PLURIPOTENT STEM CELL AND DERIVATIVE THEREOF
20230241123 · 2023-08-03
Inventors
- Linli WANG (Guangzhou, Guangdong, CN)
- Yuehua CHEN (Guangzhou, Guangdong, CN)
- Jian MO (Guangzhou, Guangdong, CN)
- Jianguo YANG (Guangzhou, Guangdong, CN)
Cpc classification
A61K35/30
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
A61K48/0008
HUMAN NECESSITIES
A61K35/545
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/545
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
Abstract
The present invention provides a pluripotent stem cell or a derivative thereof. A first nucleic acid molecule is introduced into a genome of the pluripotent stem cell or the derivative thereof; and a second nucleic acid molecule is introduced to a 3′UTR region of an immune response-related gene in the pluripotent stem cell or the derivative thereof. The first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, and the small nucleic acid molecule can specifically bind to a transcript product of the second nucleic acid molecule to start an RNA interference program to degrade or silence mRNA of the immune response-related gene, thereby blocking the expression of the immune response-related gene, such that the cell has immunological compatibility, and thus can eliminate or reduce alloimmune rejection responses.
Claims
1. A pluripotent stem cell or a derivative thereof, wherein a first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or the derivative thereof; and a second nucleic acid molecule is introduced into a 3′UTR region of an immune response-related gene in the pluripotent stem cell or the derivative thereof; the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets a transcript of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or lncRNA of the pluripotent stem cell or the derivative thereof.
2. The pluripotent stem cell or the derivative thereof according to claim 1, wherein an inducible gene expression system is further introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating the expression of the first nucleic acid molecule.
3. The pluripotent stem cell or the derivative thereof according to claim 1, wherein an expression sequence of CD47 is further introduced into the genome of the pluripotent stem cell or the derivative thereof.
4. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the immune response-related gene includes: (1) major histocompatibility complex-related genes, including at least one selected from the group consisting of B2M and CIITA; and (2) major histocompatibility complex genes, including at least one selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB1.
5. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the small nucleic acid molecule includes short interfering nucleic acid, short interfering RNA, and double-stranded RNA.
6. The pluripotent stem cell or the derivative thereof according to claim 5, wherein the pluripotent stem cell or the derivative thereof is derived from human; and the sequence of the small nucleic acid molecule is a random sequence derived from a non-human species, which does not target any human mRNA or lncRNA.
7. The pluripotent stem cell or the derivative thereof according to claim 6, wherein the sequence of the small nucleic acid molecule is any one of: TABLE-US-00018 5′-TTGTACTACACAAAAGTACTG-3′; and 5′-TCACAACCTCCTAGAAAGAGTAGA-3′.
8. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the second nucleic acid molecule includes at least 3 repeats of a reverse complement sequence of the small nucleic acid molecule sequence.
9. The pluripotent stem cell or the derivative thereof according to claim 2, wherein the inducible gene expression system includes at least one selected from the group consisting of Tet-Off system and dimer-induced expression system.
10. The pluripotent stem cell or the derivative thereof according to claim 2, wherein introduction loci for the first nucleic acid molecule and the inducible gene expression system are genomic safe loci, preferably at least one selected from the group consisting of the AAVS1 safe locus, the eGSH safe locus, and the H11 safe locus.
11. The pluripotent stem cell or the derivative thereof according to claim 2, wherein the first nucleic acid molecule and the inducible gene expression system are introduced by means of viral vector interference, non-viral vector transfection or gene editing; the second nucleic acid molecule is introduced by means of gene editing; and the gene editing is preferably gene knock-in.
12. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the pluripotent stem cell includes an embryonic stem cell, an embryonic germ cell, an embryonic carcinoma cell, or an induced pluripotent stem cell; the derivative includes a pluripotent stem cell-derived three-germ-layer-derived organ, tissue or cell; and the pluripotent stem cell-derived three-germ-layer-derived cell includes mesenchymal stem cells, neural stem or progenitor cells, or other adult stem cells.
13. A method for cellular therapy or organ transplantation, comprising administering a therapeutically effective amount of the pluripotent stem cell or the derivative thereof according to claim 1 to a subject in need thereof.
14. A universal pluripotent stem cell bank generating by the pluripotent stem cell or the derivative thereof according to claim 1.
15. A gene drug carrier, comprising the pluripotent stem cell or the derivative thereof according to claim 1.
16. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the introduction locus for the first nucleic acid molecule is a genomic safe locus, preferably at least one selected om the group consisting of the AAVS1 safe locus, the eGSH safe locus, and the H11 safe locus.
17. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the first nucleic acid molecule is introduced by means of viral vector interference, non-viral vector transfection or gene editing; the second nucleic acid molecule is introduced by means of gene editing; and the gene editing is preferably gene knock-in.
18. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the small nucleic acid molecule is at least one selected from the group consisting of miRNA, shRNA, and shRNA-miR.
19. The pluripotent stem cell or the derivative thereof according to claim 5, wherein the small nucleic acid molecule is derived from Caenorhabditis elegans.
20. The pluripotent stem cell or the derivative thereof according to claim 8, wherein the second nucleic acid molecule includes 6-10 repeats of the reverse complement sequence of the small nucleic acid molecule sequence.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
DETAILED DESCRIPTION
[0090] In order to understand the technical content of the present disclosure more clearly, the following examples are specifically given for detailed description in conjunction with the accompanying drawings. It should be understood that these examples are only used to describe the present disclosure, rather than limiting the scope of the present disclosure. Experimental methods in which no specific conditions are indicated in the following examples are usually carried out under conventional conditions, for example, the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or in accordance with the conditions recommended by the manufacturer. Various common chemical reagents used in the examples are all commercially available products.
[0091] 1 Experimental Material
[0092] 1.1 Starting Stem Cells or Derivatives Thereof
[0093] Pluripotent stem cells or derivatives thereof were selected from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs, and EB cells, Among them:
[0094] iPSCs: pE3.1-OG-KS and pE3.1-L-Myc-hmiR302 cluster were electrotransfected into somatic cells by using our established third-generation efficient and safe episomal-iPSC induction system (6F/BM1-4C), and cultured in RM1 for 2 days, in BioCISO-BM1 with 2 μM Parnate for 2 days, in BioCISO-BM1 with 2 μM Parnate, 0.25 mM sodium butyrate, 3 μM CHIR99021 and 0.5 μM PD03254901 for 2 days. In the stem cell medium BioCISO until approximately 17 days, iPSC clones were picked, and the picked iPSC clones were purified, digested, and passaged to obtain stable iPSCs. For the specific construction method, see: Stem Cell Res Ther. 2017 Nov. 2; 8(1): 245.
[0095] hPSCs-MSCs: iPSCs were cultured in a stem cell medium (BioCISO, containing 10 μM TGFβ inhibitor SB431542) for 25 days during which digestion and passage were carried out at 80-90 confluence (2 mg/mL Dispase digestion), the cells were passaged 1:3 into a Matrigel-coated culture plate and then into an ESC-MSC medium (knockout DMEM medium, containing 10% KSR, NEAA, double antibody, glutamine, β-mercaptoethanol, 10 ng/mL bFGF and SB-431542), wherein the medium was changed every day, the passage was carried out at 80-90 confluence (1:3 passage), and the cells were cultured continuously for 20 days. For the specific construction method, see: Proc Natl Acad Sci USA. 2015; 112(2): 530-535.
[0096] NSCs: iPSCs were cultured in an induction medium (knockout DMEM medium, containing 10% KSR, TGF-β inhibitor, and BMP4 inhibitor) for 14 days, and rosette-shaped nerve cells were picked and cultured in a low-adherence culture plate, wherein the medium used was DMEM/F12 (containing 1% N2, Invitrogen) and Neurobasal medium (containing 2% B27, Invitrogen) at a ratio of 1:1 and further contained 20 ng/ml bFGF and 20 ng/ml EGF. Accutase was used for digestion and passage. For the specific construction method, see: FASEB J. 2014; 28(11): 4642-4656.
[0097] EB cells: iPSCs with a confluence of 95% were digested with BioC-PDE1 for 6 min and then scraped into a mass by a mechanical scraping passage method. Cell mass settling occurred, and the settled cell mass was transferred to a low-adherence culture plate and cultured using BioCISO-EB1 for 7 days during which the medium was changed every other day. After 7 days, the cells were transferred to a Matrigel-coated culture plate to continue adherent culture with BioCISO, and after 7 days, embryoid bodies (EBs) with a structure of inner, middle and outer germ layers could be obtained. For the specific construction method, see: Stem Cell Res Ther. 2017 Nov. 2; 8(1): 245.
[0098] The pluripotent stem cell derivatives included adult stem cells differentiated from the pluripotent stem cells, and cells or tissues of each germ layer.
[0099] 1.2 Small Nucleic Acid Molecule and the Corresponding First Nucleic Acid Molecule, and Second Nucleic Acid Molecule
[0100] The sequence of the small nucleic acid molecule was: 5′TTGTACTACAC AAAAGTACTG 3′ (SEQ ID NO. 1).
[0101] Those skilled in the art would understand that other random sequences of non-human species that do not target any human mRNA or lncRNA can all achieve the objects of the present disclosure, such as SEQ ID NO. 3.
[0102] First Nucleic Acid Molecule (i.e., the shRNA Expression Framework or the shRNA-miR Expression Framework of the Small Nucleic Acid Molecule):
[0103] (1) shRNA expression framework: The shRNA expression framework comprised, in sequence from 5′ to 3′, a small nucleic acid molecule sequence, a stem-loop sequence, a reverse complement sequence of the small nucleic acid molecule sequence, and Poly T; the two reverse complementary sequences were separated by the stem-loop sequence in the middle to form a hairpin structure, and finally Poly T was connected as an transcription terminator of RNA polymerase III; and
[0104] a promoter sequence and matched promoter regulatory elements were added to a front end of the expression framework according to expression requirements.
[0105] The specific sequence was:
TABLE-US-00004 (SEQ ID NO. 5) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGG CTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATT AGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCA GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTT GAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACTTTA CCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCC CTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAG TGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGA GAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCG GTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGA GCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTT TTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC (SEQ ID NO. 6) N.sub.1...N.sub.21TTCAAGAGA N.sub.22...N.sub.42TTTTTT
[0106] wherein:
[0107] a. N.sub.1 . . . N.sub.21 was the small nucleic acid molecule sequence, and N.sub.22 . . . N.sub.42 was the reverse complement sequence of the small nucleic acid molecule sequence;
[0108] b. if the plasmid was required to express shRNAs of multiple genes, each gene corresponded to an shRNA expression framework, and they were then seamlessly connected;
[0109] c. constitutive shRNA plasmids with different resistance genes were only different in resistance gene, and the other sequences were the same;
[0110] d. N represented the base A, T, G, or C;
[0111] e. SEQ ID NO. 5 was a promoter sequence; and
[0112] f. SEQ ID NO. 6 was a stem-loop sequence.
[0113] (2) shRNA-miR expression framework: It was obtained by replacing the target sequence in microRNA-30 or microRNA-155 with the small nucleic acid molecule sequence.
[0114] The specific sequence was as follows:
TABLE-US-00005 (SEQ ID NO. 7) GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACT TGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTA TATTGCTGTTGACAGTGAGCG (SEQ ID NO. 8) M.sub.1N.sub.1...N.sub.21TAGTGAAGCCACAGATGTA (SEQ ID NO. 9) N.sub.22...N.sub.42M.sub.2TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA ATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATT TTTACAAAGCTGAATTAAAATGGTATAAAT
[0115] wherein:
[0116] a. N.sub.1 . . . N.sub.21 was the small nucleic acid molecule sequence, and N.sub.22 . . . N.sub.42 was the reverse complement sequence of the small nucleic acid molecule sequence;
[0117] b. if the plasmid was required to express shRNA-miRs of multiple genes, each gene corresponded to an shRNA-miR expression framework, and they were then seamlessly connected;
[0118] c. constitutive shRNA-miR plasmids with different resistance genes were only different in resistance gene, and the other sequences were the same;
[0119] d. the base M represented the base A or C, and N represented the base A, T, G, or C;
[0120] e. if N1 was the base G, then M1 was the base A; otherwise, M1 was the base C; and
[0121] f. the base M1 was complementary to the base M2.
[0122] Second nucleic acid molecule (B2M-3′UTR-miRNA-locus/CIITA-3′UTR-miRNA-locus):
TABLE-US-00006 (SEQ ID NO. 2) atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGT AGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTG TAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGT GTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTG TGTAGTACAACGTA
[0123] 1.3 Immune-Related Gene
[0124] The immune-related genes selected in this example were B2M (NCBI Gene ID: 567) and CIITA (NCBI Gene ID: 4261), and a second nucleic acid sequence was inserted at the 3′UTR of these two genes.
[0125] 1.4 Genomic Safe Locus
[0126] In this example, the genomic safe locus for gene knock-in was the AAVS1 safe locus. Those skilled in the art can understand that knocking in other genomic safe loci, such as the eGSH safe locus and the H11 safe locus, can also achieve the objects of the present disclosure.
[0127] 1.5 Inducible Gene Expression System
[0128] In this example, the inducible gene expression system was selected from the tet-Off system. Those skilled in the art can understand that the use of a dimer turn-off expression system can also achieve the objects of the present disclosure.
[0129] 2 Experimental Method
[0130] 2.1 Gene Knock-In
[0131] The inducible gene expression system and the first nucleic acid molecule were knocked into the genomic safe locus of a pluripotent stem cell or a derivative thereof, and the second nucleic acid molecule (SEQ ID NO. 2) was knocked into the 3′UTR of B2M and CIITA genes.
[0132] (I) Construction of sgRNA
[0133] 1. Plasmid
[0134] For the knock-in of exogenous genes, Cas9(D10A) plasmid and sgRNA plasmid system were used. The map of Cas9(D10A) plasmid was shown in
[0135] 2. Homologous Arms
[0136] (1). The nucleotide sequences of the AAVS1 homology arms AAVS1-HR-L and AAVS1-HR-R were as shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively;
[0137] (2) the nucleotide sequences of the B2M homology arms B2M-HR-L and B2M-HR-R were as shown in SEQ ID NO. 12 and SEQ ID NO. 13, respectively; and
[0138] (3) the nucleotide sequences of the CIITA homology arms CIITA-HR-L and CIITA-HR-R were as shown in SEQ ID NO. 14 and SEQ ID NO. 15, respectively;
[0139] 3. sgRNA Sequence
TABLE-US-00007 sgRNA-AAVS1-1: (SEQ ID NO. 16) 5′-TATAAGGTGGTCCCAGCTCGGGG-3′; sgRNA-AAVS1-2: (SEQ ID NO. 17) 5′-AGGGCCGGTTAATGTGGCTCTGG-3′. sgRNA-B2M-1: (SEQ ID NO. 18) 5′-CTCCTGTTATATTCTAGAACAGG-3′; sgRNA-B2M-2: (SEQ ID NO. 19) 5′-TTTCAGCATCAATGTACCCTGGG-3′. sgRNA-CIITA-1: (SEQ ID NO. 20) 5′-GGCACTCAGAAGACACTGATGGG-3′; sgRNA-CIITA-2: (SEQ ID NO. 21) 5′-AAGGTGTCTGGTCGGAGAGCAGG-3′.
[0140] 4. Plasmid Construction Method
[0141] (1) Empty sgRNA vector was digested with the restriction endonuclease BbsI and then recovered.
[0142] (2) sgRNA primers (with vector sticky ends) were synthesized.
[0143] (3) The primers were diluted with water to 10 μM, a reaction system was prepared and boiled in boiling water for 5 min, and the product was then cooled to room temperature to obtain an annealed product.
[0144] Reaction system: upstream primer: 2 μL, downstream primer: 2 μL, and water: 12.8 μL
[0145] (4) A DNA ligation reaction kit (TaKaRa, 6022) was used to ligate the vector and the annealed product in the previous steps to obtain a sgRNA plasmid containing the gene target sequence.
[0146] (II) Gene Editing Process
[0147] 1. Single-cell cloning operating steps for AAVS1 gene knock-in
[0148] (1) Electrotransfection procedure:
[0149] Donor cell preparation: Human pluripotent stem cells
[0150] Kit: Human Stem Cell Nucleofector® Kit 1
[0151] Instrument: Electrotransfection instrument
[0152] Medium: BioCISO
[0153] Inducible plasmid: Cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neo VectoI, and AAVS1 neo Vector II
[0154] (2) The electrotransfected human pluripotent stem cells were screened in a dual-antibiotic medium containing G418 and puro.
[0155] (3) Single-cell clones were screened and cultured to obtain a single-cell clone strain.
[0156] 2. Culture Reagent for AAVS1 Gene Knock-In Single-Cell Clone Strain
[0157] (1) Medium: BioCISO+300 μg/ml G418+0.5 μg/ml puro
[0158] (It should be placed at room temperature in advance and in the dark for 30-60 minutes until it returned to room temperature. Note: BioCISO should not be preheated at 37° C. to avoid reduced biomolecular activity.)
[0159] (2) Matrigel: hESC Grade Matrigel
[0160] (Before cell passaging or resuscitation, a Matrigel working solution was added to a cell culture flask or culture dish and shaken until uniform, and it was ensured that the Matrigel completely covered the bottom of the culture flask or culture dish and that the Matrigel at anywhere could not be dried before use. In order to ensure that the cells could better adhere and survive, Matrigel should be placed in an incubator at 37° C. for a coating time, which was not less than 0.5 hours for 1:100×Matrigel and not less than 2 hours for 1:200×Matrigel.)
[0161] (3) Digestion solution: EDTA was dissolved with DPBS to a final concentration of 0.5 mM, pH 7.4
[0162] (Note: EDTA could not be diluted with water; otherwise, cells would die due to reduced osmotic pressure.)
[0163] (4) Cryopreservative fluid: 60% BioCISO+30% ESCs grade FBS+10% DMSO
[0164] 3. Routine maintenance subculture process
[0165] (1) Optimal time for passage and passage ratio
[0166] a. Optimal time for passage: When the overall cell confluence reached 80% to 90%.
[0167] b. Optimal ratio for passage: 1:4 to 1:7 passage, and the optimal confluence on the next day should be maintained at 20% to 30%.
[0168] (2) Passaging process
[0169] a. The Matrigel in the coated cell culture flask or cell culture dish was aspirated and discarded in advance, an appropriate amount of medium (BioCISO+300 μg/ml G418+0.5 μg/ml puro) was added, and the flask or dish was placed in an incubator at 37° C., 5% CO.sub.2;
[0170] b. when the cells met passage requirements, the medium supernatant was aspirated, and an appropriate amount of 0.5 mM EDTA digestion solution was added to the cell flask or cell dish;
[0171] c. the cells were put into an incubator at 37° C., 5% CO.sub.2 and incubated for 5-10 minutes (digested until most of the cells observed under a microscope were shrunk and rounded but not yet floating, then the cells were detached from the wall by gentle pipetting, and the cell suspension was aspirated into a centrifuge tube for centrifugation at 200 g for 5 min);
[0172] d. after centrifugation, the supernatant was discarded, the cells were resuspended with a medium, the cells were repeatedly gently pipetted several times until uniformly mixed, and the cells were then transferred to a Matrigel-coated flask or dish prepared in advance;
[0173] e. after the cells were transferred to the cell flask or cell dish, the flask or dish was shaken horizontally back and forth and from side to side, and after no abnormality was observed under the microscope, the cells were shaken uniform and placed in an incubator for culturing at 37° C., 5% CO.sub.2; and
[0174] f. the next day, the adherence and survival state of the cells were observed, and the medium was aspirated and replaced every day on schedule as normal.
[0175] 4. Cell Cryopreservation
[0176] (1) According to routine passaging operating steps, the cells were digested with 0.5 mM EDTA until most of the cells were shrunk and rounded but not yet floating, the cells were gently pipetted, and the cell suspension was collected and centrifuged at 200 g for 5 minutes; then the supernatant was discarded, an appropriate amount of cryopreservative fluid was added to resuspend the cells, and the cells were transferred to cryopreservation tubes (it was recommended to cryopreserve one tube for a 6-well plate confluence of 80%, and the volume of the cryopreservative fluid was 0.5 ml/tube);
[0177] (2) the cryopreservation tubes were placed in a programmed cooling box and immediately placed at −80° C. overnight (it was necessary to ensure that the temperature of the cryopreservation tubes decreased by 1° C. per minute); and
[0178] (3) the next day, the cells were immediately transferred into liquid nitrogen.
[0179] 5. Cell Resuscitation
[0180] (1) A Matrigel-coated cell flask or cell dish was prepared in advance; and before cell resuscitation, the Matrigel was aspirated, an appropriate amount of BioCISO was added to the cell flask or cell dish, and the cell flask or cell dish was incubated in an incubator at 37° C., 5% CO.sub.2;
[0181] (2) the cryopreservation tubes were quickly taken out from the liquid nitrogen, immediately placed in a water bath at 37° C. and quickly shaken to quickly thaw the cells; and upon careful observation, when ice crystals disappeared completely, shaking was stopped, and the cells were transferred to a biological safety cabinet;
[0182] (3) 10 ml DMEM/F12 (1:1) basal medium was added to a 15 ml centrifuge tube in advance and equilibrated to room temperature, 1 ml DMEM/F12 (1:1) was pipetted by a Pasteur pipette, slowly added to the cryopreservation tube, and gently mixed, and the cell suspension was transferred to the prepared 15 ml centrifuge tube containing DMEM/F12 (1:1), followed by centrifugation at 200 g for 5 min;
[0183] (4) the supernatant was carefully discarded, an appropriate amount of BioCISO was added, the cells were gently mixed until uniform and seeded in the cell flask or cell dish prepared in advance; the flask or dish was shaken horizontally back and forth and from side to side, and after no abnormality was observed under the microscope, the cells were shaken uniform and placed in an incubator for culturing at 37° C., 5% CO.sub.2; and
[0184] (5) the next day, the adherence and survival state of the cells were observed, and the medium was replaced every day on schedule as normal. If the adherence was good, BioCISO was replaced with BioCISO+300 μg/ml G418+0.5 μg/ml puro.
[0185] (III) Detection Method of Gene Knock-In
[0186] 1. Detection of Single-Cell Clone AAVS1 Gene Knock-In [0187] (1) Instructions for AAVS1 gene knock-in detection
[0188] a. Test objective: gene-knock-in-treated cells were detected by PCR to test whether the cells were homozygous. Since the two donor fragments only had differences in terms of resistance gene sequence, in order to determine whether the cells were homozygous (the two chromosomes were respectively knocked in with donor fragments of different resistance genes), it was necessary to detect whether the genome of the cells contained the donor fragments of the two resistance genes, and only cells with dual knock-in were likely to be correct homozygotes.
[0189] b. Test method: Firstly, a primer was designed inside the resistance gene of the donor plasmid, and another primer was then designed in the insertion locus of the genome (close to the recombination arm). If the donor fragments could be inserted correctly in the genome, there would be bands of interest; otherwise, no bands of interest would appear).
[0190] c. The primer sequences and PCR protocols in the test scheme were as shown in Table 1:
TABLE-US-00008 TABLE 1 Primer sequences and PCR protocols in the test scheme PCR Sequence Product Reaction No. Primer Sequence (5′.fwdarw.3′) number (bp) conditions 1 F1 CCATAGCTCAGTC SEQ ID NO. 22 2029 Annealing TGGTCTATC at 58° C., 2 R1 CTCTTCGTCCAGA SEQ ID NO. 23 extension TCATCCTGA for 2 min 3 F1 CCATAGCTCAGTC SEQ ID NO. 22 1740 10 sec, and TGGTCTATC 30 cycles 4 R2 CACACCTTGCCGA SEQ ID NO. 24 TGTCGAG
[0191] The detection method for the second nucleic acid molecule knock-in at the 3′UTR of B2M and CIITA genes was the same as the detection principle for AAVS1, and the PCR detection conditions were as follows:
TABLE-US-00009 TABLE 2 Primer sequences and PCR protocols in the test scheme (detection of knock-in at the B2M locus) PCR Primer Sequence Product Reaction No. abbreviation Sequence (5′.fwdarw.3′) number (bp) conditions 1 F2 GCACTGAACGAA SEQ ID NO. 25 1994 Annealing at CATCTCAAGAAG 58° C., 2 R1 CTCTTCGTCCAGA SEQ ID NO. 23 extension for 2 TCATCCTGA min, and 30 3 F2 GCACTGAACGAA SEQ ID NO. 25 1705 cycles CATCTCAAGAAG 4 R2 CACACCTTGCCGA SEQ ID NO. 24 TGTCGAG
TABLE-US-00010 TABLE 3 Primer sequences and PCR protocols in the test scheme (detection of knock-in at the CIITA locus) PCR Primer Sequence Product Reaction No. abbreviation Sequence (5′.fwdarw.3′) number (bp) conditions 1 F3 TGCTCCGGGTTTG SEQ ID NO. 26 1952 Annealing at TCTCAGATG 58° C., 2 R1 CTCTTCGTCCAGA SEQ ID NO. 23 extension for TCATCCTGA 2 min, and 3 F3 TGCTCCGGGTTTG SEQ ID NO. 26 1663 30 cycles TCTCAGATG 4 R2 CACACCTTGCCGA SEQ ID NO. 24 TGTCGAG
[0192] 2.2 Detection of Allogeneic Immunological Compatibility Effect of Stem Cells
[0193] 2.2.1 Preparation of Effector Cells
[0194] Blood was drawn from a volunteer to isolate T cells and NK cells. Effector cells and immunologically compatible pluripotent stem cells were derived from different people.
[0195] 1) T cell isolation: Human peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-hypaque density gradient centrifugation, and T cells were isolated using Dynabeads™ CD3 kit (Invitrogen™, Cat. No. 11151D). The cells were resuspended in RPMI1640 medium containing 10% FBS, and the cells were counted by trypan blue staining and concentrated to 1×10.sup.7 cells/mL.
[0196] 2) NK cell isolation: NK cells were sorted and isolated using MagniSort™ Human NK cell Enrichment Kit (Invitrogen™, Cat. No. 8804-6819-74). The cells were resuspended in RPMI1640 medium containing 10% FBS, and the cells were counted by trypan blue staining and concentrated to 1×10.sup.7 cells/mL.
[0197] 2.2.2 Preparation of Target Cells
[0198] Embryoid body cells prepared from PSCs were taken, digested and resuspended, and the cells were counted by trypan blue staining and prepared into a cell suspension of 1×10.sup.7 cells/mL.
[0199] 2.2.3 The .sup.51Cr Release Assay
[0200] When normal cells came into contact with T/NK cells (allogeneic), T/NK attacked the normal cells and caused cell lysis and death. However, if there was good immunological compatibility, no attack by T/NK would occur, that is, immune escape. Therefore, the detection of the amount of .sup.51Cr in the medium could reflect immunological compatibility. The less the amount of .sup.51Cr released into the detection medium, the better the immunological compatibility.
[0201] Cell-mediated cytotoxicity was quantitatively detected, wherein target cells were labeled with the radioisotope .sup.51Cr and co-incubated with effector molecules or cells, and the cytotoxic activity was determined according to the radiation pulse count (cpm) of .sup.51Cr released by target cell lysis.
[0202] 1) The target cells were labeled with 100 μCi (Ci, unit of radioactivity) Na.sup.51CrO.sub.4 at 37° C. for 120 min and shaken every 15 min; after labeling, centrifugation was further carried out 5 times with a washing solution; and finally, the cells were resuspended in a culture solution to 1×10.sup.6 cells/mL for use.
[0203] 2) The target cells and T/NK cells were added to a 96-well culture plate, wherein 100 μl of target cells (2.5×10.sup.3 cells) and 100 μl of effector cells (E/T=1:2, 1:5, or 1:10, E/T was the ratio of target cells to effector cells (T/NK)), and a natural release control well (100 μl target cells+100 μl medium) and a maximum release well (100 μl target cells+100 μl 2% SDS) were established. They were placed at 37° C., 5% CO.sub.2 for 4 h for incubation. After they were taken out, the supernatant was aspirated from each well with a pipette, then centrifuged, and 100 μl of supernatant was taken to measure the cpm value with a γ counter.
[0204] Note: Generally, the natural release rate of .sup.51Cr was required to be less than 10%.
[0205] 3) Calculation of results: The natural release rate of .sup.51Cr and the activity of T/NK cells were calculated according to formulas:
[0206] 2.2.4 CFSE Test Assay
[0207] The fluorescent dye CFSE, also known as CFDA SE (5,6-carboxyfluorescein diacetate, succinimidyl ester, hydroxyfluorescein diacetate succinimidyl ester), was a fluorescent dye that could penetrate cell membranes and could be detected by flow cytometry.
[0208] 1) A CFSE working solution (with a final concentration of 5 μmol/L CFSE) was added to the target cells, and the cells were incubated at 37° C., 5% CO.sub.2 for 10 min, and washed twice. After trypan blue staining and counting, the cells were resuspended in a medium and prepared into 1×10.sup.6 cells/mL for later use.
[0209] 2) The target cells and the effector cells were added to 5 ml flow tubes, wherein 100 μl of target cells (1×10.sup.5 ml.sup.−1) and effector cells (E/T=1:2, 1:5, or 1:10, E/T is the ratio of target cells to effector cells (T)) were added to each tube, and the flow tube in which only target cells were added was used as a control. The effector cells and the target cells in the flow tubes were gently mixed until uniform. PI was added, and they were placed at 37° C., 5% CO.sub.2 for 4 h for incubation. The percentage of CFSE.sup.+PI.sup.+ cells (dead target cells) was detected by flow cytometry.
Target cell death rate (%)=death rate of target cells stimulated with T cells (%)−natural death rate of target cells (%)
[0210] 2.2.5 Analysis of CD.sub.107a Expression in NK Cells by Flow Cytometer (FCM)
[0211] When the NK cells killed the target cells, CD.sub.107a molecules were transported to the surface of the cell membrane, and NK cells with positive CD.sub.107a molecule expression could represent NK cells with killing activity.
[0212] 1) The effector cells and the target cells were mixed at a certain ratio (E/NK=3:1, 1:1, or 1:3, E/NK was the ratio of target cells to effector cells (NK)), placed in culture wells, and incubated at 37° C., 5% CO.sub.2 for 2 h, monensin (2 μmol/L) was added for continued incubation for 3.5 h, and PE-Cy5-CD.sub.107a and FITC-CD56 antibodies were then added for incubation for 30 min. After washing 3× with PBS buffer, the cells were fixed with 200 μL of 1% paraformaldehyde for flow analysis. The effector cells were simultaneously stimulated with only PMA (2.5 μg/mL) and ionomycin (0.5 μg/mL), as a positive control.
[0213] Note: The natural expression frequency of CD.sub.107a on the surface of the NK cell membrane was very low, about 1.2% to 5.8%.
[0214] 2) Calculation of Results
NK cell cytotoxicity=CD.sub.107a positive rate upon stimulation by target cells (%) −CD.sub.107a natural expression rate (%)
[0215] 2.2.6 MTT Experiment for Detecting Cell Viability
[0216] After digestion and cell counting, the cells were blown uniform with a corresponding medium and plated into a 96-well plate in which each well was seeded with 3000 cells, with 5 duplicate wells, the wells were then supplemented with the corresponding medium to a final volume of 150 uL, the corresponding medium was changed every day, the cells were placed in an incubator at 37° C., 5% CO.sub.2 for 72 h, and the MTT value was measured.
[0217] 3 Experimental Scheme
[0218] Experimental Scheme I:
[0219] The specific experimental groupings were as shown in Table 4, and “+” indicated knock-in of the corresponding item in the genome. In the scheme:
[0220] B2M-3′UTR-miRNA-locus or CIITA-3′UTR-miRNA-locus, i.e. the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3′UTR regions of B2M and CIITA genes, respectively.
[0221] B2M/CIITA-3′UTR-shRNA was the shRNA expression framework of the small nucleic acid molecule, i.e., the first nucleic acid molecule, which specifically targeted the transcript of the second nucleic acid molecule in the 3′UTR regions of the B2M gene and CIITA gene, and the knock-in locus was the genomic safe locus AAVS1.
[0222] B2M/CIITA-3′UTR-shRNA-miR was the shRNA-miR expression framework of the small nucleic acid molecule, i.e., the first nucleic acid molecule, which targeted the transcript of the second nucleic acid molecule in the 3′UTR regions of the B2M gene and CIITA gene, and the knock-in locus was the genomic safe locus AAVS1.
[0223] CD47 represented the CD47 expression sequence, and the knock-in locus thereof was the genomic safe locus AAVS1.
TABLE-US-00011 TABLE 4 Constitutive expression experiment scheme Experimental group A1 A2 A3 A4 A5 B2M-3′UTR-miRNA-locus + + + + CIITA-3′UTR-miRNA-locus + + + + B2M/CIITA-3′UTR-shRNA + + B2M/CIITA-3′UTR-shRNA-miR + + CD47 + +
[0224] Experimental Scheme II:
[0225] The specific experimental groupings were as shown in Table 5, and “+” indicated knock-in of the corresponding item in the genome. In the scheme:
[0226] B2M-3′UTR-miRNA-locus or CIITA-3′UTR-miRNA-locus, i.e. the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3′UTR regions of B2M and CIITA genes, respectively.
[0227] B2M/CIITA-3′UTR-shRNA was the shRNA expression framework of the small nucleic acid molecule, i.e., the first nucleic acid molecule, which specifically targeted the transcript of the second nucleic acid molecule in the 3′UTR regions of the B2M gene and CIITA gene, and the knock-in locus was the genomic safe locus AAVS1.
[0228] B2M/CIITA-3′UTR-shRNA-miR was the shRNA-miR expression framework of the small nucleic acid molecule, i.e., the first nucleic acid molecule, which targeted the transcript of the second nucleic acid molecule in the 3′UTR regions of the B2M gene and CIITA gene, and the knock-in locus was the genomic safe locus AAVS1.
[0229] CD47 represented CD47 expression sequence, and the knock-in locus thereof was the genomic safe locus AAVS1.
[0230] The knock-in locus for the Tet-Off system was the genomic safe locus AAVS1, and it was used to regulate the expression of shRNA or shRNA-miR and CD47.
TABLE-US-00012 TABLE 5 Inducible expression experiment scheme Experimental group B1 B2 B3 B4 B5 B2M-3′UTR-miRNA-locus + + + + CIITA-3′UTR-miRNA-locus + + + + B2M/CIITA-3′UTR-shRNA + + B2M/CIITA-3′UTR-shRNA-miR + + CD47 + + Tet-Off system + + + +
[0231] Experimental Operation of Each Experimental Group
[0232] 1. Construction of expression plasmid
[0233] KI (Knock-in) plasmid construction method:
[0234] a. Acquisition of basic backbone of the plasmid: Primers were designed, an Amp(R)-pUC origin fragment was obtained from pUC18 (Takara, Code No. 3218) plasmid by PCR, and the product was then recovered.
[0235] b. Acquisition of recombination arms: Primers were designed, the genomic DNA of a human cell was taken as a template, AAVS1-HR-L (SEQ ID NO. 10), AAVS1-HR-R (SEQ ID NO. 11), B2M-HR-L (SEQ ID NO. 12), B2M-HR-R (SEQ ID NO. 13), CIITA-HR-L (SEQ ID NO. 14) and CIITA-HR-R (SEQ ID NO. 15) fragments were amplified, and these product were then recovered.
[0236] c. Acquisition of other plasmid elements: Primers were designed, plasmids containing the plasmid elements were directly subcloned, and a product was then recovered.
[0237] d. Plasmid assembly: The various products obtained in the previous steps were ligated into large fragments by overlap PCR, and finally, the large fragments were ligated into a circular plasmid by recombination using a recombinase (Nanjing Vazyme Biotech, C113-01).
[0238] 2. The operation of inserting the molecules of each group into the KI plasmid was as follows:
[0239] (1) Group A1: Blank control group without any treatment.
[0240] (2) Group A2: The small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA expression framework 1 of AAVS1 KI Vector(shRNA,constitutive) plasmid (
[0241] B2M-3′UTR-miRNA-locus was put into B2M KI Vector (as shown in
[0242] and CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector (as shown in
[0243] (3) Group A3: The small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA-miR expression framework 1 of AAVS1 KI Vector(shRNA-miR,constitutive) plasmid (
[0244] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0245] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0246] (4) Group A4: CD47 gene sequence was put into MCS of AAVS1 KI Vector(shRNA,constitutive) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA expression framework 1;
[0247] B2M-3′UTR-miRNA-locus was put into B2M KI Vector (as shown in
[0248] and CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector (as shown in
[0249] (5) Group A5: CD47 gene sequence was put into MCS of AAVS1 KI Vector(shRNA-miR,constitutive) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA-miR expression framework 1;
[0250] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0251] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0252] (6) Group B1: Blank control group without any treatment.
[0253] (7) Group B2: The small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA expression framework 1 of AAVS1 KI Vector(shRNA,inducible) plasmid (
[0254] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0255] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0256] (8) Group B3: The small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA-miR expression framework 1 of AAVS1 KI Vector(shRNA-miR,inducible) plasmid (
[0257] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0258] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0259] (9) Group B4: CD47 gene sequence was put into MCS of AAVS1 KI Vector(shRNA,inducible) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA expression framework 1;
[0260] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0261] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0262] (10) Group B5: CD47 gene sequence was put into MCS of AAVS1 KI Vector(shRNA-miR,inducible) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was put into shRNA-miR expression framework 1;
[0263] B2M-3′UTR-miRNA-locus was put into B2M KI Vector; and
[0264] CIITA-3′UTR-miRNA-locus was put into CIITA KI Vector.
[0265] 4. Experiment Results
[0266] 4.1 Detection of the immunological compatibility effect of engineered stem cells or derivative thereof by the .sup.51Cr release assay
[0267] According to the experimental schemes in Tables 4 and 5, hPSC-derived EBs were engineered, and the .sup.51Cr release assay was used to detect the effect of immunological compatibility between the engineered EB spheres and T cells:
[0268] 1. The EB sphere immunologically compatible cells were digested into individual cells as target cells;
[0269] 2. .sup.51Cr-labeled target cells and T cells were added to a 96-well culture plate at a ratio of 1:5 for post-reaction detection; and
[0270] 3. the cell-specific .sup.51Cr release rate of the EB sphere immunologically compatible cells was detected according to the .sup.51Cr release assay, and the results are as shown in Table 6.
TABLE-US-00013 TABLE 6 Cell-specific .sup.51Cr release rates of EB sphere immunologically compatible cells Group Mean .sup.51Cr release rate (%) Deviation (±) No Dox A1 56.85 1.73 A2 41.08 1.58 A3 40.38 1.10 A4 34.20 0.91 A5 36.13 1.35 B2 40.18 0.71 B3 39.39 1.23 B4 35.41 2.27 B5 35.31 1.74 +Dox A1 55.51 3.58 A2 40.65 1.46 A3 40.02 2.09 A4 34.50 0.20 A5 35.07 0.53 B2 56.78 2.01 B3 56.49 2.55 B4 55.31 0.62 B5 57.43 1.75
[0271] It can be seen from Table 6 that the immunological compatibility effect of the hPSC-derived EB sphere cells that we prepared was significant. In addition, after 6 μM of Dox was added to the medium to treat the cells for 48 h, the inducible expression groups (B2-B5) restored antigen-presenting ability and were presented in an immunologically non-compatible state, thus realizing the reversible regulation of the immunological compatibility of the cells.
[0272] .sup.51Cr release assay was further used to detect the effect of immunological compatibility between the engineered EB sphere immunologically compatible cells and NK cells:
[0273] 1. The EB sphere immunologically compatible cells were digested into individual cells as target cells;
[0274] 2. .sup.51Cr-labeled target cells and NK cells were added to a 96-well culture plate at a ratio of 1:5 for post-reaction detection; and
[0275] 3. the cell-specific .sup.51Cr release rate of the EB sphere immunologically compatible cells was detected according to the .sup.51Cr release assay, and the results are as shown in Table 7.
TABLE-US-00014 TABLE 7 Cell-specific .sup.51Cr release rates of EB sphere immunologically compatible cells Group Mean .sup.51Cr release rate (%) Deviation (±) No Dox A1 53.22 0.84 A2 33.38 0.53 A3 34.20 1.44 A4 31.03 0.37 A5 30.16 0.31 B2 32.17 1.34 B3 33.16 1.92 B4 30.74 2.01 B5 30.34 1.80 +Dox A1 54.05 2.49 A2 34.72 1.76 A3 34.59 0.50 A4 31.79 0.90 A5 31.83 0.72 B2 51.86 0.71 B3 54.46 2.35 B4 55.00 1.34 B5 53.60 1.68
[0276] It can be seen from Table 7 that the immunological compatibility effect of the hPSC-derived EB sphere cells that we prepared was significant. In addition, after 6 μM of Dox was added to the medium to treat the cells for 48 h, the inducible expression groups (B2-B5) restored antigen-presenting ability and were presented in an immunologically non-compatible state, thus realizing the reversible regulation of the immunological compatibility of the cells.
[0277] 4.2 Detection of the Effect of Exosomes (Secreted by EB Sphere Immunologically Compatible Cells) on Other Cells in Terms of Immune Escape Development by CFSE Assay
[0278] 1. According to the experimental schemes in Tables 4 and 5, hPSC-derived EBs were engineered, the obtained EB sphere immunologically compatible cells were cultured, and the culture supernatant was collected to extract exosomes;
[0279] 2. the exosomes were added to non-engineered EB sphere immunologically non-compatible cells and EB sphere immunologically non-compatible cells engineered with B2M&CIITA-3′UTR-miRNA-locus (engineering scheme: only B2M-3′UTR-miRNA-locus or CIITA-3′UTR-miRNA-locus, i.e. the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3′UTR regions of the B2M and CIITA genes, respectively.), and the cells were cultured for 72 h and digested into individual cells as target cells;
[0280] 3. CFSE-labeled target cells and T cells were added to a 5 ml flow tube at a ratio of 1:5 for a reaction and then detected; and
[0281] 4. the percentage of CFSE+PI+ cells (dead target cells) was detected according to CFSE test assay, and the results are shown in Table 8.
TABLE-US-00015 TABLE 8 CFSE test results Mean death rate of target cell Deviation Group (%) (±) Non-engineered No Dox N 60.76 2.26 EB sphere A2 58.47 2.60 immunologically A3 61.29 2.85 non-compatible A4 59.66 2.59 cells A5 59.92 0.82 B2 58.74 0.90 B3 61.13 2.81 B4 62.26 1.97 B5 61.65 1.39 +Dox N 60.04 0.42 A2 60.25 2.79 A3 60.31 2.16 A4 61.34 2.05 A5 60.33 1.08 B2 59.84 1.69 B3 62.31 1.78 B4 62.26 1.45 B5 60.33 1.50 EB sphere No Dox N 62.91 4.37 immunologically A2 33.90 1.19 non-compatible A3 33.51 0.54 cells A4 35.07 1.39 engineered with A5 34.88 1.02 B2M&CIITA- B2 33.88 0.86 3′UTR- B3 33.79 1.00 B4 34.01 0.36 B5 34.01 1.00 +Dox N 62.21 4.38 A2 34.93 0.77 A3 34.28 1.14 A4 34.56 1.36 A5 34.56 1.09 B2 62.66 3.63 B3 60.82 2.11 B4 62.93 0.93 B5 63.15 0.38
[0282] It can be seen from Table 8 that when B2M/CIITA-3′UTR-shRNA and B2M/CIITA-3′UTR-shRNA-miR (produced by the cells) reached recipient cells via the exosomes, they only acted on the cells engineered by B2M&CIITA-3′UTR-miRNA-locus knock-in to produce immunological compatibility and did not cause other non-donor cells to produce immunological compatibility effects, that is, the immunological compatibility effect produced by the cells could only act on the donor cells.
[0283] 4.3 Analysis of CD.sub.107a Expression in NK Cells by Flow Cytometer (FCM) to Detect the Effect of Exosomes (Secreted by EB Sphere Immunologically Compatible Cells) on Other Cells in Terms of Immune Escape Development
[0284] 1. According to the experimental schemes in Tables 4 and 5, hPSC-derived EBs were engineered, the obtained EB sphere immunologically compatible cells were cultured, and the culture supernatant was collected to extract exosomes;
[0285] 2. the exosomes were added to non-engineered EB sphere immunologically non-compatible cells and EB sphere immunologically non-compatible cells engineered with B2M&CIITA-3′UTR-miRNA-locus (engineering scheme: only B2M-3′UTR-miRNA-locus or CIITA-3′UTR-miRNA-locus, i.e. the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3′UTR regions of the B2M and CIITA genes, respectively.), and the cells were cultured for 72 h and digested into individual cells as target cells;
[0286] 3. the target cells and NK cells were added to a 5 ml flow tube at a ratio of 1:1 for a reaction and then detected; and
[0287] 4. the cytotoxicity of the NK cells was detected according to the expression of CD.sub.107a in the NK cells, and the results are shown in Table 9.
TABLE-US-00016 TABLE 9 Detection results of CD.sub.107a expression in NK cells Mean cytotoxicity Group of NK Deviation cell(%) (±) Non-engineered No Dox N 55.28 1.04 EB sphere A2 54.12 3.62 immunologically A3 55.88 4.61 non-compatible A4 54.75 1.30 cells A5 54.37 0.27 B2 54.31 4.46 B3 56.42 2.42 B4 54.78 1.34 B5 56.87 0.87 +Dox N 55.66 2.81 A2 54.78 4.36 A3 52.10 1.88 A4 56.96 3.00 A5 55.06 1.41 B2 54.90 0.86 B3 55.77 0.65 B4 56.66 0.80 B5 54.65 1.08 EB sphere No Dox N 56.43 3.12 immunologically A2 30.50 0.71 non-compatible A3 30.64 0.81 cells A4 30.15 0.92 engineered with A5 30.59 1.20 B2M&CIITA- B2 29.77 0.46 3′UTR- B3 30.64 1.24 miRNA-locus B4 30.35 0.81 B5 30.60 1.08 +Dox N 54.91 4.10 A2 30.52 1.23 A3 30.57 1.03 A4 30.40 1.30 A5 31.46 0.45 B2 55.90 1.77 B3 56.24 3.58 B4 56.94 0.73 B5 57.83 3.20
[0288] It can be seen from Table 9 that when B2M/CIITA-3′UTR-shRNA and B2M/CIITA-3′UTR-shRNA-miR produced by the cells reached recipient cells via the exosomes, they only acted on the cells engineered by B2M&CIITA-3′UTR-miRNA-locus knock-in to produce immunological compatibility and did not cause other non-donor cells to produce immunological compatibility effects, that is, the immunological compatibility effect produced by the cells could only act on the donor cells.
[0289] 4.4 Immunological Compatibility Effects of Different Pluripotent Stem Cells or Derivatives Thereof
[0290] hPSCs, hPSCs-MSCs, NSCs, and EB cells were respectively engineered according to the experimental scheme of Group B4 in Table 5. These engineered cells were respectively digested into individual cells as target cells, and the .sup.51Cr release assay was used to detect the immunological compatibility effect of the target cells:
[0291] 1. .sup.51Cr-labeled target cells and T cells were added to a 96-well culture plate at a ratio of 1:5 for post-reaction detection; and
[0292] 2. the cell-specific .sup.51Cr release rate of the target cells was detected according to the .sup.51Cr release assay, and the results are as shown in Table 10.
TABLE-US-00017 TABLE 10 .sup.51Cr release rates of hPSC-MSC, NSC and EB immunologically compatible cells Group Mean .sup.51Cr release rate (%) Deviation (±) hPSCs 1 52.99 1.55 2 30.10 0.57 3 53.48 0.69 MSCs 1 50.54 0.73 2 28.36 0.69 3 49.33 0.63 NSCs 1 57.24 0.40 2 31.10 1.01 3 57.22 0.87 EBs 1 59.87 0.94 2 30.36 0.62 3 58.34 0.55
[0293] Note: Group 1 was a control group (non-engineered cell group); Group 2 was a constructed immunologically compatible cell group (scheme B4); and Group 3 was an immunologically compatible cell group treated with an inducer (Dox).
[0294] It can be seen from Table 10 that the immunological compatibility effects of the hPSCs and hPSC-derived derivatives (hPSCs-MSCs, NSCs, and EBs) that we prepared were significant, and after being treated with the inducer (Dox), these cells could all restore antigen-presenting ability and achieve reversibility of immunological compatibility.