SELF-ELIMINATING TRANSGENES
20230242900 · 2023-08-03
Inventors
- Zach N. Adelman (College Station, TX, US)
- Kevin M. Myles (College Station, TX, US)
- Sakiko Okumoto (College Station, TX, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The current invention provides vector constructs that are pre-programmed to self-terminate or self-remove at a predetermined time and methods of making the same. The present invention further provides methods for creating organisms containing these vector constructs. Also provided are various transgenic organisms with the vector constructs, including plants, insects, and mammals.
Claims
1. A recombinant polynucleotide construct comprising direct repeat sequences flanking a DNA sequence comprising a transgene and at least a first site-specific nuclease recognition site.
2. The polynucleotide construct of claim 1, wherein the DNA sequence comprises said first site-specific nuclease recognition site and a second site-specific nuclease recognition site flanking said transgene.
3. The polynucleotide construct of claim 2, wherein the first and second site-specific nuclease recognition site are the same.
4. The polynucleotide construct of claim 2, wherein the first and second site-specific nuclease recognition site are different.
5. The polynucleotide construct of claim 1, wherein the site-specific nuclease recognition site is recognized by an engineered nuclease.
6. The polynucleotide construct of claim 1, wherein the site-specific nuclease recognition site is recognized by a nuclease native to at least a first eukaryotic species.
7. The polynucleotide construct of claim 1, wherein the DNA sequence comprises a reporter gene.
8. The polynucleotide construct of claim 1, wherein the direct repeat sequences comprise from about 2 to about 200 repeats.
9. The polynucleotide construct of claim 1, wherein the direct repeat sequences comprise from about 15 to about 20000 nucleotides.
10. The polynucleotide construct of claim 1, further comprising a selectable marker.
11. The polynucleotide construct of claim 1, further comprising a nucleic acid sequence encoding a nuclease that recognizes said site-specific nuclease recognition site.
12. The polynucleotide construct of claim 11, wherein said nucleic acid sequence is operably linked to an inducible or tissue-specific promoter.
13. The polynucleotide construct of claim 12, wherein said tissue-specific promoter is a germline-specific promoter.
14. The polynucleotide construct of claim 11, further comprising a second nucleic acid sequence encoding a second nuclease that recognizes a second site-specific nuclease recognition site in said DNA sequence.
15. The polynucleotide construct of claim 14, wherein the first and second nucleic acid sequences are operably linked to different promoters that drive different levels of expression.
16. A host cell comprising the polynucleotide construct of claim 1.
17. A transgenic plant, insect or non-human animal comprising the polynucleotide construct of claim 1, wherein said transgene is capable of being eliminated in progeny of said plant, insect or non-human animal.
18. A method of transforming a host cell comprising introducing the polynucleotide construct of claim 1 into said cell.
19. A method of eliminating a transgene sequence from a cell comprising subjecting a cell according to claim 16 to an external stimulus that causes the transgene sequence to be eliminated.
20. The method of claim 19, wherein the external stimulus is a chemical stimulus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION OF THE INVENTION
[0048] The present invention provides technologies using vectors that can be pre-programmed to self-remove from eukaryotic genomes. In embodiments described herein, the programming can be based on the ‘lit-slow-fuse’ model, whereby no additional stimulus is required and the transgene slowly disappears over a number of generations, or on a ‘short-fuse’ model, whereby an external chemical-based trigger is applied (or removed) to rapidly trigger transgene self-removal.
[0049] The present invention provides a solution to a number of problems in the art regarding gene drive. For instance, the present invention provides a solution to a significant problem in the art regarding the seemingly counterintuitive goals of gene drive, namely, of both spreading a gene into a population to fixation (gene drive) and then completely removing the gene from the population (reversal). In further embodiments, the present invention provides solutions to the regulatory and political difficulties and hurdles associated with gene drive technologies.
[0050] The concept of driving genes into wild populations to control vector-borne diseases is known in the art. Genetic strategies to control dengue virus based on the release of sterile, transgenic mosquitoes have been successful where attempted. These types of strategies provide effective mosquito control only as long as releases continue, and thus represent a long-term financial and administrative commitment that must be maintained even in the absence of continued transmission. For this reason, gene drive systems that permanently convert the target population into a refractory state by spreading effector genes have been long sought after, as the release scale, duration, and costs associated with such systems are expected to be dramatically lower.
[0051] Engineering or harnessing chromosomal translocations, meiotic drive systems, transposable elements, maternal-effect dominant embryonic arrest, engineered under-dominance, and homing endonuclease genes (“HEGs”) to achieve the goals of a gene drive-based vector control campaign have been slowed or prevented by the technical challenges associated with these systems. The rapid development of clustered regulatory interspaced palindromic repeat (“CRISPR”) editing reagents introduced a new programmable nuclease that did not suffer from the problems of HEGs (which are difficult to engineer) or transcription activator-like effector nucleases (“TALENs”) (which are poor repair substrates). The advent of site-specific gene editing using CRISPR/Cas9 reagents has produced a wave of successful gene drive experiments in yeast, flies, and mosquitoes.
[0052] With the ease of developing new Cas9-guided nucleases, the concept of gene drive is now spreading out to potentially control invasive or unwanted species, as well as other applications. However, there is at present no solution that addresses how one could achieve two seemingly counterintuitive goals of both spreading a gene into a population to fixation of a problem and then completely removing the gene from the population. The ease with which CRISPR nucleases can be generated, combined with the highly effective nature of CRISPR-based gene drive in Drosophila, has led to calls for increased regulatory capacity and institutional oversight of CRISPR-based gene drive approaches, with some even calling for the prohibition of public discussion of the details due to fears of bioterrorism.
[0053] Many of the proposed concepts and suggestions in the art to control or “reverse” the drive and transgenes introduced thereby are inadequate, as they would require coordinated additional large scale field releases of secondary or tertiary transgenic strains to fight against a first failed strain. The drawbacks are many. On the technical side, one would not know if the secondary strain will work until a field release occurs. From a regulatory perspective, each strain would likely be evaluated and approved (or not) on its own merits, and there is no precedent for a conditional deregulation for release of a product X contingent upon a product Y. Finally, from a political viewpoint, local authorities may choose to end a trial abruptly for any number of reasons, many of which may have nothing to do with the technical details. In such cases, those participating in the releases may simply not have the opportunity to release additional remediating strains.
[0054] To address the difficulties and shortcomings of the prior art, strategies have been crafted, as discussed herein. The present application describes gene drive-based technologies using vectors that are pre-programmed to self-terminate. In certain embodiments described herein, the programming can be based on the “Lit Slow Fuse Model,” whereby no additional stimulus is required and the transgene slowly disappears over a number of generations, or on a “Short Fuse Model,” whereby an external chemical-based trigger is applied (or removed) to rapidly trigger transgene self-removal.
[0055] Several independent mechanisms for use in the self-elimination, gene drive-based technologies of the present invention are also described in the present application. In certain embodiments, these mechanisms include a recombinase-based mechanism, a transposase-based mechanism, and a single-strand annealing (SSA)-based mechanism. The self-elimination systems of the present invention may be incorporated into a gene drive approaches to limit the transgene persistence in nature.
[0056] Such a biodegradable system would allow for extensive field-based trials of functional gene drive systems (or any transgene), while essentially setting a time limit on the presence of the transgene in nature. This would allow accurate and meaningful assessments of both risks and benefits of the technology, including effects on the target population (such as size, density, behavior, ability to transmit non-target pathogens), as well as any changes in the surrounding ecosystem or effects on human health.
Gene Drive
[0057] In the context of the present application, “gene drive” refers to any mechanism that results in the inheritance of a gene at a probability greater than would be expected by strict Mendelian inheritance.
[0058] Compositions and methods are known in the art regarding programmable nucleases that can introduce a double stranded break (“DSB”) at predetermined locations in a genome to facilitate gene drive. Such breaks are then repaired using the homologous chromosome as a template, a process termed homology-dependent repair (“HDR”), resulting in duplication of the transgene into the repaired chromosome. However, other cellular repair pathways such as non-homologous end-joining (“NHEJ”) and single-strand annealing (“SSA”) compete for access to the DSB. Repair through these pathways does not result in duplication of the transgene into the repaired chromosome and thus does not lead to gene drive. In certain embodiments, the present invention takes advantage of these alternate repair pathways to halt gene drive and promote self-elimination of the inserted transgenes.
[0059] The various models, as well as embodiments demonstrating application of these models, are described below.
A Lit Slow Fuse Model
[0060] In certain embodiments, the present invention provides a self-elimination model referred to as “The Lit Slow Fuse Model.” This model enables removal of transgenic sequence from the target population without intervention. As shown in
A Short Fuse Model
[0061] In other embodiments, the present invention provides a self-elimination model referred to as “The Short Fuse Model.” This model enables removal of all transgenic sequence from the target population, but will require intervention such as the addition or removal of a chemical trigger. When the trigger is added or removed, such action will rapidly trigger self-removal of the transgenic sequence.
[0062] In certain embodiments, the Short Fuse Model involves conditional expression systems, such as those based on the bacterial tetO operon, which is efficiently repressed in the presence of tetracyline, and the yeast GAL4-UAS system. Such conditional expression systems allows for controlled activation of the nuclease resulting in the self-elimination of the transgene. This in turn provides conditional or controlled transgene self-elimination.
[0063] Many conditional expression systems are known in the art and are useful in present invention. These include the bacterial tetO operon, the yeast GAL4 system, the Neurospora Q system, simple heat-shock or metal-induced gene expression systems, GeneSwitch, and so forth.
Vector Constructs
[0064] It is understood in the art that SSA-based DNA repair is triggered by direct repeats flanking a DNA break, and is influenced by the length of direct repeats, as well as their spacing. To effectively harness this pathway in order to pre-program the elimination of transgene sequences from an insect population, embodiments of the present invention involve the generation and insertion into the genome of certain organisms a synthetic construct containing, for instance, a reporter, a nuclease expressed in the germline, and a corresponding unique target site.
[0065] Reporters that may be employed in various embodiments described herein are known to those of ordinary skill in the art. Reporters generally expected to achieve the desired results as described herein include fluorescent proteins such as EGFP and DsRED, as well as physical mutations in the target organisms influencing pigmentation/coloration.
[0066] Nucleases that may be employed in various embodiments described herein are known to those of ordinary skill in the art. Nucleases generally expected to achieve the desired results as described herein include those based on CRISPR/Cas9 or related CRISPR nucleases, as well as homing endonucleases such as I-Sce (yeast), I-Cre (Chlamydomonas reinhardii), and I-Ani (Aspergillus nidulans).
[0067] Various unique target sites can be selected for use in the embodiments described herein. In general, the target sites described herein for the self-eliminating transgene are not found in the genome of the host organism. Once introduced into the organism's genome, they would be a unique target for the nuclease. Target sites described herein are capable of being cleaved by a nuclease, as described herein. In some embodiments, the target site includes a random synthetic string of 20-24 nucleotides.
[0068] In certain embodiments, a vector construct of the present invention may contain, for instance, a desired gene drive transgene, any desired reporters or markers, and any desired cargo genes accompanied by a gene encoding a recombinase, wherein the entire cassette may be flanked with corresponding recombination sites. In such an embodiment, expression of the recombinase would result in intramolecular recombination between the two flanking regions resulting in the excision of the intervening gene drive transgene, as well as all other transgenes, and restoration of the host allele (
[0069] In another embodiment, a vector construct of the present invention may contain, for instance, a desired gene drive transgene and other transgenes, including, but not limited to any desired reporter, marker, and/or cargo genes, accompanied by a gene cassette encoding an integration-deficient transposase, and flanked with corresponding inverted terminal repeats (ITRs,
[0070] In yet another embodiment, a vector construct of the present invention may contain, for instance, a desired gene drive transgene and other transgenes, including, but not limited to any desired reporter, marker, and/or cargo genes, flanked by a direct repeat corresponding to the wild type host allele. In this embodiment, all transgene sequences are susceptible to loss via SSA-based DNA break repair (SSA,
[0071] The above embodiments result in in cis removal of all transgene sequences while simultaneously generating a transgene-free allele that is resistant to future cleavage by the same gene drive mechanism. While the use of a recombinase would leave behind a scar that might perturb the activity of the host gene, silent nucleotide changes may be incorporated into either the transposon- or SSA-based approaches to preserve the wild-type amino acid sequence at the target gene and still provide resistance to further cleavage by the gene drive mechanism.
[0072] Various embodiments described herein will further include a control sequence to initiate transgene elimination, as in some embodiments, the engineered nuclease is to be switched on in the developing germ cells. To accomplish this requires control sequences capable of regulating gene expression in this manner. Many such control elements have been functionally characterized for both Drosophila and Ae. aegypti and are known in the art. For example, the female germline specific promoter nanos has been used in Drosophila to efficiently drive the expression of ΦC31 integrase and now Cas9 in the female germline.
[0073] The Ae. aegypti nanos promoter has previously been shown to successfully drive transposase expression in the female ovaries. Other germline promoters are also known in the art. For instance, germline promoters have been validated in mosquitoes and include for example vasa, VgR, β-tub. Additionally, genes such as β-tubulin are conserved between Drosophila and Tribolium. In some embodiments, RNA-seq approaches can reveal other germline-specific gene candidates.
[0074] In other embodiments, in addition to directly controlling nuclease expression, conditional expression systems, such as those based on the bacterial tetO operon may be employed, which is efficiently repressed in the presence of tetracyline, and the yeast GAL4-UAS system. Thus, nuclease activity, and in turn transgene self-elimination, can be controlled by the experimenter.
[0075] The organism selected for use in various embodiments described herein can be any eukaryote. In some embodiments, the organism is an insect species such as Drosophila melanogaster, Aedes aegypti, and Tribolium castaneum, a plant species, or an animal. In further embodiments, the organism is a human. A person having ordinary skill in the art will understand that certain parameters may be adjusted for individual species, such as hormone concentrations, culture conditions, strains of Agrobacterium, and incubation periods.
[0076] Embodiments described herein may depend on the recognition of the direct repeats engineered to flank the synthetic construct by the cellular SSA-repair machinery prior to initiation of repair by the end-joining machinery, a result that would remove the nuclease target site (preventing any further cutting) while leaving the synthetic construct intact. It is anticipated that each organism may display different preferences for default DNA repair (as the genome architecture of each varies), and the optimal size and spacing of direct repeats, as well as their distance from the nuclease cleavage site may vary in each organism. It is expected that a common set of rules may be established regarding size and spacing of direct repeats for related genomes. Increasing the length of the direct repeats, decreasing the spacing between repeats, and decreasing the distance between the nuclease cleavage site and one of the repeats are all expected to shift the balance to some extent towards SSA-based repair and away from end-joining. Increasing the number of nuclease sites may also help to overcome low-level end-joining repair. Strategies that directly interfere with end-joining repair globally may be avoided in certain embodiments, as this may result in unknown changes elsewhere in the genome.
[0077] In certain embodiments, such as those involving A. palmeri, in order for gene-deletion to work in, the synthetic repeat regions within the introduced construct need to be recognized by the endogenous homologous recombination (“HR”)-based repair pathway with priority over the NHEJ pathway. Preference for these mutually exclusive pathways differs in each organism, and such preference should be assessed for each organism.
Applications for the Models
[0078] Various embodiments described herein may be useful for efforts to use genetics-based strategies to control transgenic sequences in any organisms. The strategies described herein may be used in the field of agriculture, synthetic biology, and even human medicine. For instance, mosquito-borne diseases such as dengue, malaria, chikungunya, Zika, and so forth, may be controlled or addressed using the described gene drive-based strategies. An organization testing an experimental gene drive strategy to fight malaria may wish to pre-program the elimination of the transgene from any mosquito that escapes from the study. The embodiments described herein may also be useful to eliminate transgenes in seeds so that seeds are not used in an unauthorized or undesired manner. Additionally, the embodiments described herein may be used in human gene therapies in a manner so as to allow for triggering the removal of a transgene in the event of an adverse reaction in a patient. A person of skill in the art will understand the numerous applications that can employ embodiments described herein.
EXAMPLES
[0079] The following examples provide illustrative embodiments of the invention. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in specific aspects of these embodiments without departing from the concept, spirit, and scope of the invention. Moreover, it is apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the invention as defined by the appended claims.
Validation of a Self-Eliminating Transgene in Drosophila
Example 1: Assembly of Donor Constructs with Direct Repeats Flanking
[0080] Site-specific gene insertion will be used to generate several cohorts of transgenic Drosophila. Each transgenic strain will contain a set of direct repeats flanking a visible fluorescent marker and a nuclease gene programmed to recognize the introduced transgene. Nuclease cutting followed by SSA-based repair using the engineered direct repeats is intended to eliminate all transgene sequences, resulting in restoration of body pigmentation. As flies have a shorter generation time than mosquitoes and are easier to rear, it is anticipated that the assessment of variant constructs and loss in the context of an active Cas9-based gene drive will occur fairly rapidly.
[0081]
[0082] Table 1 below lists the donor constructs for the generation of fly strains containing self-eliminating gene cassettes.
TABLE-US-00001 TABLE 1 Donor constructs. Direct repeat Control of Active Cas9 Donor Construct length nuclease present? 1 1000 bp UAS/Gal4 N 2 1000 bp UAS/Gal4 Y 3 1000 bp Tet-Off N 4 1000 bp Tet-Off Y 5 2000 bp UAS/Gal4 N 6 2000 bp UAS/Gal4 Y 7 2000 bp Tet-Off N 8 2000 bp Tet-Off Y 9 4000 bp UAS/Gal4 N 10 4000 bp UAS/Gal4 Y 11 4000 bp Tet-Off N 12 4000 bp Tet-Off Y
[0083] Constructs generated in Example 1 will be employed in Example 2.
Example 2: Generation of Transgenic Fly Strains with Confirmed Nuclease Expression
[0084] Each plasmid construct generated in Example 1 will be injected into Drosophila embryos using standard techniques along with a synthetic guide RNA targeting the yellow gene and Cas9 mRNA. After crossing the surviving individuals, transgenic progeny will be identified by the expression of the fluorescent reporter. Such individuals will also present a loss of body pigmentation due to disruption of the yellow gene when made homozygous. The landing site of each integration event will be confirmed through PCR of genomic DNA. Only those strains bearing a transgene insertion into the yellow gene with all components intact will be retained. Pre-existing Gal4-driver lines will be obtained from stock centers to activate germline-specific expression of the nuclease for those strains under the control of the UAS. As the landing site is held constant, only a single verified homozygous strain for each construct will be employed in Example 3.
Example 3: Evaluation of Transgene Loss and Phenotype Reversion at the Individual Level
[0085] For each fly strain, the percentage of progeny that contain or have lost the inserted transgene will be determined. For UAS-nuclease strains, each strain will be crossed with an appropriate Gal4-driver (nos-Gal4, vasa-Gal4 or similar) to yield expression of the nuclease in the fly germline. For strains with nuclease under the control of the tet-Off system, flies will be reared in the absence of tetracycline. In both scenarios, nuclease cutting of the transgenic construct followed by SSA-based repair will result in the loss of the fluorescent reporter and simultaneous restoration of body pigmentation. As only homozygous flies will be used for these experiments, the presence of the Cas9 transgene cannot result in any further drive, but effectively increases the length of the transgene sequence.
[0086] By varying the length of the direct repeats, the influence of this parameter on the successful use of SSA-based repair and transgene elimination will be determined. By varying the Gal4-driver line used (or the amount of tetracycline used), data is expected to yield information concerning the relationship between the strength of nuclease expression and the efficiency of transgene elimination.
Example 4: Evaluation of Transgene Loss and Phenotype Reversion at the Cage Population Level
[0087] The ability of self-eliminating transgenes to remove themselves from a laboratory cage population in the presence of an active Cas9-based gene drive system will be assessed. Fly strains containing active Cas9 (based on constructs 2, 4, 6, 8, 10, 12) will be introduced at various frequencies (1%, 10%, 25%, 50%) into wild-type cages. For UAS-nuclease strains, cage populations will be fixed for a particular Gal4-driver. For tet-Off strains, flies will be reared on various levels of tetracycline (based on observations from Example 3). For each generation, the percentage of transgenic flies (fluorescent reporter, yellow) will be determined, with flies propagated blindly for 10 generations.
[0088] The output for this Example will be data concerning the rate of transgene loss that is expected to overcome the driving ability of site-specific nucleases. This is expected to provide a paradigm-shifting safety feature for working with driving transgenes in situations (such as field releases) where they otherwise could not be controlled or removed.
Optimizing Parameters for SSA-Based Programmed Transgene Elimination in Ae. aegypti
[0089] Intrachromosomal deletions mediated by the SSA pathway can result in deletions of at least 80 kbp at high efficiency with the length of repeats and distance of separation strongly influencing this mode of repair in yeast, flies, and vertebrate cells. The length of sequence that can be effectively collapsed in turn dictates the length of a minimal nuclease-based gene drive system (along with any visual markers and anti-pathogen gene cassettes). It is known that critical factors for NHEJ, HDR, and SSA are conserved in mosquitoes, where complete deletion of more than 2 kb using very short (200 bp) repeats have been observed.
[0090] In prior studies, three different HEGs have been used to introduce double-stranded DNA breaks in the Ae. aegypti germline. Using two transgenic strains where the EGFP fluorescent marker was flanked by HEG recognition sites, progeny have been recovered that had lost EGFP expression following injection of HEG expression constructs into pre-blastoderm embryos. Two types of repair events were recovered: NHEJ following cutting at each HE recognition site flanking the EGFP gene (Y2-I-Anil only) and SSA-based repair following cutting a one HE site (I-SceI, I-CreI, Y2-I-Anil) (as shown in
[0091] Other studies have shown repeats as short as 34 bp were able to direct the collapse of ˜1500 bp of intervening sequence, but not ˜2700 bp. A longer repeat length of 195 bp enabled the collapse of ˜2400 bp of transgenic sequence. These data suggest that extending the repeat length in Ae. aegypti will increase the efficiency of performing SSA-based repair over longer intervening sequences. It should be noted that, in this study, the site of DNA break induction was between 50-150 bp from the start of one (or both) of the repeats. Reported rates show targeted transgene integration into multiple loci in the Ae. aegypti genome using CRISPR/Cas9 at rates similar to traditional transposon-based methods.
[0092] However, the SSA pathway has never been explored in any mosquito species. Thus, an analysis of each of these parameters on SSA-based repair in the Ae. aegypti germline is essential to realizing the full potential to engineer self-decaying gene drive systems for this organism.
Example 5: Establish Transgenic Ae. aegypti Bearing the Pre-Programmed Self-Excising Cassette in the Genome
[0093] CRISPR/Cas9 will be used to stimulate dsDNA break induction adjacent to an existing PUb-EGFP transgene previously inserted into the kmo locus. Homology-dependent repair will be used to incorporate one of three variant transgene cassettes (varying only in the length of the direct repeat: 1000 bp, 2000 bp, 5000 bp), with each marked with DsRED. Each cassette will also include a germline-specific promoter (nanos, vasa or β-tubulin; all of which have been characterized in Ae. aegypti) driving the expression of the tTa transactivator; a homing endonuclease under the control of the tetO promoter, and the corresponding homing endonuclease target site. The integration of each cassette will be confirmed by the stable inheritance of DsRed in subsequent generations and through PCR/Southern analysis of the integrated transgene.
[0094] This Example 5 will yield three transgenic strains of Ae. aegypti, with each marked with a specific phenotype: white-eye (visible), red eye (fluorescent), green body (fluorescent).
Example 6: Determination of the Effect of Repeat Length on Transgene Self-Elimination in Ae. aegypti
[0095] Once established, embryos from each of the three lines generated in Example 5 will be collected from females reared in the absence of tetracycline. This releases the tTa from repression and activates expression of the homing endonuclease which is expected to induce specific DSBs in the engineered transgene. While end-joining repair can result in the loss of DsRED fluorescence through disruption of the ORF, restoration of eye pigmentation can only occur following SSA-based collapse of the direct repeats. Thus, the rate of both SSA-based repair (Black eye, EGFP.sup.−,DsRED.sup.−) and NHEJ-based repair (White eye, EGFP.sup.+, DsRED.sup.−) can be determined by scoring progeny. It is expected that as the repeat length increases, so will the number of SSA-based events; inversely, NHEJ events are expected to decrease. Repair events will be confirmed through molecular analysis.
[0096] Example 6 will provide experimental verification of the role of repeat length in influencing SSA-based repair efficiency in Ae. aegypti. The most efficient construct will be chosen for use in Example 7.
Example 7: Determination of the Effect of Distance Between the DSB Site and the Direct Repeats on Transgene Self-Elimination
[0097] Using the most efficient strain from Example 6, either HDR or recombination-mediated cassette exchange will be used to generate two additional variant strains, essentially replacing the initial HEG to one of two alternative HEGs with an independent target site located at varying distances from the direct repeats. Once established, mosquitoes bearing each of the three HEGs will be reared in the absence of tetracycline to activate HEG expression and initiate targeting at distances of ˜300 bp, 1000 bp, and 4000 bp from the direct repeats. Once again, successful SSA-based collapse will eliminate both fluorescent markers and restore eye pigmentation. For the HE site at the start of the EGFP ORF, NHEJ-based repair can result in loss of EGFP fluorescence, permitting tracking of both repair types. It is expected that as the distance between the dsDNA break site and repeats increases, the number of SSA-based events will decrease, while NHEJ events will increase.
[0098] Example 7 will provide experimental data concerning the practical effect of distance between nuclease cut site and direct repeats on the efficiency of pre-programmed transgenes to undergo self-elimination.
Example 8: Determination of the Effect of Distance Between Repeats (Cargo Size) on SSA-Based Repair
[0099] One of the three transgenic strains generated in Example 7 will be selected and the ΦC31 integrase system will be used to incorporate one of two additional transgenes into the existing locus via attP:attB recombination. Homology-dependent integration cannot be used in this case, as SSA would compete for the free DNA ends. Each ΦC31-integrated transgene will be marked with a blue fluorescent protein (mTagBFP). The ΦC31-integrated transgenes will increase the spacing between the direct repeats from 4 kbp to 8 or 16 kbp; integrations will be confirmed by PCR on genomic DNA over the resulting attL and attR flanking regions. Once established, mosquitoes bearing each transgene will be reared in the absence of tetracycline to activate HEG expression and progeny scored for eye color, as well as EGFP, mTagBFP and DsRED fluorescence. Once again, successful SSA-based repair will eliminate all fluorescent markers and restore eye pigmentation. NHEJ-based repair will be tracked through the loss of DsRED (or EGFP, if an alternative HE site is used), again permitting tracking of both repair types. It is expected that increasing the distance between direct repeats may decrease the number of SSA-based events and increase NHEJ events, but it is highly possible that even at the distances used SSA-repair could remain extremely efficient.
[0100] Experimental data concerning the practical effect of distance between the direct repeats on the efficiency of pre-programmed transgenes to undergo self-elimination will be generated.
Self-Eliminating Transgenes Control CRISPR-Based Gene Drive in the Mosquito Ae. aegypti
[0101] Germline promoters will be evaluated for their ability to produce functional Cas9 protein and initiate gene drive in Ae. aegypti mosquitoes. The best candidate (best homing rate, least effect on fitness) will be chosen for incorporation into the self-eliminating transgene locus developed in Example 5. In the presence of tetracycline, the HEG is repressed and Cas9-based gene drive through a laboratory population is expected to proceed rapidly. In the absence of tetracycline, activation of the HEG triggers DSB induction at the transgene and if followed by SSA-based repair is hypothesized to eliminate all transgene sequences, resulting in restoration of eye pigmentation and complete loss of the gene drive system.
Example 9: Generation of Transgenic Mosquito Strains to Evaluate Various Promoters for their Ability to Produce Functional Cas9 in the Ae. aegypti Germline
[0102] While efficient gene drive constructs have been reported in Drosophila and Anopheles mosquitoes, this technology has not been developed for the Ae. aegypti, the primary vector of dengue, chikungunya and Zika viruses. Transgenic strains will be generated carrying an active Cas9 and sgRNA targeted to the kmo gene. The use of the kmo gene as a landing site simplifies the detection of homozygotes, as these individuals will be white-eyed. The completed construct from Example 5 will be modified to contain a nos-Cas9, vasa-Cas9 or β-tub-Cas9 cassette as well as a U6-sgRNA cassette. The resulting plasmid will be injected into pre-blastoderm Ae. aegypti embryos (kmoEGFP strain). DsRed+EGFP+ progeny containing the full set of transgenes will be crossed by the parental strain to establish the line, which will be referred to as kmosd (self-decay). A combination of Southern analysis and genomic DNA PCR/sequencing will be used to verify the landing site of the donor construct and the integrity of the components.
[0103] This experiment will generate three transgenic strains that vary only in the promoter controlling germline-specific Cas9 expression.
Example 10: Evaluation of the Baseline Rate of Gene Drive in kmosd Ae. aegypti
[0104] For this experiment, the nuclease controlling transgene self-elimination will be repressed by tetracycline so that an assay on the performance of the gene drive components may be completed. For each strain containing active Cas9 from Example 9, kmosd male mosquitoes will be mated with wild-type females and all progeny scored for fluorescent markers and eye pigmentation. Similar experiments will be performed by mating kmosd females with wild-type males to assess the effect of maternal versus paternal gene drive. Those strains displaying the expected super-inheritance of the transgene will be assessed for fitness costs. kmosd individuals will be assessed for effects on longevity, ability to procure a bloodmeal, time to oogenesis, and number of viable progeny produced. The strain displaying the best compromise of successful gene drive and lowest fitness cost will be introduced at various frequencies (1%, 10%, 25%, 50%) along with the corresponding number of wild-type individuals into large cages with a cohort of the opposite gender for large-scale laboratory cage trials. For each generation, the percentage of kmosd mosquitoes (DsRED+, EGFP+, white eye) will be determined, with mosquitoes propagated blindly for 5 generations.
[0105] An optimal control sequence will be selected for performing Cas9-based gene drive in the Ae. aegypti germline, and establish initial parameters for both the effectiveness of this drive and its effect on mosquito fitness.
Example 11: Evaluation of the Baseline Rate of Gene Decay in Homozygous kmo.SUP.sd .Mosquitoes
[0106] Mosquitoes carrying two copies of the kmo.sup.sd allele will be generated through standard crossing and reared in the absence of tetracycline to activate the HEG and stimulate transgene self-elimination. After mating with homozygous kmo.sup.sd males, kmo.sup.sd females will be offered a bloodmeal; 50-100 fully fed females will be transferred individually into single tubes for egg collection. For each female, progeny will be screened for the black eye phenotype, as well as EGFP and DsRED markers, both of which would be lost upon SSA-mediated repair. At least three replicate experiments will be performed per generation, with a target of at least three generations. The percentage of black-eyed individuals divided by the total number screened will be calculated (the rate of decay) for each female. To confirm that identified black-eyed mosquitoes are indeed the result of SSA-mediated self-decay, and not simply contaminants from a wild-type genotype, HRMA and/or sequencing on PCR amplicons derived from where the duplicated region was collapsed in each individual will be performed. SSA-mediated collapse will result in an in-frame silent base substitution that was built into the donor construct, enabling differentiation from wild-type.
[0107] It is expected that empirical data will be generated on the rate of pre-programmed transgene self-elimination in the mosquito germline after fixation of a Cas9-containing gene drive Ae. aegypti, both in the context of a single generation and through the analysis of a multi-generational large cage population.
Self-Eliminating Transgenes from an Agricultural Pest
[0108] Described herein are experiments that will rely on the ability to perform site-specific gene integration into each described target species. This technology described has commonly been used for the model organism Drosophila, and has been successful with mosquito, as well. Strategies similar to those known in the art for performing perform site-specific gene integration into model organisms such as Drosophila and the mosquito will be used to perform such manipulations in other organisms, including beetles and plants. The appropriate length/spacing of the direct repeats needed for single-strand annealing-based DNA repair, and determining the optimal expression level of the controlling nuclease to achieve transgene self-elimination on the desired timescale will be determined for each organism tested. Various synthetic biology approaches will be used to vary both parameters extensively in a number of target organisms.
[0109] Tribolium castaneum is a model insect species and a pest of stored grain. Transformation of this insect is routine, and both it and many of its coleopteran relatives are major pests of agriculture. Transgenic T. castaneum will be generated with the self-eliminating transgene construct and demonstrate use of the system in pests of agriculture. The experimental approach and timeline will be similar to that described for flies and mosquitoes.
Example 12: Validation of Germline-Specific Promoters in Transgenic Tribolium
[0110] Transgenic technology is well established for Tribolium, and despite the availability of a number of characterized promoters, no work has yet been published concerning germline-specific promoters in this organism. The male germline-specific gene β-tubulin has been identified in Tribolium and is a clear ortholog of the Drosophila gene; β-tubulin promoters have been extensively characterized and used for driving transgene expression in flies and mosquitoes. To verify that the Tribolium β-tub is expressed in a similar manner, and to potentially identify other candidate promoters capable of driving transgene expression in the germline, RNAseq will be performed on dissected ovaries, testes, newly deposited eggs and carcasses. Genes highly expressed in male/female gametes and/or early embryos compared to adult carcasses will serve as sources of new control elements. Each putative control element will be placed upstream of a fluorescent reporter and transgenic beetles will be generated, which is a highly efficient process in this insect. Three transgenic strains will be evaluated for EGFP expression for each candidate promoter.
[0111] The germline-specific expression of the Tribolium β-tub promoter will be confirmed, and at least three other candidate genes possessing germline-specific expression will be identified.
Example 13: Generation of Transgenic Tribolium Containing the Self-Eliminating Transgene Cassette
[0112] Easily scored eye-color mutants (vermillion) for Tribolium are available and have been extensively characterized. Also identified is a clear ortholog of the Drosophila yellow gene that controls body pigmentation. Both of these genes may be used as landing sites for the site-specific integration of the self-eliminating transgene cassette, as described for flies and mosquitoes. CRISPR-Cas9-based gene editing will be employed to introduce a double-stranded DNA break in either vermillion or yellow to allow incorporation of each of the constructs listed shown in
Example 14: Programmed Transgene Self-Elimination in Tribolium
[0113] Beetles homozygous for the self-eliminating transgene from Example 13 will be reared in the absence of tetracycline (or subject to heat shock) to activate the expression of the HEG. Progeny will be analyzed and scored for restoration of eye/body pigmentation along with loss of the fluorescent marker, indicating successful transgene self-elimination. Beetles will be kept off tetracycline (or heat shocked each generation) for at least three generations to establish the rate of transgene loss. Molecular analyses such as PCR and sequencing will confirm the form of repair. Empirical data will be obtained on the rate of pre-programmed transgene loss from an important agricultural pest and model genetic species.
Self-Eliminating Transgenes from a Highly Invasive Weed
[0114] Amaranthus palmeri is a major pest to cotton and soybean production in the United States. The emergence of glyphosate resistance in this noxious weed combined with its obligate sexual reproduction (plants are either male or female only) makes it an excellent candidate for gene drive-based approaches. Transgenic A. palmeri will be generated with the self-eliminating transgene construct and to establish that the system can be effective in highly invasive weeds.
Example 15: Establishment of a Gene Transformation for A. palmeri
[0115] A gene transformation methodology for A. palmeri will be developed. Two types of gene transformation techniques (callus and female gametophyte infection with Agrobacterium) will be developed. Two sets of vectors harboring the β-glucuronidase (GUS) gene under different promoters will be generated using synthetic biology or conventional cloning methods. A constitutive promoter (CaMV35S), heat-shock inducible, ethanol inducible, and dexamethasone inducible system will be used for the construction. For each construct, two sets of vectors (a set in a high-copy, small plasmid for a transient expression and a set in a binary vector for Agrobacterium-mediated transformation) will be generated. For gene transformation, either calli derived from a mature embryo or female gametophytes will be infected with Agrobacterium harboring the plasmid containing a constitutive or inducible promoter driving GUS. A direct infection of female gametophyte will be tested in parallel. As a positive control, A. hypochondriacus plants will be transformed using protocols known to those skilled in the art. The potential transformants will be selected with an antibiotic marker, followed by a PCR analysis to confirm the transgene integration. For plants transformed with an inducible promoter, the promoter activities will be assayed by adding increasing concentrations of induction reagents. Plants carrying the transgene will be regenerated, and the GUS activity will be confirmed. A methodology will be established to transform A. palmeri, as well as identification of the inducible promoter that work well in this species.
Example 16: Evaluation of Inducible Transgene Deletion in Am. palmeri
[0116] The activity of DSB-induced transgene deletion in A. palmeri will be examined. Deletion of an antibiotic-resistance marker gene, induced by a homing endonuclease, has been reported in a model plant Arabidopsis. Transgene deletion in A. palmeri and the dominant repair pathway in this species will be examined. A set of binary vectors harboring an endonuclease (HEG or CAS9) and 35S promoter-GUS reporter sequence flanked by the recognition sequences will be constructed. In addition to the recognition sequences, the constructs will carry a set of direct repeat sequences outside of the nuclease recognition sequence. The nucleases will be expressed under an inducible promoter, as evaluated in Example 15. It is predicted that the excision efficiency will be influenced by the distance between the two nuclease recognition sequences. The self-excision of the nuclease sequence will be tested by placing the two recognition sequences flanking both the nuclease and reporter expression construct. This increases the distance between the two sequences from −3 kb to −5.5 kb. Once transgenic lines are established, leaf discs will be isolated from the transgenic plants and cultured under non-inducible and inducible conditions. Gene excision activities will be measured by the loss of GUS reporter activity within the leaf discs. In addition, PCR will be performed using primers that recognize the transgene, as NHEJ-based repair and HR-based repair will produce different fragment sizes.
[0117] It is anticipated that inducible gene deletion will be observed. The efficiency of inducible gene deletion system will be established, as well as the relative frequency of NHEJ- and HR-based repair events. In case NHEJ-based repair predominates and no targeted gene insertion is observed, siRNA for ku70 or DNA ligaseIV genes may be included to promote HR-based repair.
Example 17: Establishing Transient Gene Expression System in A. palmeri
[0118] Another embodiment of the invention will be demonstrated with a self-excising gene drive unit with a targeted gene insertion in A. palmeri. A system to transiently express an exogenous gene in protoplasts, with the ability to then regenerate the entire plant, has several merits. Firstly, the turnaround time for transgene expression using such a method is much faster than gene transformation (<1 wk versus 3 months), enabling much higher throughput. In addition, macromolecules such as proteins and RNAs can be delivered to the cells during the procedure, enabling the donor sequence for HR-based repair, as well as reagent that enhances HR-based repair to be delivered during gene transformation. Protoplasts will be prepared from young mesophyll cells of A. palmeri, using protocols known in the art for other species as a starting point. This experiment will demonstrate that a transgene can be expressed in mesophyll protoplasts from A. palmeri. Once the protoplast transformation protocol is further optimized, it will be used to optimize the targeted gene deletion protocol. For this experiment, appropriate target genes on the A. palmeri genome will be identified. Since no genome or RNAseq data is available for this species, RNAseq on RNA samples extracted from representative tissues (roots, leaves and flowers) will be performed and used to determine potential target genes. The ideal target genes will allow a simple screen for loss-of-function, such as loss of color in certain tissues or loss of an enzymatic activity. Candidate targets include, but are not limited to, chalcone synthase (CHS), whose loss-of-function results in yellow seed coat, and alcohol dehydrogenase (ADH), which results in the loss of alcohol dehydrogenase function. Target genes from A. palmeri will be mined from the RNAseq data. It is known in the art that the genome of a closely related species, A. hypochondriacus, has a single, conserved CHS gene.
[0119] Next, the donor plasmid will be assembled by gene synthesis and/or conventional PCR-based cloning. A CRISPR/Cas9 construct carrying an appropriate sgRNA will be constructed using golden-gate cloning system for sgRNA. Both constructs will be introduced in the protoplasts using the methods optimized in Examples 15-16. The correct insertion of the transgene will be detected by a PCR reaction spanning the genome and transgene.
[0120] In parallel, a construct carrying the necessary components for self-deletion, flanked by the repeats of endogenous target sequences, will be constructed and introduced into protoplasts. This experiment will allow for evaluation of whether a much larger deletion compared to what is tested in Example 16 feasible. In addition, when combined with a technique to regenerate transgenic plants from protoplasts (as known in the art for other species), the protoplast mediate method offers a possibility of regenerating a whole plant that carries the transgene at the target locus without creating the second site carrying the nuclease construct. The possibility of inserting a relatively large construct will be tested. It is expected that there will be successful reporter expression in A. palmeri protoplasts and targeted gene insertion will be detected using PCR reactions, thus verifying targeted gene insertion, which is a prerequisite for self-eliminating gene drive strategy.
Modeling the Self-Elimination of Transgenes in the Context of Population Reduction and Population Conversion Strategies
[0121] In order to determine whether the empirical data obtained in each of Examples 1 through 24 is sufficient to justify field-based trials and continued pursuit of the self-eliminating transgene technology, known continuous and stochastic models of gene drive will be updated to incorporate the additional parameters of spontaneous transgene loss with or without target site regeneration.
Example 18: Inundative Releases to Achieve Population Replacement Modified to Incorporate Transgene Self-Elimination at a Range of Efficiencies
[0122] Modeling known in the art has shown that even in the absence of an active gene drive mechanism, the large scale inundative release of mosquitoes carrying a dominant anti-pathogen molecule can result in the fixation of the transgene in nature. However, such releases face the same predicament as do gene drive scenarios: how to test the effectiveness of the anti-pathogen mosquitoes in a real-world field setting without the permanent introduction of transgenic individuals into the wild. For example, if the anti-pathogen transgene(s) did not perform as expected, it would be optimal to remove the transgene from the wild (both to re-use any marker genes and to prevent the evolution of the pathogen in the case of a partially-effective anti-pathogen gene). Thus, strategies based on inundative release would benefit from a pre-programmed self-eliminating transgene. Known stochastic models will be updated to include the spontaneous reversion of transgenic individuals to wild-type at a variety of rates. For each rate, the model will show how long the transgene is predicted to remain in the population after releases stop, based a variables such as population size and inundative release rate.
Example 19: Medea, Underdominance, and Other Threshold-Based Gene Drive Approaches Modified to Incorporate Transgene Self-Elimination at a Range of Efficiencies
[0123] Known modeling suggests that threshold-based gene drives will be harder to establish in nature, making them robust against accidental releases. Once established in a target population, such constructs may potentially be removed from the wild through the subsequent release of wild-type individuals, until the threshold is reached, further pushing the transgene out completely. However, it is possible that in the case of an abrupt end to a trial, remediative releases may not be possible. The self-elimination of a Medea or underdominance-based transgene would serve the same function, but would not require any remediation. The introduced transgene could potentially slowly disappear from the population until the threshold was reached, at which point it would be expected to rapidly disappear. The Medea and underdominance-based models known in the art will be updated to include the spontaneous reversion of transgenic individuals to wild-type at a variety of rates. For each rate, the model will show how long the transgene is predicted to remain in the population after releases stop, based a variables such as certain population size and initial release rate.
Example 20: HEG-Based Chromosomal Shredding, Modified to Incorporate Transgene Self-Elimination at a Range of Efficiencies
[0124] HEG-based X-specific shredding has been developed for An. gambiae. CRISPR/Cas9 based targeting of other X-specific sequences or the overexpression of male-determining genes would yield the same practical result—the shift in population towards extreme male bias. Propagating such bias has been predicted through stochastic or continuous modeling known in the art to result in the local elimination of the target population. As it is unclear what “local” may mean in this context, it is possible that the introduction of an active gene drive construct capable of driving male bias might send a species (and any others capable of productive breeding) to extinction. To prevent this, particularly during the investigational and testing phase, the incorporation of self-eliminating transgene technology may substantially reduce the risk of an unintended global extinction event. The stochastic models and the continuous propagating wave model (reaction-diffusion) which includes the spontaneous reversion of male-biasing transgenes to wild-type at a variety of rates which are known in the art will be updated. For each rate, the model will show how long the male bias is predicted to remain in the population after releases stop, based a variables such as population size and initial release rate.
Example 21: CRISPR/HEG Based Gene Drive Coupled with a Pre-Programmed Self-Eliminating Transgenes at a Range of Efficiencies
[0125] Recent reports that Cas9-mediated gene drive is highly efficient in Drosophila, An. stephensi and An. gambiae have raised hopes that mosquito populations may be rapidly converted to a plasmodium-resistant state, breaking the cycle of malaria transmission while also addressing concerns regarding control of transgenes once released. Known models suggest that such a gene drive system would quickly become established, even with the accidental release of just a few individuals. The current models will be adjusted to set a finite limit of the presence of the introduced transgene in nature. The adjustments will address, given certain release rates and spatial patterns, the spread of the gene drive system before self-elimination, as well as the parameter space whereby a self-eliminating transgene can allow sufficient drive to evaluate the technology in a field setting, while eventually overcoming the robust nature of the gene drive system and eliminating it from the study area.
Example 22: External Stimulus-Triggered Transgene Elimination
[0126] Each of the previous scenarios assumes a constant rate of transgene elimination beginning immediately upon release, the so-called slow fuse model where the activating HEG is expressed at a low level all of the time. Models also will be modified to include a time restriction, whereby transgene self-elimination does not occur without the application of an external stimulus (either the removal or addition of a chemical agent).
Example 23: Cas9-Resistant Genotypes
[0127] While all known work to date has been focused on the use of gene drive systems for the benefit of human health and prosperity, it is possible that as the technology matures it could be used with intent to do harm. A critical question then is whether the vulnerable species may be protected from an invading gene drive system proactively (without knowledge of where it might attack the genome), or in direct response to a detection. Models also will be modified to address this issue and include the introduction at various times pre- and post-establishment of an active Cas9-based gene drive construct in the context of genotypes that transcriptionally/post-transcriptionally silence Cas9 expression.
Example 24: Feedback from Experimental Data to Further Inform the Models
[0128] As data are generated, a number of other parameters such as release size, spatial dimensions, population structure, migration rates, release timing, and so forth, may be added to the models to further predict the performance of self-eliminating transgenes. Each set of models can be parameterized with the life history traits, generation time, reproductive capacity and empirical data obtained for each organism.
[0129] At the conclusion of Examples 18-24, rigorous predictions for how pre-programming transgene elimination may affect various gene drive scenarios will be available for use in preparation for field-based trials.
Example 25: Determine the Contribution of Length and Spacing of Direct Repeats to Self-Elimination
[0130] The experiments in this Example make use of both the dipteran model organism Drosophila melanogaster and the disease vector Ae. aegypti. Using both systems is important to fully evaluate the self-elimination mechanism to control gene drive transgenes. With its short generation time, ease of rearing and a suite of highly tractable genome manipulation tools, using Drosophila allows for the expansion of the scope and scale of these experiments (particularly the number of transgene varieties that can be tested) well beyond what is practical for mosquitoes. In addition, successful gene drive approaches are readily available for Drosophila but have not yet been developed for Ae. aegypti. On the other hand, relying entirely on Drosophila would not be ideal either, as it these experiments should be applicable to disease vectors. Together, these experiments highlight similarities and differences between these two dipterans, in turn informing how this technology might be applied to other species such as Anopheline vectors of malaria or Culex vectors of West Nile virus.
[0131] Intrachromosomal deletions mediated by the SSA pathway can result in deletions of at least 80 kbp at high efficiency with the length of repeats and distance of separation strongly influencing this mode of repair in yeast, flies and vertebrate cells. The length of sequence that can be eliminated in turn dictates the length a minimal nuclease-based gene drive system along with any visual markers and anti-pathogen genes can be. Previously reported deletions of more than 2,000 bp using very short (200 bp) repeats have been shown by the inventors, while previous work in Drosophila has been limited to short repeats (˜250 bp) and spacers (<2.5 kb). Thus, an analysis of these parameters (
[0132] An EGFP transgene flanked by directs repeats of three different lengths (30 bp, 250 bp, 500 bp) was successfully engineered into the Drosophila yellow (y) gene (
[0133] Similarly, direct repeats as short as 34 bp were able to eliminate ˜1.5 kbp of intervening sequence in Ae. aegypti, but not ˜2.7 kbp, while a repeat length of 195 bp enabled the elimination of ˜2.4 kbp of transgenic sequence. Two additional transgenic strains were generated, whereby a set of two marker genes (DsRED and EGFP) were integrated into the Ae. aegypti kmo gene flanked by direct repeats of 200 bp or 700 bp. Introduction of a DSB in between the 700 bp repeats resulted in the elimination of both marker genes (˜4 kb) and the restoration of wild-type eye pigmentation (
[0134] These data show that extending the repeat length permits more efficient transgene elimination over longer intervening sequences. The experiments detailed below will methodically analyze the effects of repeat length and repeat distance on transgene elimination in both the model dipteran Drosophila melanogaster and the disease vector Ae. aegypti. The ease of generation, maintenance, and experimenting with transgenic fly strains permits testing of many more combinations than would be possible in the mosquito alone. As work in Drosophila proceeds more rapidly, results obtained from experiments in the genetic model organism will in turn refine the design of constructs used in Ae. aegypti, as described below.
Determining the Effect of Direct Repeat Length on SSA-Based Self-Elimination in Flies.
[0135] It is likely that there is a maximum direct repeat length, at which point further increases in SSA mediated repair of the dsDNA break will not occur. With an extremely tractable fly model, it will be determined if and where this point exists, at least with regard to sizes where direct repeats can practicably be employed to control nuclease-based gene drives. To do this, CRISPR/Cas9 will be used to knock-in a series of transgenes into existing fly strains containing direct repeats of varying length (
Determination of the Effect of Direct Repeat Length on SSA-Based Self-Elimination in Mosquitoes.
[0136] These experiments will begin by using the two strains already developed (200 bp and 700 bp repeats) to more fully analyze the rate of SSA-based repair in Ae. aegypti. Additionally, CRISPR/Cas9-stimulated gene insertion will be used to generate two additional transgenic Ae. aegypti strains with provisional direct repeat lengths of 1500 bp and 3000 bp. However, the length of direct repeats will be finalized based on data obtained from Drosophila as detailed above. Each new integration will be identified by DsRed and EGFP, with confirmation obtained through PCR analysis of the integrated transgene. Once established, embryos from each line will be injected with a plasmid-based I-SceI expression construct. Survivors will be crossed with a kmoΔ4 strain and progeny screened for fluorescence and eye pigmentation. While end-joining repair can result in the loss of DsRED fluorescence through disruption of the DsRED ORF, restoration of eye pigmentation can only occur following SSA-based repair. Thus, the rate of both SSA-based repair (Black eye, EGFP−, DsRED−) and NHEJ-based repair (White eye, EGFP+, DsRED−) can be determined by scoring G1 progeny. As the repeat length increases, likely so will the number of SSA-based events; inversely, NHEJ events are expected to decrease. Repair events will be confirmed through PCR and sequencing. Uninjected embryos or those injected with a non-functional I-SceI (no ATG) will serve as a negative control to estimate spontaneous transgene elimination rates.
Determination of the Effect of Distance Between Repeats on SSA-Based Self-Elimination in Flies.
[0137] Fly lines as detailed above that demonstrate the highest efficiency of SSA-based transgene elimination will be selected, and the ϕC31 integrase system will be used to incorporate 5-10 additional spacer sequences between the direct repeats. The blue fluorescent protein, mTagBFP, will serve as the marker of transformation into the existing lines. The additional transgenic sequences will increase spacing between the direct repeats from ˜1.5 and 7.2 kbp to ˜15-21 kbp. Integration of each donor construct will be confirmed through PCR and sequencing over attL and attR flanking regions. Once each line is established, I-SceI will be expressed as described above, either from a plasmid or via an independent locus. Flies not injected with plasmid expressing functional I-SceI will again serve as controls. These experiments will permit rapid determination of the relationship between the type of DSB repair that occurs and spacing of the direct repeats. For example, increasing the distance between direct repeats might favor DSB repair pathways other than SSA, decreasing the frequency of transgene elimination. If true, then any strategy for eliminating a nuclease-based drive with this technology may need to be optimized for the size of the construct, which might vary with cargo size, by altering direct repeat sizes or location of DSBs. However, answering these questions in Drosophila will permit determination of how much time, effort and resources should be devoted to optimization of this parameter in the non-model disease vector, Ae. aegypti.
Determination of the Effect of Distance Between Repeats on SSA-Based Self-Elimination.
[0138] Dependent on the results above, two of the four transgenic strains of Ae. aegypti (those already in hand and/or those generated above) will be selected and the ΦC31 integrase system will be used to incorporate an additional transgene via attP:attB recombination, with transformants identified with mTagBFP. The ΦC31-integrated transgenes will increase the spacing between the direct repeats from ˜4 to 8 or 16 kbp; integrations will be confirmed by PCR on genomic DNA over the resulting attL and attR flanking regions. Once established, embryos of each transgenic strain will be injected with plasmid expressing I-SceI as detailed above. Survivors will be crossed with kmoΔ4 mosquitoes and progeny scored for eye color, EGFP, mTagBFP and DsRED fluorescence. Once again, successful SSA-based repair will eliminate all fluorescent markers and restore eye pigmentation while end-joining repair will result in the loss of DsRED only. As in flies, increasing spacing between direct repeats will likely reduce the rate of SSA-based repair. If results in the fly indicate little or no relationship between the distance of the direct repeats and SSA-based elimination, a single line with the largest spacer (16 kbp) may be generated to confirm findings in the model organism.
[0139] The data above demonstrates effective SSA-mediated transgene elimination in both Drosophila and Ae. aegypti. As an alternative to injection of I-SceI plasmid into embryos, transgenic Ae. aegypti strains may be generated that express I-SceI and perform crosses to induce DSB formation. Transgenes or constructs may become unstable if the direct repeats become too large. Rather than being a problem, this could indicate the possibility of a self-eliminating transgene that does not even require a second nuclease, substantially simplifying the approach to controlling and eliminating gene drives from a population.
Example 26: Determination of the Contribution of Distance Between DNA Break Induction and Direct Repeats to Transgene Self-Elimination
[0140] One of the first steps in SSA-based DNA repair is resection of one or both ends of the break to generate single-stranded tails used in a homology-based search. However, if resection ceases prior to revealing at least one direct repeat, SSA may not occur. Thus, the distance between the site of DSB induction and one or both direct repeats represents an important parameter for the development of a self-eliminating strategy (
[0141] In the inventors' initial observation of SSA-based transgene elimination in Ae. aegypti, the site of DNA break induction was between 50-150 bp from the start of one of the repeats. In the updated transgenes with 200 bp and 700 bp repeats, the site of DSB induction (I-SceI target site) was ˜300 bp from one of the direct repeats. Multiple transgenic lines have been developed for assessing transgene elimination in Drosophila melanogaster, with the site for DSB induction 20 bp from the nearest direct repeat.
Distance Between DSB Induction and Direct Repeat in Flies and Mosquitoes.
[0142] As described above, Drosophila strains have been generated with transgenes that vary with respect to the size of the direct repeats (30 bp, 250 bp or 500 bp) and intervening sequences (1.5 kbp or 7.2 kbp). A series of sgRNAs will be designed that target the intervening sequences (
Number of Induced DSBs and Transgene Elimination in Flies and Mosquitoes.
[0143] For flies, effective sgRNAs identified above will be combined and injected with Cas9 into homozygous embryos (y-G 250DR; 500DR or y-ISE 250DR; 500DR). The progeny of surviving embryos will be mated and screened as described above, with the genotypes of a subset of the phenotypically scored flies again confirmed through PCR and sequencing. For mosquitoes, at least 4 pairs of effective sgRNAs from independent groups developed above will be delivered together with Cas9 protein into kmoRG embryos, with surviving individuals mated with white-eyed kmoΔ4 strain mosquitoes as before. Again, progeny will be screened for DsRED, EGFP and eye pigmentation, with the expectation that transgene elimination will result in loss of both fluorescent markers and restoration of eye pigmentation. As above, a subset of each phenotypic class will be subject to PCR/sequencing to confirm the associated genotype and progeny will be scored from at least 70 fertile founders for each sgRNA pair and the rates of transgene elimination compared to that obtained for each sgRNA alone above. sgRNA pairs will be selected based on effectiveness in mediating transgene elimination when injected individually, and proximity to the direct repeats. Rates of self-elimination will likely be higher when sgRNAs close to each direct repeat are combined. It will be particularly interesting to determine if inducing DSBs at regular intervals, or simultaneous targeting of multiple locations in close proximity to the direct repeats at both the 3′ and 5′ homology arms, can increase the efficiency of SSAbased repair.
[0144] These experiments do not depend on the generation of any new transgenic mosquito or fly strains, and can be effectively completed with the existing strains already developed. Strains developed above with larger spacer regions between the direct repeats may be incorporated into these experiments as well, further enriching the dataset. The data obtained here is useful not just for transgene self-elimination, but for any genome engineering approach where naturally occurring repetitive sequences are present around a region of interest.
Example 27: Evaluation of the Pre-Programmed Elimination of an Active Gene Drive
[0145] Genetic strategies to control dengue based on the release of sterile, transgenic individuals are currently underway and have been successful where attempted. These strategies provide effective mosquito control only as long as releases continue, and thus represent a long-term financial and administrative commitment that must be maintained even in the absence of continued transmission. For this reason, gene drive systems that permanently confer on the target population a refractory state have long been sought after. Once released, such systems cannot be contained, and this limitation, along with the unknown effects on natural ecosystems of the introduced transgene, likely precludes effective field-testing of engineered strains. Thus, there is a compelling argument for technologies that permit deployment and evaluation of gene-drive based approaches while simultaneously being self-limited and in essence, biodegradable.
[0146] Building on the preliminary data presented above (
[0147] Heat shocking the y-ISE 250DR strain resulted in SSA-based self-elimination of the transgene in a subset of flies exposed to the higher temperatures, which was scored by a loss of EGFP and reversion to wild-type body color (y+G−;
[0148] In order to extend the findings demonstrating the programmable self-elimination of a transgene to an active gene drive, the previously described CRISPR/Cas9-based y-MCR gene drive was reconstructed. This gene drive system is based on homology-dependent integration into the X-linked yellow locus, converting a heterozygous recessive loss-of-function mutation in female flies into a homozygous mutant phenotype (y−), yellow body color. Through this process of autocatalytic allelic conversion, which has been termed a mutagenic chain reaction (MCR), the transgene converts the target population from the wild type y+ to the mutant y-phenotype. Table 3 summarizes the genetic transmission of the y− phenotype through two generations after mating of flies harboring the y-MCR transgene. A total of five G0 parents were identified (F9, F12, F17, F33, and M19) for these experiments, four females and one male. When the G0 parents were outcrossed with y+ flies they produced y− progeny that were scored as likely carrying the y-MCR construct, of which a subset was tested for skewed inheritance of the y-MCR construct. For example, four female and one male progeny of F33 was tested for propagation of the y-MCR transgene by outcrossing to y+ flies and scoring G2s for a y-phenotype. While the results of this analysis are summarized in Table 3, it is worth noting that the percent of female y-MCR progeny, 93.3%, and the percent of allelic conversion by homology directed repair (HDR) estimated from female progeny, 98.7%, are remarkably similar to the percentages previously reported (Gantz and Bier, Science 348:442-444, 2015), which were 97.3% and 94.5%, respectively. Additionally, the lone outcross involving a G1 male parent, where all female progeny would be expected to inherit an X-linked y-MCR construct, did indeed demonstrate HDR conversion with 100% of female progeny exhibiting a y− phenotype (Table 3). Also similar to the results previously reported, some instances where a y allele inherited from a y-MCR parent escaped allelic conversion was observed, presumably because the allele contained a nucleotide change at a locus homologous to the sgRNA PAM site, a so-called resistance allele (Table 3; S. No. 11).
TABLE-US-00002 TABLE 3 Summary for genetic transmission of a y- phenotype in two generations of y-MCR flies. 2(X
0.5N)/ N
100 HDR germline G2s N X X/N
100 conversion y- mosaic y- y- y
Mosaic Total G2 Total HDR % y
MCR
rate(%) S. No. G0 G1 ♀ ♂ ♀ ♂ ♀ ♂ Total G2 ♀ ♀ ♀ ♀ 1 9♀ 1♀ 2 2 0 2 0 0 6 2 2 100 100 2 12♀ 1♀ 9 4 0 0 0 0 13 9 9 100 100 3 2♀ 11 10 0 0 3 0 24 14 14 100 100 4 17♀ 1♀ 14 15 0 0 0 0 29 14 14 100 100 5 33♀ 1♀ 18 10 0 0 0 0 28 18 18 100 100 6 2♀ 21 11 0 0 0 0 32 21 21 100 100 7 3♀ 6 6 0 0 1 0 13 7 7 100 100 8 4♀ 16 11 0 0 1 0 28 17 17 100 100 9 1♂ 8 0 0 13 0 0 21 8 8 100 100 10 19♂ 1♀ 15 14 0 0 0 0 29 15 15 100 100 11 2♀ 15 9 1 0 0 0 25 16 15 93.75 87.5 12 3♀ 9 8 0 0 0 0 17 9 9 100 100 Total 144 100 1 15 5 0 265 150 149 99.3333 98.66666667
indicates data missing or illegible when filed
[0149] Separately, deterministic models of gene drive have been generated to determine the effect of self-elimination on the spread and long-term stability of a CRISPR/Cas9-based gene drive in a target population. In both cases, optimal rates of transgene self-♀♂ elimination range from just greater than 0 to about 20%, while tolerating rates of failure of the self-elimination mechanism as high as 5-10% (
Self-Elimination to Control a Yellow Gene Drive System in Flies.
[0150] Now that both the self-eliminating transgene and the MCR-based gene drive has been validated, the two will be combined. The y-MCR construct will be recombined into existing y-ISE transgenic lines through engineered attP/attB sites (
Self-Elimination to Control a DSX Gene Drive in Flies.
[0151] A CRISPR-Cas9 gene drive targeted to the female Anopheles gambiae doublesex gene was recently reported to reach 100% prevalence in caged mosquito populations, with no selection of resistance alleles. While resistant variants still arose, they were selected against due to the functional constraints associated with target sequence. Thus, application of the programmable self-elimination construct to a completely self-sustaining dsx gene drive would provide a much more rigorous test of the technology. Similar to An. gambiae, the somatic sexual differentiation of D. melanogaster is also regulated by the dsx gene, which has 6 exons (
Evaluate the Baseline Rate of Transgene Elimination in Kmo.SUP.EGFP .Gene Drive Mosquitoes.
[0152] In order to translate the results from flies to disease vector mosquitoes, Cas9 protein and sgRNA will be injected into kmo.sup.EGFP embryos along with a donor construct encoding the Cas9 ORF under the control of an Aedes germline promoter, an sgRNA under the control of an Aedes U6 promoter, the DsRED marker gene and a direct repeat to create strain kmo.sup.sed (self-elimination drive;
Self-Elimination to Control a DsRED Gene Drive in Mosquitoes.
[0153] Males homozygous for the kmo.sup.sed, kmo.sup.se, or kmo.sup.d transgenes will be introduced into cages with kmo.sup.EGFP males of the same age at various ratios (10:90, 25:75, and 50:50), along with kmo.sup.EGFP/kmo.sup.EGFP females. Following bloodfeeding and egg collection, a portion of the resulting embryos will be set aside for future genotyping, with a random subset hatched and all resulting larvae reared to adulthood without phenotypic scoring. This process will be continued for 10 generations. Allele frequencies for kmo.sup.sed/kmo.sup.se/kmo.sup.d (white eye, EGFP.sup.+, DsRED.sup.+), kmo.sup.EGFP (white eye, EGFP.sup.+) and kmo.sup.+ (black eye) will be determined for each generation. PCR/sequencing will be used to characterize a subset of each genotype. Both kmo.sup.d and kmo.sup.sed alleles will likely increase rapidly in the population due to gene drive, but kmo.sup.sed alleles will subsequently decrease due to self-elimination. Both kmo.sup.d and kmo.sup.sed should generate traditional NHEJ-based drive-resistant alleles at the same rate, allowing control of these events. This ill generate empirical data on the rate of gene drive counterbalanced by transgene elimination in the germline of cage populations of Ae. aegypti, setting up large-scale cage trials and further optimization of the system. The gene drive described here targets a portion of the DsRED gene only.
[0154] The inventors have published several reports documenting the ability to use CRISPR/Cas9 technology to edit the Ae. aegypti genome. including several instances of efficient gene insertion. Germline promoters to drive Cas9 expression in Aedes aegypti have been described. While information concerning direct repeat length, spacing and the number and position of nuclease target sites will be used to inform construct assembly prior to generating transgenic strains as much as possible, these proof-of-principle experiments can be completed using the data already in hand if needed. The use of repressible (tet-off) or heat-inducible (HSP70) systems will be pursued to control the expression of the self-elimination nuclease. Upon escape from a contained laboratory or from a trial site the self-elimination mechanism could likely become activated, decreasing the likelihood of the transgene becoming established in nature. Unlike other proposed forms of molecular containment where active gene drive transgenes are split into multiple pieces (each of which can be collected and used to reform the gene drive), self-elimination leaves no transgene sequence behind and thus nothing to reconstitute. For Ae. aegypti, many of the transgenic strains that are required for these experiments have been developed by the inventors, including maternal/zygotic expression of the Tta transactivator, the kmo.sup.EGFP recipient strain, and transgenic strains that validate the HSP70 promoter.
Example 28: Evaluation of Self-Elimination Mechanism on the Spread and Persistence of a Gene Drive Transgene in a Randomly Mating Population
[0155] To evaluate how such a self-elimination mechanism might affect the spread and persistence of a gene drive transgene in a randomly mating population, previously developed deterministic models for homing-based gene drive were modified to incorporate a probability for both successful and failed transgene elimination. In total, the model considered six allele types (w, v, g, s, u, and r;
[0156] As the probability of generating low-cost resistance alleles decreases, the expected persistence of a gene drive transgene in a population is expected to increase (
[0157] To better understand the underlying dynamics, individual allele frequencies were calculated in the absence (
Example 29: Evaluation of Effect of Multiplexing Self-Elimination Mechanism
[0158] The potential for multiplexing to increase self-elimination efficiency and prevent gene drive invasion into sites outside of any potential trial area (spatial control) was next evaluated, as currently proposed methods for spatial control of gene drive require multiple independently segregating transgenes, bioremediation, or both. In one embodiment, self-elimination mechanisms based on a nuclease-induced double-stranded DNA break and SSA repair (
[0159] A gene drive scenario based on the disruption of a gene critical for female fertility such as dsx (
Example 30: Model Structure and Equation Generation
[0160] For each of the gene drive mechanisms, a system of delayed differential equations was developed that predicted the number of offspring generated during each time step. Malthusian population growth was assumed with a daily time step through the models. Differential equations were concatenated and analysed using MATLAB 2017b. A single core with 8 GB of memory was sufficient for running MATLAB models to capture the proportions of wild-type individuals and allele progressions for all models. Parameter spaces for the remaining models utilized 112 cores with 392 GB of memory for up to 24 hours from the Texas A&M University High Performance Research Computing (HPRC) Terra cluster for the computation of these parameter spaces. Model outputs were saved to a comma-separated values (.csv) file and plotted using Python 3.7.
[0161] The system dynamics models returned the number of adult and juvenile individuals of each genotype for every time step throughout the simulation. Initial model parameters are provided in Table 4.
TABLE-US-00003 TABLE 4 Variable Definitions Variable Description Value λ Female reproduction rate (per day) 7 σ Proportion of female offspring 0.5 c.sub.i Fitness cost of genotype i Varies μ.sub.A Adult mortality rate (per day) 0.3 μ.sub.j Juvenile mortality rate (per day) 0.03 η Development time (in days) 12
[0162] Using the fitness costs (c) associated with each genotype and sex (i), adult and juvenile mortality rates (μ.sub.A and μ.sub.J, respectively) were adjusted such that the mortality rate could not be more than 1, giving:
[0163] Mortality rates were applied at each time step, where the surviving number adult individuals of each genotype A.sub.i(T) was calculated by reducing the number of adult individuals of each genotype at the previous time step A.sub.i(T−1) by the mortality rate, such that:
A.sub.i(T)=(1−μ.sub.A.sub.
[0164] Juvenile mortality was applied at the time the juveniles became adults, where the number of juvenile individuals surviving the development period (η) was defined as:
J.sub.i(T−η)(1−μ.sub.J.sub.
[0165] Combining the surviving adults with the fully developed juveniles (also now adults), the number of adults with a particular genotype at time T can be defined as the number of adults surviving a single time increment (from time T−1) and the number of surviving juveniles (from time T−η), such that:
A.sub.i(T)=(1−μ.sub.A.sub.
[0166] The number of females with a particular genotype F.sub.i was directly used in calculating the number of offspring produced. Since males do not directly produce offspring, the proportion of adult males with a particular genotype M.sub.i was calculated such that:
[0167] Utilizing the equations generated for the calculation of the number of offspring of each genotype, the fitness costs, initial input, self-elimination (α, β, γ), the probability of double-stranded break induction (q, 0.95) and the probability of homology-dependent repair (p, 0.95), the number of offspring created for each time step were calculated.
[0168] For equation generation a two-dimensional matrix was generated of all the possible genotypes of females (F.sub.i) and males (M.sub.i). A third dimension was added to capture every possible outcome of offspring (g.sub.i). The value of each index within this three-dimensional matrix corresponded to the probability that the combination of the two parental genotypes would produce the respective offspring of the genotype. Iterating through all possible combinations of F.sub.i, M.sub.i, and g.sub.i, a matrix of probabilities was generated. Once the matrix was fully populated, a string was concatenated with the parental genotypes and probability of producing an offspring, resulting in the form:
F.sub.i*Ψ(g.sub.i|F.sub.l,M.sub.l)*M.sub.l
[0169] This was utilized in the calculation of the number of offspring in the system dynamics model. All combinations of parental genotypes to create a particular offspring genotype k were concatenated in the form:
[0170] Equations were simplified using MATLAB's str2sym function to reduce the additional computations necessary when referencing and calculating equations from the system dynamics model. To calculate the daily number of offspring of genotype i that were being produced, daily reproduction rates, sex ratio, and fitness costs were additionally concatenated into the equation following the simplification of the equations, for females giving:
and for males giving:
Example 31: Establishment of an SSA-Based Transgene Removal System in Aedes aegypti
[0171] To control vector mosquito populations, genetics-based control methods have been proposed based on Sterile Insect Technique (SIT), Release of Insects carrying a Dominant Lethal (RIDL) and/or gene drive. In gene drive approaches, the modified organism carries one or more genetic elements that permits the rapid introgression of the genetic trait into the target species population via super-Mendelian inheritance. The development of the Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 (CRISPR) system dramatically accelerated homing gene drive strategies in malaria or dengue transmitting mosquitoes. CRISPR-based homing gene drive approaches have been proposed that could permanently alter the genomes of disease vectors for the purposes of either population suppression or population replacement (rendering vectors unable to transmit pathogens). Meanwhile, concerns have been raised that gene drive transgenes could potentially invade non-target populations, and given their invasive nature it may be impossible to remove such transgenic material once out in the field, while potential hazards to ecosystems are still uncertain. The use of split-drives or other mitigation approaches have been proposed to make gene drive both confinable and potentially reversible. While these approaches could limit the process of gene drive, removing the transgenes themselves is not simple and in many cases would require remediation in the form of mass release of wild-type insects.
[0172] Mosquitoes, like all eukaryotes, rely on DNA repair systems to process DNA double-strand breaks (DSBs) by mainly two pathways; non-homologous end joining (NHEJ) or homology-directed recombination (HDR). In NHEJ, the Ku complex initially binds the DSB site and subsequently recruits the DNA-PKcs/Artemis complex and the XRCC4-DNA Ligase IV complex to repair the broken DNA ends, potentially generating insertions or deletions in the process. In contrast, the HDR pathway can repair DSBs by using a homologous template sequence from a sister chromosome. In the latter case, DNA end-resection at the DSB site results in a 3′ single-stranded DNA (ssDNA) tail that allows other necessary factors including the MRN/X complex, RAD51, and BRCAs to be recruited for strand invasion during the repair process.
[0173] Interestingly, when the DSB-induced ssDNA resection occurs between two parallelly identical sequences, known as direct repeats (DRs), the single-strand annealing (SSA) pathway allows the DRs to be annealed and triggers the intervening sequences to be deleted (
[0174] The example describes an exemplary system to pre-program the elimination of transgene cargos in the mosquito Aedes aegypti. Site-specific recombination was used to insert two transgenes within the Ae. aegypti kmo locus. DSB induction triggered SSA-based repair, removing all exogenous cargo and flawlessly restoring the wild-type gene and the normal eye pigmentation phenotype from the transgenic white-eyed mosquitoes. Moreover, multigenerational tests indicate that the rate of SSA-based transgene elimination assisted by natural selection substantially increased the number of wild-type individuals in the test populations. In certain embodiments, the SSA-based biodegradable transgene system described herein exemplifies a rescue strategy for transgenesis-based mosquito population control. For instance, an SSA-based rescuer strain (kmoRG) was engineered to have direct repeat sequences (DRs) in the Ae. aegypti kynurenine 3-monooxygenase (kmo) gene flanking the intervening transgenic cargo genes, DsRED and EGFP. Targeted induction of DNA double-strand breaks (DSBs) in the DsRED transgene successfully triggered complete elimination of the entire cargo from the kmo.sup.RG strain, restoring the wild-type kmo gene and thereby normal eye pigmentation.
[0175] In this example, the Aedes aegypti Liverpool wild-type strain (Lip), the TALEN-generated kmo-null mutant strain (kmo.sup.Δ4) (Aryan et al., PLoS ONE 8 (2013)), and all transgenic strains were maintained at 27° C. and 70% (±10%) relative humidity, with a day/night cycle of 14 hours light and 10 hours dark. Larvae were fed on ground dry fish food (Tetra), and adult mosquitoes were fed on 10% sucrose solution. The mated females were fed on defibrinated sheep blood (Colorado Serum Company) using the artificial membrane feeder.
[0176] To generate pSSA-KmoDR0.7, the donor DNA for kmo.sup.RG, three plasmids (pGSP1-KmoHA1-DR0.7, pGSP2.3-DsRED-SV40, and pGSP3.8C-EGFP-KmoHA2) were modified from the synthesized plasmid templates (GenScript) and assembled by Golden Gate Assembly (NEB). pGSP1-KmoHA1-DR0.7 contained kmo exon4/5 (homology arm 1 [HA1]) and kmo exon2/3 (homology arm 2 [HA2], direct repeat [DR]). pGSP2.3-DsRED-SV40 encoded 3×P3-DsRED-SV40, in which the homing endonuclease I-SceI recognition site (5′-TAGGGATAACAGGGTAAT-3′) (SEQ ID NO: 1) was engineered in-frame next to ATG translation start codon of DsRED. pGSP3.8C-EGFP-KmoHA2 included the PUb-EGFP-SV40 and kmo exon2/3 (HA2, DR). For the donor DNA for kmo.sup.EGFP, Golden Gate Assembly using pGSP1-KmoHA1, pGSP2-REDh-SV40, and pGSP3.8C-EGFP-KmoHA2 generated pBR-KmoEx4. pGSP1-KmoHA1 was made by replacing the kmo exons 2-to-5 sequence in pGSP1-KmoHA1-DR0.7 with the KpnI-AgeI fragment of kmo exon4/5. pGSP2-REDh-SV40 was modified from pGSP2.3-DsRED-SV40 by removing the AscI and SbfI fragment of the 3×P3 promoter and the 5′-half of DsRED containing the I-SceI site. Sequential blunting and ligation of both enzyme-cut ends (AscI and SbfI) created the sgRNA-HybRED site that is unique to REDh.
[0177] To establish an SSA-based transgene removal system in Aedes aegypti, site-specific insertion of transgene sequences targeting the kynurenine 3-monooxygenase (kmo) gene as the recipient locus in a two-stage process (
[0178] The result of this integration was that the HA2 region was duplicated next to HAL creating direct repeats (DRs) of approximately 700 bp that could be utilized by the SSA pathway. This two-stage process prevented competition in repair between the two HA2 motifs, as use of the HA2 in proximity to HA1 could result in repair of the kmo gene with no integration of the transgenes. As expected, the stage 2 kmo.sup.RG mosquitoes displayed DsRED fluorescence in the eyes, EGFP fluorescence in the body, and white-colored eyes due to loss of kmo (
TABLE-US-00004 TABLE 5 Generation of CRISPR/Cas9-driven transgenic lines. Transgenic Donor Recipient # Embryos # G.sub.0 Larvae # G.sub.1 Larvae w/phenotypes.sup.b mosquitos DNAs sgRNAs strains injected survived # G.sub.0 outcrossed.sup.a Blk BlkG WG WGR kmo.sup.EGFP pBR- KmoEx4 Lvp ~2,000 125 ♂51 ×Lvp 12,045 78 KmoEx4 (6.25%) ♀60 (0.64%) kmo.sup.RG pSSA- HybRED kmo.sup.EGFP ~2,080 258 ♂109 ×kmo.sup.Δ4 14,949 32 KmoDR (12.4%) ♀126 (0.2%) .sup.akmo.sup.Δ4 is the TALEN-generated kmo -null mutant strain (29). .sup.bMarker phenotypes: W, white eyes; Blk, black eyes; G, EGFP; R, DsRED.
TABLE-US-00005 TABLE 6 List of oligonucleotides for SgRNAS, PCR, and subcloning. Oligonucleotdes Sequences (5′ to 3′).sup.a sgRNA-KmoEx4 GAAATTAATACGACTCACTATAGGATGAATGTTCGGGTACTTCTGTTTTAGAGC TAGAAA (SEQ ID NO: 2) sgRNA-HybRED GAAATTAATACGACTCACTATAGGCGGTGCGGCCGCATAGGCGCGTTTTAGAGC TAGAAA (SEQ ID NO: 3) KmoEx4-F TGTGAGTAGRTTCCTTCGTCGTTGG (SEQ ID NO: 4) KmoEx4-R ATTCCGTAGCAAGTTTACCTTGGGC (SEQID NO: 5) DmHsp70-F AGCAAAGTGAACACGTCGCTAAGCG (SEQ ID NO: 6) DsRED-5Ra TCACCTTCAGCTTCACGGTCTTGTCC (SEQ ID NO: 7) KMF2 TTCTTCAAGACCAGGCCTCAATC (SEQ ID NO: 8) KMR1 TCACTAAACTCAGCCAGTATCCTAT (SEQ ID NO: 9) Ex5-F1 ACGACCGCATACAAAACGTACG (SEQ ID NO: 10) RED-3R TCGTACTGCTCCACGATGG (SEQ ID NO: 11) SV40-F AATCAGCCATACCACATTTGTAGAGG (SEQ ID NO: 12) In1-IR2 AATCATGGGTAGGACGAATGTCTTAGTCAGG (SEQ ID NO: 13) KmoHA1-F-Kpn TTTTGGTACCGCCAGATCGCAGATAGAGTGTGC (SEQ ID NO: 14) KmoHA1-R-Age TTTTACCGGTACCCGAACATTCATCTTTATTTC (SEQ ID NO: 15) KmoHA2-F-Av2 TTTTCCTAGGCGGCCGCTAAAATAAACAACATTATCAG (SEQ ID NO: 16) KmoHA2-R-Av2 TTTTCCTAGGGTTGGCTCTCTATTTGCACTCCACC (SEQ ID NO: 17) NosPro-F-M GTCAACGCGTGGATCACTATCAAACCCCTAAGGAC (SEQ ID NO: 18) NosPro-R-B GTCAGGATCCAGACATCCTCTAGATTTGTTCGTTGATC (SEQ ID NO: 19) Scel-F-B GTCAGGATCCATGCCCAAGAAGAAGCGCAAGG (SEQ ID NO: 20) Scel-R-S GTCAGTCGACTTATTTCAGGAAAGTTTCGGAGGAG (SEQ ID NO: 21) Nos3UTR-F-N GTCAGCGGCCGCTCTAGACGTAATCGAAGTGTTGGAC (SEQ ID NO: 22) Nos3UTR-R-XR GTCAGAATTCCTCGAGCGCCCTTTTCGTCATAAAATCGTAG (SEQ ID NO: 23) MRF1 AAGACGATGAGTTCTACTGGCGTGGAATCC (SEQ ID NO: 24) MRR1 CTTGCCGTATGTGATGCAGCGTTGTCATGG (SEQ ID NO: 25) MLF1 TTGTTTACTCTCAGTGCAGTCAACATGTCG (SEQ ID NO: 26) MLR1 TTCGACAGTCAAGGTTGACACTTCACAAGG (SEQ ID NO: 27) .sup.asgRNA target sequences are shown in bold letters. Restriction enzyme site sequences were underlined
[0179] As an initial test of SSA-driven elimination of the transgene in the kmo.sup.RG strain, pre-blastoderm embryos were microinjected with a donor plasmid expressing the homing endonuclease (HE) I-SceI to induce DSB formation in the transgene (
Generation of Transgenic Strains Expressing Nucleases in Aedes aegypti
[0180] Mos1-based plasmid constructs were assembled with 1-SceI under the control of several promoters known to function in Aedes aegypti; nos (Adelman, et al, Proceedings of the National Academy of Sciences of the United States of America 104 (2007); Calvo, et al., Insect Biochemistry and Molecular Biology, (2005)), β2-tublin (Smith et al., Insect Molecular Biology 16 (2007)), PUb (Anderson et al., Insect Molecular Biology 19 (2010); Carpenetti et al., Insect Molecular Biology 21 (2012)), and Hsp70A (Anderson et al., Insect Molecular Biology 19 (2010); Carpenetti et al., Insect Molecular Biology 21 (2012)). Two steps were taken for assembling the donor plasmid constructs. First, the MluI-BamHI fragment of nos (˜1.56 kb) or β2-tublin (˜1.0 kb) promoter, the BamHI-SalI fragment of the I-SceI coding region (˜0.85 kb), and the NotI-EcoRI fragment of nos (˜0.5 kb) or β2-tublin (˜0.2 kb) 3′UTR were obtained by PCR amplifications using primer sets providing the corresponding enzyme sites (Table 6) and sequentially assembled into a universal insect plasmid backbone pSLfa-PUb-mcs (Addgene #52908) to generate pSLfa-Nos-I-SceI or pSLfa-β2T-I-SceI. For pSLfa-PUb-I-SceI, the I-SceI coding sequence was ligated to BamHI and SalI sites in pSLfa-PUb-mcs. For pSLfa-Hsp70A-I-SceI, the MluI-NcoI fragment of Hsp70A promoter (˜1.5 kb) was replaced for PUb promoter (˜1.4 kb) in pSLfa-PUb-I-SceI. Second, the whole DNA piece of Promoter-I-SceI-3′UTR was taken out from the individual pSLfa-based plasmid construct and inserted to MluI and EcoRI sites in pM2-3×P3-BFP, a Mariner Mos1-based plasmid backbone.
[0181] To generate transgenic strains expressing I-SceI, each donor plasmid (0.5 μg/μl), pMOS-3×P3-BFP-Nos-I-SceI, pMOS-3×P3-BFP-32T-I-SceI, pMOS-3×P3-BFP-PUb-I-SceI, or pMOS-3×P3-BFP-Hsp70A-I-SceI, was microinjected into pre-blastoderm embryos of the kmo.sup.m strain (Aryan et al., PLoS ONE 8 (2013)), along with the Mos1 helper plasmid (0.2 μg/μl), pKhsp82M (Coates et al., Molecular and General Genetics 253 (1997)). For BFP-positive transgenic mosquitoes, transposon-chromosome junction sequences were identified by inverse PCR using Sau3AI-digested genomic DNA and primers indicated in
[0182] The timing, level and tissue specificity of I-SceI expression is variable when introduced transiently through plasmid injection. Therefore, transgenic strains that express I-SceI under the activity of germline-specific nos and beta2-tubulin (β2T), whole-body constitutive polyubiquitin (PUb), or heat-inducible heat shock protein 70A (Hsp70A) promoters (
TABLE-US-00006 TABLE 7 Generation of Mariner Mos1-driven transgenic lines Transgenic Donor Recipient # Embryos # Larvae # G.sub.0 Adults × # G.sub.1 Larvae w/phenotypes.sup.b mosquitoes Plasmids strains.sup.a injected survived kmo.sup.Δ4 W WB Nos-I-SceI pMOS-3xP3-BFP-Nos- kmo.sup.Δ4 ~1,450 183 ♂87 570 1 I-SceI (12.6%) ♀69 (0.18%) PUb-I-SceI pMOS-3xP3-BFP- kmo.sup.Δ4 ~1,150 263 ♂107 1,704 96 PUb-I-SceI (22.9%) ♀116 (5.3%) β2T-I-SceI pMOS-3xP3-BFP-β2T- kmo.sup.Δ4 ~1,150 137 ♂61 2,240 0 I-SceI (11.9%) ♀60 ~1,600 240 ♂128 19,253 0 (15%) ♀98 ~1,900 207 ♂103 11,869 0 (10.9%) ♀104 Hsp70A-I-SceI pMOS-3xP3-BFP- kmo.sup.Δ4 ~1,600 111 ♂58 10,357 0 Hsp70A-I-SceI (6.9%) ♀41 ~1,750 353 ♂165 16,919 0 (20.2%) ♀188 .sup.akmo.sup.Δ4 is the TALEN-generated kmo -null mutant strain (29). .sup.bMarker phenotypes: W, white eyes; B, BFP.
TABLE-US-00007 TABLE 8 Inverse PCR analysis reveals chromosomal sequences flanking the transgene in the Nos-I-scel or Pub-I-Scel strain. Mariner Mos1 transgenic Contig lines Identification No. Flanking Sequences MOS-3xP3-BFP- aag2_ctg_260:1:1761520:1 GATCCAATGCTGAGGAAATTACAAATGTTTTTTCAGTGTGTTTTTTGA Nos-I-Scel AAAATGTCACAACTTTAAGTTAAAGTTTAGTATACAAAATTCAAAAAA TGTTTTTGGAAAAATACATACGAAGTAAGAATAACTCTTTGCCTTTCG AATGCGGCTTAGAGAGTTTCATTAGACGCGTAATCACAGAGATATGGA CAGAACACTTTTGTATGTTGTTGAGGGGGTGAACCCAAACTTTTGCAC GGGAGTGTA=MosRH-3xP3:BFP-Nos:SceI-MosLH-TATATGGC GAATACAGAACGAAACTACATCTTGAAATTTGAAAAGAACAAAATTGT GAATCGAACAGCCTTGAATGTTTAGAATTTGATTGGGTACTTATTCGT CTGTAGTGCTTTTTATCTCTCTCTCTGCTGATGCATAATTTGAACGCA TAACGACTTTCAGACTTCACAAGTTCTAGCAACATTTCAACTTATAAT CGTTGAAAAGTATACAACATTAAGATTTCAAAATGATGATC (SEQ ID NO: 28 (left ar), SEQ ID NO: 29 (right arm)) MOS-3xP3-BFP- aag2_ctg_279:1:1681516:1 GATCCAGAATGAGCAAAGTGTCACTTTTA-MosLH-3xP3:BFP- PUb-I-Scel PUb:SceI-MosRH-TACTTGCGGAATAATTGAGCGGAACATTTTTCC GTACGGAATAGTGACAGCTCCATTTGATTTGTACAGCAGGCGTTACCA ATGTTACGAAATCAGCTCTACTTGTCAACTGGATACAGTTCAAGTAAT TTGAACAGCTGAAGTATTTCTTGACCATTACTTGTCCTATCCTTTTGC ACAGTACTTACGAAGTGGATACCAACCATTA (SEQ ID NO: 30 (left arm), SEQ ID NO: 31 (right arm))
SSA-Driven Transgene Elimination in Aedes aegypti
[0183] A single-strand annealing (SSA)-based transgene removal system successfully erasing transgenes from the Ae. aegypti genome is described, representing a novel pathway for engineering safety features into approaches for genetic control of vector mosquito populations. To determine the potential for each strain generated to initiate SSA-driven transgene elimination, Nos-I-SceI or PUb-I-SceI mosquitoes were reciprocally crossed with kmo.sup.RG (
[0184] In single-generation SSA tests (Table 9,
TABLE-US-00008 TABLE 9 Single-generation tests for SSA-based transgene elimination induced by the ISce I-expressing trigger strains (G.sub.4), Nos-I-SceI and Pub-I-SceI. F.sub.2 Larval screening.sup.c Parental cross Lineage of I-SceI inherited # WGR # WG # W # Blk (♂30 × ♀100) the SSA trigger.sup.a to F.sub.1 adults.sup.b # Total No DSB NHEJ kmo.sup.Δ4 SSA Nos-I-SceI × F.sub.0♂-F.sub.1♂ + 7500 4122 23 3315 40 kmo.sup.RG (0.56%) (0.97%) − 7252 3609 1 3642 0 (0.03%) F.sub.0♂-F.sub.1♀ + 2588 1608 9 957 14 (0.56%) (0.87%) − 4867 2410 0 2457 0 F.sub.0♀-F.sub.1♂ + 7828 4268 74 3380 106 (1.73%) (2.48%) − 7477 3839 93 3528 17 (2.42%) (0.44%) F.sub.0♀-F.sub.1♀ + 4676 2722 36 1835 83 (1.32%) (3.05%) − 5749 3077 10 2652 10 (0.32%) (0.32%) PUb-I-SceI × F.sub.0♂-F.sub.1♂ + 494 310 0 184 0 kmo.sup.RG − 1211 617 0 594 0 F.sub.0♂-F.sub.1♀ + 1370 823 0 547 0 − 2904 1473 0 1431 0 F.sub.0♀-F.sub.1♂ + 1850 1133 0 717 0 − 1302 684 0 618 0 F.sub.0♀-F.sub.1♀ + 1450 820 0 630 0 − 1277 660 0 617 0 .sup.anos -driven germline cell-specific expression of the homing endonuclease, I-SceI. .sup.bThe Mariner MosI -based transgenic I-SceI allele, which is inherited from the parental SSA trigger strain, provides the eye-specific BFP fluorescence. .sup.cW, white eye; Blk, black eye; G, EGFP; R, DsRED; B, BFP.
TABLE-US-00009 TABLE 10 The single-generation test for SSA-based transgene elimination induced by the ISce I-expressing trigger strains (G.sub.12), Nos-I-SceI and Pub-I-SceI F.sub.2 Larval screening.sup.b Parental cross Lineage of # WGR # WG # W # Blk (♂20 × ♀50) SSA trigger (G.sub.12).sup.a # Total No DSB NHEJ kmo.sup.Δ4 SSA Nos-SceI × F.sub.0♂-F.sub.1♂ 2000 990 3 1002 5 kmo.sup.RG 2080 1120 3 953 4 2240 1220 5 1004 11 F.sub.0♂-F.sub.1♀ 1380 700 1 675 4 1635 780 4 847 4 1350 661 4 677 8 F.sub.0♀-F.sub.1♂ 2340 1260 32 1035 13 980 490 10 473 7 2240 1140 25 1045 30 F.sub.0♀-F.sub.1♀ 1880 950 22 891 17 1240 673 13 546 8 2140 994 29 1103 14 PUb-SceI × F.sub.0♂-F.sub.1♂ 6153 3075 2 3074 2 kmo.sup.RG 6630 3480 0 3150 0 9327 5170 0 4157 0 F.sub.0♂-F.sub.1♀ 1060 546 0 514 0 1570 954 0 616 0 1610 880 0 730 0 F.sub.0♀-F.sub.1♂ 269 139 0 130 0 1416 678 0 738 0 2280 1310 0 970 0 F.sub.0♀-F.sub.1♀ 2398 1300 0 1098 0 2080 1100 0 980 0 1783 927 0 856 0 .sup.anos -driven germline cell-specific expression of the homing endonuclease, I-SceI. .sup.bW, white eye; Blk, black eye; G, EGFP; R, DsRED; B, BFP.
[0185] Mosquitoes scored as WG (NHEJ) and Blk (SSA) were confirmed to be heterozygous for the kmo.sup.Δ4 mutation (
[0186] In homing-based gene drive, the conversion of wild-type alleles to transgenics must be a highly efficient process in order to sustain drive. However, basic models suggest even modest SSA efficiencies of 1-3% should be sufficient to restore a population invaded by a homing-based gene drive transgene to a non-transgenic state. For example, kmo.sup.RG mosquitoes were allowed to interbreed with Nos-I-SceI or PUb-I-SceI mosquitoes in order to observe if the SSA-based rescue system would be capable of removing transgenes from the kmo.sup.RG mosquito population over multiple generations (
TABLE-US-00010 TABLE 11 The multi-generation test for transgene elimination induced by the SSA trigger strains (G.sub.4) Nos-I-SceI DSB repair-associated F.sub.2 F.sub.3 F.sub.4 F.sub.5 F.sub.6 marker phenotypes.sup.a ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ # Total pupae 496 495 470 445 832 763 1215 1181 1222 1121 No DSB # WGR 219 272 185 190 274 292 426 383 409 359 # WGRB 155 119 153 142 274 227 314 332 325 280 NHEJ # WG 1 2 1 3 1 2 4 # WGB 1 1 1 15 11 12 10 kmo.sup.Δ4 # W 51 63 63 54 138 123 207 241 225 238 # WB 66 40 62 50 127 104 217 170 194 165 SSA # Blk 2 1 1 8 8 13 18 29 23 # BlkB 3 5 3 6 10 8 12 16 # BlkGR 2 2 2 5 9 15 7 # BlkGRB 1 2 5 3 5 10 7 18 # BlkG # BlkGB 1 % WG(WGR + WG + Blk) 0 0.3 0.9 0.3 0.2 0.2 2.3 1.6 1.7 2 % Blk(WGR + WG + Blk) 1.3 0 1.2 2.4 3.2 3.2 4.2 5.6 6.9 9.1 % WGR/Total 75.4 79 72 74.6 65.9 68 60.9 60.5 60.1 57 % BFP/Total 45.2 32.1 46.2 45 49.2 44.7 46.2 45 45 43.7 PUb-I-SceI DSB repair-associated F.sub.2 F.sub.3 F.sub.4 F.sub.5 F.sub.6 marker phenotypes.sup.a ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ # Total pupae 479 563 495 439 977 927 1172 1149 976 849 No DSB # WGR 292 318 242 184 402 325 447 450 435 275 # WGRB 92 111 94 113 220 260 262 276 188 268 NHEJ # WGR 1 # WGB kmo.sup.Δ4 # W 29 39 49 49 142 149 187 159 158 137 # WB 66 95 107 90 210 191 274 261 188 164 SSA # Blk 5 3 2 1 1 2 3 4 1 # BlkB 2 1 2 1 # BlkGR 1 # BlkGRB 1 2 # BlkG # BlkGB % WG(WGR + WG + Blk) 0 0 0 0.3 0 0 0 0 0 0 % Blk(WGR + WG + Blk) 1.3 0 0.9 0.7 0.5 0.3 0.3 0.4 1.1 0.9 % WGR/Total 80.2 76.2 67.9 67.7 63.7 63.1 60.5 63.2 63.8 64 % BFP/Total 33 36.6 40.6 46.2 44.2 48.8 45.7 46.7 38.8 51.2 .sup.aMarker phenotypes: W, white eyes; Blk, black eyes; G, EGFP; R, DsRED; B, BFP.
TABLE-US-00011 TABLE 12 The multi-generation test for transgene elimination induced by the SSA trigger strains (G.sub.12) DSB repair-associated Nos-I-SceI marker phenotypes.sup.a F.sub.2 F.sub.3 F.sub.4 F.sub.5 # Total pupae 701 714 701 1951 1361 898 845 858 846 680 656 588 No DSB # WGR 204 187 175 558 327 268 205 185 186 127 149 111 # WGRB 299 345 343 898 639 372 430 377 388 229 261 188 NHEJ # WG 1 4 2 1 2 2 # WGB 3 2 3 22 8 4 10 4 9 9 8 6 kmo.sup.Δ4 # W 56 35 49 116 83 55 27 61 57 19 38 31 # WB 133 140 116 315 258 161 108 151 115 96 139 57 SSA # Blk 1 1 2 7 8 2 5 1 10 11 5 32 # BlkB 2 3 7 16 30 26 23 29 27 30 40 83 # BlkGR 1 3 6 3 8 8 4 14 38 7 37 # BlkGRB 1 1 3 8 4 4 24 28 37 58 18 38 # BlkG 3 1 # BlkGB 1 1 4 2 1 10 3 % WG(WGR + WG + Blk) 0.78 0.37 0.56 1.71 0.96 0.6 1.6 0.6 1.6 2 1.6 1.2 % Blk(WGR + WG + Blk) 0.98 0.93 2.8 2.5 4.31 5.6 9 10 13 35 14 38.9 % WGR/Total 71.8 74.5 73.9 74.6 71 71 75 66 68 52 62 50.9 % BFP/Total 62.5 68.8 67.3 64.6 69.1 63 71 70 68 71 70 63.8 DSB repair-associated PUb-I-SceI marker phenotypes.sup.a F.sub.2 F.sub.3 F.sub.4 F.sub.5 # Total pupae 795 856 908 940 724 928 945 968 868 572 683 823 No DSB # WGR 245 258 301 277 196 355 239 303 231 115 328 271 # WGRB 357 389 397 382 330 348 352 462 366 149 218 230 NHEJ # WG 1 1 # WGB 1 kmo.sup.Δ4 # W 17 11 2 16 5 18 15 37 28 19 14 20 # WB 176 198 208 196 179 180 170 158 175 72 112 154 SSA # Blk 9 5 15 21 4 9 40 5 5 53 28 # BlkB 25 1 1 39 1 29 141 4 54 # BlkGR 19 5 18 68 2 39 79 7 83 # BlkGRB 3 2 1 22 4 44 3 # BlkG # BlkGB % WG(WGR + WG + Blk) 0 0 0 0.14 0 0 0.13 0.13 0 0 0 0 % Blk(WGR + WG + Blk) 0.82 0.77 2.1 9.34 2.22 3.7 22.2 1.03 10.2 54.6 2 21.6 % WGR/Total 75.7 75.6 76.9 78.1 72.9 75.8 62.5 79 68.8 39.3 79.9 60.9 % BFP/Total 67 68.6 66.6 64.6 71 57.1 61.6 64.2 66.1 60.4 48.9 54.8 .sup.aMarker phenotypes: W, white eyes; Blk, black eyes; G, EGFP; R, DsRED; B, BFP.
[0187] For the Nos-I-SceI x kmo.sup.RG experiment at the G.sub.4 generation, five F.sub.2 individuals with wild-type black eye (Blk) were identified from 765 WGR mosquitoes (0.7%), with the number of individuals with the restored phenotypes increasing by 10-fold when the experiment was concluded at F.sub.6 (
[0188] Interestingly, the frequency of restored wild-type individuals increased much faster in the G.sub.12 experiment (30-40% at F.sub.5) as compared to the G.sub.4 experiment (less than 10% at F.sub.6). One potential explanation for this is due to greater exposure to the I-SceI nuclease (avg. 44.2% in G.sub.4; avg. 67% in G.sub.12), indicating that the rate of DSB induction and hence repair would likely be even higher with the I-SceI transgene encoded at the target locus itself, generating a complete self-eliminating transgene. Once again, compared to SSA-associated alleles (Blk), NHEJ-driven indels in DsRED (WG) occurred at lower frequencies (Avg. ˜1%) (
Example 32: A Single Component System SSA-Based Rescue Strategy
[0189] Genetic control strategies have significant promise to prevent the transmission of highly pathogenic diseases by rapidly spreading beneficial genetic traits such as pathogen-resistance into vector mosquito populations. However, the highly invasive, self-propagating nature of gene drive-based transgene-delivery systems presents a challenge for conducting field trials and the ultimate development of gene drive technologies. The invasive nature of gene drive approaches heighten concerns related to releasing genetically modified organisms (GMOs), in terms of both health and ecological safety. Along with institutional containment protocols and field test-related governance and guidance of gene drive-modified insects, novel confinable gene drive strategies have been suggested to eliminate unwanted invasion to non-target populations. However, many such approaches only aim to halt the process of gene drive and do not directly delete the transgene itself from gene drive mosquitoes or they fail to restore the wild-type gene.
[0190] The rates of successful transgene removal via SSA as described are anticipated to be sufficient to counteract homing-based gene drive approaches. In certain embodiments, an SSA-based rescue strategy will be designed to remove transgenic material in the targeted population by both removing the effector gene while simultaneously restoring a wild-type allele from the gene drive allele. For example, a single component system consisting of both a homing-based gene drive and an SSA-based self-elimination mechanism at a single locus is predicted to allow the temporary invasion of a gene drive transgene (allowing potential field testing), with SSA-triggered reversion to wild-type occurring with no need for remediation such as the inundated release of wild-type strains. SSA-based transgenes could also be incorporated into split drive or daisy-chain drive approaches that utilizes composite interactions of multiple transgenes, potentially shortening the lifespan of each component.