NOVEL TRANSPLANTATION CELLS HAVING REDUCED IMMUNOGENICITY
20230242894 · 2023-08-03
Assignee
Inventors
- Hyun Ah KIM (Yongin-si, Gyeonggi-do, KR)
- Seung Min KIM (Yongin-si, Gyeonggi-do, KR)
- JungHyun HER (Yongin-si, Gyeonggi-do, KR)
- Sunglim CHO (Yongin-si, Gyeonggi-do, KR)
- Hyojin KIM (Yongin-si, Gyeonggi-do, KR)
- Hoyong LIM (Yongin-si, Gyeonggi-do, KR)
- Sungyoo CHO (Yongin-si, Gyeonggi-do, KR)
- Yu Kyeong HWANG (Yongin-si, Gyeonggi-do, KR)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/1138
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
Abstract
A composition containing, as an active ingredient, a nucleic acid molecule that inhibits expression of type II HLA protein and uses thereof are disclosed. The composition is useful for inhibiting immunogenicity of mammalian cells. A method of producing hypoimmunogenic mammalian cells using the composition is also disclosed. The cells which are allogeneic transplanted for disease treatment, such as stem cells or immune cells, may be used as an effective cell therapy product having a long-term activity with minimized immune rejection in the recipient's body.
Claims
1. A composition for inhibiting immunogenicity of mammalian cells comprising, as an active ingredient, a nucleic acid molecule that inhibits expression of type II HLA protein.
2. The composition according to claim 1, wherein the nucleic acid molecule is a guide RNA (gRNA) which specifically recognizes a nucleotide sequence encoding the type II HLA protein or an activating protein thereof, or a nucleotide encoding the gRNA.
3. The composition according to claim 2, wherein the activating protein of the type II HLA protein is a class II major histocompatibility complex transactivator (CIITA) protein.
4. The composition according to claim 2, further comprising RNA-guided endonuclease or a nucleotide sequence encoding the RNA-guided endonuclease.
5. The composition according to claim 3, wherein the gRNA specifically recognizes a nucleotide sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 40 and SEQ ID NO: 44, or a sequence complementary thereto.
6. The composition according to claim 1, further comprising a nucleic acid molecule that inhibits expression of β2-microglobulin protein.
7. The composition according to claim 6, wherein the nucleic acid molecule is a guide RNA (gRNA) which specifically recognizes a nucleotide sequence encoding the β2-microglobulin protein, or a nucleotide sequence encoding the gRNA.
8. The composition according to claim 7, further comprising RNA-guided endonuclease or a nucleotide sequence encoding the RNA-guided endonuclease.
9. The composition according to claim 7, wherein the guide RNA (gRNA) specifically recognizes a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 14, or a sequence complementary thereto.
10. The composition according to claim 4, wherein the RNA-guided endonuclease is selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1) and MAD7.
11. The composition according to claim 1, further comprising a nucleic acid molecule encoding a type I HLA protein.
12. The composition according to claim 11, wherein the type I HLA protein is HLA-E protein.
13. (canceled)
14. The composition according to claim 1, wherein the mammalian cells are stem cells or immune cells.
15. (canceled)
16. A hypoimmunogenic mammalian cell produced using the composition according to claim 1.
17. A method for producing hypoimmunogenic mammalian cells comprising: (a) inhibiting expression of a protein, selected from the group consisting of β2-microglobulin protein, type II HLA protein, an activating protein of type II HLA protein, and combinations thereof, in cells isolated from a mammalian subject; and (b) introducing HLA-E gene into the cells.
18. The method according to claim 17, wherein step (a) is performed by introducing, into the cells, a guide RNA (gRNA) which specifically recognizes a nucleotide sequence encoding the protein, or a nucleotide sequence encoding the gRNA; and RNA-guided endonuclease or a nucleotide sequence encoding the RNA-guided endonuclease.
19. The method according to claim 18, wherein the guide RNA (gRNA) which specifically recognizes the nucleotide sequence encoding the β2-microglobulin protein specifically recognizes a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 14, or a sequence complementary thereto.
20. The method according to claim 17, wherein the activating protein of the type II HLA protein is a class II major histocompatibility complex transactivator (CIITA) protein.
21. The method according to claim 20, wherein the guide RNA (gRNA) which specifically recognizes the nucleotide sequence encoding the CIITA protein specifically recognizes a nucleotide sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 40 and SEQ ID NO: 44, or a complementary sequence thereto.
22. (canceled)
23. (canceled)
24. A method of inhibiting immunogenicity of mammalian cells comprising a step of introducing the composition according to claim 1 into the mammalian cells.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
MODE FOR INVENTION
[0079] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention according to the subject matter of the present invention is not limited by these examples.
EXAMPLES
Example 1: Knockout of B2M Gene Using Gene Scissors
[0080] Low-immunogenic NK cells were produced using cord blood natural killer (CBNK) cells isolated from umbilical cord blood donated by donors.
[0081] β2m, which is common to HLA-A, HLA-B and HLA-C, which are human leukocyte antigens (HLAs) present on the cell surface, is made by expression from the B2M gene. For the production of NK cells that do not express HLA-ABC, the desired portion of the B2M gene in the genome of NK cells was cut using gene scissors technology in the following manner to inhibit the expression of β2m.
[0082] First, a reaction solution of RNP (ribonucleoprotein), a complex of gRNA and nuclease, was prepared in a 1.5 mL centrifuge tube as described below and allowed to react at room temperature for 5 minutes or more, and then used within 60 minutes.
[0083] 20 μL of each of gRNAs (synthesized by IDT, 10 μM) having different sequences for cleaving the B2M gene was mixed with 3.32 μL of 40 μM Cpf1 nuclease (Feldan Therapeutics) in 26.84 μL of 1×PBS or with 4 μL of MAD7 nuclease (Feldan Therapeutics) in 26 μL of 1×PBS, and then allowed to react at room temperature for 5 minutes or more to obtain an RNP reaction solution. The prepared RNP reaction solution could be used for up to 1 to 4×10.sup.6 cells, and in this Example, cells were counted using an ADAM cell counter system (NanoEntek) and then 2×10.sup.6 NK cells were used. 2×10.sup.6 NK cells were placed in a separate 1.5 mL centrifuge tube and centrifuged at 2,000 rpm for 3 minutes, and then the supernatant was removed. 500 μL of 1×PBS was added thereto and then centrifuged at 2,000 rpm for 3 minutes, and the supernatant was removed, leaving only the cells. 2 μL of Feldan shuttle (Feldan Therapeutics, 5 μM) was added to 48 μL of alpha MEM medium (Sigma, M8042) in another 1.5 mL centrifuge tube, and then 50 μL of the RNP reaction solution was added thereto and mixed. Then, the mixture solution was added to the NK cells from which the supernatant has been removed, and allowed to react at room temperature for 1 minute and 30 seconds in a stationary state. Next, 2 mL of Cellgro medium (Cellgenix, 20802-0500) containing 1% (v/v) of human plasma and 1000 IU hIL-2 (Proleukin Inj., Novartis Korea) was added thereto to suspend the NK cells which were then transferred and cultured in a 6-well plate.
[0084] After stationary culture for 72 hours, 2×10.sup.5 NK cells were harvested and centrifuged at 1,200 rpm for 5 minutes, and the medium was removed. Next, the cells were suspended in FACS buffer containing 2 mL of 2% FBS and centrifuged at 2,000 rpm for 3 minutes, and the supernatant was removed, leaving only the NK cells. Next, 100 μL of FACS buffer was added to the cells, and then antibodies for analysis as shown in Table 1 below were added to the cells and reacted at 4° C. for 30 minutes. 2 mL of FACS buffer was added to the cells, followed by centrifugation at 2,000 rpm for 3 minutes. The supernatant was removed, and the NK cells were fixed by adding 300 μL of a fixation (BD, 554655) solution. Then, expression on the stained NK cell surface was analyzed using the flow cytometer LSRFortessa (BD Bioscience).
[0085] As guide RNAs (gRNAs) capable of cleaving the B2M gene using Cpf1 or MAD7 nuclease, gRNA candidate sequences selected using the benchling (https://benchling.com) and CRISPR RGEN Tools (www.rgenome.net) program are listed in Table 2 below. The knockout efficiency of each gRNA was evaluated by analyzing HLA-ABC expression by FACS.
TABLE-US-00001 TABLE 1 Antibody for FACS analysis for NK cell phenotype Amount of Antibody information antibody Marker (fluorescent/manufacturer/catalog No.) used Human CD56 APC/BD Bioscience/555518 5 μL Human HLA-ABC BV421/BD Bioscience/565332 0.5 μL Human CD3 FITC/BD Bioscience/555332 5 μL 7-AAD PerCp-Cy5.5/Beckmen Coulter/A07704 5 μL
TABLE-US-00002 TABLE 2 gRNA candidate sequences targeting B2M SEQ B2M ID Length Cleavage knockout % NO. Sequence (bp) Nuclease position (FACS) Remarks 1 ATCCATCCGACATTGAAGT 20 Cpf1 Exon 2 23 T 2 ATCCATCCGACATTGAAGT 21 Cpf1 Exon 2 9 Sequence 1 + 1 nt TG 3 ATCCATCCGACATTGAAGT 23 Cpf1 Exon 2 0.8 Sequence 1 + 2 nt TGAC 4 TTAGAGTCTCGTGATGTTT 22 Cpf1 Promoter 0.5 AAG 5 CCGAUAUUCCUCAGGUAC 22 Cpf1 Exon 2 5 UCCA 6 ATATAAGTGGAGGCGTCGC 21 Cpf1 Exon 1 1.1 GC 7 ATATAAGTGGAGGCGTCGC 23 Cpf1 Exon 1 0.6 Sequence 6 + 2 nt GCTG 8 AGTGGGGGTGAATTCAGTG 21 Cpf1/MAD7 Exon 2 69.5 TA 9 AGTGGGGGTGAATTCAGTG 23 Cpf1 Exon 2 77 Sequence 8 + 2 nt TAGT 10 CTGAATTGCTATGTGTCTG 21 Cpf1 Exon 2 3 GG 11 CTGAATTGCTATGTGTCTG 23 Cpf1 Exon 2 0.5 Sequence 10 + 2 nt GGTT 12 CTCACGTCATCCAGCAGAG 21 Cpf1 Exon 2 5 AA 13 CTCACGTCATCCAGCAGAG 23 Cpf1 Exon 2 0.8 Sequence 12 + 2 nt AATG 14 AGCAAGGACTGGTCTTTCT 21 Cpf1 Exon 2 32 AT 15 AGCAAGGACTGGTCTTTCT 23 Cpf1 Exon 2 0.2 Sequence 14 + 2 nt ATCT 16 CATTCTCTGCTGGATGACG 23 Cpf1 Exon 2 0.9 TGAG 17 TCAGTGGGGGTGAATTCAG 23 Cpf1 Exon 2 0.5 TGTA 18 CAGTGGGGGTGAATTCAGT 23 Cpf1 Exon 2 0.4 GTAG 19 TCACAGCCCAAGATAGTTA 23 Cpf1 Exon 2 0.3 AGTG
[0086] As a result, it was confirmed that the B2M gene was knocked out at the highest rate in 4 gRNA sequences, including #1 (ATCCATCCGACATTGAAGTT), #8 (AGTGGGGGTGAATTCAGTGTA), #9 (AGTGGGGGTGAATTCAGTGTAGT) and #14 (AGCAAGGACTGGTCTTTCTAT), among the 19 sequences (
[0087] The B2M gene in NK cells was cleaved using #8 and #9 gRNAs and Cpf1 or MAD7, and then genomic DNA was isolated and subjected to whole genome sequencing. A genomic DNA sequence having four or less nucleic sequences that mismatch the gRNA sequence was assumed to be a potential off-target region, and whether insertions/deletions by off-target actually occurred was examined. As a result, three predicted off-target regions were identified, and as a result of sequencing for gene insertions/deletions, it was confirmed that no insertions/deletions occurred in two predicted regions. Insertions/deletions were found in the chromosome 4 region, but they were insertions/deletions seen at the same positions as those in control NK. As a result, it was confirmed that B2M knockout using #8 and #9 gRNA did not cause mutation in the predicted off-target regions (Appendix 1).
[0088] In this Example, the RNP reaction solution was delivered into the cells using a shuttle (Feldan therapeutics) as a peptide carrier, but various delivery methods such as electroporation, lipofectamine or a cationic polymer (e.g., poly arginine) may also be used.
Example 2: Evaluation for Efficiency of Shuttle for B2M Gene Knockout
[0089] Knockout of the B2M gene was performed using a shuttle protein. The sequence of the shuttle used is shown in Table 3 below, and knockout of the B2M gene was performed in the same manner as described in Example 1.
TABLE-US-00003 TABLE 3 Sequence of shuttle used Shuttle Amino acid sequence FSD64d1 LLKIWSRLIKIWTQGRRLGGSGGGSARAARQAR (SEQ ID NO: 45)
[0090] As a result of examining the efficiency of knockout of the B2M gene in CBNK cells using 5 μM and 10 μM of the shuttle, it was confirmed that 5 μM of the FSD64d1 shuttle was superior to 10 μM in terms of B2M knockout efficiency and cell viability (
Example 3: Production and In Vitro Evaluation of Low-Immunogenic NK Cells
[0091] As a result of confirming the expression of B2M and HLA-ABC while culturing B2M gene knockout NK cells, it was confirmed that the proportion of cells, which did not simultaneously express B2M and HLA-ABC, in total cells, decreased with time (
[0092] 3-1) Production of B2M KO NK Cells (B2M.sup.− NK)
[0093] On day 3 of knockout when the proportion of cells not expressing HLA-ABC was maintained at the highest level, B2M gene knockout NK cells were isolated. B2M gene knockout NK cells were collected by centrifugation, and then the supernatant was removed. The cells were resuspended at a concentration of 1×10.sup.7 cells/100 μL in PBS (Lonza) containing MACS buffer (0.5% FBS (GIBCO), 2 mM EDTA (Invitrogen)), and g of biotin-conjugated B2M antibody (Invitrogen, MA1-19506) was added per 100 μL of the cell suspension, followed by staining 4° C. for 15 minutes. Next, 2 mL of MACS buffer was added thereto, followed by centrifugation at 1,200 rpm for 5 minutes, and the supernatant was removed. Thereafter, the pelleted NK cells were suspended in 80 μL of MACS buffer, and 20 μL of anti-biotin microbeads (Miltenyi Biotec, 130-090-485) were added to the cell suspension and allowed to react at 4° C. for 15 minutes. Next, 2 mL of washing buffer (Miltenyi Biotec, 130-091-222) was added to the cell suspension, followed by centrifugation at 1,200 rpm for 10 minutes, and then the supernatant was removed. The NK cells were suspended in 500 μL of washing buffer. An LS column (Miltenyi Biotec) was fixed to QuadroMACS™ separator (Miltenyi Biotec) and washed with 2 mL of wash buffer, and the suspended NK cells were passed through the column. Then, B2M knockout cells not bound to the column were recovered by passing 3 mL of washing buffer through the column. After cell counting, the cells were suspended in NK cell medium at a concentration of 1×10.sup.6 cells/ml, and then cultured in a well plate container having an appropriate size.
[0094] 3-2) Production of HLA-E TD NK Cells (HLA-E.sup.+ NK)
[0095] A lentiviral vector was used to express a single-chain HLA-E trimer (scHLA-E) in NK cells. As the single-chain HLA-E trimer used in the present invention, the amino acid sequence disclosed in US20050196404A1 was used after codon optimization of the nucleic acid sequence encoding the same (SEQ ID NO: 46). A lentiviral vector expressing the codon-optimized single-chain trimer sequence was produced by Flash Therapeutics (France).
[0096] To transduce scHLA-E into NK cells, a complex of 50 MOI (multiplicity of infection) scHLA-E lentiviral vector and 10 μg/mL Protransduzin-A (immundiagnostik/A 2115AG.1) was prepared and left to stand for 5 minutes or more at room temperature, and then the NK cells contained in the culture container were treated with the complex. The medium was co-treated with 6 μM of 5Z-7-oxozeaenol (TOCRIS #360420) and 20 ng/mL of IL-21 (Biolegend/571204) to promote the introduction and expression of the lentiviral vector in the cells.
[0097] 3-3) Production of B2M KO/HLA-E TD NK Cells (B2M.sup.−/HLA-E.sup.+ NK)
[0098] The B2M KO NK cells produced as described in 3-1) above were placed in a culture container, and then transduced with scHLA-E as described in 3-2) above. Finally, low-immunogenic NK cells genetically engineered to have a HLA-ABC.sup.−/HLA-E.sup.+ or HLA-ABC.sup.−/HLA-E.sup.+ were obtained, and the present inventors named the obtained NK cells “Log-NK” (Log-lasting NK). The produced NK cells were analyzed by FACS using the antibodies shown in Table 4 below.
TABLE-US-00004 TABLE 4 Antibodies for FACS analysis of NK cell phenotype Amount of Antibody information antibody Marker (fluorescent/manufacturer/catalog No.) used Human CD56 APC/BD Bioscience/555518 5 μL Human HLA-ABC BV421/BD Bioscience/565332 0.5 μL Human CD3 FITC/BD Bioscience/555332 5 μL Human HLA-E PE/Biolegend/342604 1 μL 7-AAD PerCp-Cy5.5/Beckmen Coulter/A07704 5 μL
Example 4: In Vitro Characterization of Low-Immunogenic NK Cells
[0099] The NK cells of the four groups (wild-type CBNK, B2M.sup.− NK, HLA-E.sup.+ NK, and B2M.sup.−/HLA-E.sup.+ NK) to be used as target cells were washed with 1×PBS, and then the supernatant was removed. The cells were suspended at a concentration of 1×10.sup.6 cells/ml in 1 mL of an assay medium, an RPMI 1640 medium (Gibco, 11875093) containing 10% FBS, and then 30 μL of Calcein-AM (Molecular probe, C34852) was added thereto, followed by culture in a CO.sub.2 incubator at 37° C. for 1 hour. Next, the cells were washed twice with assay medium and then suspended in 10 mL of assay medium at a concentration of 1×10.sup.5 cells/ml. Meanwhile, PBNK (NK cells from donor peripheral blood) or CBNK (NK cells from donor cord blood) to be used as effector cells were also washed with 1×PBS and then the supernatant was removed, and the cells were suspended in assay medium at a concentration of 3×10.sup.6 cells/ml for an effector:target cell ratio of 30:1 or at a concentration of 1×10.sup.6 cells/ml for an effector:target cell ratio of 10:1. 100 μL of the effector cells prepared at a ratio of 30:1 or 10:1 were added to each of three wells of a round-bottom 96-well plate, and then 100 μL of the target cells at a concentration of 1×10.sup.5/mL were added to each well. Spontaneous release wells and maximum release wells were prepared to calculate the cell killing ability by a formula. 100 μL of stained target cells were added to the span wells, and 100 μL of assay medium was added each. To each spontaneous release well, 100 μL of stained target cells were added and 100 μL of assay medium was added. To each maximum release well, 100 μL of stained target cells were added and 100 μL of 2% Triton-X 100 solution was added. In order to correct the autofluorescence value present in the assay medium and the 2% Triton-X 100 solution, 200 μL of assay medium was added to prepare the medium value, and 100 μL of 2% Triton-X 100 solution was added to 100 μL of assay medium to prepare the value of the mixed solution of the two solutions. The autofluorescence value was corrected by subtracting the value of the mixed solution from the value of the medium to obtain difference (A) and adding difference (A) to the maximum release medium value. The plate was incubated in a CO.sub.2 incubator at 37° C. for 4 hours under a light-shielded condition and then centrifuged at 2,000 rpm for 3 minutes. 100 μL of the supernatant was added to each well of a 96-well black plate, and the fluorescence value (OD.sub.480/535 nm) was measured using a fluorescence plate reader (Perkin Elmer, VICTOR Nivo). Based on the fluorescence value, the ability of the effector cells to kill the target cells was calculated using the following formula:
Cell killing ability (%)=(average fluorescence value of sample wells−average fluorescence value of spontaneous release wells)/{(average fluorescence value of maximum release wells+A)−average fluorescence value of spontaneous release wells}×100
[0100] It was confirmed that the B2M knockout (KO) NK group (donor 1) was easily attacked by the PBNK cells derived from another donor (donor A or donor B) or the wild type NK cells from the same donor (donor 1). On the other hand, it was observed that the degree of attack significantly decreased in the HLA-E TD NK or B2M KO/HLA-E TD NK group expressing HLA-E, indicating that the NK cells expressing HLA-E can efficiently evade the attack of NK cells derived from other donors or wild-type NK cells expressing HLA-ABC (
TABLE-US-00005 TABLE 5 Expression of NKG2A and NKG2C on effector cells Effector cells NKG2A expression (%) NKG2C expression (%) PBNK (donor A) 31 48 PBNK (donor B) 76 17 CBNK (donor 1) 96 17
[0101] In addition, it was shown that, when the produced genetically engineered NK cell groups were cultured separately, there was no significant difference in viability between the groups, but the growth rate was significantly lower in the B2M KO NK group than in the other groups (
Example 5: Optimization of Method for Producing Log-NK Cells (B2M.SUP.−./HLA-E.SUP.+ NK Cells)
[0102] Log-NK cells having inhibited expression of HLA-ABC due to B2M gene knockout and transduced with the HLA-E gene were produced by four different methods as shown in Table 6 below.
TABLE-US-00006 TABLE 6 Log-NK production methods Day 7 Day 10 Day 12 Day 14 Day 21 Day 29 Days 39 to 42 Production B2M KO B2M- FACS End of culture Method 1 isolation, expression analysis (FACS expression scHLA-E TD analysis) Production scHLA- B2M KO FACS End of culture Method 2 E TD expression analysis (FACS expression analysis) Production scHLA- B2M KO B2M- FACS End of culture Method 3 E TD isolation expression analysis (FACS expression analysis) Production B2M KO End of culture — Method 4 (FACS expression analysis) *KO: Knockout, TD: Transduction
[0103] The detailed experimental method of each process and the method for FACS analysis of expression characteristics are as described in Examples 1 and 3. In
[0104] In the case of Production Method 2, on day 14 corresponding to ⅓ of the entire culture period, scHLA-E was transduced into cells and expressed, and after 3 days, B2M was knocked out, and the process of isolating B2M.sup.− cells was not performed. Since cells expressing HLA-E can evade the attack of other NK cells, it was expected that, even if the B2M gene was knocked out, the expression of HLA-E would continue and the survival and growth of the cells could be maintained. However, the actual results showed that the Log-NK cell production efficiency was low (about 13%) and the Log-NK cells present decreased over the culture time, and thus there were no Log-NK cells remaining at the end point.
[0105] In the case of Production Method 3, the production process was started on day 7 of culture as in Production Method 1, and B2M knockout and HLA-E transduction were performed in reverse order, followed by the process of isolating B2M− cells, thereby producing Log-NK cells. As a result, it was confirmed that the Log-NK cell production efficiency (87%) was higher than that in preparation method 2, but the Log-NK cells were reduced to about 20% at the end of culture, resulting in a very low yield.
[0106] In the case of Production Method 4, B2M was knocked on day 7 of culture, and HLA-E was transduced without the process of isolating B2M− cells, followed by culturing. It was confirmed that Log-NK cells were hardly obtained (about 3%) compared to the previous three production methods.
[0107] From the above results, it was confirmed that Log-NK cells of the present invention, which inhibit B2M gene expression for elimination of immunogenicity by inhibition of HLA-ABC expression and express HLA-E to evade the attack of other NK cells, were best obtained by Production Method 1.
Example 6: Culture and Characterization of NK or Log-NK Cells
[0108] CBNK or Log-NK cells were cultured with restimulation using feeder cells on the start date of culture, day 14 of culture, and day 28 of culture. The feeder cells used in culture were CD4+ T cells transformed with 4-1BBL, mbIL-21 (membrane bound IL-21) and mTNF-α (membrane TNF-α) genes. Restimulation using feeder cells is possible at intervals ranging from 14 to 16 days. Log-NK cells that were stationary cultured in an appropriate culture container were frozen after up to 39 days of culture, and could be cultured for up to 42 days depending on the cell growth rate. If more than 42 days of culture is required, continuous culture is possible by restimulation with feeder cells on day 42 of culture. NK or Log-NK cells were stained with the antibodies shown in Table 7, and whether the Log-NK (HLA-ABC−/HLA-E.sup.+) phenotype was maintained in NK cells with CD3.sup.−/CD56.sup.+ purity was checked up to the end of culture. As a result, it was confirmed that the expression of HLA-ABC gene in the Log-NK cells was maintained at 5% or less, and the HLA-E expression level (mean fluorescence intensity, MFI) in each type of cells was maintained higher than that in the wild-type NK cells (
[0109] The Log-NK cells produced by Production Method 1 showed a similar cell viability compared to the wild-type NK cells during a period ranging from day 10 of culture (corresponding to the end of the production process) to day 39 corresponding to the end of culture. The decreases in the viability and growth rate of Log-NK cells, which appeared between day 10 and day 14 of culture, were a phenomenon that appeared temporarily due to the death of the B2M-NK cells remaining untransformed with the HLA-E lentiviral vector, and it could be confirmed that, after restimulation with the feeder cells on day 14, both the growth rate and the viability were restored (
TABLE-US-00007 TABLE 7 List of antibodies for FACS analysis of NK characteristics Amount of Antibody information antibody Marker (human) (fluorescent/manufacturer/catalog No.) used Human CD16 PE/BD Bioscience/555407 5 μL Human NKG2A PE/Miltenyi Biotec/130-113-566 1 μL Human NKG2C PE/R&D Systems/FAB138P 1 μL Human NKG2D PE/BD Bioscience/557940 1 μL Human NKp30 PE/BD Bioscience/557940 1 μL Human NKp44 PE/BD Bioscience/558563 5 μL Human NKp46 PE/BD Bioscience/557991 5 μL Human DNAM1 PE/BD Bioscience/559789 5 μL Human CD25 PE/BD Bioscience/555432 5 μL Human CD62L PE/Invitrogen/12-0629-42 1 μL Human CD69 PE/R&D Systems/FAB23591P 1 μL Human CXCR3 PE/BD Bioscience/557185 5 μL Human CD57 PE/BD Bioscience/560844 1 μL Mouse IgG1k PE/BD Bioscience/555749 5 μL
Example 7: Assessment of Tumor Cytotoxicity of Log-NK Cells
[0110] To evaluate the tumor-killing ability of wild-type NK cells or Log-NK cells, the K562 hematological cancer cell line was used as target cells. K562 cells were washed with 1×PBS, and then the supernatant was removed. The cells were suspended at a concentration of 1×10.sup.6 cells/ml in an assay medium, which is an RPMI 1640 medium containing 1000 FBS, and then 30 μL of Calcein-AM (Molecular probe, C34852) was added thereto, followed by culture in a CO.sub.2 incubator at 37° C. for 1 hour. Next, the cells were washed twice with 10 mL of assay medium and then suspended in 10 mL of assay medium at a concentration of 1×10.sup.5 cells/ml. Wild-type NK cells or Log-NK cells were washed with 1×PBS, and then the supernatant was removed, the cells were suspended in assay medium at a concentration of 1×10.sup.6 cells/ml for an effector:target cell ratio of 10:1, a concentration of 3×10.sup.5 cells/ml for an effector:target cell ratio of 3:1, a concentration of 1×10.sup.5 cells/ml for an effector:target cell ratio of 1:1, or a concentration of 3×10.sup.4 cells/ml for an effector:target cell ratio of 0.3:1. 100 μL of the effector cells prepared at four ratios were added to each of three wells of a round-bottom 96-well plate, and then 100 μL of the target cells at a concentration of 1×10.sup.5/mL were added to each well. Subsequent experimental procedures and the calculation of tumor cell killing ability were performed in the same manner as in Example 4. As a result of evaluating the ability to kill the K562 cancer cell line, it was confirmed that there was no significant difference in cancer cell killing ability between NK cells and Log-NK cells at a high E:T ratio, and as the E:T ratio decreased, the difference in cancer cell killing ability between the NK cells and the Log-NK cells completely disappeared (
Example 8: Examination of Cytokine Secretion by Log-NK Cells
[0111] The secretion amounts of CD107a, IFN-γ and TNF-α, which are major cytokines secreted by NK cells to kill cancer cells, were examined by an intracellular cytokine staining (ICS) assay method. Antibodies used in the ICS experiment are specified in Table 8 below, and the types of antibodies used in each cell staining method are specified in Table 9 below.
TABLE-US-00008 TABLE 8 List of antibodies for ICS Amount of Antibody information antibody Antibody (fluorescent/manufacturer/catalog No.) used Human IFN-γ FITC/BD Bioscience/554700 1 μL Human TNF-α PE-CY7/eBioscience/25-7349-82 1 μL Human CD3 PerCP-Cy5.5/eBioscience/45-0036-42 5 μL Human CD56 APC-Cy6/eBioscience/47-0567-42 1 μL Human CD107a APC/BD Bioscience/560664 1 μL 7-AAD PerCp-Cy5.5/Beckmen Coulter/A07704 5 μL Mouse IgG1k FITC/BD Bioscience/555748 5 μL Mouse IgG1k PE-Cy7/BD Bioscience/557872 5 μL Mouse IgG1k APC/BD Bioscience/555751 5 μL
TABLE-US-00009 TABLE 9 List of antibodies for each cell staining method Antibody Fluorescent (−), target well iso well Surface PerCP-cy5.5 7AAD/CD3 staining APC-Cy7 CD56 APC CD 107a IgG1k Intracellular FITC IFN-γ IgG1k staining PE-Cy7 TNF-α IgG1k
[0112] Wild-type NK cells or Log-NK cells as effector cells were washed with 1×PBS, and then supernatant was removed. The cells were suspended in an assay medium, which is 1000 FBS-containing RPMI 1640 medium, at a concentration of 2.5×10.sup.6 cells/mL for an effector:target cell ratio of 1:1. Next, 1.2 mL of the suspension was placed in a fresh tube, and 1.56 μL of Golgi-stop (BD, 554724) and 2.4 μL of Golgi-plug (BD, 555029) were added thereto.
[0113] Meanwhile, K562 cells as target cells were suspended in assay medium at a concentration of 2.5×10.sup.6 cells/ml. A 96-well round bottom plate was prepared, APC-CD107a antibody was added to (−) and target wells, and APC-IgG1k antibody was added to iso wells. To each (−) well, 100 μL of 10% FBS-containing RPMI 1640 medium was added, and to each of the target and iso wells, 100 μL of the target cells were added. 100 μL of the effector cells were added to each of the wells and then incubated in a CO.sub.2 incubator at 37° C. for 4 hours. The plate was centrifuged at 2,000 rpm for 3 min at 4° C. and washed twice with 200 μL of perm/wash buffer (BD, 554723), and then 200 μL of fixation/permeabilization buffer (BD, 554655) was added to each well, followed by incubation at 4° C. for 30 minutes. The plate was centrifuged at 2,000 rpm for 3 min at 4° C. and washed twice with 200 μL of perm/wash buffer (BD, 554723), and then 100 μL of perm/wash buffer (BD, 554723) was added to each well. To the (−) and target wells, IFN-γ and TNF-α antibodies were added, and to the iso wells, FITC-IgG1k and PE-Cy7-IgG1k antibodies were added, followed by incubation at 4° C. for 30 minutes. 100 μL of 1× perm/wash buffer was added to each well, and the plate was centrifuged at 2,000 rpm for 3 min at 4° C., and the supernatant was removed. The plate was centrifuged at 2,000 rpm for 3 min at 4° C. and washed twice with 200 μL of perm/wash buffer (BD, 554723), and then 200 μL of 1× perm/wash buffer was added to each well. The cell pellet was transferred to a FACS tube (BD falcon, 352052) and the cytokine expression therein was analyzed by flow cytometry. As a result, it was confirmed that, when the NK cells and the Log-NK cells were in contact with the K562 target cells, the major cytokines CD107a, IFN-γ and TNF-α in the NK cells and Log-NK cells all increased by more than 60%, and there was no significant difference in the cytokines between the NK cell group and the Log-NK cell group (
Example 9: In Vitro Evaluation of Low Immunogenicity of Log-NK Cells
[0114] An in vitro mixed lymphocyte reaction (MLR) assay was performed to evaluate the in vivo low-immunogenicity of the produced Log-NK cells. Using a CD8 (+) T cell isolation kit (Miltenyi Biotec, 130-096-495), CD8 (+) T cells were isolated as follows. PBMCs obtained from donor blood were washed once with PBS (Lonza) containing MACS buffer 0.5% FBS (GIBCO) and 2 mM EDTA (Invitrogen), and then the obtained cell pellet was suspended in MACS buffer to a cell concentration of 1×10.sup.7 cells/10 μL. Biotin-antibody cocktail was added to the suspension to reach a concentration of 1×10.sup.7 cells/10 μL, mixed well, and incubated at 4° C. for 5 minutes. After completion of the reaction, MACS buffer was added to reach a cell concentration of 1×10.sup.7 cells/30 μL, and 20 μL of CD8(+) T cell microbead cocktail was added per 1×10.sup.7 cells, followed by incubation at 4° C. for 10 minutes. After completion of incubation, the cell suspension was passed through an LS column (Miltenyi Biotec) to isolate only T cells expressing CD8.
[0115] In order to culture the isolated CD8(+) T cells, PBMCs donated from another donor were irradiated with 2,000 cGy and then mixed with the CD8(+) T cells at a 1:1 ratio, followed by culture for 7 days. PBMCs were prepared in the same manner and mixed at a ratio of 1:1 with the CD4(+) T cells and CD8(+) T cells cultured for 7 days. The cells were cultured in RPMI 1640 medium containing anti-CD3 (1 μg/mL, Invitrogen), IL-2 (100 U/mL) and 10% BBS for 7 days. The cells were further cultured for 7 days (a total of 14 days of culture) and used in the experiment. The same donor-derived PBMCs used above were irradiated again with 2,000 cGy, mixed with the cultured CD8(+) T cells at a ratio of 1:1, and further cultured for one week. Using the CD8(+) T cells cultured for a total of 14 days as effector cells, and using NK or Log-NK cells as target cells, whether Log-NK cells could evade the attack of CD8(+) T cells was examined by measuring cell death in the same manner as in Example 3. As shown in
[0116] In addition, NK and Log-NK cells were stained with CFSE (Thermo scientific, C34554), and then 100 μL of CD8(+) T cells at a concentration of 1.2×10.sup.6 cells/mL in RPMI 1640 (10% FBS, 1000 IU IL-2) medium and 100 μL of the NK or Log-NK cells at a concentration of 4×10.sup.4 cells/mL in the medium were added to each of 3 wells of a 96-flat-well plate so that the ratio of CD8(+) T:NK or Log-NK was 30:1. The plate was analyzed using the IncuCyte®S3 system (Sartorius) provided inside the cell culture incubator, well images were stored every hour in a live state, and then only cells positive for CFSE fluorescence on the images was counted. As a result, it could be confirmed that, when NK cells were co-cultured with CD8(+) T cells, the ratio of the cultured NK cells to the NK cells initially added to the wells decreased over time, whereas, in the case of Log-NK cells, the number of the cells initially added to the wells was maintained (
Example 10: Selection of Optimal gRNA Sequence for CIITA Gene Knockout
[0117] 10-1) Knockout of CIITA and RFXANK Genes Using Gene Scissors
[0118] Human major histocompatitibility complex (MHC) class II genes include HLA-DR, HLA-DQ, and HLA-DP. In order to produce NK cells that do not express HLA-DR/DQ/DP, a desired portion of Class II transactivator (CIITA) known as a master controller or the transcription factor RFXANK (RFX-associated ankyrin-containing protein gene was delivered in the following manner using gene scissor technology to inhibit the expression of CIITA or RFXANK.
[0119] Each of the CIIA- or RFXANK-targeting gRNA candidate sequences listed in Table 10 below was prepared using an RNP reaction solution in the same manner as in Example 1, and the reaction solution was used within 60 minutes after reaction at room temperature for 5 minutes or more.
[0120] The prepared RNP reaction solution could be used for up to 1 to 4×10.sup.6 cells, and NK cells were counted using an ADAM cell counter system (NanoEntek) and then 2×10.sup.6 NK cells were used. Subsequent experimental procedures and cell culture were performed in the same manner as in Example 1.
TABLE-US-00010 TABLE 10 gRNA candidate sequence targeting CIITA or RFXANK NK cell culture period after SEQID gRNA-exon Length knockout No. NO. Nuclease position Sequence (bp) (KO % of HLA-DR) 1 20 Cpf1 CIITA-ex1A CCTTGGGGCTCTGAC 23 D4 D8 AGGTAGGA (29.7) (28.2) 2 21 Cpf1 CIITA-ex1B CCGGCCTTTTTACCTT 23 D4 (—) D8 GGGGCTC (7.3) 3 22 Cpf1 CIITA-ex3A CTCCCAGAACCCGAC 23 D4 D8 ACAGACAC (9.6) (12.4) 4 23 Cpf1 CIITA-ex4A CTTGTCTGGGCAGCG 23 D4 D8 GAACTGGA (4.6) (5.3) 5 24 Cpf1 CIITA-ex5A TGCCCAACTTCTGCTG 23 D5 D7 D10 D14 GCATCTC (5.6) (11.4) (14.9) (17.7) 6 25 Cpf1 CIITA-ex5B TGACTTTTCTGCCCAA 23 D5 CTTCTGC (0.6) 7 26 Cpf1 CIITA-ex7A TCCAGGCGCATCTGG 23 D5 CCGGAGGC (2.0) 8 27 Cpf1 CIITA-ex8A TCCCCACCATCTCCAC 23 D5 D7 D10 D14 TCTGCCC (5.4) (13.1) (14.9) (19.9) 9 28 Cpf1 CIITA-ex8B TCCAGTTCCTCGTTGA 23 D5 (—) GCTGCCT 10 29 Cpf1 CIITA-ex8C CCAGAGCCCATGGGG 23 D5 D8 CAGAGTGG (5.5) (10.4) 11 30 Cpf1 CIITA-ex9A CTCGGGAGGTCAGGG 23 D5 D8 CAGGTTCA (8.9) (11.2) 12 31 Cpf1 CIITA-ex10A GAAGCTTGTTGGAGA 23 D5 (—) CCTCTCCA 13 32 Cpf1 CIITA-ex11A GCAGCACGTGGTACA 23 D5 D8 GGAGCTCC (3.5) (9.1) 14 33 Cpf1 CIITA-ex11B GCCATCGCCCAGGTC 23 D5 CTCACGTC (5.1) 15 34 Cpf1 CIITA-ex11C AGAGCTCAGGGATGA 23 D5 CAGAGCAC (—) 16 35 Cpf1 RFXANK-ex1A CAGTAGGAGTAGTCG 23 D5 TCGCGTAT (—) 17 36 Cpf1 RFXANK-ex1B CAGGGCAAGGGTGCG 23 D5 CAGGCGCA (—) 18 37 Cpf1 RFXANK-ex1C CGAGATCTACTGAAC 23 D5 CAGAAAAG (—) 19 38 Cpf1 RFXANK-ex1D TGGTTCAGTAGATCTC 23 D5 GTAAAGA (—) 20 39 Cpf1 RFXANK-ex2A GGACAAGGTTCTCTG 23 D5 CAACCTGA (—) 21 40 MAD7 CIITA-ex1A CCTTGGGGCTCTGAC 21 D5 D7 AGGTAG (22.6) (15.5) 22 41 MAD7 CIITA-ex1B GGGCTCTGACAGGTA 21 D4 D8 (0) GGACCC (1.0) 23 42 MAD7 CIITA-ex3A CCTCCCAGGCAGCTC 21 D4 D8 (0) ACAGTG (1.3) 24 43 MAD7 CIITA-ex3B TATGACCAGATGGAC 21 D4 D8 (0) CTGGCT (0.3) 25 44 MAD7 CIITA-ex5A TGCCCAACTTCTGCTG 21 D5 D7 GCATC (38.6) (40.1)
[0121] 10-2) NK Cell Staining for Flow Cytometry
[0122] In order to examine the degree of knockout of CIITA or RFXANK gene in NK cells, NK cells treated with the CIITA RNP reaction solution in Example 10-1) were stained and then analyzed by flow cytometry. 2×10.sup.5 NK cells were suspended in 2 mL of 200 FBS-containing FACS buffer and centrifuged at 2,000 rpm for 3 minutes. Then, the cells were in 100 μL FACS buffer, and fluorescently labeled antibodies (Table 11) were added thereto, followed by incubation at 4° C. for 30 min. After 30 min, 2 mL of FACS buffer was added to the cells, followed by centrifugation at 2,000 rpm for 3 minutes. Next, 300 μL of a fixation solution was added to the cells which were then analyzed using the flow cytometer BD LSRFortessa (BD Bioscience), and the results are shown in
TABLE-US-00011 TABLE 11 List for antibodie for FACS analysis Amount of Antibody information antibody Marker (fluorescent/manufacturer/Catalog No.) used Human B2M APC/BD Bioscience/316312 0.5 μL Human HLA-DR PE/Invitrogen/12-9956-42 1 μL Human CD56 BV421/BD Bioscience/562751 0.5 μL Human CD3 FITC/BD Bioscience/555332 5 μL 7-AAD PerCp-Cy5.5/Beckmen Coulter/A07704 5 μL
[0123] The degree of knockout of HLA class II was examined based on by the expression of HLA-DR. It was confirmed that NK cells treated with Cpf1-#1 gRNA among a total of 25 gRNA sequences tested showed a CIITA gene knockout efficiency of 28.2% compared to the control wild-type NK cells, and NK cells treated with Cpf1-#5 gRNA showed a knockout efficiency of 17.7%, and NK cells treated with Cpf1-#8 gRNA showed a knockout efficiency of 19.9%. In addition, NK cells treated with MAD7-#21 gRNA was a knockout efficiency of 15.5%, and NK cells treated with MAD7-#25 gRNA showed a knockout efficiency of 40.1%. Therefore, MAD7 nuclease and #25 gRNA showing the best CIITA gene knockout efficiency were selected and used in subsequent experiments. In addition, as shown in
Example 11: Optimization of Conditions for Production of NK Cells Knocked-Out of B2M and CIITA Genes
[0124] To produce NK cells knocked-out of B2M and CIITA genes, the NK cells were produced by two methods as shown in
[0125] As can be seen in
[0126] Genomic DNA was isolated from the B2M- and CIITA-double knockout NK cells produced by Production Method 1, and then subjected to whole genome sequencing. A genomic DNA sequence having four or less nucleic sequences that mismatch the gRNA sequence of each of B2M and CIITA was assumed to be a potential off-target region, and whether insertions/deletions by off-target actually occurred was examined. As a result, three predicted off-target regions were identified in the B2M gRNA sequence (
Example 12: Production of Log-NK-CIITA KO Cells (B2M−/CIITA−/HLA-E+ NK Cells)
[0127] NK cells having an HLA-ABC.sup.−/HLA-DR/DP/DQ.sup.−/HLA-E.sup.+ phenotype as a result of inhibiting the expression of the type II HLA protein HLA-DR/DP/DQ by knocking out the CIITA gene in Log-NK cells having B2M−/HLA-E+ expression characteristics were produced by Production Method 1 or Production Method 2 shown in
Example 13: Culture of Log-NK-CIITA KO Cells and Confirmation of Phenotypic Expression
[0128] 13-1) Measurement of Expansion Ability of Log-NK-CIITA KO Cells
[0129] As shown in
[0130] 13-2) Analysis of Phenotype of Log-NK-CIITA KO Cells During Culture Period
[0131] In order to examine whether the expression of HLA-ABC and HLA-DR/DP/DQ was continuously inhibited for 43 days of culture after the production of Log-NK-CIITA KO cells, the NK cells produced by the method of Example 11 were stained, and then the expression in the cells was analyzed by flow cytometry. 2 mL of FACS buffer containing 2% FBS was added to 2×10.sup.5 NK cells, followed by centrifugation at 2,000 rpm for 3 minutes, and then the supernatant was removed. The cells were suspended in 100 μL of FACS buffer and incubated with the antibodies listed in Table 12 at 4° C. for 30 minutes. Next, 2 mL of FACS buffer was added to the cells, followed by centrifugation at 2,000 rpm for 3 minutes, and the supernatant was removed. Next, 300 μL of fixative solution was added to the cells, and then expression was analyzed by the flow cytometer BD LSRFortessa (BD Bioscience). As a result, as shown in
TABLE-US-00012 TABLE 12 List of antibodies for FACS analysis Amount of Antibody information antibody Marker (fluorescent/manufacturer/catalog No.) used Human FITC/BD Bioscience/555558 5 μL HLA-DR/DP/DQ Human CD56 APC/BD Bioscience/555518 5 μL Human HLA-ABC BV421/BD Bioscience/565332 0.5 μL Human CD3 PE-Cy7/Invitrogen/25-0038-42 1 μL Human HLA-E PE/Biolegend/342604 1 μL 7-AAD PerCp-Cy5.5/Beckmen Coulter/A07704 5 μL
Example 14: Analysis of Anticancer Activity of Log-NK-CIITA KO Cells
[0132] 14-1) Examination of Cancer Cell Killing Ability Using Calcein-AM
[0133] To use cancer cells K562 (chronic myeloid leukemia), DU145 (prostate cancer), HepG2 (liver cancer), HCC1954 (breast cancer), MDA-MB-231 (breast cancer), MDA-MB-468 (breast cancer) and SKOV3 (ovarian cancer) as target cells, each type of cells was suspended at a concentration of 1×10.sup.6 cells/mL in 1 mL of an assay medium, which is 10% FBS-containing RPMI 1640 medium, and then treated with 30 μL of Calcein-AM (Invitrogen), followed by incubation in a CO.sub.2 incubator at 37° C. for 1 hour. After incubation, the cells were washed twice with assay medium and then prepared at a concentration of 1×10.sup.5 cells/mL. NK or Log-NK-CIITA KO cells as effector cells were suspended in assay medium at a concentration of 3×10.sup.6 cells/mL for an effector:target cell ratio of 3:1 or a concentration of 1×10.sup.6 cells/mL for an effector:target cell ratio of 1:1. 100 μL of the prepared effector cells were added to each of 3 wells of a round-bottom 96-well plate, and then 100 μL of target cells at a concentration of 1×10.sup.5 cells/mL were added to each well. Subsequent experimental procedures and measurement value calculation method were performed in the same manner as in Example 4.
[0134] As shown in
[0135] 14-2) Examination of Cancer Cell Killing Ability Using CFSE Staining
[0136] Each type of cancer cells (DU145, HepG2, HCC1954, MDA-MB-231, MDA-MB-468, and SKOV3) was suspended at a concentration of 4×10.sup.4 cells/mL in an assay medium, which is 10% FBS-containing RPMI 1640 medium, and then 100 μL of the cell suspension was added to each well of a 96-well plate and cultured for 18 to 22 hours, and then effector cells were added thereto. NK or Log-NK-CIITA KO cells as effector cells were suspended in RPMI 1640 medium containing 10% FBS and 1000 IU IL-2 at a concentration of 8×10.sup.4 cells/mL for an effector:target cell ratio of 2:1, and then 100 μL of target cells were added to each of 3 wells of the 96-well plate being cultured. While the cells were cultured in a CO.sub.2 incubator at 37° C. for 7 days, cell images were stored every 2 hours using a real-time cell image analyzer IncuCyte®S3 system (Sartorius) provided inside the incubator, and the cancer cell killing ability of the cells was evaluated by analyzing the cell images. As a result, it was confirmed that Log-NK-CIITA KO cells showed increased cancer cell killing ability compared to the control NK cells against DU145 and MDA-MB-231, and showed killing ability similar to the control NK cells against other cancer cell lines (
Example 15: Knockout of B2M and CIITA Genes Using Various gRNA Delivery Methods
[0137] In order to further confirm whether the same knockout effect is exerted even with a delivery system other than the shuttle, an RNP of B2M gRNA or CIITA gRNA and MAD7 nuclease was delivered to NK cells by various methods to confirm the efficiency of knockout of each gene. For the B2M gene, #8 gRNA (SEQ ID NO: 8) was used, and for the CIITA gene, #25 gRNA (SEQ ID NO: 44) was used. The same number of NK cells (1×10.sup.6 cells) was used for each delivery method. On the day of knock-out, cells were suspended in 500 μL of opti-MEM (Gibco, 31985062) medium and cultured in a 12-well plate, and the next day, 1 mL of NK cell culture medium was added to each well.
[0138] In Method 1, 26 μL of PBS, 4 μL of 40 μM MAD7 nuclease and 2 μL of 10 μM B2M or 2 μL of CIITA gRNA were mixed together and allowed to react at room temperature for 5 minutes or more, thus preparing an RNP reaction solution. 2 μL of 5 μM FSD64d1 shuttle was added to 48 μL of α-MEM medium and then mixed with 50 μL of the RNP reaction solution. Next, NK cells were treated with the mixture and incubated at room temperature for 1 minute and 30 seconds. The detailed delivery method was performed in the same manner as described in Example 1.
[0139] In Method 2, gRNA was delivered to NK cells by electroporation, and Nucleofector (Lonza) system and Human Natural Killer Cell Nucleofector Kit (Lonza, VPA-1005) were used. The same amounts of gRNA and MAD7 nuclease as in Method 1 and NK cells were added to 100 μL of the solution provided in the kit, and the mixture was placed in a cuvette and then subjected to electroporation using the U-01 program.
[0140] In Method 3, Lipofectamine CRISPRMAX transfection reagent (Invitrogen, CMAX00008) was used. 1×10.sup.6 NK cells were pre-suspended in a 12-well plate, and the same amounts of gRNA and MAD7 nuclease as in Method 1, 2.5 μL of Cas9 plus reagent, and 25 μL of opti-MEM were added to a 1.5-mL tube, thus preparing tube 1 which was allowed to react. 1.5 μL of CRISPRMAX reagent and 25 μL of opti-MEM were added to another 1.5-mL tube, thus preparing tube 2. Next, the reaction solution prepared in tube 1 was mixed with tube 2, the mixture was allowed to react at room temperature for 5 minutes, and then the NK cells were treated with the mixture.
[0141] In Method 4, Lipofectamine2000 transfection reagent (Invitrogen, 11668027) was used. 1×10.sup.6 NK cells were pre-suspended in a 12-well plate, and the same amounts of gRNA and MAD7 nuclease as in Method 1, and 25 μL of opti-MEM were added to a 1.5-mL tube, thus preparing tube 1. 2.5 μL of Lipofectamine2000 and 25 μL of opti-MEM were added to another 1.5-mL tube, thus preparing tube 2. Next, the reaction solution prepared in tube 1 was mixed with tube 2, the mixture was allowed to react at room temperature for 5 minutes, and then the NK cells were treated with the mixture.
[0142] To confirm decreases in gene expression, the NK cells knocked-out of the B2M gene were analyzed by flow cytometry using B2M antibody after 3 days of culture, and the NK cells knocked-out of the CIITA gene were analyzed by flow cytometry using HLA-DR antibody after 7 days of culture. The gene expression level in wild-type NK measured by flow cytometry was converted to 1, and then the expression level in the NK cells knocked-out of the B2M or CIITA gene was calculated as a ratio relative to the expression level in the wild-type NK cells, thereby determining the efficiency of gene expression reduction. As shown in
Example 16: In Vitro Evaluation of Low-Immunogenicity of Log-NK-CIITA KO Cells
[0143] Log-NK-CIITA KO cells are NK cells having inhibited expression of type I HLA and type II HLA on the surface thereof, and thus were expected to have low immunogenic characteristics. In order to examine whether the cells can survive for a long time by evading the attack of the recipient's CD4 (+) T cells and CD8 (+) T cells when injected in vivo, an in vitro mixed lymphocyte reaction (MLR) assay was performed. In order to facilitate the MLR reaction, the experiment was conducted under conditions where the HLA-A, B, C and DRB1 types of CD8(+) T cells or CD4(+) T cells 100% mismatched with those of wild-type NK or Log-NK-CIITA KO cells and where the irradiated PBMCs used for culture of CD8(+) T cells or CD4(+) T cells were 37.5% identical with the HLA-A, B, C, DRB1 types of wild-type NK or Log-NK-CIITA KO cells. The method of isolating CD8(+) T cells from PBMCs was the same as the procedure described in Example 9, and in order to isolate CD4(+) T cells, a CD4(+) T cell isolation kit (Miltenyi Biotec, 130-096-533) was used and the method was as follows. PBMCs were washed once with MACS buffer, and then the cell pellet was suspended to a concentration of 1×10.sup.7 cells/40 μL, and biotin-antibody cocktail at a concentration of 1×10.sup.7 cells/10 μL was added thereto, followed by incubation at 4° C. for 5 minutes. Thereafter, MACS buffer was added again to the cells to a concentration of 1×10.sup.7 cells/30 μL, and CD4(+) T cell microbead cocktail at a concentration of 1×10.sup.7 cells/20 μL was added to the cells, followed by incubation at 4° C. for 10 minutes. After completion of incubation, the cell suspension was passed through an LS column (Miltenyi Biotec), and only cells expressing CD4 were isolated. PBMCs with 37.5% HLA type match were irradiated with 2,000 cGy and then mixed with the isolated CD4(+) T cells or CD8(+) T cells at a ratio of 1:1 ratio, followed by culture for 7 days. PBMCs were prepared in the same manner and mixed at a ratio of 1:1 with the CD4(+) T cells and CD8(+) T cells cultured for 7 days. The cells were further cultured for 7 days (a total of 14 days of culture) and used in the experiment. Control NK cells and Log-NK-CIITA KO cells were fluorescently stained with CFSE, and then CD8(+) T cells or CD4(+) T cells were diluted in the same manner as in Example 9 in order to make an effector cells:target cell ratio of 10:1, and the cells were added to a 96-flat-well plate. To the well to which CD4(+) T cells were added, the same number of PBMCs (which have been irradiated with 2,000 cGy and from which CD3 T cells have been removed) as CD4(+) T cells were added. While the 96-well plate prepared by adding cells thereto was incubated in a CO.sub.2 incubator at 37° C., only cells positive for CFSE fluorescence were counted once every 2 hours using IncuCyte®S3 system (Sartorius). As a result, as shown in
[0144] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.