METHOD AND DRUG FOR TREATING HURLER SYNDROME
20230242916 · 2023-08-03
Inventors
- Pengfei YUAN (Beijing, CN)
- Yanxia Zhao (Beijing, CN)
- Nengyin Liu (Beijing, CN)
- Zexuan Yi (Beijing, CN)
- Gangbin Tang (Beijing, CN)
Cpc classification
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2310/344
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
C12N9/2402
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed are a LEAPER technique-based nucleic acid drug and a method for treating diseases such as Hurler syndrome by means of using the nucleic acid drug to target and edit RNA. The method comprises: performing an editing from adenosine base to hypoxanthine base on RNA by using the nucleic acid drug to precisely repair the pathogenic G>A mutation site of, for example, Hurler syndrome; thereby recovering the normal in vivo expression of a protein encoded by RNA, such as IDUA.
Claims
1. A method for targeted editing of a target RNA in a cell based on the LEAPER technology, wherein the target RNA comprises a transcript sequence of an α-L-iduronidase (IDUA) gene containing a guanosine (G) to adenosine (A) mutation site (target adenosine), and the method comprises: introducing into the cell an arRNA or a construct comprising the arRNA coding sequence, wherein the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase acting on RNA (ADAR) by hybridization to the target RNA so as to deaminate the target adenosine in the target RNA.
2. The method according to claim 1, wherein the nucleotide (targeting nucleotide) in the arRNA opposite to the target adenosine is a cytidine (C), an adenosine (A) or a uridine (U).
3. The method according to claim 1, wherein the target adenosine forms a target triplet together with its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide, and the target triplet is 5′-UAG-3′.
4. The method according to claim 1, wherein the 5′ most adjacent nucleotide of the targeting nucleotide is a cytidine (C), a guanosine (G) or a uridine (U).
5. The method according to claim 1, wherein the 3′ most adjacent nucleotide of the targeting nucleotide is an adenosine (A).
6. The method according to claim 1, wherein the targeting nucleotide forms a targeting triplet together with its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide, and the targeting triplet is 5′-CCA-3′.
7. The method according to claim 1, wherein the length of the arRNA is any integer number of nt selected from 61 nt to 121 nt.
8. The method according to claim 1, wherein the distance from the targeting nucleotide of the arRNA to the 3′ end of the arRNA is less than the distance from the targeting nucleotide to the 5′ end of the arRNA.
9. The method according to claim 1, wherein the distance from the targeting nucleotide of the arRNA to the 3′ end of the arRNA is any integer number of nt selected from 9 nt to 60 nt.
10. The method according to claim 1, wherein the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is any integer number of nt selected from 25 nt to 60 nt.
11. The method according to claim 1, wherein the arRNA is an arRNA having a length characteristic selected from the group consisting of: 55 nt-c-35 nt, 55 nt-c-25 nt, 55 nt-c-24 nt, 55 nt-c-21 nt, 55 nt-c-20 nt, 55 nt-c-19 nt, 55 nt-c-18 nt, 55 nt-c-17 nt, 55 nt-c-16 nt, 55 nt-c-15 nt, 55 nt-c-14 nt, 55 nt-c-13 nt, 55 nt-c-12 nt, 55 nt-c-11 nt, 55 nt-c-10 nt, 55 nt-c-9 nt, 50 nt-c-20 nt, 50 nt-c-15 nt, and 45 nt-c-20 nt; wherein cytidine is the targeting nucleotide in the arRNA opposite to the target adenosine, and the orientation of the arRNA is 5′ to 3′.
12. (canceled)
13. The method according to claim 1, wherein the arRNA comprises one or more chemical modifications.
14. The method according to claim 13, wherein the chemical modification is one or more selected from the group consisting of: 2′-O-methylation modification, phosphorothioation modification in internucleotide linkage, deoxyribonucleotide substitution modification, LNA modification, and 2′-O-(2-methoxyethyl) modification.
15. The method according to claim 13, wherein the chemical modification is one or more selected from the group consisting of: 1) 2′-O-methylation modifications in the first 2, 3, 4 or 5 nucleotides; 2) 2′-O-methylation modifications in the last 2, 3, 4, or 5 nucleotides; 3) 2′-O-methylation modifications in all the cytidines except that in the targeting triplet; 4) 2′-O-(2-methoxyethyl) modifications in the first 2, 3 or 4 nucleotides; 5) 2′-O-(2-methoxyethyl) modifications in the last 2, 3 or 4 nucleotides; 6) deoxyribonucleotide substitution modifications of the first 2, 3 or 4 nucleotides; 7) deoxyribonucleotide substitution modifications of the last 2, 3 or 4 nucleotides; 8) phosphorothioation modifications in the first 1, 2, 3, 4 or 5 internucleotide linkages; 9) phosphorothioation modifications in the last 1, 2, 3, 4 or 5 internucleotide linkages; 10) phosphorothioation modifications in all internucleotide linkages except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation; and (11) phosphorothioation modifications in internucleotide linkages at an interval of 1, 2, 3, or 4 nucleotides except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation.
16. (canceled)
17. The method according to claim 1, wherein the guanosine (G) to adenosine (A) mutation site targeted by the arRNA is a mutation site in NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter), or a corresponding mutation site thereof, in the genome of a patient with Hurler syndrome.
18. The method according to claim 1, wherein the arRNA comprises any sequence selected from the group consisting of: TABLE-US-00019 1) (SEQ ID NO: 31) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G-Um* G-Um*G-G*Um-Um*G-Cm*Um-G*Um-Cm*Cm- A*G-G*A-Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm- Cm*Um-G*Cm-G*A-Cm*A-Cm*Um-Um*Cm- G*G-Cm-C-C-A*G-A*G-Cm*Um-G*Cm-Um* Cm-Cm*Um*Cm*Am; 2) (SEQ ID NO: 31) Gm*Am*Cm-G*Cm-Cm*Cm-A*-Cm-Cm*G- Um*G-Um*G-G*Um-Um*G-Cm*Um-G*Um- Cm*Cm-A*G-G*A-Cm*G-G*Um-Cm*Cm-Cm* G-G*Cm-Cm*Um-G*Cm-G*-A-Cm*A-Cm* Um-Um*Cm-G*G-Cm*Cd-Cd*Ad*-G-A*G- Cm*Um-G*Cm-Um*Cm-Cm*Um*Cm*Am; 3) (SEQ ID NO: 31) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G- Um*G-Um*G-G*Um-Um*G-Cm*Um-G*Um- Cm*Cm-A*G-G*A-Cm*-G-G*Um-Cm*Cm- Cm*G-G*Cm-Cm*Um-G*-Cm-G*A-Cm*A- Cm*Um-Um*Cm-G*G-Cm-Cd-Cd*Ad*G- A*G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am; 4) (SEQ ID NO: 31) Gmoe*Amoe*Cmoe*Gmoe-C-C-C-A-C- C-G-Um-G-Um-G-G-Um-Um-G-C-Um-G- Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-GC-G-A-C-A-C-Um-Um- C-G-G-C-C-C-A-G-A-G-C-Um-G-C- Um-C*Cmoe*Umoe*Cmoe*Amoe; or 5) (SEQ ID NO: 31) G+*A+*C+*G+C-C-C-A-C-C-G-Um-G- Um-G-G-Um-Um-G-C-Um-G-Um-C-C- A-G-G-A-C-G-G-Um-C-C-C-G-G-C- C-Um-GC-G-A-C-A-C-Um-Um-C-G-G- C-C-C-A-G-A-G-C-Um-G-C-Um-C* C+*U+*C+*A+; wherein * indicates a phosphorothioation modification, m indicates a 2′-O-methylation modification, moe indicates a 2′-O-(2-methoxyethyl) modification, + indicates an LNA modification, and d indicates a deoxyribonucleotide substitution modification.
19. The method according to claim 1, wherein the arRNA is introduced into the cells by any method selected from the group consisting of: electroporation, liposome transfection, exosome delivery, or lipid-nanoparticle delivery (LNP).
20. The method according to claim 1, wherein the amount of arRNA in a single introduction into the cells is 5 to 160 nM.
21. The method according to claim 1, wherein several introductions are taken for introducing the arRNA into the cells, and the interval between the adjacent two introductions is ≤21 days.
22. A method for preventing or treating Hurler syndrome, comprising correcting a pathogenic G>A mutation of Hurler syndrome by using the method according to claim 1.
23. An engineered arRNA which is used for targeted editing of a target RNA in a cell based on LEAPER technology, wherein the target RNA comprises a transcript sequence of an α-L-iduronidase (IDUA) gene containing a guanosine (G) to adenosine (A) mutation site (target adenosine), the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and the arRNA is capable of recruiting an adenosine deaminase acting on RNA (ADAR) by hybridization to the target RNA so as to deaminate the target adenosine in the target RNA, the guanosine (G) to adenosine (A) mutation site targeted by the arRNA is NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter) mutation site, or a corresponding mutation site thereof, in the genome of a patient with Hurler syndrome.
24-29. (canceled)
30. A construct comprising the coding sequence of the arRNA according to claim 23.
31. A composition comprising the arRNA according to claim 23.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
DETAIL DESCRIPTION OF THE APPLICATION
Definitions
[0144] The present application will be described herein by giving examples and with reference to the drawings, but the present application is not limited thereto, but is defined only by the claims. Any appended drawing reference markings in the claims should not be construed as limiting the scope. When the term “comprise/include” or “comprising/including” is used in the specification and claims, they do not exclude other components, elements or steps. When a numerical range of nucleotides is used herein, the values of the two endpoints of the range and all integers between the two endpoints are included. For example, for the range of 60-200 nucleotides, any integer number of nucleotides between 60 and 200 nucleotides is covered in addition to the numbers of 60 nucleotides and 260 nucleotides.
[0145] The following terms or definitions are provided only to aid in the understanding of the present application. Unless specifically defined herein, all terms used herein have the same meaning as those used by those skilled in the art of the application. Practitioners may rely on books e.g., Molecular Cloning: a Laboratory Manual (Fourth Edition), (March 2017, published by Science Press, LLC, authors J. Sambrook, M. R. Green, and translator, Fuchu He) to understand definitions and terms in the field. The definitions provided herein should not be construed as having a scope less than that understood by those of ordinary skill in the art.
[0146] As used herein, the term “target site” refers to the nucleotide site in the RNA sequence to be edited.
[0147] The term “dRNA” (Deaminase Recruiting RNA) refers to an engineered RNA capable of recruiting a deaminase e.g., adenosine deaminase acting on RNA (ADAR) to deaminate a target adenosine. It is also referred to as arRNA” (Adenosine Deaminase Recruiting RNA) due to its function of recruiting an adenosine deaminase. In the present application dRNA and arRNA are used interchangeably to denote the same meaning. For example, in the context of the present application, arRNA binds to a segment of RNA in a cell through base complementary pairing and recruits a deaminase, e.g., ADAR, to deaminate a target nucleotide, e.g., adenosine (A), located at the target site of that RNA sequence into, e.g., inosine, thereby enabling editing. Particularly, when the target nucleotide is an adenosine, the target nucleotide is also referred to as “target adenosine” or “target A”. The RNA comprising the target nucleotide is referred to as “target RNA” or “targeted RNA” and the sequence comprising the target nucleotide in the target RNA is referred to as the “target sequence” or “targeted sequence”.
[0148] In the present application, when the arRNA used binds and hybridizes to the target RNA, one nucleotide in the arRNA sequence is directly opposite the target adenosine to be edited in the target RNA. This nucleotide in the arRNA sequence can be a cytidine (C), an adenosine (A) or a uridine (U). The cytidine (C), adenosine (A) and uridine (U) directly opposite the target adenosine are collectively referred to as the “targeting nucleotide” or respectively referred to as the “targeting cytidine (C)”, “targeting adenosine (A)” and “targeting uridine (U)”.
[0149] In this application, all nucleic acid sequences are written in the order from the 5′ to the 3′ end. Therefore, when “first” and “last” are used to describe a sequence in this document, they denote the “5′ end” and the “3′ end” of the the sequence, respectively. Particularly, the nucleotide nearest to any nucleotide in the direction of its 5′ end is called the “5′ most adjacent nucleotide” or “5′ most adjacent nucleoside” of the nucleotide; the nucleotide nearest to any nucleotide in the direction of its 3′ end is called the “3′ most adjacent nucleotide” or “3′ most adjacent nucleoside” of the nucleotide. The linkage between any of the nucleotides and its 5′ most adjacent nucleotide is referred to as a “5′ most adjacent internucleotide linkage”; the linkage between any of the nucleotides and its 3′ most adjacent nucleotide is referred to as a “3′ most adjacent internucleotide linkage”. For example, the most adjacent nucleotides in the 5′ and 3′ end directions of a target nucleotide in a target RNA are referred to as “5′ most adjacent nucleotide of the target nucleotide” and “3′ most adjacent nucleotide of the target nucleotide” respectively; and a nucleotide triplet formed by linking the target nucleotide and its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide is called “target triplet”. Similarly, the most adjacent nucleotides in the direction of the 5′ and 3′ ends of the targeting nucleotide are called “5′ most adjacent nucleotide of the targeting nucleotide” and “3′ most adjacent nucleotide of the targeting nucleotide” respectively; and a nucleotide triplet formed by linking the targeting nucleotide and its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide is called “targeting triplet”.
[0150] The terms “polynucleotide”, “nucleotide sequence” and “nucleic acid” are used interchangeably. They refer to polymeric forms of nucleotides of any length, i.e., the polymeric forms of deoxyribonucleotides (DNA) or ribonucleotides (RNA) or the analogs thereof. The deoxyribonucleotide or ribonucleotide may be referred to as “nucleotide” or “nucleoside”. In this application, unless otherwise indicated, “nucleotide” and “nucleoside” are used interchangeably. Nucleotides are linked to each other by phosphodiester bonds. A plurality of nucleotides are linked by phosphodiester bonds to form a polynucleotide or nucleic acid. Phosphodiester bonds between nucleotides can be phosphorthioated, replacing a double bonded oxygen in the phosphodiester bond with a double bonded sulfur to form a “phosphorothioate bond”, and this process is known as “phosphorothioation modification”.
[0151] In this application, “2′-O-Me” or “2′-OMe”, i.e. 2-0′-methyl, refers to the group formed by replacing the hydrogen atom on the second hydroxyl group on the ribose of a nucleotide with a methyl group. And this process of the methyl substitution is referred to as “2′-O-methylation”, “2′ methylation modification”, “2′-OMe modification” or “2′-O-Me modification”. As used herein, the term “LNA” or “locked nucleic acid” refers to a specific bicyclic nucleotide derivative, in which the ribose 2′ and 4′ form an oxymethylene bridge (a cyclic structure) by condensation. Therefore, the term “locked nucleic acid modification” or “LNA modification” in this application means that the nucleotide is modified to be a locked nucleic acid.
[0152] As used herein, the “deoxyribonucleotide substitution” modification refers to that the ribonucleotide in the RNA is replaced with its corresponding deoxyribonucleotide.
[0153] The term “2′-O-(2-methoxyethyl)” refers to a group formed by the substitution of the hydrogen atom at the second hydroxyl group on the ribose of the modified nucleotide by 2-methoxyethyl, and this process of the substitution by a 2-methoxyethyl is referred to as 2′-O-(2-methoxyethyl) modification.
[0154] Herein, when labeled in a nucleic acid sequence, “*” indicates a phosphorothioate-modified internucleotide linkage, “m” indicates that the nucleotide immediately to its left is modified by 2′-O-methylation, and “moe” indicates that the nucleotide immediately to its left is modified by 2′-O-(2-methoxyethyl), “+” indicates that the nucleotide immediately to its left is modified by LNA, “d” indicates that the nucleotide immediately to its left is substituted by a deoxyribonucleotide. As used herein, when “>” is used between two letters representing nucleotides, nucleosides or bases, it indicates a mutation in which the nucleotide represented by the letter to its left is modified to be the nucleotide represented by the letter to its right. For example, “G>A” indicates a mutation from guanosine to adenosine.
[0155] “Complementation” herein refers to the formation of hydrogen bonds between a nucleic acid and another nucleic acid through the traditional Watson-Crick base pairing principle. Complementation as used herein may refer to that the majority of nucleotides of two nucleic acids are complementary to each other, and not requiring all their nucleotides to be complementary.
[0156] “RNA editing” refers to a natural process present in eukaryotic cells, wherein an editing from base A (adenosine) to I (inosine) occurs at RNA level after DNA transcription and before protein translation, and during translation, inosine is recognized as G (guanosine), resulting in an A>G transition. This editing can occur through deamination of A to form I catalyzed by the ADAR (Adenosine Deaminase Acting on RNA) protease, ultimately producing targeted editing of a single nucleotide. Editing can occur in coding regions including intron and exon sequences, as well as in non-coding region sequences, and the editing of coding regions can redefine protein coding sequences.
[0157] As used herein, a “construct” refers to a nucleic acid comprising an RNA coding sequence or an amino acid coding sequence, wherein the coding sequence can express the RNA or amino acid by transcription or translation. The construct may be cyclic or linear, may be double-stranded or single-stranded, may be DNA or RNA, or a hybrid molecule of DNA and RNA, and may be chemically synthesized or biosynthetically synthesized. In some particular embodiments, the construct is a plasmid. In some particular embodiments, the construct is an oligonucleotide.
[0158] As used herein, “inrtoduce” or “introducting” into a cell refers to the process of making a protein or nucleic acid encoding the protein, RNA or a construct encoding the RNA, plasmid or other linear or circular DNA, etc., to pass through the cell membrane and enter the cell by transfection, infection, endocytosis, etc.
[0159] To address the current situation of lack of reliable therapies for Hurler syndrome, in the present application on the basis of the individualized features of Hurler syndrome, the mutant type (NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter)) with the highest percentage of IDUA causative genes is selected, and based on LEAPER technology, the length of the arRNA and the position of the targeting base are optimized, and at the same time appropriate chemical modifications are introduced to develop the functional RNA of the present application, i.e., arRNA, and the application methods thereof, for the treatment of Hurler syndrome. The arRNA can target and bind RNA sequences encoding α-L-iduronidase (IDUA) containing G>A mutation sites by complementary pairing of base sequences, recruiting deaminase to deaminate the adenosine (A) (target adenosine) of the mutation site to form an inosine (I), which will be recognized as G (guanosine) during translation, thereby realizing an A>G translation. The premature stop codon appeared due to the UGG>UAG mutation in the pre-mRNA or mRNA transcribed from the IDUA gene may be reverted to the codon UGG encoding tryptophan by using the arRNA and the method according to the present application, allowing the synthesis of IDUA enzyme to continue, and restoring the function of IDUA enzyme.
[0160] By constructing a reporter system with the IDUA pathogenic mutation (c.1205G>A), while using GM06214 cells purchased from the Coriell Institute (Hurler syndrome patient-derived fibroblasts (TGG>TAG [Trp402Ter (W402X)] homozygous mutation at position 1293 of the IDUA gene in exon 9), and using GM01323 cells (Scheie syndrome patient-derived fibroblasts, containing a G>A transition (IVS5AS-7G>A) at position −7 of exon 6, i.e., intron 5) as a control, the function and characteristics of the arRNAs of this application were validated. The validation includes transfection of the arRNAs into cells containing the above-mentioned reporter system, or GM06214 cells, and the arRNA editing efficacy was tested by comparing the fluorescence intensity of the repoter system, the function of the IDUA enzyme, or by detecting the A>G editing efficiency or mutation rate by methods such as NGS (second generation sequencing technology).
[0161] RNA Editing Method
[0162] In one aspect, the present application provides a method for targeted editing of a target RNA in a cell based on LEAPER technology, wherein the target RNA comprises a transcript sequence of an IDUA gene containing a guanosine (G) to adenosine (A) mutation site (target adenosine). The method comprises: introducing into the cell an arRNA or a construct comprising the arRNA coding sequence, wherein the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase acting on RNA (ADAR) by hybridization to the target RNA so as to deaminate the target adenosine in the target RNA.
[0163] In some embodiments, the 5′ most adjacent nucleotide of the target adenosine in the target RNA is a nucleotide selected from U, C, A and G, and the order of preference is U>C≈A>G; and the 3′ most adjacent nucleotide of the target adenosine in the target RNA is a nucleotide selected from G, C, A and U, and the order of preference is G>C>A≈U. In some embodiments, in a target RNA, the target adenosine is located in a target triplet selected from the group consisting of: UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU. In some embodiments, the target triplet formed by the target adenosine together with its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide is 5′-UAG-3′. In some embodiments, the target RNA is selected from: pre-mRNA or mRNA transcribed from the IDUA gene. In some embodiments, the target RNA is a pre-mRNA transcribed from an IDUA gene.
[0164] In some embodiments, the arRNA comprises one or more mismatches, wobble pairings and/or unilateral bulges with complementary IDUA coding RNA sequences. In some embodiments, the arRNA does not comprise a region capable of forming an intramolecular stem-loop structure for recruiting an ADAR enzyme.
[0165] In some embodiments, the nucleotide in the arRNA opposite the target adenosine (targeting nucleotide) is a cytidine (C), an adenosine (A), or a uridine (U), preferably C. In some embodiments, the 5′ most adjacent nucleotide of the targeting adenosine is a C, a G, or a U. In some embodiments, the 3′ most adjacent nucleotide of the targeting adenosine is an A. In some embodiments, a targeting triplet is formed by the targeting nucleotide together with its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide, wherein the targeting triplet is 5′-CCA-3′.
[0166] In some embodiments, the length of the arRNA is greater than 61 nt, for example the length of the arRNA is 62-121 nt, 62-111 nt, 62-101 nt, 62-100 nt, 62-91 nt, 62-76 nt or 62-70 nt; in some embodiments, the length of the arRNA is selected from any integer number of nucleotides of 62-121 nt; in some particular embodiments, the length of the arRNA is 62 nt, 63 nt, 64 t, 65 nt, 66 nt, 67 nt, 68 nt, 69 nt, 70 nt, 71 nt, 72 nt, 73 nt, 74 nt, 75 nt, 76 nt, 77 nt, 78 nt, 79 nt, 80 nt 81 nt, 82 nt, 83 nt, 84 nt, 85 nt, 86 nt, 87 nt, 88 nt, 89 nt, 90 nt, 92 nt, 95 nt, 98 nt, 100 nt, 103 nt, or 106 nt.
[0167] In some embodiments, the distance from the targeting nucleotide of the arRNA to the 3′ end of the arRNA is less than the distance from the targeting nucleotide to the 5′ end of the arRNA. In some embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is greater than 8 nt, e.g., 9-60 nt, preferably 9-45 nt, or 9-35 nt; in some embodiments, in order to avoid ultra-long poly G structures where possible, the distance from the targeting nucleotide of the arRNA to its 3′ end is selected from 9-25 nt, 9-26 nt, or 9-27 nt; preferably, in some embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is selected from 9-20 nt, 9-21 nt, or 9-22 nt; in some particular embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is any integer number of nucleotides selected from 9-25 nt, e.g., 10 nt, 11 nt 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 23 nt, or 24 nt. In some embodiments, the distance from the targeting nucleotide of the arRNA to its 5′ end is more than 25 nt, e.g., 26-60 nt, 35-60 nt, or 45-60 nt; in some preferred embodiments, the distance from the targeting nucleotide of the arRNA to its 5′ end is selected from the group consisting of: 45 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, 54 nt, 55 nt, 56 nt, 57 nt, 58 nt, or 59 nt.
[0168] In some embodiments, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is less than the distance from the targeting nucleotide to the 3′ end of the arRNA. In some embodiments, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is greater than 35 nt, e.g., 36-60 nt, or 36-55 nt; preferably, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is selected from the group consisting of: 54 nt, 53 nt, 52 nt, 51 nt, 50 nt, 49 nt, 48 nt, 47 nt, 46 nt, 45 nt, 44 nt, 43 nt, 42 nt, 41 nt, 40 nt, 39 nt, 38 nt, or 36 nt.
[0169] In some embodiments, the arRNA is an arRNA having a length charactorastic selected from the group consisting of: 55 nt-c-35 nt, 55 nt-c-25 nt, 55 nt-c-24 nt, 55 nt-c-21 nt, 55 nt-c-20 nt, 55 nt-c-19 nt, 55 nt-c-18 nt, 55 nt-c-17 nt, 55 nt-c-16 nt, 55 nt-c-15 nt, 55 nt-c-14 nt, 55 nt-c-13 nt, 55 nt-c-12 nt, 55 nt-c-11 nt, 55 nt-c-10 nt, 55 nt-c-9 nt, 50 nt-c-20 nt, 50 nt-c-15 nt, 45 nt-c-55 nt, or 45 nt-c-20 nt. Preferably, the arRNA is an arRNA having a length charactorastic selected from the group consisting of: 55 nt-c-20 nt, 55 nt-c-15 nt, or 55 nt-c-14 nt.
[0170] In some embodiments the arRNA is an oligonucleotide. In some embodiments the arRNA comprises one or more chemical modifications. It should be known to those of skill in the art that some appropriate chemical modifications can improve the editing efficiency of the arRNA by improving the stability of the RNA in the cell or in vivo while ensuring the editing efficiency, for example, adding 2′-O-methylation modifications to the nucleotides at both ends of the RNA, or making the internucleotide linkage undergo phosphorothioation modifications. As can be seen from the embodiments of the present application, the arRNA stability and editing efficiency fo the arRNA sequences according to the present application can be improved by one or more chemical modifications selected from: 2′-O-methylation modification, phosphorothioation modification, deoxyribonucleotide substitution modification, LNA modification, and 2′-O-(2-methoxyethyl) modification. Particularly, in some embodiments, the chemical modifications are one or more selected from the group consisting of:
[0171] 1) 2′-O-methylation modifications in the first 2, 3, 4 or 5 nucleotides;
[0172] 2) 2′-O-methylation modifications in the last 2, 3, 4, or 5 nucleotides;
[0173] 3) 2′-O-methylation modifications in all the cytidines except that in the targeting triplet;
[0174] 4) 2′-O-(2-methoxyethyl) modifications in the first 2, 3 or 4 nucleotides;
[0175] 5) 2′-O-(2-methoxyethyl) modifications in the last 2, 3 or 4 nucleotides;
[0176] 6) deoxyribonucleotide substitution modifications of the first 2, 3 or 4 nucleotides;
[0177] 7) deoxyribonucleotide substitution modifications of the last 2, 3 or 4 nucleotides;
[0178] 8) phosphorothioation modifications in the first 1, 2, 3, 4 or 5 internucleotide linkages;
[0179] 9) phosphorothioation modifications in the last 1, 2, 3, 4 or 5 internucleotide linkages;
[0180] 10) phosphorothioation modifications in all internucleotide linkages except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation; and
[0181] (11) phosphorothioation modifications in internucleotide linkages at an interval of 1, 2, 3, or 4 nucleotides except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation.
[0182] Preferably, in some particular embodiments, the chemical modification is one or more selected from the group consisting of:
[0183] 1) 2′-O-methylation modifications in the first 2, 3, 4 or 5 nucleotides and the last 2, 3, 4, or 5 nucleotides;
[0184] 2) 2′-O-methylation modifications in all the cytidines except that in the targeting triplet;
[0185] 3) 2′-O-(2-methoxyethyl) modifications in the first 2, 3 or 4 nucleotides and the last 2, 3 or 4 nucleotides;
[0186] 4) deoxyribonucleotide substitution modifications of the first 2, 3 or 4 nucleotides and the last 2, 3 or 4 nucleotides;
[0187] 5) phosphorothioation modifications in the first 1, 2, 3, 4 or 5 internucleotide linkages and the last 1, 2, 3, 4 or 5 internucleotide linkages;
[0188] 6) phosphorothioation modifications in all internucleotide linkages, or at least every other internucleotide linkage, except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation.
[0189] In some embodiments, the arRNA comprises any chemical modification selected from the group consisting of:
[0190] CM0, CM1, CM2, CM3, CM4, CM6, CM148, CM149, CM150, CM151, CM152, CM153, CM94, CM119, CM120, CM123, or CM125.
[0191] In some embodiments, the G to A mutation site targeted by the arRNA is a mutation site in NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter), or a corresponding mutation site thereof, in the genome of a patient with Hurler syndrome. In some embodiments, the arRNA comprises any sequence selected from the group consisting of:
TABLE-US-00003 1) (SEQ ID NO: 89) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G-Um*G-Um*G-G*Um-Um*G- Cm*Um-G*Um-Cm*Um-Cm*Cm-A*G-G*A-Cm*G-G*Um-Cm*G-G*U m-Cm*Cm-Cm*G-G*Cm-Cm*Um-G*Cm-G*Cm-Cm*Um-G*Cm-G*Cm- G*A-Cm*A-Cm*Um-Um*Cm-G*G-Cm-C-C-A*G-A*G-Cm*Um-G* Cm-Um*Cm-Cm*Um*Cm*Cm*Am; 2) (SEQ ID NO: 90) Gm*Am*Cm-G*Cm-Cm*Cm-A*-Cm-Cm*G-Um*G-Um*G-G*Um-Um* G-Cm*Um-G*Um-Cm*CM-A*G-G*A-Cm*G-G-G*Um-Cm*G*Cm*G- G*Um-Cm*Cm-Cm*G-G*Cm-Cm*Um-G*Cm-G*Cm*Um-G*-G*-A-Cm *A-Cm*A-Cm*Um-Um*Cm-G*G-Cm*Cd-Cd*Ad*-G-A*G-Cm*Um-G *Cm-Um*Cm-Cm*Um*Cm*Am. 3) (SEQ ID NO: 86) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G-Um*G-Um*G-G*Um-Um*G- G*Um-Um*G-Cm*Um-G*Um-Cm*Cm-A*G-G*A-Cm*-G-G*Um-Cm*- Cm*-G*Um-Cm*G-G*Cm-Cm*Um-G*G-Cm*Um-G*-Cm*Um-G*-Cm- G*A-Cm*A-Cm*A-Cm*Um-Um*Cm-G*G-Cm-Cd-Cd*Ad*G-A*G-Cm *Um-G*Cm-Um*Cm-Cm*Um*Cm*Am; 4) (SEQ ID NO: 87) Gmoe*Amoe*Cmoe*Gmoe-C-C-C-A-C-C-C-G-Um-G-Um-G-G- Um-Um-G-C-Um-G-Um-C-C-A-G-G-G-Um-G-Um-C-C-A-G-G-G- A-G-A-C-G-G-G-Um-C-C-G-Gm-G-C-C-C-A-G-A-G-C-Um-G- C-Um-C*Cmoe*Umoe*Cmoe*Amoe; or 5) (SEQ ID NO: 88) G+*A+*C+*G+C-C-C-A-C-C-C-G-Um-G-Um-G-G-Um-Um-G-C- Um-G-Um-C-C-A-G-G-A-G-G-A-A-G-G-A-C-C-G-G-Um-GA-G- C-Um-G-C-Um-C*C+*U+*C+*A+.
[0192] In some embodiments, the arRNA is introduced into the cell by a method selected from the group consisting of: electroporation, liposome transfection, exosome delivery, or lipid-nanoparticle delivery (LNP). Preferably, the arRNA is introduced into the cell by liposome transfection. In some embodiments, the cell is a human cell. In some embodiments, the cell is selected from the group consisting of: stem cells, chondrocytes, periosteal cells, mesenchymal cells, cardiomyocytes, neural cells, or hepatocytes. In some embodiments, the cell is preferably a hepatocyte.
[0193] In some embodiments, the method for targeted editing of the target RNA in a cell based on LEAPER technology comprises introducing into the cell a plurality, e.g., 2, 3, 4 or more, of arRNAs with different sequences and/or having different chemical modifications.
[0194] In some embodiments, the arRNAs are introduced into the cells by multiple times, e.g., 2, 3, 4, or more times. In some embodiments, the method used for each introduction of arRNA is the same, e.g., all are liposome transfection, or all are lipid-nanoparticle delivery. In some embodiments, the method used for each introduction of the arRNAs is different depending on the state of the cell.
[0195] In some embodiments, the cells are introduced with the arRNA for only once. in some embodiments, the amount of arRNA in a single introduction into the cells is ≥5 nM, preferably ≥10 nM, further preferably ≥20 nM; in some particular embodiments, the amount of arRNA in a single introduction into the cells is 5-160 nM, e.g., 10-160 nM, 20-160 nM 40-160 nM, 20-80 nM, 40-80 nM, or 20-40 nM; in some particular embodiments, the amount of arRNA in a single introduction into the cells is 15 nM, 17 nM, 19 nM, 21 nM, 22 nM, 23 nM, 24 nM, 25 nM, 26 nM, 27 nM, 28 nM, 29 nM, 30 nM, 31 nM, 32 nM, 33 nM, 34 nM, 35 nM, 36 nM, 37 nM, 38 nM, 39 nM, 41 nM, 43 nM, 45 nM, 55 nM, 65 nM, 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135 nM, 145 nM, or 155 nM. In some embodiments, several introductions are taken for introducing the arRNA into the cells, and the interval between the adjacent two introductions is ≤21 days, e.g., ≥17 days, ≥14 days, ≥12 days, ≥11 days, or ≥10 days; in some embodiments, the interval between the adjacent two introductions is 9-20 days, 9-16 days, 9-14 days, 12-19 days, 12-15 days, or 12-13 days; in some embodiments, the interval between the adjacent two introductions is 7 days, 8 days, 11 days, 15 days, 18 days, 19 days, or 20 days.
[0196] In some embodiments, the method for targeted editing of the target RNA in the cell based on LEAPER technology does not include introducing any exogenous protein or coding sequence of an exogenous protein into the cell. In some embodiments, the method further comprises introducing an exogenous ADAR into the patient cell. In some particular embodiments, the exogenous ADAR is ADAR1 comprising the E1008 mutation. In some embodiments, the method may also comprise introducing an inhibitor of ADAR3 into the host cell. In some embodiments, the method further comprises introducing a stimulator of an interferon into the host cell.
[0197] As can be seen from the data and results of the examples of this application, according to the method described in this application the recovery rate (A>G editing efficiency) of the target adenosine (G>A) mutation site is at least about 20%, e.g., at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or higher.
[0198] arRNA
[0199] In one aspect, the present application further provides an arRNA comprising a complementary RNA sequence that hybridizes to a target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase acting on RNA (ADAR) by hybridization to the target RNA so as to deaminate the target adenosine in the target RNA, wherein the target RNA comprises a guanosine (G) to adenosine (A) mutation site (target adenosine). In some embodiments, a target triplet is formed by the target adenosine together with its 5′ most adjacent nucleotide and its 3′ most adjacent nucleotide, wherein the target triplet is 5′-UAG-3′.
[0200] In some embodiments, the arRNA comprises one or more mismatches, wobble pairings and/or unilateral bulges with the complementary IDUA encoding RNA sequence. In some embodiments, the arRNA does not comprise a region capable of forming an intramolecular stem-loop structure for recruiting an ADAR enzyme. In some embodiments, the nucleotide in the arRNA opposite the target adenosine (targeting nucleotide) is a cytidine (C), an adenosine (A), or a uridine (U), preferably a C. In some embodiments, the 5′ most adjacent nucleotide of the targeting adenosine is a C, a G, or a U. In some embodiments, the 3′ most adjacent nucleotide of the targeting adenosine is an A. In some embodiments, a targeting triplet formed by the targeting nucleotide together with its 5′ most adjacent nucleotide and 3′ most adjacent nucleotide is 5′-CCA-3′. In some embodiments, the arRNA further comprises one or more guanosines, each of which is opposite a particular adenosine (non-target adenosine) other than the target adenosine in the target RNA. In some embodiments, the arRNA comprises two or more contiguously mismatched nucleotides opposite non-target adenosines in the target RNA.
[0201] In some embodiments the length of the arRNA is greater than 61 nt, for example the length of the arRNA is 62-121 nt, 62-111 nt, 62-101 nt, 62-100 nt, 62-91 nt, 62-76 nt, or 62-70 nt; in some embodiments the length of the arRNA is an integer number of nucleotides selected from any of 62-121 nt; in some particular embodiments the length of the arRNA is 62 nt, 63 nt, 64 t, 65 nt, 66 nt, 67 nt, 68 nt, 69 nt, 70 nt, 71 nt, 72 nt, 73 nt, 74 nt, 75 nt, 76 nt, 77 nt, 78 nt, 79 nt, 80 nt 81 nt, 82 nt, 83 nt, 84 nt, 85 nt, 86 nt, 87 nt, 88 nt, 89 nt, 90 nt, 92 nt, 95 nt, 98 nt, 100 nt, 103 nt, or 106 nt.
[0202] In some embodiments, the distance from the targeting nucleotide of the arRNA to the 3′ end of the arRNA is less than the distance from the targeting nucleotide to the 5′ end of the arRNA. In some embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is greater than 8 nt, e.g., 9-60 nt, preferably 9-45 nt, or 9-35 nt; in some embodiments, in order to avoid ultra-long poly G structures where possible, the distance from the targeting nucleotide of the arRNA to its 3′ end is selected from: 9-25 nt, 9-26 nt, or 9-27 nt; preferably, in some embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is selected from the group: 9-20 nt, 9-21 nt, or 9-22 nt; in some particular embodiments, the distance from the targeting nucleotide of the arRNA to its 3′ end is any integer number of nucleotides selected from 9-25 nt, e.g., 10 nt, 11 nt 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 23 nt, or 24 nt. In some embodiments, the distance from the targeting nucleotide of the arRNA to its 5′ end is greater than 25 nt, e.g., 26-60 nt, 35-60 nt, or 45-60 nt; in some preferred embodiments, the distance from the targeting nucleotide of the arRNA to its 5′ end is selected from the group consisting of: 45 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, 54 nt, 55 nt, 56 nt, 57 nt, 58 nt, or 59 nt.
[0203] In some embodiments, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is less than the distance from the targeting nucleotide to the 3′ end of the arRNA. In some embodiments, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is greater than 35 nt, e.g., 36-60 nt, or 36-55 nt; preferably, the distance from the targeting nucleotide of the arRNA to the 5′ end of the arRNA is selected from the group consisting of: 54 nt, 53 nt, 52 nt, 51 nt, 50 nt, 49 nt, 48 nt, 47 nt, 46 nt, 45 nt, 44 nt, 43 nt, 42 nt, 41 nt, 40 nt, 39 nt, 38 nt, or 36 nt.
[0204] In some embodiments, the arRNA is an arRNA having a length charactorastic selected from the group consisting of: 55 nt-c-35 nt, 55 nt-c-25 nt, 55 nt-c-24 nt, 55 nt-c-21 nt, 55 nt-c-20 nt, 55 nt-c-19 nt, 55 nt-c-18 nt, 55 nt-c-17 nt 55 nt-c-16 nt, 55 nt-c-15 nt, 55 nt-c-14 nt, 55 nt-c-13 nt, 55 nt-c-12 nt, 55 nt-c-11 nt, 55 nt-c-10 nt, 55 nt-c-9 nt, 50 nt-c-20 nt, 50 nt-c-15 nt, 45 nt-c-55 nt, or 45 nt-c-20 nt. Preferably, the arRNA is an arRNA having a length charactorastic selected from the group consisting of: 55 nt-c-20 nt, 55 nt-c-15 nt, or 55 nt-c-14 nt.
[0205] In some embodiments the arRNA is an oligonucleotide. In some embodiments the arRNA comprises one or more chemical modifications. In some embodiments the chemical modification is one or more selected from the group consisting of: 2′-O-methylation modification, phosphorothioation modification, deoxyribonucleotide substitution modification, LNA modification, and 2′-O-(2-methoxyethyl) modification. In some embodiments, the chemical modification is one or more selected from the group consisting of:
[0206] 1) 2′-O-methylation modifications in the first 2, 3, 4 or 5 nucleotides;
[0207] 2) 2′-O-methylation modifications in the last 2, 3, 4, or 5 nucleotides;
[0208] 3) 2′-O-methylation modifications in all the cytidines except that in the targeting triplet;
[0209] 4) 2′-O-(2-methoxyethyl) modifications in the first 2, 3 or 4 nucleotides;
[0210] 5) 2′-O-(2-methoxyethyl) modifications in the last 2, 3 or 4 nucleotides;
[0211] 6) deoxyribonucleotide substitution modifications of the first 2, 3 or 4 nucleotides;
[0212] 7) deoxyribonucleotide substitution modifications of the last 2, 3 or 4 nucleotides;
[0213] 8) phosphorothioation modifications in the first 1, 2, 3, 4 or 5 internucleotide linkages;
[0214] 9) phosphorothioation modifications in the last 1, 2, 3, 4 or 5 internucleotide linkages;
[0215] 10) phosphorothioation modifications in all internucleotide linkages except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation; and
[0216] (11) phosphorothioation modifications in internucleotide linkages at an interval of 1, 2, 3, or 4 nucleotides except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation.
[0217] Preferably, in some particular embodiments the chemical modification is one or more selected from the group consisting of:
[0218] 1) 2′-O-methylation modifications in the first 2, 3, 4 or 5 nucleotides and the last 2, 3, 4, or 5 nucleotides;
[0219] 2) 2′-O-methylation modifications in all the cytidines except that in the targeting triplet;
[0220] 3) 2′-O-(2-methoxyethyl) modifications in the first 2, 3 or 4 nucleotides and the last 2, 3 or 4 nucleotides;
[0221] 4) deoxyribonucleotide substitution modifications of the first 2, 3 or 4 nucleotides and the last 2, 3 or 4 nucleotides;
[0222] 5) phosphorothioation modifications in the first 1, 2, 3, 4 or 5 internucleotide linkages and the last 1, 2, 3, 4 or 5 internucleotide linkages;
[0223] 6) phosphorothioation modifications in all internucleotide linkages, or at least every other internucleotide linkage, except that one or more of the 5′ or 3′ most adjacent internucleotide linkages of each of the nucleotides in the targeting triplet are not modified by phosphorothioation.
[0224] In some embodiments, the arRNA comprises any chemical modification selected from the group consisting of:
[0225] CM0, CM1, CM2, CM3, CM4, CM6, CM148, CM149, CM150, CM151, CM152, CM153, CM94, CM119, CM120, CM123, or CM125.
[0226] In some embodiments, the target RNA targeted by the arRNA is selected from: pre-mRNA, mature mRNA, ribosomal RNA, transfer RNA, long-stranded non-coding RNA, or small RNA. In some embodiments, the target RNA is a pre-messenger RNA. In some embodiments, the target RNA is a transcript sequence of an IDUA gene. In some embodiments, the target RNA is a pre-mRNA or mature mRNA transcribed from the IDUA gene. In some embodiments, the target RNA is a pre-mRNA transcribed from the IDUA gene. In some embodiments, the target RNA comprises a mutation site equivalent to NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter) mutation site in the genome of a patient with Hurler syndrome, and when the arRNA hybridizes to the target RNA, the targeting nucleotide of the arRNA is opposite to the mutation site in the target RNA. Meanwhile, the mutation site is the target nucleotide of the arRNA. In some embodiments, the arRNA may be used in the RNA editing method previously described.
[0227] In some embodiments, the arRNA comprises any sequence selected from the group consisting of:
TABLE-US-00004 1) (SEQ ID NO: 89) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G-Um*G-Um*G-G*Um-Um*G- Cm*Um-G*Um-Cm*Um-Cm*Cm-A*G-G*A-Cm*G-G*Um-Cm*G-G* Um-Cm*Cm-Cm*G-G*Cm-Cm*Um-G*Cm-G*Cm-Cm*Um-G*Cm-G* Cm-G*A-Cm*A-Cm*Um-Um*Cm-G*G-Cm-C-C-A*G-A*G-Cm*Um- G*Cm-Um*Cm-Cm*Um*Cm*Cm*Am; 2) (SEQ ID NO: 90) Gm*Am*Cm-G*Cm-Cm*Cm-A*-Cm-Cm*G-Um*G-Um*G-G*Um-Um* G-Cm*Um-G*Um-Cm*CM-A*G-G*A-Cm*G-G-G*Um-Cm*G*Cm*G- G*Um-Cm*Cm-Cm*G-G*Cm-Cm*Um-G*Cm-G*Cm*Um-G*-G*-A-Cm *A-Cm*A-Cm*Um-Um*Cm-G*G-Cm*Cd-Cd*Ad*-G-A*G-Cm*Um-G *Cm-Um*Cm-Cm*Um*Cm*Am; 3) (SEQ ID NO: 86) Gm*Am*Cm-G*Cm-Cm*Cm-A*Cm-Cm*G-Um*G-Um*G-G*Um-Um*G- G*Um-Um*G-Cm*Um-G*Um-Cm*Cm-A*G-G*A-Cm*-G-G*Um-Cm*- Cm*-G*Um-Cm*G-G*Cm-Cm*Um-G*G-Cm*Um-G*-Cm*Um-G*-Cm- G*A-Cm*A-Cm*A-Cm*Um-Um*Cm-G*G-Cm-Cd-Cd*Ad*G-A*G-Cm *Um-G*Cm-Um*Cm-Cm*Um*Cm*Am; 4) (SEQ ID NO: 87) Gmoe*Amoe*Cmoe*Gmoe-C-C-C-A-C-C-C-G-Um-G-Um-G-G- Um-Um-G-C-Um-G-Um-C-C-A-G-G-G-Um-G-Um-C-C-A-G-G-G- A-G-A-C-G-G-G-Um-C-C-G-Gm-G-C-C-C-A-G-A-G-C-Um-G- C-Um-C*Cmoe*Umoe*Cmoe*Amoe; or 5) (SEQ ID NO: 88) G+*A+*C+*G+C-C-C-A-C-C-C-G-Um-G-Um-G-G-Um-Um-G-C- Um-G-Um-C-C-A-G-G-A-G-G-A-A-G-G-A-C-C-G-G-Um-GA-G- C-Um-G-C-Um-C*C+*U+*C+*A+.
[0228] Construct, Composition, Particle, Cell, Library or Kit
[0229] In one aspect, the present application also provides a construct comprising a coding sequence of the arRNA previously described herein. In some embodiments, the construct is a single-stranded DNA. In some embodiments, the construct is a double-stranded DNA. In some embodiments, the construct is a hybrid molecule of RNA and DNA. In some embodiments, the construct is a double-stranded RNA. In some embodiments, the construct comprises an antisense nucleic acid sequence of the arRNA.
[0230] In some embodiments, the construct is in the form of a loop. In some embodiments, the construct is linear.
[0231] In some embodiments, the construct is a plasmid. In some embodiments, the construct comprises all or part of the genome of a virus. In some embodiments, the virus is selected from AAV, lentivirus, phage, or baculovirus. Thus, the present application also provides a virus comprising the construct. In one aspect, the present application also provides a compositions, a liposome, an exosome, a lipid-nanoparticle, a cell, a library, or a kit comprising an aforementioned arRNA or an aforementioned construct. In some embodiments, the composition, liposome, exosome, lipid-nanoparticle, cell, library, or kit comprises only one of the aforementioned arRNAs or constructs comprising the arRNA coding sequences. In some embodiments, the composition, liposome, exosome, lipid-nanoparticle, cell, library, or kit comprises two or more of the aforementioned arRNAs or constructs comprising the arRNA coding sequences.
[0232] In some embodiments, the composition is a pharmaceutical composition, so that the composition further comprises one or more pharmaceutically acceptable excipients.
[0233] In some embodiments, the cell comprises the construct, and the construct is located in the cytoplasm. In some embodiments, the cell comprises the construct, and the construct is a part of the genomic DNA.
[0234] Method for Preventing or Treating Hurler Syndrome
[0235] In one aspect, the present application also provides a method for treating or preventing Hurler syndrome, the method comprises administering to a patient (with Hurler syndrome having a mutation site equivalent to NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter)) an aforementioned arRNA, or a aforementioned construct, liposome, exosome, lipid-nanoparticle or cell, or preventing or treating the symptoms associated with Hurler syndrome in a patient by the aforementioned RNA editing method.
[0236] In some embodiments, the administration is selected from: intravenous injection, subcutaneous injection, arterial perfusion, intramuscular injection, single organ local injection, or intracranial injection. In some embodiments, the administration is a single administration, for example a single infusion of cells comprising the arRNA coding sequence to the patient, thereby allowing the cells to colonize in a particular tissue.
[0237] In some embodiments, the administration is performed 2, 3, or more times. In some embodiments, the interval between two adjacent administrations is longer than 21 days. In some embodiments, the interval between two adjacent administrations is ≥17 days, ≥14 days, ≥12 days, ≥11 days, or ≥10 days. In some embodiments, the interval between the two adjacent introductions is 9-20 days, 9-16 days, 9-14 days, 12-19 days, 12-15 days, or 12-13 days. In some embodiments, the interval between two adjacent introductions is 7 days, 8 days, 11 days, 15 days, 18 days, 19 days, 20 days.
[0238] In some embodiments, the administration maintains arRNA concentration in the target tissue at ≥5 nM, preferably ≥10 nM, further preferably ≥20 nM. In some particular embodiments, the administration maintains arRNA concentration in the target tissue at 5-160 nM, e.g., 10-160 nM, 20-160 nM, 40-160 nM, 20-80 nM, 40-80 nM, or 20-40 nM. In some particular embodiments, the administration maintains arRNA concentration in the target tissue at 15 nM, 17 nM, 19 nM, 21 nM, 22 nM, 23 nM, 24 nM, 25 nM, 26 nM, 27 nM, 28 nM, 29 nM, 30 nM, 31 nM, 32 nM, 33 nM, 34 nM, 35 nM, 36 nM, 37 nM, 38 nM, 39 nM, 41 nM, 43 nM, 45 nM, 55 nM, 65 nM, 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135 nM, 145 nM, or 155 nM.
[0239] The technical solutions of the present application are further described in detail below with reference to the following specific examples, but the application is not limited to these examples. If not specifically noted, the reagents involved below are commercially available. For the sake of simplicity, some of the operations are not detailed in terms of the parameters, the steps and the apparatus used in the operations, it should be understood that these are well known and reproducible by those skilled in the art.
EXAMPLES
[0240] The cells, GM06214 and GM01323, used herein were purchased from Coriell, USA, wherein GM06214 was a fibroblast derived from a patient with Hurler syndrome with a mutation from G to A at nucleotide 1293 in exon 9 of the IDUA gene, and the codon of which was mutated from TGG to TAG, ([Trp402Ter (W402X)]) (the above description of the cell was from the product specification, wherein the mutation described corresponds to NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter) mutation). While GM01323 was a fibroblast derived from a patient with Scheie syndrome (SDS), whose IDUA activity was 0.3% of that in healthy human-derived fibroblasts. Compared to Hurler syndrome, the symptoms of Scheie syndrome are relatively mild. Therefore, GM01323 was used as a positive control of IDUA enzyme activity, and GM06214 was used as a disease model and test cell in the following examples.
Example 1: Detection of Genotype of GM06214 Mutant
[0241] GM06214 cells were placed in fibroblast culture medium (ScienCell, FM medium, Catalog. No. 2301) containing 15% serum and added with 1% fibroblast growth supplement (ScienCell, GFS, Catalog. No. 2301), incubating for 2-3 days at 37° C. in a 5% CO.sub.2 incubator. When cell confluence reached 90%, the cells were digested with 0.25% trypsin, then the digestion was terminated by using a fibroblast culture medium containing 15% serum. DNA extraction was performed by using the TianGene® (TIANGEN Biotech (Beijing) Co., Ltd.) Cell DNA Extraction Kit (Catalog. No. DP304-03) according to the operating instructions.
[0242] Primer design for the upstream and downstream sequences of IDUA target sites was performed by using NCBI-Primer blast (URL: https://www.ncbi.nlm.nih.gov/tools/primer-blast/). SEQ ID NO: 1: CGCTTCCAGGTCAACAACAC (forward primer hIDUA-F1); SEQ ID NO: 2: CTCGCGTAGATCAGCACCG (reverse primer hIDUA-R1). PCR reactions were performed, and PCR products were subjected to sanger sequencing. As shown in
Example 2: Detection of IDUA Enzyme Activity and Editing Efficiency after Electroporation of GM06214 Cells with arRNA
[0243] The following arRNA sequences were designed and synthesized for the upstream and downstream sequences of the target sites in the mRNA precursor (pre-mRNA) and the mature mRNA after transcription of the IDUA gene:
TABLE-US-00005 Targeting arRNA for the pre-mRNA: (SEQ ID NO: 3, Pre-55 nt-c-55 nt) GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCG GCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCCA GCAGCGCCAGCAGCCCCAUGGCCGUGAGCACCGGCUU. Targeting arRNA for the mature mRNA: (SEQ ID NO: 4, m-55 nt-c-55 nt) GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCG GCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCUG CGGGGCGGGGGGGGGCCGUCGCCGCGUGGGGUCGUUG. Randomly designed non-targeting arRNA: (SEQ ID NO: 5, Random-111 nt) UACCGCUACAGCCACGCUGAUUUCAGCUAUACCUGCC CGGUAUAAAGGGACGUUCACACCGCGAUGUUCUCUGC UGGGGAAUUGCGCGAUAUUCAGGAUUAAAAGAAGUGC;
[0244] Particularly, the bases in the arRNAs targeting the mutation sites (target adenosine of the target sequence) of the mRNA precursor (pre-mRNA) and the mature mRNA was C, such that an A-C mismatch was formed between the target adenosine and the base in the arRNA corresponding to the target adenosine. The length of the synthesized arRNA was chosen to be 111 nt. The synthesized arRNA was chemically modified with the pattern of CM0 (the first 3 and last 3 nucleotides in the arRNA sequence were modified by 2′-O-methylation, and the first 3 and last 3 internucleotide linkages were modified by phosphorothioation modification, respectively). Cells were electroporated by the following steps.
[0245] The cells were digested when the GM06214 cells grew to approximately 90% confluence, then terminating the digestion and counting. For electroporation, 6 million cells were resuspended with 400 μl of premixed electroporation solution (Lonza, Catalog. No. V4XP-3024), then adding 20 μg of arRNA to mix well, taking each 20 μl as one electroporation system, and performing electroporation by using the preset electroporation conditions of the Lonza Nucleofector electroporation instrument. After electroporation, the cells were rapidly transferred into 2 ml of fibroblast culture medium (ScienCell, FM medium, Catalog. No. 2301) containing 15% serum, and inoculated in 6-well plates. The cells were incubated in a 37° C., 5% CO.sub.2 incubator.
[0246] Forty-eight hours after electroporation, cells were collected and assayed for enzyme activity and A to G mutation rate in IDUA mRNA.
[0247] Detection of a to G Mutation Rate in IDUA mRNA
[0248] The designed synthetic arRNA was dissolved to the desired concentration with RNAase-free water (Transgen Biotech, Catalog. No. GI201-01,) and stored at −80° C. Cells were digested when GM06214 cells grew to approximately 90% confluence, counting after termination of the digestion. One million cells were taken to add 200 pmol of arRNA, and electroporation was performed in a volume of 100 μl. Forty-eight hours after electroporation, the cells were counted and the viability was measured. The cells were transferred into RNAase-free centrifuge tubes, and the supernatant was discarded, and RNA was extracted by using the QIAGEN RNA extraction kit (QIAGEN, Catalog. No. 74134). According to the instructions, 0.35 ml of Buffer RLT Plus was added as per 5×10.sup.5 cells to mix by pipetting up and down (if frozen cells were derectly used for RNA extraction, washing once with PBS). Suspension of lysed cells was added to a gDNA Eliminator centrifuge column, centrifuging at ≥8000 g for 30 s, then discarding the column to leave the liquid. 70% ethanol of the volume was added to mix by pippeting up and down, then immediately performing the next step. The liquid was added to the RNeasyMinElute centrifuge column centrifuging at ≥8000 g for 15 s, then discarding the waste liquid. 700 μl of Buffer RW1 was added to the RNeasyMinElute centrifuge column, centrifuging at ≥8000 g for 15 s, then discarding the waste solution. 500 μl of Buffer RPE was added to the RNeasyMinElute column, centrifuging at ≥8000 g for 15 s, then discarding the waste liquid. 500 μl of 80% ethanol was added to the RNeasyMinElute centrifuge column, centrifuging at ≥8000 g for 2 min, then discarding the waste liquid. The RNeasyMinElute centrifuge column was placed into a 2 ml collection tube, centrifuging at maximum speed with the cap open for 5 min to allow the column to dry. The RNeasyMinElute centrifuge column was placed into a 1.5 ml collection tube, and 14 μl of RNAase-free water was added dropwise at the center of the centrifuge column membrane, then centrifuging at maximum speed for 1 min to elute RNA.
[0249] The concentration of the extracted RNA was measured with Nanodrop (Thermo, Catalog. No. Nanodrop2000), and 1 μg RNA was used for reverse transcription (Thermo, reverse transcriptase Catalog. No. 28025013). The reverse transcription system was configured as in Table 1, after incubating at 65° C. for 5 min, it is immediately cooled in an ice bath. Then the system as shown in Table 2 was used to incubate continuously at 37° C. for 50 minutes. The reverse transcriptase was then inactivated at 70° C. for 15 minutes. PCR was performed by using the PCR primers in Example 1 under the conditions shown in Table 3. After PCR, 2 μl of PCR product was taken for agarose gel electrophoresis, and the concentration of the PCR product and the correct band size were initially determined based on the electrophoresis results. After purification, the PCR product was used for library preparation, and sent for second-generation sequencing.
[0250] All subsequent tests involving reverse transcription were performed by using the reverse transcription system and procedures in this example.
TABLE-US-00006 TABLE 1 Configuration-1 of the reverse transcription system Volume (μl) Total RNA(1 μg) X Oligo dT 1 10 nM dNTP 1 RNase free water 10-X Total volume 12
TABLE-US-00007 TABLE 2 Configuration-2 of the reverse transcription system Volume (μl) System of table 1 12 μl 5X First-Strand buffer 4 0.1M DTT 2 RNaseOUT ™ recombinant nuclease inhibitor 1 M-MLV 1 Total volume 20
TABLE-US-00008 TABLE 3 PCR conditions Steps Time Cycle 98° C. 2 min 1 cycle 98° C. 15 s 28-35 cycles 63° C. 30 s 72° C. 15 s 72° C. 2 min 1 cycle
[0251] Enzyme Activity Detection
[0252] After digestion, the GM06214 cells were centrifuged, then resuspending in 28 μl of 1×PBS containing 0.1% Triton X-100, and lysing on ice for 30 min. Then 25 μl of cell lysate was added to 25 μl of substrate containing 190 μm 4-methylumbelliferyl-α-L-iduronidase (Cayman, 2A-19543-500, dissolved in 0.4 M sodium formate buffer containing 0.2% Triton X-100, pH 3.5), incubating for 90 min at 37° C. in the dark. 200 μl of 0.5 M NaOH/glycine solution (Beijing Chemical, NAOH, Catalog. No. AR500G; Solarbio, Glycine Catalog. No. G8200) with PH=10.3 was added to inactivate the catalytic reaction, centrifuging at 4° C. for 2 min. The supernatant was transferred to 96-well plates, and the fluorescence values were measured on an Infinite M200 instrument (TECAN) with 365 nm and 450 nm excitation wavelengths.
[0253] The results of this example were shown in
Example 3: Detection of Editing Efficiency of IDUA Target Site on IDUA-Reporter Cell Line after Electroporation of arRNA
[0254] As shown in
[0255] After cells were separately transfected with different arRNAs with the electroporation conditions in Example 2, the ratio of GFP-positive cells was detected from day 1 to day 7 respectively, for a preliminary comparison of editing efficiency. As seen in
TABLE-US-00009 TABLE 4 111 nt-random SEQ ID NO: 5 uaccgcuacagccacgcugauuuca gcuauaccugcccgguauaaaggga cguucacaccgcgauguucucugcu ggggaauugcgcgauauucaggauu aaaagaagugc 91 nt-random SEQ ID NO: 6 uaauccugaauaucgcgcaauuccc cagcagagaacaucgcggugugaac gucccuuuauaccgggcagguauag cugaaaucagcguggc 71 nt-random SEQ ID NO: 7 uuucagcuauaccugcccgguauaa agggacguucacaccgcgauguucu cugcuggggaauugcgcgaua 51 nt-random SEQ ID NO: 8 uuccccagcagagaacaucgcggug ugaacgucccuuuauaccgggcagg u 55 nt-c-55 nt SEQ ID NO: 4 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucaucugc ggggcgggggggggccgucgccgcg uggggucguug 45 nt-c-45 nt SEQ ID NO: 9 gugugguugcuguccaggacggucc cggccugcgacacuucggcccagag cugcuccucaucugcggggcggggg ggggccgucgccgcgu 35 nt-c-35 nt SEQ ID NO: 10 uguccaggacggucccggccugcga cacuucggcccagagcugcuccuca ucugcggggcgggggggggcc 25 nt-c-25 nt SEQ ID NO: 11 ggucccggccugcgacacuucggcc cagagcugcuccucaucugcggggc g
Example 4: Detection of RNA Editing Efficiency at Different Time Points after ELectroporation of GM06214 Cells with Different Lengths of arRNA
[0256] Different lengths of arRNA (see Table 4, each arRNA was chemically modified in the CM0 pattern) were electroporated into GM06214 cells by using the electroporation conditions in Example 2, after the electroporation, intracellular enzyme activity was respectively detected on day 2, 4, 6, 8, 10, 12 and 14, and the A to G mutation rate of the RNA target sites in the cells was also detected on day 2 and day 4 by the method in Example 3, respectively. The results are shown in
Example 5: arRNA Optimization
[0257] Through literature research, we believe that the electroporation approach cannot fully meet the purpose of future disease treatment. Therefore, we tested the liposome transfection method. For example, in this example, we used lipofectamineRNAiMAX (Invitrogen 13778-150) to transfect arRNA. Firstly, we designed new arRNAs by truncating the sequence at both ends on the basis of 111 nt, and later the design was extended by fixing one end while truncating from the other end. By this design method, 14 arRNA sequences were generated. Four random sequences (random) were also designed as controls. The arRNA sequences used in this example are shown in Table 5 below. Each arRNA was chemically modified with the CM0 pattern. By testing the enzyme activity of IDUA at 48 h after transfection (same method as Example 3), it was found that the editing efficiency decreases when the arRNA length is equal to or more than 111 nt; and in the case of equal length of arRNA, higher editing efficiency may be achieved when the sequence lengths flanking the targeting nucleotide C are not the same, and when the length of the 5′ end flanking sequence of the targeting nucleotide C is greater than that of 3′ end flanking sequence, the editing efficiency tends to be higher (
[0258] Furthermore, in the arRNAs tested in this example, cells edited with the following arRNAs have better IDUA enzyme activity: 45 nt-c-55 nt (SEQ ID NO: 17) having a total length of 101 nt, 55 nt-c-35 nt (SEQ ID NO: 13) having a total length of 91 nt, 55 nt-c-25 nt (SEQ ID NO: 24) having a total length of 81 nt, and 55 nt-c-15 nt (SEQ ID NO: 25) having a total length of 71 nt.
TABLE-US-00010 TABLE 5 111 nt-random SEQ ID NO: 5 uaccgcuacagccacgcugauuuca gcuauaccugcccgguauaaaggga cguucacaccgcgauguucucugcu ggggaauugcgcgauauucaggauu aaaagaagugc 91 nt-random SEQ ID NO: 6 uaauccugaauaucgcgcaauuccc cagcagagaacaucgcggugugaac gucccuuuauaccgggcagguauag cugaaaucagcguggc 71 nt-random SEQ ID NO: 7 uuucagcuauaccugcccgguauaa agggacguucacaccgcgauguucu cugcuggggaauugcgcgaua 51 nt-random SEQ ID NO: 8 uuccccagcagagaacaucgcggug ugaacgucccuuuauaccgggcagg u 55 nt-c-55 nt SEQ ID NO: 4 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucaucugc ggggcgggggggggccgucgccgcg uggggucguug 45 nt-c-45 nt SEQ ID NO: 9 gugugguugcuguccaggacggucc cggccugcgacacuucggcccagag cugcuccucaucugcggggcggggg ggggccgucgccgcgu 35 nt-c-35 nt SEQ ID NO: 10 uguccaggacggucccggccugcga cacuucggcccagagcugcuccuca ucugcggggcgggggggggcc 25 nt-c-25 nt SEQ ID NO: 11 ggucccggccugcgacacuucggcc cagagcugcuccucaucugcggggc g 55 nt-c-45 nt SEQ ID NO: 12 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucaucugc ggggcgggggggggccgucgccgcg u 55 nt-c-35 nt SEQ ID NO: 13 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucaucugc ggggcgggggggggcc 55 nt-c-25 nt SEQ ID NO: 14 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucaucugc ggggcg 55 nt-c-15 nt SEQ ID NO: 15 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagcugcuccucau 55 nt-c-5 nt SEQ ID NO: 16 gacgcccaccgugugguugcugucc aggacggucccggccugcgacacuu cggcccagagc 45 nt-c-55 nt SEQ ID NO: 17 gugugguugcuguccaggacggucc cggccugcgacacuucggcccagag cugcuccucaucugcggggcggggg ggggccgucgccgcguggggucguu g 35 nt-c-55 nt SEQ ID NO: 18 uguccaggacggucccggccugcga cacuucggcccagagcugcuccuca ucugcggggcgggggggggccgucg ccgcguggggucguug 25 nt-c-55 nt SEQ ID NO: 19 ggucccggccugcgacacuucggcc cagagcugcuccucaucugcggggc gggggggggccgucgccgcgugggg ucguug 15 nt-c-55 nt SEQ ID NO: 20 ugcgacacuucggcccagagcugcu ccucaucugcggggcgggggggggc cgucgccgcguggggucguug 5 nt-c-55 nt SEQ ID NO: 21 cggcccagagcugcuccucaucugc ggggcgggggggggccgucgccgcg uggggucguug
Example 6: Screening for the Optimal Length from the Editing Site to the 3′ End
[0259] The IDUA gene RNA contains a plurality of contiguous cytidines (C's) near the target site. therefore, when designing an arRNA complementary to the target RNA sequence, the counterpart to the plurality of contiguous C's is a plurality of guanosines (G's). Poly G consisting of a plurality of G's are difficult to synthesize at the current level of chemical synthesis technology, and should therefore be avoided. Since the plurality of G's are located at position 20 nt from the target site (4 contiguous G's), and position 25 nt (9 contiguous G's) in the direction of the 3′ end of the targeting nucleotide. Therefore, in all subsequent examples, we tried to make the 3′ end flanking sequence of the targeting nucleotide C of the designed arRNA less than 25 nt to avoid poly G structures as much as possible, with the preferred 3′ end flanking sequence of the targeting nucleotide C is less than 20 nt.
[0260] Since in Example 6, we detected higher IDUA enzyme activity and A to G mutation rate for 81 nt:55-c-25 and 71 nt:55-c-15 sequences, reflecting their relatively high editing efficiency. To find a shorter and better length of the 3′ end flanking sequence of the targeting nucleotide C, we also designed and tested sequences starting from a distance (from the editing site to the 3′ end) from 25 nt (81 nt:55-c-25) to 10 nt (66 nt:55 nt-c-10 nt). arRNA sequences are shown in Table 6. Each arRNA was chemically modified with the CM0 pattern. GM06214 cells were transfected with lipofectamineRNAiMAX, then inoculating in 6-well plates with 3*10.sup.5 cells per well one day before transfection, and fresh culture medium was changed for the cells on the day of transfection. Cells were transfected with arRNA at a concentration of 20 nM. Cells were collected 48 hours after transfection for enzyme activity detection.
[0261] Enzyme activity detection method was performed as follows: GM06214 cells were digested to centrifuge, then resuspending with 33 μl of 1×PBS containing 0.1% Triton X-100. After lysis on ice for 30 min, the cells were centrifuged at 4° C. for 2 min. Then 25 μl of cell lysate was added to 25 μl of substrate containing 190 μM 4-methylumbelliferyl-α-L-iduronidase (Glycosynth, 44076). The substrate was dissolved in a buffer containing 0.4 M sodium formate and 0.2% Triton X-100 (pH 3.5) to incubate at 37° C. for 30 min in the dark. Afterwards, 200 μl of 0.5 M NaOH/glycine solution (pH 10.3) (Beijing Chemical Industry, NAOH, Catalog. No. AR500G; Solarbio, Glycine Catalog. No. G8200) was added to inactivate the catalytic reaction. Fluorescence values were measured by using an Infinite M200 instrument (TECAN) and excitation lights of 365 nm and 450 nm. Cell lysates were taken for concentration measurement.
[0262] As shown in
[0263] Combining the data of Example 6 with the results of
TABLE-US-00011 TABLE 6 55 nt-c-25 nt SEQ ID NO: 14: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcggggcg 55 nt-c-24 nt SEQ ID NO: 22: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcggggc 55 nt-c-23 nt SEQ ID NO: 23: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcgggg 55 nt-c-22 nt SEQ ID NO: 24: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcggg 55 nt-c-21 nt SEQ ID NO: 25: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcgg 55 nt-c-20 nt SEQ ID NO: 26: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcg 55 nt-c-19 nt SEQ ID NO: 27: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugc 55 nt-c-18 nt SEQ ID NO: 28: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucug 55 nt-c-17 nt SEQ ID NO: 29gacgcccaccgugugguugcuguccaggacggu cccggccugcgacacuucggcccagagcugcuccu caucu 55 nt-c-16 nt SEQ ID NO: 30: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca uc 55 nt-c-15 nt SEQ ID NO: 15: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca u 55 nt-c-14 nt SEQ ID NO: 31 gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca 55 nt-c-13 nt SEQ ID NO: 32: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuc 55 nt-c-12 nt SEQ ID NO: 33: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccu 55 nt-c-11 nt SEQ ID NO: 34: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcucc 55 nt-c-10 nt SEQ ID NO: 35: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuc 55 nt-c-9 nt SEQ ID NO: 36: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcu 55 nt-c-8 nt SEQ ID NO: 37: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugc 55 nt-c-7 nt SEQ ID NO: 38: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcug 55 nt-c-6 nt SEQ ID NO: 39: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcu 55 nt-c-5 nt SEQ ID NO: 16: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagc random-70 nt SEQ ID NO: 40: uaccgcuacagccacgcugauuucagcuauaccug cccgguauaaagggacguucacaccgcgaugu ucu random-67 nt SEQ ID NO: 41: uaccgcuacagccacgcugauuucagcuauaccug cccgguauaaagggacguucacaccgcgaug
Example 7: Screening for Optimal 5′ End Length Under the Condition that the Preferred 3′ End Length was Fixed
[0264] We selected 2 different lengths of arRNAs: 76 nt:55-c-20, 71 nt:55-c-15, with a fixed length of the 3′ end flanking sequence of the targeting nucleotide, the 5′ end was gradually truncated, as shown in Table 7. Each arRNA was chemically modified with the CM0 pattern. After transfecting GM06214 cells with lipofectamine RNAiMAX, the IDUA enzyme activity was measured with tests. The results are shown in
TABLE-US-00012 TABLE 7 55 nt-c-20 nt SEQ ID NO: 26: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca ucugcg 50 nt-c-20 nt SEQ ID NO: 42: ccaccgugugguugcuguccaggacggucccggcc ugcgacacuucggcccagagcugcuccucaucugc g 45 nt-c-20 nt SEQ ID NO: 43: gugugguugcuguccaggacggucccggccugcga cacuucggcccagagcugcuccucaucugcg 40 nt-c-20 nt SEQ ID NO: 44: guugcuguccaggacggucccggccugcgacacuu cggcccagagcugcuccucaucugcg 35 nt-c-20 nt SEQ ID NO: 45: uguccaggacggucccggccugcgacacuucggcc cagagcugcuccucaucugcg 55 nt-c-15 nt SEQ ID NO: 15: gacgcccaccgugugguugcuguccaggacggucc cggccugcgacacuucggcccagagcugcuccuca u 50 nt-c-15 nt SEQ ID NO: 46: ccaccgugugguugcuguccaggacggucccggcc ugcgacacuucggcccagagcugcuccucau 45 nt-c-15 nt SEQ ID NO: 47: gugugguugcuguccaggacggucccggccugcga cacuucggcccagagcugcuccucau 40 nt-c-15 nt SEQ ID NO: 48: guugcuguccaggacggucccggccugcgacacuu cggcccagagcugcuccucau 35 nt-c-15 nt SEQ ID NO: 49: uguccaggacggucccggccugcgacacuucggcc cagagcugcuccucau
Example 8: Study of the Effect of Targeting Nucleotide Position Shift on the Editing Efficiency of the Target Site
[0265] Three lengths of arRNAs were selected from the previous examples to study the effect of targeting nucleotide position shift on the editing efficiency of the target site. A series of arRNA sequences were designed by gradually moving the targeting nucleotide from the central position to the 3′ end direction, while considering the requirement of arRNA synthesis to avoid some unfavorable structures for synthesis. arRNAs are shown in Table 8. Each arRNA was chemically modified with the CM0 pattern. Samples were collected for enzyme activity detection (the enzyme activity detection was performed according to the method in Example 7, and the results were shown as folds of the IDUA enzyme activity in GM01323) 48 hrs after transfecting GM06214 cells with lipofectamineRNAiMAX. The experimental results are shown in
TABLE-US-00013 TABLE 8 67 nt 55 nt-c-11 nt gacgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggccca gagcugcucc (SEQ ID NO: 34) 54 nt-c-12 nt acgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccag agcugcuccu (SEQ ID NO: 50) 53 nt-c-13 nt cgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccaga gcugcuccuc (SEQ ID NO: 51) 52 nt-c-14 nt gcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagag cugcuccuca (SEQ ID NO: 52) 51 nt-c-15 nt cccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagc ugcuccucau (SEQ ID NO: 53) 50 nt-c-16 nt ccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcu gcuccucauc (SEQ ID NO: 54) 49 nt-c-17 nt caccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcug cuccucaucu (SEQ ID NO: 55) 48 nt-c-18 nt accgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugc uccucaucug (SEQ ID NO: 56) 47 nt-c-19 nt ccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcu ccucaucugc (SEQ ID NO: 57) 46 nt-c-20 nt cgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcuc cucaucugcg (SEQ ID NO: 58) 45 nt-c-21 nt gugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcucc ucaucugcgg (SEQ ID NO: 59) 44 nt-c-22 nt ugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcuccu caucugcggg (SEQ ID NO: 60) 43 nt-c-23 nt gugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcuccuc aucugcgggg (SEQ ID NO: 61) 70 nt 55 nt-c-14 nt gacgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggccca gagcugcuccuca (SEQ ID NO: 31) 54 nt-c-15 nt acgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccag agcugcuccucau (SEQ ID NO: 62) 53 nt-c-16 nt cgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccaga gcugcuccucauc (SEQ ID NO: 63) 52 nt-c-17 nt gcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagag cugcuccucaucu (SEQ ID NO: 64) 51 nt-c-18 nt cccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagc ugcuccucaucug (SEQ ID NO: 65) 50 nt-c-19 nt ccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcu gcuccucaucugc (SEQ ID NO: 66) 49 nt-c-20 nt caccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcug cuccucaucugcg (SEQ ID NO: 67) 48 nt-c-21 nt accgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugc uccucaucugcgg (SEQ ID NO: 68) 47 nt-c-22 nt ccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcu ccucaucugcggg (SEQ ID NO: 69) 46 nt-c-23 nt cgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugcuc cucaucugcgggg (SEQ ID NO: 70) 72 nt 55 nt-c-16 nt gacgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggccca gagcugcuccucauc (SEQ ID NO: 30) 54 nt-c-17 nt acgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccag agcugcuccucaucu (SEQ ID NO: 71) 53 nt-c-18 nt cgcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccaga gcugcuccucaucug (SEQ ID NO: 72) 52 nt-c-19 nt gcccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagag cugcuccucaucugc (SEQ ID NO: 73) 51 nt-c-20 nt cccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagc ugcuccucaucugcg (SEQ ID NO: 74) 50 nt-c-21 nt ccaccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcu gcuccucaucugcgg (SEQ ID NO: 75) 49 nt-c-22 nt caccgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcug cuccucaucugcggg (SEQ ID NO: 76) 48 nt-c-23 nt accgugugguugcuguccaggacggucccggccugcgacacuucggcccagagcugc uccucaucugcgggg (SEQ ID NO: 77)
Example 9: Effect of arRNA Chemical Modifications on Editing Efficiency
[0266] Firstly, we compared the effect of CM1 modification versus CM0 modification on arRNA editing efficiency in three lengths of arRNAs (55-c-16 (SEQ ID NO: 30), 55-c-14 (SEQ ID NO: 31), and 55-c-11 (SEQ ID NO: 34)). The CM1 modifications are shown below:
[0267] CM1: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by 2′-O-methylation, the first 3 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-methylation.
[0268] The results are shown in
[0269] Subsequently, we then selected 2 preferred lengths of arRNAs: 71 nt, and 76 nt, and investigated the effect of different combinations of modifications on the editing efficiency. The specific modifications are shown below, and the specific sequences and modification annotations are shown in Table 9.
[0270] CM2: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by 2′-O-methylation, and the first 3 and last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation; and the 3′ most adjacent nucleotide of the targeting nucleotide was modified by 2′-O-methylation.
[0271] CM3: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by 2′-O-methylation, the first 3 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and the 5′ most adjacent nucleotide of the targeting nucleotide was modified by 2′-O-methylation.
[0272] CM4: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by 2′-O-methylation, the first 3 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and the 3′ most adjacent internucleotide linkage of each of the three bases in the targeting triplet was modified by phosphorothioation.
[0273] CM5: All nucleotides were modified by 2′-OMe except the targeting nucleoside and the 5 bases adjacent to its 5′ end and the 5 bases adjacent to its 3′ end; and the first and last three internucleotide linkages of the sequence were modified by phosphorothioation.
[0274] CM6: the first 5 and the last 5 nucleotides in the arRNA sequence were respectively modified by 2′-O-methylation, and the first 5 and the last 5 internucleotide linkages of the sequence were respectively modified by phosphorothioation.
[0275] IDUA mRNA was edited by transfecting different arRNAs into GM06214 cells separately using Lipofectamine RNAiMAX. 48 h after transfection, cells were collected for IDUA enzyme activity detection (enzyme activity detection was performed according to the method in Example 7, and results were shown as folds of the enzyme activity in GM01323). It can be seen from the experimental results shown in
[0276] The IDUA enzyme activity detection allows comparison of the ability of different lengths of arRNA to restore IDUA protein function at the protein level. In order to be able to quickly probe the editing ability of arRNA at the RNA level, the editing efficiency of arRNA was also detected in this example by using an enzymatic cleavage method. The specific method is as follows: the normal sequence of the site near the IDUA mRNA point mutation contains a CTGG, which becomes CTAG after mutation. Particularly, the four bases CTAG are the restriction sites of the restriction endonuclease BfaI, so if the transfected arRNA implements the A to G editing on the target site in the cell, the restriction site CTAG of the restriction endonuclease BfaI will be transformed into CTGG, and thus the enzymatic cleavage of BfaI will no longer occur. 48 hours after cell transfection with arRNA, the cell genome was extracted to perform reverse transcription. Samples were subjected to PCR by using primers hIDUA-62F: CCTTCCTGAGCTACCACCCG (SEQ ID NO: 78), and hIDUA-62R: CCAGGGCTCGAACTCGGTAG (SEQ ID NO: 79). PCR products were purified and recovered for enzymatic cleavage. The enzymatically cleaved products were subjected to gel electrophoresis with 2% agarose, and the editing efficiency was calculated by calculating the percentage of the gray value of uncut fragments relative to the overall gray value on the gel map. As shown in
TABLE-US-00014 TABLE 9 Name Length Modification Sequence HIV2-76- 55 nt-c- CM1 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM1 20 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-C-C- A-G-A-G-C-Um-G-C-Um-C-C-Um-C-A-Um-C- Um*Gm*Cm*Gm (SEQ ID NO: 26) HIV2-76- 55 nt-c- CM2 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM2 20 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-C-C- Am-G-A-G-C-Um-G-C-Um-C-C-Um-C-A-Um-C- Um*Gm*Cm*Gm (SEQ ID NO: 26) HIV2-76- 55 nt-c- CM3 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM3 20 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-Cm- C-A-G-A-G-C-Um-G-C-Um-C-C-Um-C-A-Um-C- Um*Gm*Cm*Gm (SEQ ID NO: 26) HIV2-76- 55 nt-c- CM4 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM4 20 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C- C*C*A*G-A-G-C-Um-G-C-Um-C-C-Um-C-A-Um-C- Um*Gm*Cm*Gm (SEQ ID NO: 26) HIV2-76- 55 nt-c- CM5 Gm*Am*Cm*Gm-Cm-Cm-Cm-Am-Cm-Cm-Gm-Um- CM5 20 nt Gm-Um-Gm-Gm-Um-Um-Gm-Cm-Um-Gm-Um-Cm- Cm-Am-Gm-Gm-Am-Cm-Gm-Gm-Um-Cm-Cm-Cm- Gm-Gm-Cm-Cm-Um-Gm-Cm-Gm-Am-Cm-Am-Cm- Um-Um-C-G-G-C-C-C-A-G-A-G-C-Um-Gm-Cm-Um- Cm-Cm-Um-Cm-Am-Um-Cm-Um*Gm* Cm* Gm (SEQ ID NO: 26) HIV2-76- 55 nt-c- CM6 Gm*Am*Cm*Gm*Cm*C-C-A-C-C-G-U-G-U-G-G-U- CM6 20 nt U-G-C-U-G-U-C-C-A-G-G-A-C-G-G-U-C-C-C-G-G-C- C-U-G-C-G-A-C-A-C-U-U-C-G-G-C-C-C-A-G-A-G-C- U-G-C-U-C-C-U-C-A-U*Cm*Um*Gm*Cm*Gm (SEQ ID NO: 26) HIV2-71- 55 nt-c- CM1 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM1 15 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-C-C- A-G-A-G-C-Um-G-C-Um-C-C-Um*Cm*Am*Um (SEQ ID NO: 15) HIV2-71- 55 nt-c- CM2 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM2 15 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-C-C- Am-G-A-G-C-Um-G-C-Um-C-C-Um*Cm*Am*Um (SEQ ID NO: 15) HIV2-71- 55 nt-c- CM3 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM3 15 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C-Cm- C-A-G-A-G-C-Um-G-C-Um-C-C-Um*Cm*Am*Um (SEQ ID NO: 15) HIV2-71- 55 nt-c- CM4 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- CM4 15 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- G-G-C-C-Um-G-C-G-A-C-A-C-Um-Um-C-G-G-C- C*C*A*G-A-G-C-Um-G-C-Um-C-C-Um*Cm*Am*Um (SEQ ID NO: 15) HIV2-71- 55 nt-c- CM5 Gm*Am*Cm*Gm-Cm-Cm-Cm-Am-Cm-Cm-Gm-Um- CM5 15 nt Gm-Um-Gm-Gm-Um-Um-Gm-Cm-Um-Gm-Um-Cm- Cm-Am-Gm-Gm-Am-Cm-Gm-Gm-Um-Cm-Cm-Cm- Gm-Gm-Cm-Cm-Um-Gm-Cm-Gm-Am-Cm-Am-Cm- Um-Um-C-G-G-C-C-C-A-G-A-G-C-Um-Gm-Cm-Um- Cm-Cm-Um*Cm*Am*Um (SEQ ID NO: 15) HIV2-71- 55 nt-c- CM6 Gm*Am*Cm*Gm*Cm*C-C-A-C-C-G-U-G-U-G-G-U- CM6 15 nt U-G-C-U-G-U-C-C-A-G-G-A-C-G-G-U-C-C-C-G-G-C- C-U-G-C-G-A-C-A-C-U-U-C-G-G-C-C-C-A-G-A-G-C- U-G-C-U-C*Cm*Um*Cm*Am*Um (SEQ ID NO: 15) Note: “m” indicates 2′-O-Me on nucleotide ribose, and “*” indicates phosphorothioation modification.
Example 10: Concentration Gradient Tests on CM1-Modified 55 nt-c-16 nt, 55 nt-c-14 nt, and 55 nt-c-11 nt
[0277] To investigate the editing ability of arRNA at different concentrations, CM1-modified 55 nt-c-16 nt, 55 nt-c-14 nt, and 55 nt-c-11 nt were selected for testing in this example. A total of 9 different dilutions of arRNA at 160 nM, 80 nM, 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, and 0.625 nM were taken, and GM06214 cells were transfected by using lipofectamine RNAiMAX. Forty-eight hours after transfection, the cells were detected for enzyme activity, and gene editing efficiency was detected by second-generation sequencing. As shown in
Example 11: IDUA Sustains Protease Activity after Editing by arRNA
[0278] In this experiment, by using three preferred arRNAs targeting human IDUA target sites, and chemically modifying them with the CM1 pattern, significantly increased IDUA enzyme activity was obtained in GM06214 cells and lasted for more than about 3 weeks.
[0279] We selected a concentration of 20 nM, and the IDUA enzyme activity and editing efficiency at different times were compared. As shown in
[0280] Therefore, it is easy to speculate that if a second transfection is performed on days 10 to 14, it will be possible to consistently maintain the IDUA enzyme activity at a higher level than that on the second day of the first transfection. And if the second transfection is performed at days 17 to 21, it would allow the IDUA enzyme activity to be at least higher than the enzyme activity in GM01323, keeping the IDUA enzyme activity of the cells in a relatively normal state.
Example 12: In Vitro Editing of the Wild IDUA (c.1205-5 bp) Site with arRNA in Human Primary Hepatocytes
[0281] This test involves editing of the wild-type IDUA gene site in cultured human primary hepatocytes by LEAPER technology. In this example, A in the CAG was used as a target for editing to test the editing efficiency of the method according to this application for IDUA gene in hepatocytes. The arRNA sequences are shown in Table 10.
[0282] Human primary hepatocytes were purchased from LONZA (Catalog. No. HUCPI), and the cells were recovered and cultured according to the manufacturer's instructions (recovery medium Catalog. No. MCHT50; plating medium Catalog. No. MP100). The cells were replaced with hepatocyte maintaining medium 5 C after adherence (reference document: Xiang C, Du Y, Meng G, et al. Long-term functional maintenance of primary human hepatocytes in vitro[J]. Science, 2019, 364(6438):399-402).
[0283] After 24 h of adherent culture, human hepatocytes were transfected with arRNAs by using lipofectmine RNAiMAX, wherein the transfection concentrations of arRNAs were 20 nM and 40 nM, respectively. Samples were respectively collected at 0 h, 12 h, 24 h, 48 h and 72 h after transfection. After collection, samples were assayed for editing efficiency by second-generation sequencing. As shown in
TABLE-US-00015 TABLE 10 arRNA arRNA modifi- name length cation sequence hIV2- 55 nt- CM1 Cm*Am*Cm*-C-G-Um-G- wt1CM1 c-14 nt Um-G-G-Um-Um-G-C-Um-G-Um- C-C-A-G-G-A-C-G-G-Um-C-C- C-G-G-C-C-Um-G-C-G-A-C-A- C-Um-Um-C-G-G-C-C-C-A-G-A- G-C-C-G-C-Um-C-C-Um-C-A-Um- C-Um*Gm*Cm*Gm (SEQ ID NO: 80)
Example 13: Comparison of Combinations of Chemical Modification Methods and Lengths
[0284] In this Example, by editing the c.1239 G>A (p.Trp402Ter) mutation site in GM06214 cells, we compared the method in this application with the preferred method in the prior art. The advantages of the method according to this application were further shown.
[0285] The sequences and modifications are shown in Table 11. The representative sequence of the method according to this application is 55 nt-c-15 nt-CM1, and the positive control sequence selected from the prior art (CN110352244A) is 36 nt-c-13 nt-CM11, wherein all the nucleotides, except the editing site CCA, were modified by 2′-O-Me, and the first and last 4 nucleotide linkages were modified by phosphorothioation. In addition, the CM0-modified sequence (55 nt-c-15 nt) and the CM0-modified random sequence (Random-70) in this application were taken as control in this example.
[0286] In this example, 48 hours after transfection of arRNA into GM06214 cells by using LipofectamineRNAiMAX, the IDUA enzyme activity was detected by the method shown in Example 7. The results are shown in
TABLE-US-00016 TABLE 11 Modifi- Name cation Sequence 55 nt-c- CM1 Gm*Am*Cm*G-C-C-C-A-C-C-G- 15 nt- Um-G-Um-G-G-Um-Um-G-C-Um- CM1 G-Um-C-C-A-G-G-A-C-G-G-Um- C-C-C-G-G-C-C-Um-G-C-G-A- C-A-C-Um-Um-C-G-G-C-C-C-A- G-A-G-C-Um-G-C-Um-C-C-Um* Cm*Am*Um (SEQ ID NO: 15) 36 nt-c- CM11 Cm*Um*Gm*Um*Cm-Cm-Am-Gm-Gm- 13 nt- Am-Cm-Gm-Gm-Um-Cm-Cm-Cm-Gm- CM11 Gm-Cm-Cm-Um-Gm-Cm-Gm-Am-Cm- Am-Cm-Um-Um-Cm-Gm-Gm-Cm-C- C-A-Gm-Am-Gm-Cm-Um-Gm-Cm- Um*Cm*Cm*Um*Cm (SEQ ID NO: 81) Note: “m” indicates 2′-O-Me on nucleotide ribose, and “*” indicates phosphorothioation modification.
Example 14: Effect of End Modifications on arRNA Editing Efficiency
[0287] In this Example, different amounts of 2′MOE and LNA modifications were performed on both ends of arRNAs based on CM1, and they were compared with CM1 modifications, wherein 2′MOE refers to 2′-O-(2-methoxyethyl) modification.
[0288] As shown in Table 12, the sequence 55 nt-c-20 nt (SEQ ID NO: 26) was modified with CM1, CM148, CM149, CM150, CM151, CM152 and CM153, respectively, for testing in this Example. LipofectamineRNAiMAX was used in this example to transfect arRNA into IDUA reporter cells at a transfection concentration of 20 nM. Then the fluorescence intensity was measured by flow cytometry after 48 h (day 2) and 168 h (day 7), respectively. The results are shown in
[0289] The specific modification methods used in this example (except CM1 which is previously described) are shown below:
[0290] CM148: the first 4 and the last 4 nucleotides in the arRNA sequence were respectively modified by 2′-O-(2-methoxyethyl), the first 3 and the last 4 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
[0291] CM149: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by 2′-O-(2-methoxyethyl), the first 2 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
[0292] CM150: the first 2 and the last 2 nucleotides in the arRNA sequence were respectively modified by 2′-O-(2-methoxyethyl), the first and the last 2 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
[0293] CM151: the first 4 and the last 4 nucleotides in the arRNA sequence were respectively modified by LNA, the first 3 and the last 4 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
[0294] CM152: the first 3 and the last 3 nucleotides in the arRNA sequence were respectively modified by LNA, the first 2 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
[0295] CM153: the first 2 and the last 2 nucleotides in the arRNA sequence were respectively modified by LNA, the first 2 and the last 3 internucleotide linkages in the arRNA sequence were respectively modified by phosphorothioation, and all the uridines of the sequence were modified by 2′-O-Me.
TABLE-US-00017 TABLE 12 Name Length Modification Sequence HIV2- 55 nt-c- CM1 Gm*Am*Cm*G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um-Um- 70- 14 nt G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C-G-G-C-C- CM1 Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G-A-G-C- Um-G-C-Um-C-C*Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM148 Gmoe*Amoe*Cmoe*Gmoe-C-C-C-A-C-C-G-Um-G-Um-G- 70- 14 nt G-Um-Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C- CM148 C-G-G-C-C-Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A- G-A-G-C-Um-G-C-Um-C*Cmoe*Umoe*Cmoe*Amoe (SEQ ID NO: 31) HIV2- 55 nt-c- CM149 Gmoe*Amoe*Cmoe-G-C-C-C-A-C-C-G-Um-G-Um-G-G- 70- 14 nt Um-Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C- CM149 G-G-C-C-Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G- A-G-C-Um-G-C-Um-CC*Umoe*Cmoe*Amoe (SEQ ID NO: 31) HIV2- 55 nt-c- CM150 Gmoe*Amoe-C-G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um- 70- 14 nt Um-G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C-G-G- CM150 C-C-Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G-A-G- C-Um-G-C-Um-CCU*Cmoe*Amoe (SEQ ID NO: 31) HIV2- 55 nt-c- CM151 G+*A+*C+*G+C-C-C-A-C-C-G-Um-G-Um-G-G-Um-Um- 70- 14 nt G-C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C-G-G-C-C- CM151 Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G-A-G-C- Um-G-C-Um-C*C+*U+*C+*A+ (SEQ ID NO: 31) HIV2- 55 nt-c- CM152 G+*A+*C+G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um-Um-G- 70- 14 nt C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C-G-G-C-C- CM152 Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G-A-G-C- Um-G-C-Um-C-C*U+*C+*A+ (SEQ ID NO: 31) HIV2- 55 nt-c- CM153 G+*A+*C-G-C-C-C-A-C-C-G-Um-G-Um-G-G-Um-Um-G- 70- 14 nt C-Um-G-Um-C-C-A-G-G-A-C-G-G-Um-C-C-C-G-G-C-C- CM153 Um-GC-G-A-C-A-C-Um-Um-C-G-G-C-C-C-A-G-A-G-C- Um-G-C-Um-C-C*U*C+*A+ (SEQ ID NO: 31) Note: “m” indicates 2′-O-Me modification on nucleotide ribose; “*” indicates phosphorothioation modification; “+” indicates locking nucleic acid (LNA) modification. “Moe” indicates 2′-O-(2-methoxyethyl) modification.
Example 15: Effect of Modifications with Combinations of Phosphorothioation, 2′-O-(2-methoxyethyl), and Deoxyribonucleotide Substitution on arRNA Editing Efficiency
[0296] This example attempts to add more phosphorothioation and 2′-O-Me modifications to arRNA, and introduces deoxyribonucleotide substitution.
[0297] The specific sequence modifications are as follows:
[0298] CM71: the first 3 and last 3 nucleotides in the arRNA sequence were each modified by 2′-OMe, while in the arRNA sequence, all the uridines and all the cytidines except that in the targeting triplet were modified by 2′-OMe, and the first 3 and last 3 internucleotide linkages were modified by phosphorothioation.
[0299] CM94: the first 3 and the last 3 nucleotides in the arRNA sequence, all the uridines and all the cytidines except that in the targeting triplet in the arRNA sequence were modified by 2′-O-methylation; the first 4 and the last 3 internucleotide linkages in the arRNA sequence were all modified by phosphorothioation; and from the 4th internucleotide linkage from the 5′ end to the 3rd internucleotide linkage from the 3′ end, every other internucleotide linkage was modified by phosphorothioation, except that the 5′ most adjacent internucleotide linkage of each nucleotide in the targeting triple was not modified by phosphorothioation.
[0300] CM104: the first 3 and last 3 nucleotides in the arRNA sequence were each modified by 2′-O-methylation, while in the arRNA sequence, all the uridines and all the cytidines except that in the targeting triplet were modified by 2′-O-methylation, and all the nucleotide linkages were modified by phosphorothioation except that the 5′ most adjacent internucleotide linkage of each nucleotide in the targeting triple was not modified by phosphorothioation.
[0301] CM105: in addition to comprising all the modifications in CM104, the targeting nucleotide C was modified by deoxyribonucleotide substitution.
[0302] CM106: in addition to comprising all the modifications in CM104, each nucleotide in the targeting triplet was modified by deoxyribonucleotide substitution.
[0303] CM107: in addition to comprising all the modifications in CM94, the targeting nucleotide C was modified by deoxyribonucleotide substitution.
[0304] CM108: in addition to comprising all the modifications in CM94, each nucleotide in the targeting triplet was modified by deoxyribonucleotide substitution.
[0305] CM114: in addition to comprising all the modifications in CM94, the 5′ most adjacent internucleotide linkage of each nucleotide in the targeting triple was also modified by phosphorothioation.
[0306] CM115: in addition to comprising all the modifications in CM94, the 3′ most adjacent internucleotide linkage of each nucleotide in the targeting triple was also modified by phosphorothioation.
[0307] CM116: in addition to comprising all the modifications in CM94, the 5′ most adjacent internucleotide linkage of the 5′ most adjacent nucleotide of the targeting nucleotide was also modified by phosphorothioation.
[0308] CM117: in addition to comprising all the modifications in CM94, the 3′ most adjacent internucleotide linkage of the targeting nucleotide was also modified by phosphorothioation.
[0309] CM118: in addition to comprising all the modifications in CM115, the targeting nucleotide C was modified by deoxyribonucleotide substitution.
[0310] CM119: except that the 5′ most adjacent internucleotide linkage of the targeting nucleotide C was not modified by phosphorothioation, other modifications were the same as those in CM118.
[0311] CM120: in addition to comprising all the modifications in CM116, the targeting nucleotide C was modified by deoxyribonucleotide substitution.
[0312] CM121: in addition to comprising all the modifications in CM117, the targeting nucleotide C was modified by deoxyribonucleotide substitution.
[0313] CM122: in addition to comprising all the modifications in CM114, each nucleotide in the targeting triplet was modified by deoxyribonucleotide substitution.
[0314] CM123: each nucleotides in the targeting triplet was modified by deoxyribonucleotide substitution, while other modifications were the same as those in CM119.
[0315] CM124: in addition to comprising all the modifications in CM116, each nucleotide in the targeting triplet was modified by deoxyribonucleotide substitution.
[0316] CM125: in addition to comprising all the modifications in CM117, each nucleotide in the targeting triplet was modified by deoxyribonucleotide substitution.
[0317] The sequence 55 nt-c-20 nt (SEQ ID NO: 26) and modification annotations used in this example are shown in Table 13. LipofectamineRNAiMAX was used in this example to transfect arRNA into IDUA Reporter cells at a transfection concentration of 20 nM. The fluorescence intensity was detected by flow cytometry after 72, 120 and 168 hours, respectively. The results are shown in
TABLE-US-00018 TABLE 13 Modifi- Name Length cation Sequence HIV2- 55 nt-c- CM1 Gm*Am*Cm*G-C-C-C-A-C-C-G- 70-CM1 14 nt Um-G-Um-G-G-Um-Um-G-C-Um- G-Um-C-C-A-G-G-A-C-G-G-Um -C-C-C-G-G-C-C-Um-G-C-G-A -C-A-C-Um-Um-C-G-G-C-C-C- A-G-A-G-C-Um-G-C-Um-C-C*U m*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM71 Gm*Am*Cm*G-Cm-Cm-Cm-A-Cm- 70- 14 nt Cm-G-Um-G-Um-G-G-Um-Um-G- CM71 Cm-Um-G-Um-Cm-Cm-A-G-G-A- Cm-G-G-Um-Cm-Cm-Cm-G-G-Cm -Cm-Um-G-Cm-G-A-Cm-A-Cm-U m-Um-Cm-G-G-Cm-C-C-A-G-A- G-Cm-Um-G-Cm-Um-Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM94 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM94 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm-C-C-A*G-A* G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM 104 Gm*Am*Cm*G*Cm*Cm*Cm*A*Cm* 70- 14 nt Cm*G*Um*G*Um*G*G*Um*Um*G* CM104 Cm*Um*G*Um*Cm*Cm*A*G*G*A* Cm*G*G*Um*Cm*Cm*Cm*G*G*Cm *Cm*Um*G*Cm*G*A*Cm*A*Cm*U m*Um*Cm*G*G*Cm-C-C-A*G*A* G*Cm*Um*G*Cm*Um*Cm*Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM105 Gm*Am*Cm*G*Cm*Cm*Cm*A*Cm* 70- 14 nt Cm*G*Um*G*Um*G*G*Um*Um*G* CM105 Cm*Um*G*Um*Cm*Cm*A*G*G*A* Cm*G*G*Um*Cm*Cm*Cm*G*G*Cm *Cm*Um*G*Cm*G*A*Cm*A*Cm*U m*Um*Cm*G*G*Cm-C-Cd-A*G*A *G*Cm*Um*G*Cm*Um*Cm*Cm*Um *Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM106 Gm*Am*Cm*G*Cm*Cm*Cm*A*Cm* 70- 14 nt Cm*G*Um*G*Um*G*G*Um*Um*G* CM106 Cm*Um*G*Um*Cm*Cm*A*G* G*A*Cm*G*G*Um*Cm*Cm*Cm*G* G*Cm*Cm*Um*G*Cm*G*A*Cm*A* Cm*Um*Um*Cm*G*G*Cm-Cd-Cd- Ad*G*A*G*Cm*Um*G*Cm*Um*Cm *Cm*Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM107 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM107 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm-C-Cd-A*G-A *G-Cm*Um-G*Cm-Um*Cm-Cm*Um *Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM108 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM108 Cm*Um-G*-Um-Cm*Cm-A*G-G*- A-Cm*G-G*Um-Cm*Cm-Cm*G-G* Cm-Cm*Um-G*Cm-G*A-Cm*A-Cm *Um-Um*Cm-G*G-Cm-Cd-Cd-Ad *G-A*-G-Cm*Um-G*Cm-Um*Cm- Cm*Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM114 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 214 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM114 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm*C*C*A*G-A* G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM115 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM115 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm-C*C*A*G-A* G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM116 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM116 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm*C-C-A*G-A* G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM117 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM117 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm-C-C*A*G-A* G-Cm*Um-G*Cm-Um*Cm-Cm*Um* Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM118 Gm*Am*Cm*G*Cm-Cm*Cm-A*-Cm 70- 14 nt -Cm*G-Um*G-Um*G-G*Um-Um*G CM118 -Cm*Um-G*Um-Cm*Cm-A*G- G*A-Cm*G-G*Um-Cm*Cm-Cm*G- G*Cm-Cm*Um-G*Cm-G*A-Cm*A- Cm*Um-Um*Cm-G*G-Cm*C*Cd*A *G-A*G-Cm*Um-G*Cm-Um*Cm-C m*Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM119 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM119 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm*C-Cd*A*G-A *G-Cm*Um-G*Cm-Um*Cm-Cm*Um *Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM120 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM120 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm*C-Cd-A*G-A *G-Cm*Um-G*Cm-Um*Cm-Cm*Um *Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM121 Gm*Am*Cm*G*-Cm-Cm*Cm-A*Cm 70- 14 nt -Cm*G-Um*G-Um*G-G*-Um-Um* CM121 G-Cm*Um-G*Um-Cm*Cm-A*G-G* A-Cm*-G-G*Um-Cm*Cm-Cm*G-G *Cm-Cm*Um-G*Cm-G*A-Cm*A-C m*Um-Um*Cm-G*G-Cm-C-Cd*A* -G-A*-G-Cm*Um-G*Cm-Um*Cm- Cm*Um*Cm*Am (SEQ ID NO: 3 1) HIV2- 55 nt-c- CM 122 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM122 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*G-G*Um-Cm*Cm-Cm*G-G*Cm -Cm*Um-G*Cm-G*A-Cm*A-Cm*U m-Um*Cm-G*G-Cm*Cd*Cd*Ad*G -A*G-Cm*Um-G*Cm-Um*Cm-Cm* Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM123 Gm*Am*Cm*G*Cm-Cm*Cm-A*-Cm 70- 14 nt -Cm*G-Um*G-Um*G-G*Um-Um*G CM123 -Cm*Um-G*Um-Cm*Cm-A*G-G*A -Cm*G-G*Um-Cm*Cm-Cm*G-G*C m-Cm*Um-G*Cm-G*-A-Cm*A-Cm *Um-Um*Cm-G*G-Cm*Cd-Cd*Ad *-G-A*G-Cm*Um-G*Cm-Um*Cm- Cm*Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM 124 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM124 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*-G-G*Um-Cm*Cm-Cm*G-G*C m-Cm*Um-G*Cm-G*A-Cm*A-Cm* Um-Um*Cm-G*G-Cm*Cd-Cd-Ad* G-A*G-Cm*Um-G*Cm-Um*Cm-Cm *Um*Cm*Am (SEQ ID NO: 31) HIV2- 55 nt-c- CM125 Gm*Am*Cm*G*Cm-Cm*Cm-A*Cm- 70- 14 nt Cm*G-Um*G-Um*G-G*Um-Um*G- CM125 Cm*Um-G*Um-Cm*Cm-A*G-G*A- Cm*-G-G*Um-Cm*Cm-Cm*G-G*C m-Cm*Um-G*-Cm-G* A-Cm* A-Cm*Um-Um* Cm-G* G-Cm-Cd-Cd*Ad*G-A*G- Cm*Um-G*Cm-Um*Cm-Cm*Um*Cm* Am (SEQ ID NO: 31) Note: “m” indicates 2′-O-mrthylation modification on nucleotide ribose; “*” indicates phosphorothioation modification; “d” indicates deoxyribonucleotide substitution modification.