PHENOXY ACID COMPOUNDS AND MEDICAL USES THEREOF

Abstract

A phenoxy carboxylic acid compound, its pharmaceutically acceptable salt or ester, stereoisomer, prodrug, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; a pharmaceutical composition comprising the compound, its pharmaceutically acceptable salt or ester, stereoisomer, prodrug, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; and a medicinal use of the compound, its pharmaceutically acceptable salt or ester, stereoisomer, prodrug, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof, for preventing and/or treatment of a metabolic disease (e.g., metabolic syndrome, non-alcoholic fatty liver disease, and/or diabetes mellitus).

Claims

1. A compound represented by Formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof: ##STR00064## wherein, R.sup.1 and R.sup.2 are each independently selected from the group consisting of C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 alkoxy, and the C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.4 alkoxy is optionally substituted with one or several substituents independently selected from the group consisting of: halogen, nitro, amino, hydroxyl and thiol; R.sup.3 and R.sup.4 are each independently selected from the group consisting of hydrogen, halogen, nitro, amino, hydroxyl, thiol, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 alkylthio and C.sub.1-C.sub.4 alkylamino; wherein the amino, hydroxyl, thiol, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 alkylthio or C.sub.1-C.sub.4 alkylamino is optionally substituted with one or several substituents independently selected from the group consisting of: halogen, amino and hydroxyl; wherein, at least one of R.sup.3 and R.sup.4 is halogen; R.sup.5 and R.sup.6 are each independently selected from the group consisting of C.sub.1-C.sub.4 alkyl; R.sup.7 is selected from the group consisting of —C(O)X and cyano; wherein X is hydroxyl or C.sub.1-C.sub.4 alkoxy; n is 1, 2, 3 or 4; provided that the compound is not 5-(2,4-dichloro-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid; 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid; 5-(2-chloro-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid; or 5-(4-bromo-2,5-dimethyl-phenoxy)-2,2-dimethylpentanoic acid.

2. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: R.sup.1 and R.sup.2 are each independently selected from the group consisting of C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 alkoxy, and the C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.4 alkoxy is optionally substituted with one or several substituents independently selected from the group consisting of: halogen and hydroxyl.

3. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: R.sup.3 and R.sup.4 are each independently selected from the group consisting of hydrogen, halogen, nitro, hydroxy and C.sub.1-C.sub.4 alkyl; wherein, the hydroxy or C.sub.1-C.sub.4 alkyl is optionally substituted with one or several substituents independently selected from the group consisting of halogen and hydroxyl.

4. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: R.sup.5 and R.sup.6 are the same as each other.

5. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: R.sup.7 is selected from the group consisting of carboxy, —CO.sub.2Me, —CO.sub.2Et and cyano.

6. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: n is 1, 2 or 3.

7. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein: R.sup.1 and R.sup.2 are each independently selected from the group consisting of methyl, ethyl, methoxy and ethoxy, and the methyl, ethyl, methoxy or ethoxy is optionally substituted with one or several substituents independently selected from the group consisting of: —F, —Cl, —Br, —I and hydroxyl; R.sup.3 and R.sup.4 are each independently selected from the group consisting of hydrogen, —F, —Cl, —Br, —I, nitro, hydroxy, methyl and ethyl; wherein the hydroxy, methyl or ethyl is optionally substituted with one or several substituents independently selected from the group consisting of halogen and hydroxyl; R.sup.5 and R.sup.6 are methyl; R.sup.7 is selected from the group consisting of carboxy, —CO.sub.2Me, —CO.sub.2Et and cyano; n is 1, 2 or 3.

8. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein, the compound has a structure represented by Formula (Ia): ##STR00065## wherein, R.sup.3 is halogen.

9. The compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof according to claim 1, wherein, the compound is selected from: 5-(4-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-3); 5-(2,4-dibromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-109); 5-(3-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-213); 5-(4-bromo-2,5-diethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-310); 5-(4-bromo-2,3,5-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-315); 5-(2-bromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-404); 5-(4-bromo-2,3,6-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-409); 5-(4-bromo-2-iodo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-413); 5-(4-bromo-2-methoxy-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-412); 5-(4-bromo-3,6-dimethyl-2-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-414); 5-(4-bromo-2-hydroxy-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-415); 5-(4-bromo-3-hydroxy-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-416); 5-(4-bromo-2-(hydroxymethyl)-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-502); 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylvaleronitrile (BJMU-309); 5-(4-bromo-2,5-dimethylphenoxy)-2-ethyl-2-methylpentanoic acid (BJMU-401); 5-(2,5-dimethyl-4-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-110); 5-(4-bromo-2-ethyl-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-410); 5-(4-bromo-2,5-dimethoxyphenoxy)-2,2-dimethylpentanoic acid (BJMU-201); 4-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylbutanoic acid (BJMU-111); 6-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylhexanoic acid (BJMU-403).

10. A pharmaceutical composition, comprising a compound represented by Formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof, and one or more pharmaceutically acceptable carriers and/or excipients; ##STR00066## wherein, R.sup.1 and R.sup.2 are each independently selected from the group consisting of C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 alkoxy, and the C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.4 alkoxy is optionally substituted with one or several substituents independently selected from the group consisting of: halogen, nitro, amino, hydroxyl and thiol; R.sup.3 and R.sup.4 are each independently selected from the group consisting of hydrogen, halogen, nitro, amino, hydroxyl, thiol, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 alkylthio and C.sub.1-C.sub.4 alkylamino; wherein the amino, hydroxyl, thiol, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 alkylthio or C.sub.1-C.sub.4 alkylamino is optionally substituted with one or several substituents independently selected from the group consisting of: halogen, amino and hydroxyl; wherein, at least one of R.sup.3 and R.sup.4 is halogen; R.sup.5 and R.sup.6 are each independently selected from the group consisting of C.sub.1-C.sub.4 alkyl; R.sup.7 is selected from the group consisting of —C(O)X and cyano; wherein X is hydroxyl or C.sub.1-C.sub.4 alkoxy; n is 1, 2, 3 or 4.

11. The pharmaceutical composition according to claim 10, wherein the compound has a structure represented by Formula (Ia), ##STR00067## wherein, R.sup.3 is halogen.

12. The pharmaceutical composition according to claim 10, wherein, the compound is selected from: 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-1); 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-2); 5-(4-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-3); 5-(2,4-dibromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-109); 5-(2-chloro-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-209); 5-(3-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-213); 5-(4-bromo-2,5-diethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-310); 5-(4-bromo-2,3,5-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-315); 5-(2-bromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-404); 5-(4-bromo-2,3,6-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-409); 5-(4-bromo-2-iodo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-413); 5-(4-bromo-2-methoxy-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-412); 5-(4-bromo-3,6-dimethyl-2-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-414); 5-(4-bromo-2-hydroxy-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-415); 5-(4-bromo-3-hydroxy-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-416); 5-(4-bromo-2-(hydroxymethyl)-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-502); 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylvaleronitrile (BJMU-309); 5-(4-bromo-2,5-dimethylphenoxy)-2-ethyl-2-methylpentanoic acid (BJMU-401); 5-(2,5-dimethyl-4-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-110); 5-(4-bromo-2-ethyl-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-410); 5-(4-bromo-2,5-dimethoxyphenoxy)-2,2-dimethylpentanoic acid (BJMU-201); 4-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylbutanoic acid (BJMU-111); 6-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylhexanoic acid (BJMU-403).

13. The pharmaceutical composition according to claim 10, which optionally comprises an additional pharmaceutically active agent.

14-18. (canceled)

19. A method for prevention or treatment of a metabolic disease in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; the compound is a compound as defined in claim 10.

20. A method for prevention or treatment of a disease associated with PPARα and/or PPARγ in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; wherein the compound is a compound as defined in claim 10.

21. A method for reducing body weight, reducing body fat, reducing liver fat fraction, preventing or treating obesity, and/or preventing or treating non-alcoholic fatty liver disease (NAFLD) in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; wherein the compound is a compound as defined in claim 10.

22. A method for reducing blood glucose level, increasing insulin sensitivity, preventing or treating insulin resistance, and/or preventing or treating diabetes mellitus in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; wherein the compound is a compound as defined in claim 10.

23. A method for lowering blood total cholesterol level, lowering blood triglyceride level, lowering blood low-density lipoprotein level, and/or increasing blood high-density lipoprotein level in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound, its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate or crystal form, or metabolite form thereof, or any combination or mixture thereof; wherein the compound is a compound as defined in claim 10.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0354] FIG. 1 shows the cytotoxicity of the compound to L02 human normal hepatocytes, and the results are expressed as the relative viability of cells in the administration group (10 μM) as compared with that of the cells of the control group (DMSO group), in which compared with the control group, *P<0.05, **P<0.01, ***P<0.001.

[0355] FIG. 2 shows the effect of the compound on NO production induced by LPS in RAW264.7 mouse macrophages. The results are expressed as the multiple of the NO content in the cell culture supernatant of the administration group (10 μM) as compared with that in the cell culture supernatant of the control group (DMSO group), in which compared with the control group, *P<0.05, **P<0.01, ***P<0.001.

[0356] FIG. 3 shows the effect of the compound on the expression of NF-κB reporter gene, and the results are expressed as the multiple of the activity of luciferase reporter gene in the cells of the administration group (50 μM) as compared with that in the cells of the control group (DMSO group), in which compared with the control group, *P<0.05, **P<0.01, ***P<0.001.

[0357] FIG. 4 shows the effect of the compound on the activity of ARE reporter gene, and the results are expressed as the multiple of the activity of luciferase reporter gene in the cells of the administration group (50 μM) as compared with that in the cells of the control group (DMSO group), in which compared with the control group, *P<0.05, **P<0.01, ***P<0.001.

[0358] FIG. 5 shows the effects of the compound on the mRNA levels of PPARα (A), PPARγ (B), PGC1α (C), ACOX1 (D), FABP1 (E) respectively, and the results are expressed as the multiple of the relative expression amount of mRNA of the corresponding gene in the cells of the administration group (1 μM) as compared with that in the cells of the control group (DMSO group), in which compared with the gemfibrozil group, *P<0.05, **P<0.01, ***P<0.001.

[0359] FIG. 6 shows the effects of the compound on the protein levels of CPT1α (A), phosphorylated GSK3β (C), and phosphorylated IRS-1 (D), and the results are expressed as the multiple of the corresponding protein level quantified by Western blotting in the cells of the administration group (1 μM) as compared with that in the cells of the control group (DMSO group).

[0360] FIG. 7 shows the effects of the compound on the blood glucose level of DB/DB mice.

[0361] FIGS. 8A to 8B show the effects of the compound on fat contents in liver tissues of DB/DB mice. FIG. 8A: stained with Oil red O; FIG. 8B: stained with H.E.

[0362] FIG. 9 shows the effects of the compound on the blood glucose level of diabetes mellitus+NASH model mice, in which compared with the model control group, *P<0.05, **P<0.01, ***P<0.001; compared with the BJMU group, #P<0.05, ##P<0.01, ###P<0.001.

[0363] FIG. 10 shows the effects of the compound on the body fat content of diabetes mellitus+NASH model mice, determined by MRI in which compared with the model control group, *P<0.05, **P<0.01, ***P<0.001; compared with the BJMU group, #P<0.05, ##P<0.01, ###P<0.001.

[0364] FIG. 11 shows the effects of the compound on weight ratio of the epididymal white fat of diabetes mellitus+NASH model mice, in which compared with the model control group, *P<0.05, **P<0.01, ***P<0.001.

[0365] FIGS. 12A to 12B show the effects of the compound on the fat content in the liver tissue of diabetes mellitus+NASH model mice. FIG. 12A: stained with Oil red O; FIG. 12B: stained with H.E.

SPECIFIC MODELS FOR CARRYING OUT THE PRESENT INVENTION

[0366] The embodiments of the present invention will be described in detail below in conjunction with examples, but those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.

[0367] Unless otherwise specified, the experiments and methods described in the examples are basically performed according to conventional methods well known in the art and described in various references. If specific conditions are not indicated in the examples, it shall be carried out in accordance with conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without the manufacturer's indication are all conventional products that are commercially available. Those skilled in the art know that the examples describe the present invention by way of example and are not intended to limit the scope of protection claimed by the present invention. All publications and other references mentioned in the context are incorporated in their entirety by reference.

[0368] Synthesis and Structural Characterization of Compounds

[0369] Instruments and Reagents

[0370] The measurement of MS was performed by Agilent (ESI) mass spectrometer, manufacturer: Agilent, model: Agilent 6120B

[0371] High-resolution mass spectrogram was recorded by PE SCLEX QSTAR spectrometer.

[0372] Hydrogen nuclear magnetic spectrum and carbon nuclear magnetic spectrum were recorded by Bruker AVIII-400 spectrometer.

[0373] Thin-layer chromatography purification was performed by GF254 (0.4-0.5 nm) silica gel plate produced by Yantai Jiangyou silica gel development Co. Ltd.

[0374] Reaction monitoring was performed by thin-layer chromatography (TLC), and the used developing solvent systems included not limiting to: dichloromethane-methanol system, n-hexane-ethyl acetate system, and petroleum ether-ethyl acetate system, in which the volume ratio of solvents was adjusted according to the compound, while a small amount of triethylamine could be added for adjustment.

[0375] Unless specifically indicated in the examples, the reaction temperature was room temperature (20° C. to 30° C.).

[0376] The reagents used in the examples were purchased from Acros Organics, Aldrich Chemical Company or Topbiochem Ltd.

[0377] The abbreviations used herein had the following meanings:

[0378] AcCl: acetyl chloride; Ac.sub.2O: acetic anhydride; DCM: dichloromethane; aq: aqueous solution; TBAI: tetrabutylammonium iodide; DMF: N,N-dimethylformamide; EtOH: ethanol.

SYNTHESIS EXAMPLES

Example 1: Preparation of 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-1)

[0379] ##STR00041##

Step 1: Preparation of isobutyl 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoate (Int 1)

[0380] Compound 1-1 (4-chloro-2,5-dimethylphenol) (780 mg, 5.0 mmol), isobutyl 5-chloro-2,2-dimethylpentanoate (1144 mg, 5.2 mmol), TBAI (36.9 mg, 0.1 mmol) and potassium carbonate (1380 mg, 10.0 mmol) were dissolved in DMF (30 mL), stirred overnight at 90 degrees Celsius; when TLC monitoring indicated no trend of continuous conversion, the reaction solution was poured into water and layered; after the aqueous phase was extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate and filtered, and the filtrate was concentrated. The crude product was separated by silica gel column chromatography to obtain Compound 1-2 (1.5 g) with a yield of 88%.

Step 2: Preparation of 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-1)

[0381] Compound 1-2 (isobutyl 5-(4-chloro-2,5-dimethylphenoxy)-2,2-dimethylpentanoate) (1360 mg, 4.0 mmol), KOH (1120 mg, 20.0 mmol) and TBAI (36.9 mg, 0.1 mmol) were dissolved in a mixed solvent of EtOH (7 mL) and H.sub.2O (2 mL), heated to reflux at 120° C., and reacted for 24 h; when TLC monitoring indicated the reaction was completed, water was added for washing; the system was acidified with diluted hydrochloric acid and extracted three times with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate and filtered, and the filtrate was concentrated. The extract was subjected to rotary evaporation to dryness and purified by column chromatography to obtain the target product BJMU-1 (1.1 g), and the yield was 96%.

[0382] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.07 (s, 1H), 6.62 (s, 1H), 3.90 (t, J=5.9 Hz, 2H), 2.31 (s, 3H), 2.15 (s, 3H), 1.88-1.65 (m, 4H), 1.25 (s, 6H). .sup.13C NMR (101 MHz, CDCl.sub.3) δ 185.83, 155.68, 133.80, 130.71, 126.06, 124.99, 113.64, 68.46, 42.06, 36.96, 25.21, 25.14, 20.19, 15.68.

Example 2: Preparation of 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-2)

[0383] ##STR00042##

[0384] Compound BJMU-2 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 2, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 2-1, and the yield of the two steps was 66%.

[0385] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.25 (s, 1H), 6.64 (s, 1H), 3.90 (t, J=5.9 Hz, 2H), 2.33 (s, 3H), 2.15 (s, 3H), 1.91-1.58 (m, 4H), 1.25 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.38, 156.20, 135.57, 133.65, 126.29, 114.58, 113.47, 68.23, 41.94, 36.78, 25.04, 24.98, 22.87, 15.44

Example 3: Preparation of 5-(4-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-3)

[0386] ##STR00043##

[0387] Compound BJMU-3 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 3, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 3-1, and the yield of the two steps was 78%.

[0388] .sup.1H NMR (400 MHz, CDCl3) δ 6.78 (d, J=9.8 Hz, 1H), δ 6.56 (d, J=7.0 Hz, 1H), δ 3.89 (t, J=6.0 Hz, 2H) δ 2.22 (s, 3H), δ 2.17 (s, 3H), δ 1.85-1.69 (m, 4H), δ 1.25 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.76, 155.12 (d, J=236.3 Hz), 152.72 (d, J=2.15), 125.60 (d, J=7.57), 121.61 (J=18.4), 116.82 (d, J=23.74), 113.78 (d, J=5.43), 68.69, 41.94, 36.81, 25.12, 24.94, 22.83, 15.41. .sup.19F NMR (376 MHz, CDCl3), δ−129.00 (s, 1F)

Example 4: Preparation of 5-(2,4-dibromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-109)

[0389] ##STR00044##

[0390] Compound BJMU-109 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 4, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 4-1, and the yield of the two steps was 72%.

[0391] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.33 (s, 1H), 3.83 (t, J=5.6 Hz, 2H), 2.53 (s, 3H), 2.26 (s, 3H), 1.89-1.75 (m, 4H), 1.27 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.31, 153.96, 136.07, 133.23, 131.42, 121.11, 119.16, 72.66, 41.93, 36.69, 25.76, 24.96, 23.90, 16.29

Example 5: Preparation of 5-(2-chloro-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-209)

[0392] ##STR00045##

[0393] Compound BJMU-209 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 5, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 5-1, and the yield of the two steps was 58%.

[0394] .sup.1H NMR (400 MHz, Chloroform-d) δ 6.98 (d, J=7.7 Hz, 1H), 6.90 (d, J=7.7 Hz, 1H), 3.90 (t, J=5.7 Hz, 2H), 2.36 (s, 3H), 2.29 (s, 3H), 1.90-1.82 (m, 4H), 1.30 (s, 6H). .sup.13C NMR (101 MHz, Chloroform-d) δ 184.6, 153.5, 135.1, 130.1, 128.4, 128.2, 125.6, 72.6, 41.9, 36.7, 25.9, 24.9, 20.1, 16.3.

Example 6: Preparation of 5-(3-fluoro-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-213)

[0395] ##STR00046##

[0396] Compound BJMU-213 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 6, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 6-1, and the yield of the two steps was 76%.

[0397] .sup.1H NMR (400 MHz, Chloroform-d) δ 6.90-6.85 (m, 1H), 6.59 (s, 1H), 4.01 (t, J=5.6, 2H), 2.48 (s, 3H), 2.41 (s, 3H), 1.80-1.67 (m, 4H), 1.21 (s, 6H). .sup.13C NMR (101 MHz, Chloroform-d) δ 182.28, 162.75, 157.90, 138.40, 115.43, 113.02, 111.63, 69.37, 42.41, 37.22, 25.19, 25.13, 24.43, 16.80.

Example 7: Preparation of 5-(4-bromo-2,5-diethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-310)

[0398] ##STR00047##

[0399] Compound BJMU-310 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 7, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 7-1, and the yield of the two steps was 56%.

[0400] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.28 (s, 1H), 6.68 (s, 1H), 3.95 (t, J=5.8 Hz, 2H), 2.65 (dq, J=47.2, 7.5 Hz, 4H), 1.89-1.70 (m, 4H), 1.28 (s, 6H), 1.21 (dt, J=14.9, 7.5 Hz, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.78, 156.11, 141.24, 132.49, 132.34, 114.15, 112.23, 68.12, 41.99, 36.86, 29.73, 25.08, 22.71, 14.50.

Example 8: Preparation of 5-(4-bromo-2,3,5-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-315)

[0401] ##STR00048##

[0402] Compound BJMU-315 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 8, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 8-1, and the yield of the two steps was 68%.

[0403] .sup.1H NMR (400 MHz, Chloroform-d) δ 6.59 (s, 1H), 3.89 (t, J=5.9 Hz, 2H), 2.38 (s, 3H), 2.37 (s, 3H), 2.18 (s, 3H), 1.87-1.69 (m, 4H), 1.25 (s, 6H). .sup.13C NMR (101 MHz, Chloroform-d) δ 184.6, 155.5, 137.2, 135.5, 124.2, 119.0, 111.5, 68.5, 41.9, 36.8, 25.1, 25.0, 24.4, 20.4, 12.8.

Example 9: Preparation of 5-(2-bromo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-404)

[0404] ##STR00049##

[0405] Compound BJMU-404 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 9, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 9-1, and the yield of the two steps was 48%.

[0406] .sup.1H NMR (400 MHz, Chloroform-d) δ 6.98 (d, J=7.7 Hz, 1H), 6.88 (d, J=7.7 Hz, 1H), 3.86 (t, J=5.7 Hz, 2H), 2.36 (s, 3H), 2.27 (s, 3H), 1.91-1.57 (m, 4H), 1.27 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.84, 154.44, 137.09, 129.96, 129.37, 125.79, 120.24, 72.59, 42.01, 36.78, 25.85, 24.99, 23.08, 16.49.

Example 10: Preparation of 5-(4-bromo-2,3,6-trimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-409)

[0407] ##STR00050##

[0408] Compound BJMU-409 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 10, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 10-1, and the yield of the two steps was 65%.

[0409] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.23 (s, 1H), 3.67 (t, J=4.8 Hz, 2H), 2.33 (s, 3H), 2.22 (m, 6H), 1.79-1.78 (m, 4H), 1.27 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 183.86, 154.97, 134.85, 131.58, 131.44, 129.91, 119.61, 72.63, 41.91, 36.84, 25.87, 24.98, 19.75, 15.97, 13.82.

Example 11: Preparation of 5-(4-bromo-2-iodo-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-413)

[0410] ##STR00051##

[0411] Compound BJMU-413 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 11, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 11-1, and the yield of the two steps was 58%.

[0412] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.31 (s, 1H), 4.08 (t, J=7.1 Hz, 2H), 2.39 (s, 3H), 2.31 (s, 3H), 1.82-1.71 (m, 4H), 1.21 (s, 6H). .sup.13C NMR (400 MHz, Chloroform-d) δ 180.57, 153.80, 134.22, 133.83, 128.46, 119.83, 91.62, 70.78, 43.22, 37.23, 25.18, 24.30, 22.50, 16.04.

Example 12: Preparation of 5-(4-bromo-2-methoxy-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-412)

[0413] ##STR00052##

[0414] Compound BJMU-412 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 12, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 12-1, and the yield of the two steps was 56%.

[0415] .sup.1H NMR (400 MHz, Chloroform-d) δ 12.30 (s, 1H), 7.22 (s, 1H), 6.38 (s, 1H), 3.88-3.94 (t, J=5.8 Hz, 2H), 3.83 (s, 3H), 2.11 (s, 3H), 1.82-1.73 (m, 4H), 1.25 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 185.01, 157.10, 154.53, 133.92, 120.38, 101.08, 97.35, 68.42, 56.41, 41.97, 36.74, 25.03, 24.99, 15.14.

Example 13: Preparation of 5-(4-bromo-3,6-dimethyl-2-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-414)

[0416] ##STR00053##

[0417] Compound BJMU-414 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 13, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 13-1, and the yield of the two steps was 68%.

[0418] .sup.1H NMR (400 MHz, Chloroform-d) δ 7.44 (s, 1H), 3.87 (t, J=5.8 Hz, 2H), 2.25 (s, 6H), 1.76-1.63 (m, 4H), 1.22 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.8, 147.8, 147.4, 135.8, 132.2, 127.9, 119.3, 75.3, 41.9, 36.3, 25.6, 24.9, 17.7, 15.7.

Example 14: Preparation of 5-(4-bromo-2-hydroxy-3,6-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-415)

[0419] ##STR00054##

[0420] Compound BJMU-415 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 14, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 14-1, and the yield of the two steps was 66%.

[0421] .sup.1H NMR (400 MHz, CDCl3) δ 11.04 (brs, 1H), 6.91 (s, 1H), 5.95 (brs, 1H), 3.83 (t, J=5.9 Hz, 2H), 2.28 (s, 3H), 2.22 (s, 3H), 1.83-1.73 (m, 4H), 1.27 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 183.4, 147.7, 143.4, 128.9, 124.9, 122.4, 119.9, 73.6, 41.9, 36.6, 26.1, 25.1, 15.7, 15.5.

Example 15: Preparation of 5-(4-bromo-3-hydroxy-2,5-dimethylphenoxy)-2,2-dimethylpentanoic acid (BJMU-416)

[0422] ##STR00055##

[0423] Compound BJMU-416 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 15, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 15-1, and the yield of the two steps was 57%.

[0424] .sup.1H NMR (400 Hz, CDCl3), δ: 6.34 (s, 1H), 3.90 (t, J=5.6 Hz, 2H), 2.34 (s, 3H), 2.14 (s, 3H), 1.72-1.81 (m, 4H), 1.25 (s, 6H). .sup.13C NMR (101 Hz, CDCl3), δ: 184.7, 156.7, 150.6, 134.8, 111.2, 106.1, 104.7, 68.5, 41.9, 36.8, 25.0, 24.9, 23.2, 9.1.

Example 16: Preparation of 5-(4-bromo-2-(hydroxymethyl)-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-502)

[0425] ##STR00056##

[0426] Compound BJMU-502 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 16, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 16-1, and the yield of the two steps was 72%.

[0427] .sup.1H NMR (400 MHz, CDCl.sub.3) δ 7.41 (s, 1H), 6.71 (s, 1H), 4.62 (s, 2H), 3.94-3.97 (m, 2H), 2.36 (s, 3H), 1.71-1.81 (m, 4H), 1.25 (s, 6H); .sup.13C NMR (100 MHz, CDCl.sub.3) δ 155.8, 138.0, 132.1, 128.6, 115.1, 113.6, 68.1, 61.0, 41.9, 36.7, 29.7, 25.1, 23.1.

Example 17: Preparation of 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylvaleronitrile (BJMU-309)

[0428] ##STR00057##

[0429] Compound 17-3 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 17, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 17-1, and the yield was 80%.

Step 3: Preparation of 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylpentaneamide (17-4)

[0430] Compound 17-3 (1.64 g, 5.0 mmol) was dissolved in THF (10 mL), and stirred for 20 min in condition of ice bath. Thionyl chloride (1.08 mL, 14.8 mmol) was slowly added dropwise to the reaction solution. After the dropwise addition was completed, DMF solution (5 d) was added, heated to 50° C. and reacted for 2 h. After the reaction was completed, the reaction solution was cooled to 0° C., stirred vigorously, and slowly added with concentrated ammonia (4 mL) to precipitate a large amount of white solid, which was filtered with suction, washed with THF, and dried to obtain Compound 17-4 (1.38 g) with a yield of 84%.

Step 4: Preparation of 5-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylvaleronitrile (BJMU-309)

[0431] Compound 17-4 (1.30 g, 4.0 mmol), Pd(OAc).sub.2 (89.6 mg, 0.4 mmol) and selectfluor (283.2 mg, 0.8 mmol) were added into a 100 mL schlenk reaction flask, argon replacement was performed three times, and acetonitrile (20 mL) was added and stirred at 60° C. for 3 h. TLC monitoring indicated no trend of continuous conversion. The reaction solution was filtered, evaporated under reduced pressure to remove solvent, and separated by column chromatography to obtain the target product BJMU-309 (0.93 g) with a yield of 83%.

[0432] .sup.1H NMR (400 MHz, CDCl.sub.3) δ 7.27 (s, 1H), 6.68 (s, 1H), 4.39-3.74 (m, 2H), 2.36 (s, 3H), 2.17 (s, 3H), 2.08-1.94 (m, 2H), 1.87-1.68 (m, 2H), 1.41 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ=173.21, 135.65, 133.67, 126.20, 124.86, 114.75, 113.47, 67.51, 37.76, 32.22, 26.67, 25.50, 22.89, 15.51.

Example 18: Preparation of 5-(4-bromo-2,5-dimethylphenoxy)-2-ethyl-2-methylpentanoic acid (BJMU-401)

[0433] ##STR00058##

[0434] Compound BJMU-401 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 18, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 18-1 and isobutyl 5-chloro-2,2-dimethylpentanoate in Step 1 of Example 1 was replaced with isobutyl 5-chloro-2-methyl-2-ethylpentanoate, and the yield of the two steps was 62%.

[0435] .sup.1H NMR (400 MHz, Chloroform-d): δ 7.25 (s, 1H), 6.64 (s, 1H), 3.90 (td, J=5.8, 2.2 Hz, 2H), 2.33 (s, 3H), 2.14 (s, 3H), 1.87-1.77 (m, 2H), 1.76-1.68 (m, 2H), 1.66-1.48 (m, 2H), 1.18 (s, 3H), 0.98-0.80 (t, J=7.5 Hz, 3H). .sup.13C NMR (101 MHz, Chloroform-d): δ 156.18, 135.55, 133.61, 126.23, 114.52, 113.40, 68.23, 45.82, 34.74, 31.61, 24.67, 22.86, 20.74, 15.43, 8.81.

Example 19: Preparation of 5-(2,5-dimethyl-4-nitrophenoxy)-2,2-dimethylpentanoic acid (BJMU-110)

[0436] ##STR00059##

[0437] Compound BJMU-110 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 19, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 19-1, and the yield of the two steps was 47%.

[0438] .sup.1H NMR (400 MHz, Chloroform-d) δ 11.99 (s, 1H), 7.92 (s, 1H), 6.62 (s, 1H), 4.02 (t, J=6.0 Hz, 2H), 2.61 (s, 3H), 2.22 (s, 3H), 1.89-1.73 (m, 4H), 1.26 (s, 6H). .sup.13C NMR (101 MHz, Chloroform-d) δ 184.4, 160.6, 141.1, 134.6, 127.5, 125.5, 113.6, 68.5, 41.9, 36.5, 25.0, 24.8, 21.7, 15.6.

Example 20: Preparation of 5-(4-bromo-2-ethyl-5-methylphenoxy)-2,2-dimethylpentanoic acid (BJMU-410)

[0439] ##STR00060##

[0440] Compound BJMU-410 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 20, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 20-1, and the yield of the two steps was 55%.

[0441] .sup.1H NMR (400 MHz, CDCl3) δ 12.14 (bs, 1H), 7.29 (s, 1H), 6.70 (s, 1H), 3.94 (t, J=5.9 Hz, 2H), 2.61 (q, J=7.5 Hz, 2H), 2.38 (s, 3H), 1.75-1.89 (m, 4H), 1.29 (s, 6H), 1.21 (t, J=7.5 Hz, 3H). .sup.13C NMR (101 MHz, CDCl.sub.3) δ 184.9, 155.9, 135.6, 132.3, 132.2, 114.9, 113.6, 68.2, 42.0, 36.8, 25.1, 25.0, 22.9, 22.7, 14.1.

Example 21: Preparation of 5-(4-bromo-2,5-dimethoxyphenoxy)-2,2-dimethylpentanoic acid (BJMU-201)

[0442] ##STR00061##

[0443] Compound BJMU-201 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 21, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 21-1, and the yield of the two steps was 85%.

[0444] .sup.1H NMR (400 MHz, CDCl3) δ 7.06 (s, 1H), 6.57 (s, 1H), 4.02 (t, J=6.6 Hz, 2H), 3.86 (s, 3H), 3.83 (s, 3H), 1.94-1.81 (m, 2H), 1.74 (dd, J=11.2, 5.0 Hz, 2H), 1.26 (s, 6H). .sup.13C NMR (101 MHz, CDCl3) δ 184.19, 150.32, 148.51, 144.33, 117.20, 101.49, 100.75, 69.81, 57.14, 56.86, 41.94, 36.48, 24.98, 24.95.

Example 22: Preparation of 4-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylbutanoic acid (BJMU-111)

[0445] ##STR00062##

[0446] Compound BJMU-111 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 22, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 22-1 and isobutyl 5-chloro-2,2-dimethylpentanoate in Step 1 of Example 1 was replaced with isobutyl 5-chloro-2,2-dimethylbutyrate, and the yield of the two steps was 75%.

[0447] .sup.1H NMR (400 MHz, Chloroform-d) δ 11.99 (s, 0.5H), 7.21 (s, 1H), 6.65 (s, 1H), 3.99 (t, J=6.4 Hz, 2H), 2.33 (s, 3H), 2.13-2.10 (m, 5H), 1.30 (s, 6H). .sup.13C NMR (101 MHz, Chloroform-d) δ 184.5, 156.0, 135.5, 133.6, 126.1, 114.6, 113.0, 64.6, 40.7, 39.0, 25.3, 22.9, 15.4.

Example 23: Preparation of 4-(4-bromo-2,5-dimethylphenoxy)-2,2-dimethylhexanoic acid (BJMU-403)

[0448] ##STR00063##

[0449] Compound BJMU-403 was synthesized by a method similar to that described in Step 1 to Step 2 of Example 1, except that in Step 1 of Example 23, Compound 1-1 in Step 1 of Example 1 was replaced with Compound 23-1 and isobutyl 5-chloro-2,2-dimethylpentanoate in Step 1 of Example 1 was replaced with isobutyl 5-chloro-2,2-dimethylhexanoate, and the yield of the two steps was 45%.

[0450] .sup.1H NMR (400 MHz, CDCl.sub.3): δ (ppm): 7.27 (s, 1H), 6.68 (s, 1H), 3.94 (t, J=6.4 HZ, 2H), 2.36 (s, 3H), 2.16 (s, 3H), 1.76-1.84 (m, 2H), 1.46-1.67 (m, 4H), 1.24 (s, 6H). .sup.13C NMR (100 MHz, CDCl.sub.3): δ (ppm): 184.6, 156.3, 135.6, 133.6, 126.3, 114.5, 113.5, 67.8, 42.1, 40.0, 29.7, 24.9, 22.8, 21.5, 15.4.

[0451] Biological Activity Experiment

[0452] The cells, reagents and instruments involved in in vitro experiments in the following experimental examples were as follows:

[0453] Drugs:

[0454] Compounds obtained by the preparation of the examples; control drug: Gemfibrozil (purchased from Beijing Ouhe Technology Co., Ltd.).

[0455] Cells:

[0456] RAW264.7 mouse macrophages, human colon cancer cells SW480, human liver cancer cells HepG2, and human liver cells L02, all came from the ATCC cell bank.

[0457] Culture Media:

[0458] RPMI1640 medium containing 10% fetal bovine serum (FBS) and DMEM high glucose medium containing 10% fetal bovine serum (FBS).

[0459] Cell Culture:

[0460] In an environment maintained at 37° C., 5% CO.sub.2 and saturated humidity, after incubation was carried out to 80% confluence, digestion treatment was performed with 0.25% trypsin-EDTA.

[0461] Main Reagents and Instruments Involved:

[0462] RIPA cell lysate, BCA protein concentration test kit (Beyotime Institute of Biotechnology, Jiangsu); Phenylmethanesulfonyl fluoride (PMSF), β-mercaptoethanol, acrylamide (Sigma, USA); ECL™ Prime Western Blotting detection reagent (Bio-Rad, USA); glycine, sodium lauryl sulfonate (Amresco, USA); RPMI1640 medium, DMEM high glucose medium, trypsin (Gibco, Maryland, USA); fetal bovine serum (GBO, Germany); nitric oxide (NO) assay kit (Nanjing Jiancheng, China); luciferase reporter gene assay kit (Beyotime Institute of Biotechnology, Jiangsu); Tranzol reagent (Tranzol total RNA extraction reagent, TransGen Biotech); 5× All-In-One RT MasterMix reverse transcription kit (Abcam, USA); CPT1α rabbit polyclonal antibody (12252S, CST, USA), p-GSK3β (Ser9) rabbit polyclonal antibody (9323, CST, USA), pIRS-1 (Ser636/639) rabbit polyclonal antibody (2388, CST, USA), β-Tubulin mouse monoclonal antibody (BE0025, EASYBIO, China).

[0463] INCO246 cell incubator (Memmert, Germany); Gen5 synergy H1 Take3 (BioTek, USA) multifunctional microplate reader; fluorescence real-time quantitative PCR instrument, protein electrophoresis system (Bio-Rad, USA); low-temperature refrigeration high-speed centrifuge (Eppendorf, Germany); electrophoresis instrument and horizontal electrophoresis tank (Beijing Junyi Dongfang Electrophoresis Equipment Co., Ltd., China).

Experimental Example 1: Evaluation of Compounds' Cytotoxicity

[0464] In this experiment, the compounds' cytotoxicity was determined by the SRB method. The specific steps were as follows:

[0465] (1) Cells at log phase were collected; the cell suspension was adjusted to a concentration of about 3×10.sup.3/100 μL culture medium; cells were added to a middle area of a 96-well plate, sterile PBS was added to edge holes, and routine culture was performed overnight in condition of 5% CO.sub.2, 37° C.

[0466] (2) The compound was formulated with serum-free medium, with final concentration of 10 μM; the 96-well plate medium was removed, washing was performed with PBS, the prepared compound to be tested was added, and routine regular culture was performed for 24 hours.

[0467] (3) Cell fixation: At the end of the action of compound, 50 μL of 4° C. pre-cooled trichloroacetic acid (TCA) solution (30%, w/v) was added to each well of plate to fix the cells. The final concentration of the TCA solution was 10%. After standing for 5 min, the plate was moved into a refrigerator at 4° C. to perform fixation for 1 h, then taken out and rinsed with deionized water 5 times, and air-dried at room temperature.

[0468] (4) Staining: After the 96-well plate was air-dried at room temperature, 70 μL of 0.4% (w/v) SRB dye solution (prepared with 1% acetic acid) was added to each well, the dye solution was discarded after dyeing for 30 min, and 1% (v/v) acetic acid was used for rinsing 4 times to remove unbound dye, and air-dried at room temperature.

[0469] (5) Determination: 100 μL of non-buffered Tris-base lye (10 mM, pH=10.5) was used to dissolve the dye bound to cell proteins, shaking was performed on a horizontal shaker for 20 min, and the absorbance value at 540 nm was measured with a microplate reader.

[0470] (6) Relative cell viability refers to a percentage of cell viability of the cells in a sample well under the action of drug relative to that of the cells in a negative control well, and the calculation formula was: relative cell viability=(Tx−C)/(T0−C)*100%, wherein, T0 represents an average absorbance value of a negative control with a medium added with an equal volume of DMSO without drug action (negative control); Tx represents an average absorbance value of cells measured after the cells were treated with drug, fixed and stained; C represents an average absorbance value of a blank well that was already fixed and stained.

[0471] The test results of L02 human normal liver cells were shown in FIG. 1. The results showed that after the normal liver cells were treated with BJMU-1, 2, 3, 110, 111, 113, 114, 115, 201, 203, 204, 205, 209, 212, 213, 214, 404, 409, 415, 416 or 502, less than 30% of cell viability was inhibited (relative cell viability was greater than 70%), and the above compounds had no significant cytotoxicity.

Experimental Example 2: Evaluation of Regulatory Effect of Compound on Cellular Inflammatory Response

[0472] In this experimental example, the generation of nitric oxide (NO) and the transcriptional activity of NF-κB inflammation signal pathway were tested to evaluate the regulatory effect of compound on cell inflammatory response.

[0473] 2.1 Determination of NO Generation

[0474] NO is a reactive nitrogen species (RNS) and an important gas signal molecule. Macrophages could convert arginine into NO which participated in the body's inflammatory response. Therefore, determination of inhibitory activity of a drug on NO generation was one of the classic methods to evaluate drug's anti-inflammatory ability. RAW264.7 cells at exponential growth phase were inoculated into a 96-well plate at 1×10.sup.4 cells/200 μL. well of medium. After adherence, the medium was discarded, and the cells were subjected to drug treatments. Normal group (serum-free medium), LPS model group (serum-free medium containing 1 μg/mL LPS), LPS+drug group (serum-free medium containing 1 μg/mL LPS, 10 μM gemfibrozil or the compound of the present application) were established, and 3 repeated wells were set for each group. After 24 hours incubation in incubator, cell supernatant of each well was collected and assay was performed according to the instructions of NO determination kit (Nanjing Jiancheng). The absorbance value of each well at wavelength of 540 nm was read and NO content was calculated.

[0475] The results were shown in FIG. 2. The tested compounds 1, 2, 3, 109, 111, 401, 403, 413, 415 and 502 could inhibit NO generation. In contrast, gemfibrozil (BJMU) did not have an activity of inhibiting NO generation. The above results indicated that the compound of the present application had significant anti-inflammatory activity.

[0476] 2.2 Determination of Transcriptional Activity of NF-κB Luciferase Reporter Gene

[0477] NF-κB was the most important inflammatory signal pathway. SW480 human colon cancer cells stably transfected with a luciferase reporter gene driven by NF-κB were used to determine the effects of the compound of the present application and the control drug gemfibrozil on NF-κB transcriptional activity, which comprised the following steps.

[0478] (1) Cells stably transfected with NF-κB Luc were cultivated to exponential growth, inoculated at a culture medium concentration of 1×10.sup.5/2000 μL in a 24-well plate, and cultured for 24 hours, the medium was discarded, and the test compound or gemfibrozil formulated with serum-free medium at 50 μM were added to the 24-well plate and incubation was continued for 6 hours. After washing once with 200 μL of PBS, 100 μL of reporter gene cell lysis buffer was added, the cells were lysed on ice for 10 minutes, and the cell lysate was collected by pipetting.

[0479] (2) After centrifugation was performed at 8000 rpm and 4° C. for 10 min, the supernatant was pipetted for fluorescence assay.

[0480] (3) The measurement gap time of chemiluminescence analyzer was set to 2 s and the measurement time was set to 10 s. Automatic sample injection was adopted, 50 μL of luciferase assay reagent was added to each well. The reporter gene cell lysis buffer was used as a blank control.

[0481] (4) After centrifugation, the supernatant was taken, and the BCA method was used to determine the protein concentration so as to normalize the reporter gene results.

[0482] The results were shown in FIG. 3. The tested compounds 1, 2, 209, 309, 315, 404 and 415 could significantly inhibit the activity of NF-κB reporter gene. In contrast, gemfibrozil could not inhibit the activity of NF-κB reporter gene. The above results further indicated that the compound of the present application has obvious anti-inflammatory activity that gemfibrozil does not possess.

[0483] It is known in the art that long-term chronic inflammation is a key event in the progression of MS, NAFLD and diabetes mellitus, and the continuous activation of NF-kB signals is a typical feature thereof. Thus, it is an important means to inhibit NF-kB signals for the control of progression and complications of the aforementioned diseases (see: references [1] to [4]), so the above experimental results could show that the compound of the present application could be used for the prevention and/or treatment of MS, NAFLD and diabetes mellitus as well as complications thereof.

Experimental Example 3: Evaluation of Regulatory Effect of Compound on Cellular Oxidative Stress Response Signal

[0484] In this experimental example, the luciferase activity in HepG2 human liver cancer cells stably transfected with a luciferase reporter gene driven by antioxidant response element (ARE) was determined to evaluate the regulatory effects of the compound of the present application and gemfibrozil on the transcriptional activity of transcription factor Nrf2 and the cellular oxidative stress response signals, in which the operation process of the reporter gene assay was the same as that of Experimental Example 2.2.

[0485] The results were shown in FIG. 4. The tested compounds 1, 2, 3, 401, 403, 404, 409, 412, 415, 416 and 502 could significantly activate the ARE reporter gene activity. In contrast, gemfibrozil did not obviously activate the ARE. The above results showed that the compound of the present application could exert an antioxidant effect by activating antioxidant response element to induce the expression of cellular antioxidant and metabolic detoxification genes, and had significant antioxidant activity.

[0486] Since it was known in the art that oxidative stress was one of the most important pathogenic factors in the occurrence and progression of MS, NAFLD and diabetes mellitus, and antioxidant and activation of Nrf2-mediated cellular antioxidant response had always been important strategies for the prevention and treatment thereof (see: references [5] to [9]), so the above experimental results could indicate that the compound of the present application could be used for the prevention and/or treatment of MS, NAFLD and diabetes mellitus as well as complications thereof.

Experimental Example 4: Evaluation of Regulatory Effects of Compound on Cellar Glycolipid Metabolism Signaling Pathway and Gene Expression

[0487] Peroxisome proliferation factor activated receptor (PPAR) is an important nuclear receptor that regulates glycolipid metabolism, including three subtypes: α, β/δ and γ. Peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) is its auxiliary transcriptional activator. Acyl-CoA oxidase 1 (ACOX1) is the first rate-limiting enzyme for fatty acid β oxidation. Fatty acid binding protein 1 (FABP1) is highly expressed in liver, and can bind fatty acid, heme and other molecules to reduce their toxicity and damage. Up-regulating the expression level of these genes helps to improve the body's metabolism, and their agonists are an important class of anti-metabolic drugs. After the compound of the present application (1 μM) and the control drug gemfibrozil (1 μM) were incubated with human liver cancer cells HepG2 for 6 hours, real-time fluorescent quantitative PCR method was used to determine the relative expression of mRNA of related genes in the cells.

TABLE-US-00002 Primer sequences: PPARα Upstream: (SEQ ID NO: 1) CATTACGGAGTCCACGCGT Downstream: (SEQ ID NO: 2) ACCAGCTTGAGTCGAATCGTT PPARγ Upstream: (SEQ ID NO: 3) GTACTGTCGGTTTCAGAAATGCC Downstream: (SEQ ID NO: 4) ATCTCCGCCAACAGCTTCTCCT PGC1α Upstream: (SEQ ID NO: 5) GCTACGAGGAATATCAGCACGA Downstream: (SEQ ID NO: 6) TCACACGGCGCTCTTCAA ACOX1 Upstream: (SEQ ID NO: 7) CTGTAGGACCATTGTCTCG Downstream: (SEQ ID NO: 8) TTACACTCTGCACTCCAAAG FABP1 Upstream: (SEQ ID NO: 9) CACCCCCTTGATATCCTTCC Downstream: (SEQ ID NO: 10) TTCTCCGGCAAGTACCAACT

[0488] The company which synthesized the primers was Suzhou Hongxun Biotechnology Co., Ltd. Tranzol reagent (Tranzol total RNA extraction reagent, TransGen Biotech) was used to extract total RNA from tissues. 5× All-In-One RT MasterMix reverse transcription kit (Abcam, USA) and real-time quantitative PCR Master Mix (Aidlab Biotechnologies Co., Ltd) were used. Bio-Rad CFX Connect™ Real-Time PCR Detection System for qPCR was used, and 2.sup.−ΔΔCT method was used for data analysis. The expression level of mRNA in the normal control group was set to 1, and the relative expression level of mRNA in the administration group was calculated, so as to confirm whether the active compound affected the PPAR pathway, thereby further regulating lipid metabolism.

[0489] The test results were shown in FIG. 5. The determination results of PPARα mRNA expression were shown in FIG. 5A, in which the tested compounds 1, 2, 3, 404, 409 and 416 significantly induced PPARα mRNA expression by more than 1.5 times with significant difference, and were better than gemfibrozil. In particular, it was known in the art that gemfibrozil required a higher dose (50 to 100 μM) to significantly activate PPARα, while the above-mentioned tested compounds had a dose of only 1 μM.

[0490] The test results of PPARγ mRNA expression were shown in FIG. 5B. The tested compounds 2, 3, 309, 415 and 502 significantly induced PPARγ mRNA expression.

[0491] The test results of PGC1α mRNA expression were shown in FIG. 5C. The tested compounds 1, 2, 3, 409, 412, 415 and 502 significantly induced PGC1α mRNA expression. In contrast, gemfibrozil could not activate PGC1α expression.

[0492] The test results of ACOX1 mRNA expression were shown in FIG. 5D. The tested compounds 1, 2, 3, 109, 404, 409 and 502 significantly induced PGC1α mRNA expression. In contrast, gemfibrozil could not activate ACOX1 expression.

[0493] The test results of FABP1 mRNA expression were shown in FIG. 5E. The tested compounds 1, 2, 3, 112, 404 and 409 significantly induced FABP1 expression. In contrast, gemfibrozil could not activate FABP1 expression.

[0494] The above results indicated that the compound of the present invention could up-regulate the expression of PPARα/γ, PGC1α, ACOX1 and FABP1, and had PPARα/γ dual agonistic activity and glycolipid metabolism regulation activity that gemfibrozil did not possess, so that it was particularly suitable for regulating glycolipid metabolism, and could have better lipid-lowering activity than gemfibrozil.

[0495] In addition, the inventors also tested the effects of the compounds on the expression levels of multiple glycolipid metabolism-related genes such as MTTP, UCP1/2, Elovl3 and CD36. The results showed that the above-mentioned compounds could significantly regulate the expression of these genes, further confirming the compound of the present invention has superior activity of regulating lipid metabolism.

Experimental Example 5: Effect of Compound on Glycolipid Metabolism-Related Protein Level and Fatty Acid Oxidation Rate-Limiting Enzyme CPT1α Protein Level

[0496] Carnitine palmitoyltransferase (CPT1α) is a rate-limiting enzyme of fatty acid oxidation. When the body or tissues are lacking in energy, CPT1α catalyzes the entry of fatty acids into mitochondria for 13 oxidation, and at the same time, CPT1α is also involved in the regulation of fatty acid-induced insulin resistance and inflammation. Protein kinase B/glycogen synthase kinase 3β (AKT/GSK3β) signaling pathway and insulin receptor substrate 1 (IRS-1) are key signaling pathways that regulate glucose metabolism in response to insulin signal. Therefore, by determining the effects of compounds on the CPT1α protein level and the AKT, GSK3β and IRS-1 protein phosphorylation levels, it is possible to evaluate the regulatory effects of the compounds on glycolipid metabolism.

[0497] After human liver cancer cells HepG2 were incubated with the compound of the present application or the control drug at 1 μM for 24 hours, the CPT1α protein level and the AKT, GSK3β and IRS-1 phosphorylated protein levels in the cells were determined by Western blotting; after gray-scale scanning by using Image J15.0.1, normalization was performed by using β-tubulin protein level as internal control, and the quantitative analysis results were shown in FIG. 6. The tested compounds 1, 2, 213, 404, 409, 415 and 502 all significantly increased CPT1α protein level (FIG. 6A), the tested compounds 2, 109, 213, 404, 409 and 411 all significantly increased the phosphorylation level of GSK3β (FIG. 6B), the tested compounds 2, 3, 109, 209, 213, 309, 404, 409, 411, 412, 415, 416 and 502 all significantly increased the phosphorylation level of IRS-1 (FIG. 6C). The above results indicated that the above compounds could regulate insulin signaling and fatty acid oxidation, thereby improving the glycolipid metabolism in liver.

[0498] In addition, the inventors also tested the effects of the compounds on the phosphorylation levels of many glycolipid metabolism-related proteins such as Akt, HSL, ACC and PKA substrates. The results showed that the above-mentioned compounds could significantly regulate the phosphorylation levels of these proteins, further confirming that the compound of the present invention has superior activity of regulating lipid metabolism.

Experimental Example 6: Evaluation of the Therapeutic Effect of the Compound on Diabetic Mice

[0499] 6.1 Diabetes Mellitus Model:

[0500] Animal model: C57BL/KsJ-leprdb/leprdb diabetic (db/db) mice were widely used as animal models of type 2 diabetes mellitus, in which spontaneous mutations of leptin receptor (Leptin receptor, Lepr) caused extreme obesity, polyphagia, diabetes and polyuria. In this experiment, db/db mice (purchased from the Department of Animals, Health Science Center of Peking University) were selected.

[0501] In the experiment, 28 db/db mice were used, and the animals with blood glucose of about 7-13 mmol/L were selected. According to their blood glucose levels, they were randomly divided into a control group, a BJMU group (gemfibrozil), a BJMU-2 group and a positive control group (pioglitazone), 7 animals in each group. Intragastric administration was adopted with an administration volume of 10 ml/kg. The control group was administrated with 1% Tween 80-saline; the BJMU group was administrated with a dose of 50 mg/kg, the BJMU-2 group was administrated with a dose of 50 mg/kg, and the positive control group was administrated with pioglitazone at a dose of 6 mg/kg. The administration was performed once a day for 28 consecutive days. From the day of oral administration, the physiological changes of the animals were observed every day. Blood glucose was measured every 3 days (Roche blood glucose meter) and blood glucose difference (Δ) was calculated by the following formula: blood glucose difference (Δ)=the blood glucose of the day—the initial blood glucose (the initial blood glucose difference was zero).

[0502] For mice in each experimental group, blood was collected, serum was separated, and liver was taken for wet-weight measurement after necropsy; liver tissue was taken and fixed for pathological examination, H.E. staining and oil red O staining (Wuhan Zishan Biotechnology Co., Ltd.) were performed, and mouse liver lesions were observed under light microscope; routine examination of blood was performed by Animal Laboratory Department, Health Science Center of Peking University to measure the following indexes: white blood cell count (WBC), red blood cell count (RBC), lymphocyte count (LY), platelet (PLT) and so on; biochemical laboratory examination of blood was performed by Laboratory Medicine, Third Hospital, Peking University to measure the following indexes: triglycerides (TG), total cholesterol (T-CHO), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and so on.

[0503] The measurement results of blood glucose were shown in FIG. 7. The tested compound BJMU-2 could significantly reduce the blood glucose level of db/dbmice, and was even better than the known hypoglycemic agent pioglitazone. In contrast, gemfibrozil did not show obvious hypoglycemic activity. This result indicated that the compound of the present invention exhibited significant hypoglycemic activity.

[0504] The measurement results of blood lipid indexes were shown in the following table. The tested compound BJMU-2 had an activity of lowering triglycerides better than gemfibrozil. In particular, BJMU-2 could reduce the total cholesterol content in the blood of db/dbmice. In contrast, gemfibrozil did not show the activity of lowering total cholesterol in blood. The above results indicated that BJMU-2 had a more prominent effect of reducing blood lipids.

TABLE-US-00003 TABLE 1 Measurement results of blood lipid indexes Dose CHOL TGL AHDL ALDL Group (mg/kg) (mmol/L) (mmol/L) (mmol/L) (mmol/L) Control 0 3.44 ± 0.41 2.15 ± 0.53 1.68 ± 0.28 0.41 ± 0.05 group Pioglitazone 6 3.45 ± 0.26 2.17 ± 0.61 1.65 ± 0.29 0.38 ± 0.03 BJMU 50 3.37 ± 0.36 2.09 ± 0.95 1.64 ± 0.28 0.35 ± 0.02 BJMU-2 50 3.06 ± 0.63  1.44 ± 0.42* 1.59 ± 0.13 0.33 ± 0.09 Note: Compared with the model control group, *P < 0.05, **P < 0.01. CHOL: total cholesterol; TGL: triglycerides; AHDL: high density lipoprotein, ALDL: low density lipoprotein.

[0505] The pathological examination results of liver tissue were shown in FIGS. 8A to 8B. The results showed that the tested compound BJMU-2 could significantly reduce the fat content in the liver of model mice. In contrast, neither gemfibrozil nor pioglitazone showed the above activity. The above results indicated that BJMU-2 not only had a significant activity in reducing blood lipids, but also a significant activity in reducing liver fat.

[0506] In addition, the measurement date of mouse liver function and kidney function indexes (Table 2) showed that the tested compound would not cause liver and kidney toxicity after continuous intragastric administration at a dose of 50 mg/kg for one month. This result indicated that the compound of the present invention had good in vivo safety.

TABLE-US-00004 TABLE 2 Data of mouse liver function and kidney function indexes Dose AST ALT BUN CREA CK Group (mg/kg) (U/L) (U/L) (mmol/L) (umol/L) (U/L) Control 0 218.4 ± 48.25  226.5 ± 67.64 10.92 ± 1.3  15.9 ± 5.37  1025.4 ± 375.81 group Pioglitazone 6 212.79 ± 91.2  225.43 ± 79.31 11.4 ± 5.48 .sup. 12 ± 3.91 1482.86 ± 707.74 BJMU 50   225 ± 132.19 172.25 ± 123.sup.  9.56 ± 1.57   16 ± 10.46   1037 ± 523.17 BJMU-2 50 210.75 ± 56.97  187.75 ± 62.07 7.23 ± 1.19 10.13 ± 5.25  1790.75 ± 388.38

[0507] 6.2 Diabetes Mellitus+Non-Alcoholic Steatohepatitis (NASH) Model:

[0508] Animal model: Each db/db mouse was injected subcutaneously with 40% CCl.sub.4 solution (Beijing Tongguang Fine Chemical Co., Ltd.) at a dose of 0.72 mg/100 g for 4 consecutive weeks to obtain a diabetes mellitus+NASH model.

[0509] In the experiment, 35 of the above model mice were used, and animals with blood glucose of about 7 to 13 mmol/L were selected. According to their blood glucose levels, they were randomly divided into a blank control group, a model group, a BJMU group (gemfibrozil), a BJMU-1 group, a BJMU-2 Group and a BJMU-3 group, 7 animals in each group (the model group and each administration group were modeled according to the animal modeling method). Intragastric administration was adopted with an administration volume of 10 ml/kg. The blank control group and the model group were administrated with 1% Tween 80-saline; the BJMU group was administrated with a dose of 50 mg/kg, the BJMU-1 group was administrated with a dose of 50 mg/kg, the BJMU-2 group was administrated with a dose of 50 mg/kg, and the BJMU-3 group was administrated with a dose of 50 mg/kg. The administration was performed once a day for 28 consecutive days. From the day of oral administration, the physiological changes of the animals were observed every day. Blood glucose was measured every week, and blood glucose difference (Δ) was calculated by the following formula: blood glucose difference (Δ)=the blood glucose of the day—the initial blood glucose (the initial blood glucose difference was zero). After the administration, the animals were sacrificed, and the internal organs and epididymal fat were taken out for experiments. White epididymal fat was taken from each group of mice and weighed. According to the corresponding body weight, the weight ratio of white fat was calculated. Before the mice were sacrificed, 3 mice in each group were randomly selected and subjected to magnetic resonance imaging (MRI) (EchoMRI-700 body fat tester) so as to measure body fat content.

[0510] For mice in each experimental group, blood was collected and serum was separated, and liver was taken for wet-weight measurement after necropsy; liver tissue was taken and fixed for pathological examination, H.E. staining and oil red O staining (Wuhan Zishan Biotechnology Co., Ltd.) were performed, and mouse liver lesions were observed under light microscope; routine examination of blood was performed by Animal Laboratory Department, Health Science Center of Peking University to measure the following indexes: white blood cell count (WBC), red blood cell count (RBC), lymphocyte count (LY), platelet (PLT) and so on; biochemical laboratory examination of blood was performed by Laboratory Medicine, Third Hospital, Peking University to measure the following indexes: triglycerides (TG), total cholesterol (T-CHO), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and so on.

[0511] The measurement results of blood glucose were shown in FIG. 9. The tested compounds BJMU-1, BJMU-2 and BJMU-3 could significantly reduce the blood glucose level of the diabetes mellitus+NASH model mice, and the blood glucose level almost returned to the normal level 14 days after the administration. In contrast, gemfibrozil did not exhibit significant hypoglycemic activity. This result indicated that the compound of the present invention exhibited significant hypoglycemic activity.

[0512] The measurement results of body fat were shown in FIG. 10. The tested compounds BJMU-1, BJMU-2 and BJMU-3 could significantly reduce the body fat content of mice; in contrast, gemfibrozil did not show an activity of reducing body fat. The above results indicated that the compound of the present invention had significant activity of reducing body fat.

[0513] The measurement results of white fat weight ratio were shown in FIG. 11. The tested compounds BJMU-2 and BJMU-3 could significantly reduce the weight ratio of mouse epididymal fat, and were better than gemfibrozil. The above results further indicated that the compound of the present invention had significant activity of reducing body fat.

[0514] The measurement results of blood lipid indexes were shown in the table below. The tested compounds BJMU-1, BJMU-2 and BJMU-3 had better activity of lowering triglycerides than gemfibrozil. In particular, BJMU-2 could reduce total cholesterol content in blood of DB/DB mice; in contrast, gemfibrozil did not show an activity of lowering total cholesterol in blood. The above results indicated that the compound of the present invention had a more prominent effect of reducing blood lipids.

TABLE-US-00005 TABLE 3 Measurement results of blood lipid indexes Dose CHOL TGL AHDL ALDL Group (mg/kg) (mmol/L) (mmol/L) (mmol/L) (mmol/L) Blank 0 3.44 ± 0.51 3.05 ± 1.43 1.91 ± 0.21 0.41 ± 0.1  control Model 0 4.96 ± 1.04 2.27 ± 1.22 2.29 ± 0.45 0.7 ± 0.45 group BJMU 50 5.37 ± 0.88 1.86 ± 0.66 2.68 ± 0.31 0.7 ± 0.16 BJMU-1 50 4.85 ± 0.7  1.77 ± 0.65 2.34 ± 0.24 0.49 ± 0.06  BJMU-2 50  3.78 ± 0.45* 1.73 ± 0.41 2.15 ± 0.29 0.48 ± 0.05* BJMU-3 50 4.42 ± 1.77 1.86 ± 0.99 2.27 ± 0.84 0.52 ± 0.14  Note: Compared with the model control group, *P < 0.05, **P < 0.01. CHOL: total cholesterol; TGL: triglycerides; AHDL: high density lipoprotein, ALDL: low density lipoprotein.

[0515] The pathological examination results of liver tissues were shown in FIGS. 12A to 12B. The results showed that the tested compounds BJMU-1, BJMU-2 and BJMU-3 could significantly reduce the fat content in liver of model mice. In contrast, gemfibrozil did not exhibit the aforementioned activity. The above results indicated that the compound of the present invention not only had a significant activity in reducing blood fat, but also a significant activity in reducing body fat.

[0516] In addition, the measurement data of mouse liver function and kidney function indexes (Table 4) showed that the tested compounds would not cause liver and kidney toxicity after continuous intragastric administration at a dose of 50 mg/kg for one month. This result indicated that the compound of the present invention had good in vivo safety.

TABLE-US-00006 TABLE 4 Data of mouse liver function and kidney function indexes Dose AST ALT BUN CREA CK Group (mg/kg) (U/L) (U/L) (mmol/L) (umol/L) (U/L) Blank 0 245.11 ± 86.34  167.89 ± 114.44 10.92 ± 1.23   27 ± 10.03 1135.78 ± 690.2  control Model 0 227.75 ± 79.81 120.25 ± 27.06 12.81 ± 4.49 23.29 ± 6.58    1346 ± 650.43 group BJMU 50 235.14 ± 41.06 134.14 ± 38.71 11.96 ± 2.26 22.29 ± 3.45  1222.14 ± 392.96 BJMU-1 50 216.43 ± 60.6  114.86 ± 51.2   9.89 ± 1.31 .sup. 19 ± 1.63 1297.71 ± 814.48 BJMU-2 50 233.67 ± 47.75 115.57 ± 39.12 11.95 ± 1.81 22.5 ± 7.12 1406.33 ± 458.77 BJMU-3 50 257 ± 83 125.14 ± 51.99  9.29 ± 3.44 21.33 ± 10.52 1674.71 ± 864.05

[0517] The above results indicated that the tested compounds BJMU-1, BJMU-2 and BJMU-3 could reduce blood glucose and blood lipid levels, and could reduce body fat and liver fat content. In particular, BJMU-2 could be metabolized by the liver to produce metabolites BJMU-415 and 502; since these two compounds had activity no less or even better than that of BJMU-2 in cell-level experiments, it could be reasonably expected that BJMU-415 and 502 would have at least the above-mentioned excellent in vivo activity of BJMU-2.

[0518] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and substitutions can be made to those details according to all the teachings that have been disclosed, and these changes are all within the protection scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

REFERENCES

[0519] [1] Reddy P, Lent-Schochet D, Ramakrishnan N, McLaughlin M, Jialal I. Metabolic syndrome is an inflammatory disorder: A conspiracy between adipose tissue and phagocytes. Clin Chim Acta 2019; 496:35-44. [0520] [2] Chen Z, Yu R, Xiong Y, Du F, Zhu S. A vicious circle between insulin resistance and inflammation in nonalcoholic fatty liver disease. Lipids Health Dis 2017; 16:203. [0521] [3] Catrysse L, van Loo G. Inflammation and the Metabolic Syndrome: The Tissue-Specific Functions of NF-kappaB. Trends Cell Biol 2017; 27:417-429. [0522] [4] Esser N, Paquot N, Scheen A J. Anti-inflammatory agents to treat or prevent type 2 diabetes, metabolic syndrome and cardiovascular disease. Expert Opin Investig Drugs 2015; 24:283-307. [0523] [5] Chartoumpekis D V, Kensler T W. New player on an old field; the keap1/Nrf2 pathway as a target for treatment of type 2 diabetes and metabolic syndrome. Curr Diabetes Rev 2013; 9:137-145. [0524] [6] Chowdhry S, Nazmy M H, Meakin P J, Dinkova-Kostova A T, Walsh S V, Tsujita T, Dillon J F, et al. Loss of Nrf2 markedly exacerbates nonalcoholic steatohepatitis. Free Radic Biol Med 2010; 48:357-371. [0525] Santos J C, Valentim I B, de Araujo O R, Ataide Tda R, Goulart M O. Development of nonalcoholic hepatopathy: contributions of oxidative stress and advanced glycation end products. Int J Mol Sci 2013; 14:19846-19866. [0526] [7] Shimozono R, Asaoka Y, Yoshizawa Y, Aoki T, Noda H, Yamada M, Kaino M, et al. Nrf2 activators attenuate the progression of nonalcoholic steatohepatitis-related fibrosis in a dietary rat model. Mol Pharmacol 2013; 84:62-70. [0527] [8] Spahis S, Delvin E, Borys J M, Levy E. Oxidative Stress as a Critical Factor in Nonalcoholic Fatty Liver Disease Pathogenesis. Antioxid Redox Signal 2017; 26:519-541.