further infected by SARS-CoV-2 virus with MOI (multiplicity of infection—refers to the number of viral particles per cell) of 0.01. 1 hour after incubation at 37° C., the infectious medium was removed and cells were washed 2× with DPBS. Afterwards, culture medium was collected at time points of 24 hpi (hours post infection) and 48 hpi. The experimental schedule is shown in FIG. 6A.

[0177] The SARS-CoV-2 infectivity was measured by plaque assay. The results are shown in FIG. 6B. The plaque assay shows that in most cases a combination of effective single guide RNAs results in an increased ability to inhibit viral replication. All guide RNAs which were identified as efficient in the luciferase assay (Example 3) and tested in the combinational approach essay turned out to be highly efficient in suppressing the viral replication in living human epithelial lung cells. Thus, in principle all combinations of guide RNAs that showed a degradation efficiency close to 50% and below can be used for the combinational approach.

Experimental Design 2

[0178] A new experimental design was developed (see FIG. 7A), involving a higher AAV titer (100,000 vg/cell per construct) to transduce Calu-3 cells (30,000 cells/well). After 48 hours, the AAV-transduced cells were further infected by SARS-CoV-2 virus, and the culture medium was collected at time points of 24 hpi and 48 hpi.

[0179] The SARS-CoV-2 infectivity was measured by plaque assay. The results are shown in FIG. 7B. All three samples (D-F) that were treated with different gRNA combinations showed significant effects as compared to untreated control sample. Combination D of 3 guide RNAs showed 93% reduction of SARS-CoV2 titer within 24 hours and 94% reduction within 48 hours. Combination F of 4 guide RNAs showed 98% reduction within 24 hours and 95% reduction within 48 hours. Combination E of 5 guide RNAs showed 94% reduction within 24 hours and 100% reduction within 48 hours.

[0180] The experiment was repeated by also including multi-guide RNA constructs that could deliver several guide RNAs in one AAV. These included the quadguide construct of SEQ ID NO:42 and the construct of SEQ ID NO: 44 encoding Cas13d with NTD fused to its C-terminus. The results are shown in FIG. 8.

REFERENCES

[0181] [1] Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, “The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2”, Nature Microbiology (5): 536-544, 2020. [0182] [2] Wessels H-H et al., “Massively parallel Cas13 screens reveal principles for guide RNA design”, Nature Biotechnology, 2020. [0183] [3] Konermann S et al., “Transcriptome engineering with RNA-targeting Type VI-D CRISPR effectors”, Cell (173(3)): 665-676, 2018 [0184] [4] Cong L, “Multiplex genome engineering using CRISPR/Cas systems”, Science (339(6121)):819-23, 2013. [0185] [5] Shmakov S et al., “Discovery and functional characterization of diverse class 2 CRISPR-Cas systems”, Molecular Cell (69):385-397, 2015. [0186] [6] Colella P et al., “Emerging issues in AAV-mediated in vivo gene therapy”, Molecular Therapy: Methods & Clinical Development (8):87-104, 2018. [0187] [7] Guggino W B et al., “AAV gene therapy for cystic fibrosis: current barriers and recent developments”, Expert Opinion on Biological Therapy (17(10)):1265-1273, 2017. [0188] [8] Moss R B et al., “Repeated Adeno-Associated Virus serotype 2 aerosol-mediated cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis”, CHEST (125(2)):509-521, 2004. [0189] [9] Abbott T R et al., “Development of CRISPR as a prophylactic strategy to combat novel coronavirus and influenza”, bioRxiv, 2020. [0190] [10] Blanchard E L et al., “Treatment of influenza and SARS-CoV-2 infections via mRNA-encoded Cas13a in rodents”, Nature Biotechnology, doi: 10.1038/s41587-021-00822-w, 2021. [0191] [11] Grieger C J & Samulski R J, “Packaging capacity of adeno-associated virus serotypes: impact of larger genomes on infectivity and postentry steps”, Journal of Virology 79(15):9933-9944, 2005.