METHOD FOR DETERMINING PROGNOSIS OF CANCER
20220120753 · 2022-04-21
Assignee
Inventors
Cpc classification
G01N33/57484
PHYSICS
A61K31/167
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61K31/138
HUMAN NECESSITIES
A61K31/4535
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61K31/085
HUMAN NECESSITIES
International classification
Abstract
The present invention is intended to provide a method for determining the prognosis of a hormone receptor-positive cancer (for example, an ERα-positive breast cancer, an ERα-positive endometrial cancer, etc.) or a method for assisting the determination of the prognosis, and a method for evaluating the sensitivity of the cancer to antihormone therapy or a method for assisting the evaluation of the sensitivity of the cancer to antihormone therapy. Specifically, the present invention relates to a method for determining the prognosis of a hormone receptor-positive cancer, or a method for assisting the determination of the prognosis, which comprises the following steps (a) and (b): (a) a step of detecting Fbxo22-positive cancer cells in a sample derived from the cancer tissues; and (b) a step of calculating the percentage of the Fbxo22-positive cancer cells to the cells present in the sample.
Claims
1. A method for evaluating the prognosis of a hormone receptor-positive cancer, or assisting the evaluating thereof, the method comprising the following steps (a) and (b): (a) a step of detecting Fbxo22-positive cancer cells in a sample derived from cancer tissues; and (b) a step of calculating the percentage of the Fbxo22-positive cancer cells to cancer cells present in the sample.
2. The method according to claim 1, wherein the cancer is evaluated to have a poor prognosis, when the percentage of the Fbxo22-positive cancer cells is less than 10%.
3. The method according to claim 1, wherein the Fbxo22-positive cancer cells are detected by an immunohistochemical staining method.
4. The method according to claim 3, the Fbxo22-positive cancer cells are evaluated based on the stainability of the cells by an anti-Fbxo22 antibody.
5. The method according to claim 4, wherein the cells are evaluated to be Fbxo22-positive cancer cells, when the stainability is a moderate level or higher.
6. The method according to claim 1, wherein the hormone receptor-positive cancer is either an ERα (estrogen receptor α)-positive cancer or an AR (androgen receptor)-positive cancer.
7. The method according to claim 6, wherein the ERα-positive cancer is an ERα-positive breast cancer or an ERα-positive endometrial cancer.
8. The method according to claim 6, wherein the AR-positive cancer is an AR-positive prostate cancer.
9. (canceled)
10. The method according to claim 16, wherein the hormone receptor-positive cancer is either an ERα-positive cancer or an AR-positive cancer.
11. The method according to claim 10, wherein the ERα-positive cancer is an ERα-positive breast cancer or an ERα-positive endometrial cancer.
12. The method according to claim 11, wherein the anti-hormonal agent is SERM (selective estrogen receptor modulator).
13. The method according to claim 10, wherein the AR-positive cancer is an AR-positive prostate cancer.
14. The method according to claim 13, wherein the anti-hormonal agent is SARM (selective androgen receptor modulator).
15. A kit for evaluating the prognosis of a hormone receptor-positive cancer, or for evaluating the therapeutic effects of an anti-hormonal agent on the cancer, wherein the kit comprises an element for detecting the expression level of Fbxo22.
16. A method of treatment of a hormone receptor-positive cancer, comprising: administering a therapeutically-effective amount of an anti-hormonal agent to a subject in need thereof, Fbxo22-positive cancer cells having been detected in a sample derived from cancer tissue from the subject, the percentage of the Fbxo-22-positive cancer cells to cancer cells having been calculated to be 10% or more.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
DESCRIPTION OF EMBODIMENTS
[0053] The present invention relates to: a method for determining the prognosis of a cancer (or for predicting the prognosis of a cancer), or a method for assisting the determination of the prognosis, in which the expression level of Fbxo22 in hormone receptor-positive cancer cell tissues is used as an indicator; and a method for evaluating the sensitivity of the cancer to antihormone therapy or the therapeutic effects of an anti-hormonal agent on the cancer, based on the results obtained by determining the prognosis (namely, the results obtained by measuring the expression level of Fbxo22 in the cancer tissues), or a supplemental evaluation method.
[0054] Specifically, a first embodiment of the present invention relates to a method for determining the prognosis of a hormone receptor-positive cancer, or a method for assisting the determination of the prognosis, which comprises the following steps (a) and (b):
[0055] (a) a step of detecting Fbxo22-positive cancer cells in a sample derived from the cancer tissues; and
[0056] (b) a step of calculating the percentage of the Fbxo22-positive cancer cells to cancer cells present in the sample.
[0057] In the above-described determination method, when the percentage of the Fbxo22-positive cancer cells calculated in the step (b) is less than a predetermined percentage, the prognosis of the hormone receptor-positive cancer is determined to be poor. Besides, since the above-described steps (a) and (b) can also be carried out by professionals other than doctors, these steps are also constituent elements of a method for assisting the determination of the prognosis, which is for use in providing information necessary for the determination of prognosis by doctors.
[0058] Herein, the term “prognosis” has the same meanings as those commonly used in the medical field, and thus, is not particularly limited. For example, the prognosis means a point of view regarding a predictable medical condition (health condition) or a future state of disease and/or wound. In addition, the term “poor prognosis” means, for example, a reduction in the survival rate, an increased risk of recurrence, and/or the possible metastasis of a tumor to another site.
[0059] The “hormone receptor-positive cancer” of the first embodiment of the present invention is a cancer expressing a hormone receptor, and examples of the hormone receptor-positive cancer may include: ERα (estrogen receptor α)-positive cancers such as ERα-positive breast cancer and ERα-positive endometrial cancer; and AR (androgen receptor)-positive cancers such as AR-positive prostate cancer. It has been reported that KDM4B plays an important role also in androgen signaling (Coffey et al., Nucleic Acids Res. 41: 4433-4446, 2013). Accordingly, it is considered that the method for determining prognosis (or the method for assisting the determination) of the present invention can also be utilized in an antihormone therapy using SARM (selective androgen receptor modulator) for an AR-positive prostate cancer, as well as an ERα-positive breast cancer.
[0060] As mentioned above, Fbxo22 is an F-box protein consisting of three functional domains (F-box, FIST-N, and FIST-C), which forms a complex with SCF and functions as ubiquitin ligase. In the present description, when the term “Fbxo22” is used, it means an Fbxo22 protein. Information such as the amino acid sequence of Fbxo22 (GenBank no.: AAH20204.2, SEQ ID NO: 6) and a nucleic acid sequence encoding this protein (GenBank no.: BCO20204.1, SEQ ID NO: 7) has been disclosed in already published database and the like, a person skilled in the art could readily obtain the information.
[0061] The first embodiment of the present invention includes a step of detecting Fbxo22 in cancer tissues (cancer cells). In this case, a means for collecting a sample comprising cancer tissues from a target patient whose prognosis is to be determined can be carried out any methods easily selected by a person skilled in the art, such as, for example, a needle biopsy of obtaining a cell sample using a puncture needle, or an incision biopsy of obtaining an affected tissue section by surgical incision.
[0062] Fbxo22-expressing cells can be detected in a sample comprising cancer tissues (cancer cells) by a method that can be easily selected by a person skilled in the art. For example, when Fbxo22 expressed in cancer cells comprised in a sample is detected and the expression level thereof is then examined according to an immunohistochemical method, a suitable tissue specimen or cytologic specimen may be produced, and studies may be then conducted. As a method of producing a tissue specimen or a cell specimen, any known methods may be applied. For example, collected tissues and the like may be fixed with formalin, etc., may be then embedded in paraffin to produce a section, which may be subjected to immunohistochemical staining, so that the expression level of Fbxo22 may be examined. Alternatively, one of cytologic methods, Liquid Based Cytology (LBC) may be applied to examine the expression level of Fbxo22. According to the LBC method, a collected cytologic specimen (tumor cell sample) is stirred and/or dispersed in a dispersed solution (preservative solution), and then, the cells are recovered and are thinly transcribed and smeared on a slide glass, so that the cells are immobilized, and thereafter, antibody staining or the like is carried out to examine the amount of the stained Fbxo22.
[0063] In order to detect Fbxo22 expressed in the collected tissues or cells according to an immunohistochemical method, an antibody reacting against Fbxo22 (anti-Fbxo22 antibody) can be used. As such an anti-Fbxo22 antibody, either an antibody produced by a person who carries out the present invention, or a commercially available antibody (for example, Gene Tex[N3C3], Sigma[FF-7], etc.) can be used. Moreover, the anti-Fbxo22 antibody may be either a monoclonal antibody or a polyclonal antibody. Furthermore, the anti-Fbxo22 antibody does not need to be an antibody having a complete body, but it may be an antibody fragment comprising a CDR region, etc., or a genetically engineered antibody. Such an antibody fragment is not particularly limited, as long as it can bind to Fbxo22 expressed in cells and can be used in immunohistochemical staining. Examples of the antibody fragment may include Fab, Fab′, F(ab′)2, Fv (a variable fragment of antibody), a single chain antibody (a heavy chain, a light chain, a heavy chain variable region, a light chain variable region, etc.), scFv, diabody (an scFv dimer), dsFv (a disulfide-stabilized variable region), and a peptide comprising CDR at least as a portion thereof, all of which are peptide fragments comprising a partial region of the anti-Fbxo22 antibody.
[0064] When a tissue or cell sample, etc. collected from a patient is immunostained with an anti-Fbxo22 antibody, such immunostaining can be carried out: by allowing a suitable label to bind to the anti-Fbxo22 antibody, or to a secondary antibody that is to be bound to the anti-Fbxo22 antibody, if the anti-Fbxo22 antibody is used as a primary antibody; and then by visualizing the label. For example, when peroxidase is used in labeling, diaminobenzidine (DAB), aminomethylcarbazole (ACE) or the like is used as a chromogenic substrate, whereas when alkaline phosphatase is used in labeling, 5-bromo-4-chloro-3-indoxyl phosphate/nitroblue tetrazolium chloride (BCIP/NBT) or the like is used as a chromogenic substrate, so that the staining can be carried out.
[0065] Next, when the presence or absence of Fbxo22 expression in cells is evaluated according to an immunohistochemical method, the evaluation method is not particularly limited. For example, the evaluation can be carried out as follows. Specifically, a tissue or cell specimen that has been stained at a low magnification is observed under a microscope, a region having the highest staining intensity is selected. Subsequently, the selected region is observed under a high-power field, and 100 cells are then selected as observation targets. The staining intensity of the nucleus of each of the thus selected 100 cells is classified, for example, into the following 4 classifications.
No staining: Cells whose nuclei are not stained or whose nuclei are slightly stained at the same level as the background.
Low degree: Cells that are not distinguished from non-stained cells when they are observed at a low magnification, but when they are observed at a high magnification, the staining of the nuclei thereof can be slightly confirmed.
Moderate degree: Cells, in which the staining of the nuclei thereof can be confirmed at a low magnification, and the staining of the nuclei thereof can be completely confirmed at a high magnification.
High degree: Cells, in which the staining of the nuclei thereof can be completely confirmed at a low magnification.
[0066] The selected 100 cells, in which the staining intensity of the nuclei thereof is at a moderate level or high, are determined to be “Fbxo22-positive cells,” and the percentage thereof is calculated. Although the percentage is somewhat fluctuated depending on the detection method, when the percentage is less than 30%, less than 20%, less than 10%, preferably less than 5%, or more preferably less than 1%, the stainability by the anti-Fbxo22 antibody is determined to be “negative.” In addition, it can be determined that the prognosis of a cancer, from which the “negative” sample is derived, is highly likely to be poor. Besides, the percentage of the “Fbxo22-positive cells” in the case of determining to be “negative” is desirably set, such that the negative cases (cases determined to be “negative”) can be approximately 30% of all cases.
[0067] Moreover, the stainable state of the collected sample may be photographed by a camera or the like, so that an image of the stained cells may be obtained. Thereafter, the image may be subjected to electronic data processing, and may be analyzed. Otherwise, the staining intensity obtained from the image may be quantified, and may be converted to a numerical form, so that the above-described 4 stages of staining levels may be evaluated. For example, a high magnification field image (from 200- to 400-fold) of a stained main cancer cell population is photographed through a microscope, and the colors of Fbxo22 staining in the photographed image are divided classified into RGB colors, namely, red, green and blue according to a bioimaging analysis system, etc. The stainabilities of the colors are each indicated with hue and binarized. The stained positive area on the photographed image is obtained by subtraction of a negative area that is non-specifically stained with a negative antibody (control antibody), and the percentage of the positive area may be defined to be the percentage of the “Fbxo22-positive cells.”
[0068] Alternatively, according to, what is called, a hybridization method, the mRNA of Fbxo22 expressed in cancer cells in a sample may be detected, and the expression status of Fbxo22 may be monitored. The available hybridization method may be, for example, an in situ hybridization method. A labeled probe complementary to the mRNA of Fbxo22, such as, for example, a radiolabeled probe, a digoxigenin (DIG) probe, a fluorescent labeled (FITC, RITC, etc.) probe, or the like is used to a tissue section or a cell specimen obtained from cancer tissues serving as targets of prognosis determination, so that the mRNA level of Fbxo22 in the sample section or specimen can be detected. For evaluation of the mRNA level of Fbxo22 in the sample, signals obtained from the labeled probe are observed under a microscope, the observed cells are then classified into 4 stages, as described above, based on signal strength from the label. Thereafter, the percentage of the cells, in which the signal strength is at a moderate level or higher, is calculated, and it can be used as an indicator for determining prognosis or assisting the determination of prognosis.
[0069] What is more, in addition to the immunohistochemical method, as a method for detecting the expression level of Fbxo22 in tumor cells in a sample, a quantitative RT-PCR (real time PCR) method may be applied to detect the expression level of Fbxo22 mRNA in the sample.
[0070] Information regarding the thus obtained percentage of Fbxo22-positive cells in a test target sample can be used as a material for determining the prognosis of a cancer, from which the test target sample is derived.
[0071] The results obtained by the method for determining prognosis or the method for assisting the determination according to the first embodiment can be used as a base for the determination of the sensitivity of the cancer to an antihormone therapy. That is to say, the case where a cancer is determined to have a poor prognosis or to be highly likely to have a poor prognosis by the method for determining prognosis or the method for assisting the determination of the present invention is a case where Fbxo22 is not expressed or is expressed in an extremely small amount in the cancer cells. In such a case, if an antihormone therapy (for example, the treatment of an ERα-positive breast cancer with SERM (selective estrogen receptor modulator) or the treatment of an AR-positive prostate cancer with SARM (selective androgen receptor modulator)) is performed on the cancer, it can be evaluated that no therapeutic effects are obtained, or that a recurrence risk is rather increased (see Examples).
[0072] In view of the foregoing, a second embodiment of the present invention relates to a method for evaluating the therapeutic effects of an anti-hormonal agent on a hormone receptor-positive cancer based on the results obtained by the method for determining prognosis or the method for assisting the determination of prognosis according to the first embodiment of the present invention, or a method for supplementally evaluating the therapeutic effects.
[0073] Examples of the anti-hormonal agent used in the embodiment of the present invention may include: SERM, when the hormone receptor-positive cancer is an ERα-positive cancer such as an ERα-positive breast cancer or an ERα-positive endometrial cancer; and SARM, when the hormone receptor-positive cancer is an AR-positive cancer.
[0074] Herein, SERM and SARM mean a selective estrogen receptor modulator and a selective androgen receptor modulator, respectively. SERM and SARM are generic names of compounds exhibiting an agonistic action or an antagonistic action in organs or tissues.
[0075] Examples of the SERM used in the second embodiment may include tamoxifen, toremifene, lasofoxifene, arzoxifene, ospemifene, raloxifene, and derivatives thereof. Examples of the SARM may include andarine, ostarine, and derivatives thereof.
[0076] A third embodiment of the present invention relates to a kit for determining the prognosis of hormone receptor-positive cancers such as an ERα-positive breast cancer, an ERα endometrial cancer and an AR-positive prostate cancer, or for assisting the determination of the prognosis; or for evaluating the therapeutic effects of an anti-hormonal agent such as SERM or SARM against these cancers, or for supplementally evaluating the therapeutic effects. As mentioned above, the first and second embodiments of the present invention provide, respectively, a method for determining the prognosis of a hormone receptor-positive cancer, or for assisting the determination of the prognosis; and a method for evaluating the therapeutic effects of an anti-hormonal agent such as SERM or SARM on the hormone receptor-positive cancer, wherein the therapeutic effects are obtained when the cancer is treated with the anti-hormonal agent, or for supplementally evaluating the therapeutic effects, in each of which the expression level of Fbxo22 in the hormone receptor-positive cancer is used as an indicator. Accordingly, elements for measuring the expression level of Fbxo22 in cancer cells in a sample, such as, for example, an anti-Fbxo22 antibody, and a probe, a primer or the like used to measure the expression level of Fbxo22 mRNA, have the intended use for determining the prognosis of a hormone receptor-positive cancer and for evaluating the therapeutic effects of an anti-hormonal agent on the cancer. This intended use is disclosed for the first time in the present application. The kit of the third embodiment of the present invention comprises, as essential constituent elements, an anti-Fbxo22 antibody, and a probe, a primer, and the like used to measure the expression level of Fbxo22 mRNA. In addition to these essential constituent elements, the kit of the third embodiment of the present invention may further comprise auxiliary constituent elements such as, for example, a fixing agent necessary for immunostaining tissues or cells serving as diagnostic targets, such as formalin, and a chromogenic substrate, a buffer and the like necessary for performing immunohistochemical staining or quantitative RT-PCR.
[0077] When an English translation of the present description includes singular terms with the articles “a,” “an,” and “the,” these terms include not only single items but also multiple items, unless otherwise clearly specified from the context.
[0078] Hereinafter, the present invention will be further described in the following examples. However, these examples are only illustrative examples of the embodiments of the present invention, and thus, are not intended to limit the scope of the present invention.
EXAMPLES
1. Methods
[0079] 1-1. Antibodies and shRNAs
[0080] Information regarding the shRNAs and antibodies used in the present Examples are shown in the following Table 1 and Table 2, respectively.
TABLE-US-00001 TABLE 1 Target gene Sequence Fbxo22 GGAATTGTAGTGACTCCAATG (SEQ ID NO: 2) KDM4B GGAAGGACATGGTCAAGAT (SEQ ID NO: 3) Luciferase CGTACGCGGAATACTTCGA (SEQ ID NO: 4)
TABLE-US-00002 TABLE 2 Animal Antibody species Source Anti-alpha-beta-Actin Mouse Neomarkers, Fremont, CA (DMIA + BMIB) Anti-beta-Actin(6276) Mouse Abcam, Cambridge, United Kingdom Anti-EGFP (0153-3) Rat MBL, Nagoya, Japan Anti-ERalpha (HC-20) Rabbit Santa Cruz Biotechnologies, Santa Cruz, CA Anti-ERalpha (H-184) Rabbit Santa Cruz Biotechnologies, Santa Cruz, CA Anti-Fbxo22 (N3C3) Rabbit GeneTex, Irvine, CA Anti-Fbxo22 (FF-7) Mouse Santa Cruz Biotechnologies, Santa Cruz, CA Anti-FLAG (M2) Mouse Sigma, St. Louis, MD Anti-HA (3F10) Rat Roche, Basel, Switzerland Anti-HA (12CA5) Mouse Boehringer, Mannheim, Germany Anti-KDM4A Mouse UC Davis/NIH NeuroMab (N154/32) Facility, Davis, CA Anti-KDM4B (D7E6) Rabbit Cell Signaling Technology, Boston, MA Anti-KDM4C (27532) Rabbit Abcam, Cambridge, United Kingdom Anti-KDM4D (63199) Rabbit Abcam, Cambridge, United Kingdom Anti-LC3 (2775) Rabbit Cell Signaling Technology, Boston, MA Anti-Myc (N262) Rabbit Santa Cruz Biotechnologies, Santa Cruz, CA Anti-Myc (17355) Mouse Abcam, Cambridge, United Kingdom Anti-NcoR (5948) Rabbit Cell Signaling Technology, Boston, MA Anti-SRC3 (5E11) Rabbit Cell Signaling Technology, Boston, MA Anti-StrepII Rabbit Abnova, Walnut, CA (PAB16603) Anti-TFEB (4240) Rabbit Cell Signaling Technology, Boston, MA
1-2. Cell Culture
[0081] Cell culture and treatments with various drugs were carried out in accordance with the method described in Johmura et al., Molecular Cell 55: 73-84, 2014.
[0082] MCF-7 cells, T47D cells, ZR75-1 cells, U2OS cells, U2OS-LacO-I-SceI-TetO (Burgess et al., Cell reports. 9: 1703-17, 2014), or 293T cells were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (FBS).
[0083] Estradiol (E2) (Sigma-Aldrich), cycloheximide (Sigma-Aldrich), 4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich), Fulvestrant (Sigma-Aldrich), Toremifene (Sigma-Aldrich), and MG132 (Sigma-Aldrich) were used in concentrations of 10 nM, 50 μg/ml, 100 nM, 10 μg/ml, 100 nM, and 100 nM, respectively.
[0084] To create an E2-depleted condition, the following operations were carried out. The cells were washed with PBS three times, and were then cultured in phenol red-non-added DMEM (supplemented with 5% charcoal-stripped FBS) for 72 hours.
1-3. Colony Formation Assay
[0085] The cells (5×10.sup.2) were seeded on a 6-well plate, and were then cultured for 2 weeks. Thereafter, colonies were immobilized with methanol/acetic acid (1:1) for 15 minutes, and were then stained in 20% methanol/PBS containing 0.4% trypan blue (Sigma) for 15 minutes, followed by counting.
1-4. Construction of Plasmid
[0086] A lentivirus-based shRNA construct and a Tet-on-induced lentivirus construct were produced according to the method described in Johmura et al., Molecular Cell 55: 73-84, 2014.
[0087] In order to prepare a lentivirus-based shRNA construct, 19-21 bp shRNA-coding fragments having a loop sequence (SEQ ID NO: 1: 5′-ACGTGTGCTGTCCGT-3′) (Table 1: Fbxo22 (SEQ ID NO: 2), KDM4B (SEQ ID NO: 3), and Luciferase (SEQ ID NO: 4)) were inserted into pENTR4-H1 cleaved with AgeI/EcoRI. Subsequently, in order to insert HltetOxl-shRNA into a lentiviral vector, the obtained pENTR4-H1-shRNA vector was mixed with a CS-RfA-ETBsd vector or a CS-RfA-ETPuro vector, and the mixture was then reacted using Gateway LR clonase (Invitrogen).
[0088] In order to construct a Tet-on induced lentivirus construct, a pENTR-1A vector (Invitrogen) comprising the sequence of Flag, HA, FLAG-HA or EGFP was cleaved with BamHI/NotI. Thereafter, a BamHI/NotI fragment comprising the cDNA of wild-type human/mouse Fbxo22 or each variant thereof, or the cDNA of wild-type human KDM4B was amplified by PCR, and the resultant was then inserted into the above-described BamHI/NotI cleaved site. The obtained plasmid was mixed with a CS-IV-TRE-RfA-UbC-Puro vector or a CS-IV-TRE-RfA-UbC-Hygro vector, and the mixture was then reacted using Gateway LR clonase (Invitrogen), so as to prepare a lentivirus plasmid.
[0089] pcDNA3-(HA-Ub)x6 comprising, in tandem, six HA-tagged ubiquitin-coding sequences was produced by the method described in Nishikawa et al., The Journal of biological chemistry 279: 3916-3924, 2004. pcDNA3-St2-KDM4B was produced using KDM4B cDNA sub-cloned into pcDNA3 retaining the following oligonucleotide corresponding to a Strep II epitope:
TABLE-US-00003 (SEQ ID NO: 5) TGGAGCCATCCTCAGTTCGAGAAAGGTGGCGGTTCTGGCGGAGGGTCGGGC GGCTCCGCCTGGAGTCACCCTCAGTTTGAGAAA-3′.
1-5. Preparation of Virus and Infection
[0090] Preparation of lentivirus and infection of the cells with the prepared virus were carried out according to the method described in Johmura et al., Molecular Cell 55: 73-84, 2014. Lentiviruses expressing shRNA or various types of genes were prepared by being co-transfected into 293T cells according to a calcium phosphate co-precipitation method, using pCMV-VSV-G-RSV-RevB, pCAG-HIVgp, and CS-RfA-ETBsd, CS-RfA-ETPuro, CS-IV-TRE-RfA-UbC-Puro, CS-IV-TRE-RfA-UbC-Hygro or CSII-CMV-MCS. The cells infected with the lentivirus were treated with 10 μg/ml blasticidin (Invitrogen) and/or 2 μg/ml puromycin (Sigma-Aldrich) for 2 or 3 days. doxycycline (Sigma-Aldrich) was added to the resulting cells to a concentration of 1 μg/ml, so as to induce the expression of each shRNA or each gene.
1-6. Immunoprecipitation and Immunoblotting
[0091] Immunoprecipitation and immunoblotting were carried out according to the method described in Johmura et al., Molecular Cell 55: 73-84, 2014. The cells were dissolved in a TBSN buffer (20 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.5% NP-40, 5 mM EGTA, 1.5 mM EDTA, and 0.5 mM Na.sub.3VO.sub.4). The obtained cell lysate was centrifuged at 4° C. at 15,000×g for 20 minutes, and was then used in immunoprecipitation using an antibody.
[0092] Regarding immunoprecipitation of ERα and KDM4B, a nuclear extract was prepared according to the method described in Hirokawa et al., Cancer Res. 74: 3880-3889, 2014. Cell pellets were suspended in buffer A (10 mM Hepes-KOH pH 7.9, 10 mM KCl, 1.5 mM MgCl.sub.2, 0.5 mM DTT, 0.5 mM PMSF, and protease inhibitor cocktail (Nakalai Tesque)) having five times the volume of the cell pellets, and the suspension was then incubated on ice for 5 minutes. Thereafter, the cells were centrifuged at 4° C. at 500×g for 5 minutes, and the obtained cell pellets were then suspended in buffer A having two times the volume of the cell pellets for homogenization. The homogenized cell suspension was centrifuged at 4° C. at 4,000×g for 5 minutes, and a cell nucleus was recovered in a precipitate. To the recovered nucleus, an equal amount of buffer B (20 mM Hepes-KOH pH 7.9, 600 mM KCl, 1.5 mM MgCl.sub.2, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, 0.5 mM PMSF, and protease inhibitor cocktail) was added and suspended, and the obtained mixture was then blended at 4° C. for 30 minutes, using a rotator. The nuclear extract was centrifuged at 4° C. at 16,000×g for 15 minutes, and was then recovered in a supernatant. The nuclear extract was dialyzed against buffer C (20 mM Hepes-KOH pH 7.9, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.5 mM DTT, and 0.5 mM PMSF). After completion of the dialysis, the nuclear extract was centrifuged at 4° C. at 16,000×g for 30 minutes, and the remaining precipitate was then eliminated.
[0093] Regarding the total cell lysate, the cells were directly dissolved in Laemmli-buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002% bromophenol blue, and 62.5 mM Tris HCl pH 6.8).
[0094] A protein (20 to 50 μg) was separated from the total cell lysate by SDS-PAGE, and was then transferred into a PVDF membrane (Millipore), which was then used in immunoblotting using various types of antibodies.
1-7. Quantitative RT-PCR
[0095] Quantitative RT-PCR was carried out according to the method described in Johmura et al., Molecular Cell 55: 73-84, 2014. Total RNA was extracted using ISOGEN II (Wako), and using this as a template, cDNA was synthesized using SuperScript II cDNA synthesis kit (Invitrogen). PCR amplification was carried out in a 96-well optical reaction plate, using Power SYBR Green PCR Master Mix (Applied Biosystems). The relative expression ratio of individual genes was normalized with respect to the expression level of GAPDH.
1-8. Ubiquitination Assay
[0096] In order to detect ubiquitinated KDM4B in vivo, the cells were transfected with a plasmid comprising a 2× Strep II (WSHPQFEKGGGSGGGSGGSAWSHPQFEK: SEQ ID NO: 8)-tagged KDM4B sequence, and were then treated with 20 μIVI MG132 for 16 hours. Forty-eight hours after the transfection, the cells were recovered. The cells were dissolved in a buffer containing 1% SDS under denaturation conditions, and after completion of centrifugation, a supernatant was diluted according to the methods described in Nishikawa et al., The Journal of biological chemistry 279: 3916-3924, 2004 and Sato et al., The Journal of biological chemistry 279: 30919-30922, 2004. A pulldown assay with 10 μl of a 50% StrepTactin resin was carried out using a buffer with a high salt concentration (2M NaCl, 50 mM Tris-HCl pH 7.5, 0.5% Nonidet P-40, 150 mM NaCl, 50 mM NaF, and 1 mM dithiothreitol). The resin was boiled in a sample buffer, and was then used in immunoblotting.
1-9. Fluorescence Microscope
[0097] U205-LacO-I-SceI-TetO cells were cultured in a glass bottom dish (Iwaki) on the stage of BZ-9000 (Keyence) equipped with an environmental chamber (Keyence). The microscopic image was analyzed with BZ-9000 software.
1-10. Gene Knockout by CRISPR/Cas9
[0098] An oligonucleotide of sgRNA for knocking-out human Fbxo22 was prepared, and was then cloned into the Bbsl site of the vector pX330 (obtained from Dr. Feng Zhang) expressing Cas9 and sgRNA. The obtained plasmid (pX330-hFbxo22-4) was transfected into MCF-7 cells or T47D cells, using Lipofectamine 3000 (Invitrogen). After the cells had been incubated for 48 hours, the cells were sub-cultured for cloning. The cell lysate of each cell line was used in Western blotting using an anti-Fbxo22 antibody, and whether the gene was destructed was confirmed. The sgRNA sequence of human Fbxo22 is 5′-CGCCGGAACCAGTCCTACGG-3′ (SEQ ID NO: 9).
1-11. ChIP-Seq Analysis
[0099] Chromatin immunoprecipitation was carried out using SimpleChIP Enzymatic Chromatin IP kit (CST).
[0100] 4×10.sup.6 cells were fixed with 1% formaldehyde at room temperature for 10 minutes, and thereafter, 125 mM glycine was added to the cells. Chromatin was prepared from cell pellets, and was then treated with micrococcal nuclease at room temperature for 15 minutes. The cleaved chromatin and approximately 2 μg of each type of antibody were incubated at 4° C. overnight. Thereafter, 20 μl of magnetic beads were added thereto, and the obtained mixture was then incubated at 4° C. for 2 hours. The magnetic beads were washed with a washing buffer four times, and the chromatin was then eluted with a ChIP elution buffer, which was then treated with Protein K at 65° C. for 4 hours to perform reverse crosslink. Thereafter, DNA was extracted using a DNA purification column. A sequencing library was prepared with 1.8 ng of DNA, using Ion Xpress Plus Fragment Library kit (Thermo Fisher Scientific). Sequencing was carried out using Ion PI Chip and Ion PI Sequencing 200 kit, according to Ion Proton system (Thermo Fisher Scientific). The base-call and alignment in a single-ended read operation were carried out under default setting, using Torrent Suite™ Software 5.2.2. The read was mapped with respect to the human genome hg19 used as a control according to Torrent Mapping Alignment Program (TMAP). A tag directory was produced from the aligned read, using makeTagDirectory version v4.9.1 provided by HOMER (http://homer.salk.edu/homer/). Thereafter, using Homer, basic quality control analysis and sequence bias analysis were carried out. Using a default parameter, namely, a parameter having a tag density that is 4 or more times the normalized tag density in a region 10 kb from each peak, and a false discovery rate of 0.001 or less, the peak was called using rfindPeaks. In order to find a concentrated TF motif, findMotifsGenome was used at a region size of 50 bp and at a p-value of less than 1e-50, so that the region was annotated with annotatePeaks. The peak of the overlapped ER and SRC-3 was identified with intervals of less than 100 bp between the concentrated ER and SRC-3 regions. The hierarchical cluster analysis of the concentrated region was carried out using Cluster 3.0. Heat map data matrix was produced using Homer, and was then visualized using Java TreeView. A box-and-whisker plot was produced using Excel by taking log 2-ratio of each density.
1-12. Transplantation of Cancer Cells into Mice
[0101] Control (wild-type) T47D cells or Fbxo22-KO (knockout) T47D cells were cultured until the cells became 80% to 90% confluent. Thereafter, the cells were treated with trypsin, were then suspended in PBS, and were then mixed with Matrigel (CORNING 354230) at a mixing ratio of 1:1. An estrogen pellet (a 60-day slow-release pellet containing 0.72 mg of estrogen (Innovative Research of America)) was embedded into the subcutis of the nape of a mouse, and one day after the embedding, the cells (3×10.sup.6 cells) were injected together with 100 μl of PBS/Matrigel (1:1) into the subcutis of the mammary gland fat pad of a 9-week-old NOD/Scid mouse. When the size of a tumor became approximately 50 mm.sup.3, a tamoxifen pellet (a 60-day slow-release pellet containing 5 mg of tamoxifen (Innovative Research of America)) was embedded into the subcutis of five mice in each group. The size of the transplanted tumor was measured every week. Six weeks later, the mice were euthanized, the tumor was then excised, and the size of the tumor was then measured. Thereafter, the tumor was fixed with formalin and was then embedded in paraffin, and an HE stain slide glass was produced. The size of a tumor was evaluated as follows: V=(length×width×height×0.5326) mm.sup.3. All of the mice were fed under a specific pathogen-free environment, and were treated in accordance with Animal Experiment Guidelines, Graduate School of Medicine and Faculty of Medicine, The University of Tokyo.
1-13. Immunohistochemical Analysis of Tumor Section
[0102] The transplanted tumor tissues were fixed with 10% formalin, were then dehydrated, and were then embedded in paraffin. The paraffin section was deparaffinized, was then rehydrated, and was then incubated together with an anti-Ki-67 antibody (DAKO) or an antibody reacting against cleaved caspase-3 (CST). A primary antibody bound to the antigen was detected with an HRP-labeled secondary antibody, and was then visualized with DAB (3,3′-diaminobenzidine tetrahydrochloride).
1-14. Immunohistochemical Analysis of Patient-Derived Tissue Specimen
[0103] Formalin fixing, paraffin embedding, core needle aspiration biopsy cytology panels, and the clinical data thereof, which were derived from 163 cases of continuously treated T2 (diameter: 2 to 5 cm) ERα-positive/HER-2-negative primary breast cancers, were obtained from patients who underwent surgery at St. Marianna University School of Medicine Hospital from 2005 to 2009. The median follow-up time was 7.4 years. The present research was approved by the clinical trial review committee of the university (approval number: 3095). The immunohistochemical analysis was carried out using Nichirei Histofine system (Nichirei Biosiences Inc., Tokyo, Japan). A tissue section was incubated with anti-Fbxo22 antibody (GTX117774, GeneTex) used as a primary antibody, which was diluted to 1:200, and was then detected using an HRP-polymer-labeled secondary antibody (Histofine Simple Stain MAX PO (multi), Nichirei, Japan). Coloration was carried out using DAB. Cancer tissues comprising one or more cells exhibiting Fbox22 staining at a moderate degree or a high degree (i.e. Fbxo22-positive cells) out of 100 cells were determined to be Fbxo22-positive. The Fbxo22-positive cells were evaluated according to a blind test conducted by two pathologist. The statuses of ERα, PR, HER2, and Ki-67 were determined by a standard immunohistochemical method and a FISH (fluorescence in situ hybridization) method, which are used in clinical studies.
1-15. Statistical Analysis
[0104] The statistical analysis of a cell-based experiment was carried out according to a Student's t-test to an independent variable. P value<0.05 was defined to be statistically significant. A statistical analysis regarding tag counting of ChIP-seq data was carried out by one-way ANOVA. The relationship between Fbxo22 status and various clinicopathological features was calculated by a chi-square test, a Fisher's exact test, and a Student's t-test. A relapse-free survival (RFS) curve was produced by a Kaplan-Meier method and a log-rank test. Regarding individual variables in a single variable analysis and a multivariate analysis, a cox proportional hazard regression model was used to evaluate the hazard ratio (HR) and 95% confidence intervals (95% CIs) of RFS. A Kaplan-Meier plot was produced using GraphPad Prism6. The cox proportional hazard regression model was analyzed by R (version 3.3.2). The statistical significance was defined as P<0.05.
2. Results
2-1. Breast Cancer
2-1-1. KDM4B Ubiquitination and Influence of its Decomposition on Agonistic Activity of TAM
[0105] If E2-induced transcriptional activity in MCF-7 cells is regulated by proteasome-dependent decomposition, the antagonistic activity of TAM is also likely to be regulated by proteasome-dependent proteolysis.
[0106] In order to examine this assumption, first, the kinetics of the antagonistic activity of 4-hydroxytamoxifen (4-OHT) were measured. E2 was added to MCF-7 cells in an E2-depleted condition to stimulate the cells, and 6 hours after the addition of E2, 4-OHT was added to the cells. The transcript levels of GREB1 and EBAG1 that were target genes of ERα were measured over time. As a result, 4 hours after the addition of E2, the transcript levels became maximum, and were then reduced. Six hours after the addition of 4-OHT, the transcript levels became minimum (
[0107] After the treatment with E2, ERα forms a complex with KDM4B and SRC-3 (
[0108] In addition, when E2 was removed from the medium containing E2, the E2-induced transcriptional activity of EBAG9 and GREB1 disappeared (
[0109] From the aforementioned results, it is considered that the dynamics of cofactors are triggered by the decomposition by proteasome of KDM4B that binds to ERα, and that the antagonistic activity of TAM in ERα-positive breast cancer cells is promoted.
2-1-2. Identification of Factor Associated with Decomposition of KDM4B
[0110] Next, a factor that selectively decomposes KDM4B forming a complex with ERα was searched.
[0111] It has been reported that Fbxo22 is somewhat correlated with the function of KDM4A. Thus, whether or not Fbxo22 is associated with decomposition of KDM4B was examined. The steady-state levels of KDM4A, 4C and 4D in Fbxo22-depleted cells were equivalent to the steady-state level of wild-type cells, but the amount of KDM4B was apparently increased (
[0112] In order to examine whether or not SCF.sup.Fbxo22 ubiquitinates KDM4B that forms a complex with ERα, first, formation of a complex between ERα and Fbxo22 was examined. FLAG-HA-tagged Fbxo22 (FH-Fbxo22) was allowed to express in MCF-7 cells in the presence of MG132, and immunoprecipitation was carried out using an anti-FLAG antibody and an anti-HA antibody. As a result, ERα was contained in the immunoprecipitated obtained with the anti-FLAG/anti-HA antibodies. Hence, it was found that ERα interacts with Fbxo22 (
[0113] Subsequently, the interaction of an agonist or an antagonist binding to ERα with Fbxo22 was examined. In the presence of MG132, FLAG-Fbxo22 binding to ERα was reduced dependently on the additive amount of E2, and the binding to KDM4B was not influenced (
2-1-3. Ubiquitination of KDM4B by SCF.SUP.Fbxo22 .(SCF-Fbxo22 Complex)
[0114] In order to examine the influence of Fbxo22 or ERα on the amount of KDM4B in MCF-7 cells, Fbxo22 and/or ERα were allowed to express in MCF-7 cells. As a result, when Fbxo22 or ERα was allowed to express alone, it did not influence on the amount of KDM4B. However, when Fbxo22 and ERα were allowed to simultaneously express, the amount of KDM4B was reduced (
[0115] In order to further examine this possibility, an in vivo ubiquitination assay was carried out under denaturation conditions. Ubiquitination of KDM4B by Fbxo22 was weak when ERα was not expressed. However, when ERα was co-expressed, ubiquitination of KDM4B was significantly reinforced in an ERα dose dependent manner (
[0116] If Fbxo22 preferentially binds to ligand-non-bound ERα or 4-OHT-bound ERα, the ubiquitination by SCF.sup.Fbxo22 of KDM4B forming a complex with ERα is considered to depend on the type of a ligand binding to Ra. Ubiquitination of KDM4B forming a complex with ERα was significantly reduced by addition of E2, and when 4-OHT was added, the amount of ubiquitination was recovered (
[0117] From the aforementioned results, it was demonstrated that SCF.sup.Fbxo22 preferentially ubiquitinates KDM4B forming a complex with ligand-non-bound ERα or 4-OHT-bound ERα.
2-1-4. Influence of Decomposition of KDM4B Mediated by SCF.SUP.Fbxo22 .on Antagonistic Activity of SERM
[0118] When control MCF-7 cells stimulated by E2 were treated with 4-OHT, transcription of EBAG9 and GREB1 was strongly suppressed (
[0119] The transcriptional activity of ERα is caused by AF1 and AF2. Hence, whether or not ERα activity in Fbxo22-depleted cells in the presence of 4-OHT depends on AF1 and/or AF2 was examined.
[0120] Fbxo22-expressing U2OS cells or Fbxo22-non-expressing U2OS cells, which express the entire-length wild-type ERα or Δ44 mutant ERα deleting AF1 activity, were stimulated by E2 and were then treated with 4-OHT. The antagonistic activity of 4-OHT was suppressed in U2OS cells, in which Fbxo22 was not expressed but wild-type ERα was expressed, and which were stimulated by E2 (
[0121] In order to further analyze the role of Fbxo22 in accumulation of a coactivator and ERα induced by a ligand, the intracellular dynamics of an ERα-coactivator complex in living cells were observed in real time. In order to immobilize ERα on a Lac operator array stably incorporated into living cells, using a CFP-tagged lac receptor-ERα chimeric protein (CFP-LacER), accumulation of YFP-SRC-1 and KDM4B in an ERα-immobilized position was examined.
[0122] First, with regard to colocalization of FLAG-KDM4B in CFP-LacER and YFP-SRC-1 foci, an analysis was carried out using U2OS-LacO-I-SceI TetO cells expressing CFP-LacER, YFP-SRC-1 and FLAG-KDM4B. According to an immunofluorescence analysis using an anti-FLAG antibody, in the presence of E2, FLAG-KDM4B was also colocalized in CFP-LacER and YFP-SRC-1 foci in control cells and Fbxo22-depleted cells (
[0123] From the aforementioned results, it was demonstrated that Fbxo22 plays an important role in cofactor dynamics in the action of 4-OHT to antagonize E2 signaling.
2-1-5. Role of Fbxo22 in Dissociation of 4-OHT-Dependent SRC-3 from ERα-SRC3-Binding Genomic Region
[0124] Applying a ChIP-Seq analysis, the genome-wide binding of ERα-SRC-3 was mapped. The analysis was carried out using control MCF-7 cells and Fbxo22-depleted MCF-7 cells. The cells were left under an estrogen-depleted condition for 72 hours, and were then stimulated by E2 (10 nM) or E2+4-OHT for 2 hours. As a result, 1,264 ERα accumulation peaks were detected in E2-treated wild-type MCF-7 cells, and 23,213 ERα accumulation peaks were detected in Fbxo22-depleted MCF-7 cells. In addition, 26,751 ERα accumulation peaks were detected in E2+4-OHT-treated control MCF-7 cells, and 19,924 ERα accumulation peaks were detected in Fbxo22-depleted MCF-7 cells. From these results, it is considered that 4-OHT does not affect the interaction of ERα with a target region. In the above-described 4 data sets, 8,528 ERα accumulation peaks were overlapped. In E2-treated wild-type MCF-7 cells, 1,723 SRC-3 accumulation peaks were detected. In Fbxo22-depleted MCF-7 cells, 5,572 SRC-3 accumulation peaks were detected. Between these two data, 469 SRC-3 accumulation peaks were common, and approximately 90% (410) of these peaks were overlapped with ERα peaks (
[0125] In fact, when control MCF-7 cells and Fbxo22-depleted MCF-7 cells were treated with E2, accumulation of ERα in the promoter regions of GREB1 and IGFBP4 genes was promoted (
[0126] From these results, it was demonstrated that Fbxo22 plays an important and universal role in the dissociation of SRC-3 from the ERα/SRC-3-binding genomic region, which is induced by tamoxifen.
2-1-6. Influence of Fbxo22 on Breast Cancer Cell Proliferation Inhibitory Activity of TAM In Vitro and In Vivo
[0127] Estrogen is necessary for proliferation of MCF-7 cells. Thus, whether or not Fbxo22 is necessary for the suppression of proliferation of MCF-7 cells by 4-OHT was examined. As a result of a colony formation assay, it was found that proliferation of control MCF-7 cells in the presence of E2 was completely suppressed by being treated with 4-OHT, and that the proliferation-suppressing effect of 4-OHT was reduced in Fbxo22-depleted MCF-7 cells (
[0128] Subsequently, whether or not Fbxo22 is also necessary for the antagonistic activity of 4-OHT in vivo was examined. Control T47D breast cancer cells or Fbxo22-knocked-out T47D breast cancer cells (3×10.sup.6 cells) were transplanted into the mammary gland fat pad of female NOD/Scid mice. Two weeks after the transplantation, 4-OHT pellets were transplanted into the mice, and the degree of proliferation of a tumor was then examined. Before the 4-OHT treatment, both the control cells and the Fbxo22-knocked-out cells formed a tumor having almost the same size in all of the transplanted mice, and thus, it was confirmed that the removal of Fbxo22 does not affect proliferation of T47D cells in the mammary gland fat pad. However, unexpectedly, when the mice into which Fbxo22-knocked-out cells had been transplanted were treated with 4-OHT, a clear increase in the tumor was observed, compared with the mice into which control cells had been transplanted (
[0129] Six weeks after the transplantation, the mice were euthanized, and the weight of the tumor, etc. was then measured. The tumor of Fbxo22-knocked-out T47D cells was apparently heavier than the tumor of wild-type T47D cells (
[0130] From the aforementioned results, it was demonstrated that Fbxo22 is essential for the antagonistic activity of 4-OHT, in vivo and in vitro, through decomposition of KDM4B that forms a complex with ERα.
2-1-7. Significance of Expression Level of Fbxo22 in Determination of Prognosis of ERα-Positive/HER2-Negative Breast Cancer Patients
[0131] The important role of SCF.sup.Fbxo22 as a TAM sensitivity determining factor in breast cancer cells suggests that the expression level of Fbxo22 can be used as a prognosis-determining factor for patients with ERα-positive breast cancer. Hence, in order to confirm the possibility of the expression level of Fbxo22 as a prognosis-determining factor for patients with ERα-positive breast cancer, 163 ERα-positive/HER2-negative breast cancer specimens were analyzed in terms of the expression level of Fbxo22 according to an immunohistochemical method. When the specimens were immunostained using an anti-Fbxo22 antibody, the cell nucleus was unevenly stained in normal mammary gland-derived tissues (
TABLE-US-00004 TABLE 3 Fbxo22 expression Characteristics positive negative P Total samples 114 49 age, years Mean 56 54 SD 13 13 0.4036 Node Positive 60 27 Negative 54 22 0.7719
Grade Low 67 24 Medium/High 47 25 0.2583
Histology
IC of NST (invasive ductal) 95 35 Invasive lobular Ca 4 7 Mucinous Ca 8 2 Ca with apocrine differentiation 3 0 Others 4 5 0.02797
PR
Positive 95 33 Negative 19 16 0.0227
Ki67
high 28 24 low 86 25 0.0022
Chemotherapy No 52 17 Yes 62 32 0.1957
Hormone therapy No 3 2 tamoxifen 32 14 aromatase inhibitors 59 23 both (TAM & AI) 18 10 Others 2 0 0.8386
.sup.1)Histology was determined based on WHO 2012 classification IC of NST: invasive carcinoma of no special type .sup.2)PR status: 0% vs 1%≤, Ki67 status: ≤ 10% vs 20%≤ .sup.3)unpaired t-test .sup.4)Chi-square test .sup.5)Fisher's exact test
indicates data missing or illegible when filed
[0132] However, the Fbxo22 status was not correlated with lymph node metastasis and tumor grading (Table 3). It is particularly noteworthy that the Fbxo22-depleted tumor has a significant correlation with a reduction in the relapse-free survival (RFS), compared with the Fbxo22-positive tumor (
[0133] Furthermore, it was demonstrated according to a multivariable survival analysis that Fbxo22 depletion predicts prognosis, independently from other prognosis-determining factors (Table 4). These clinical data show that Fbxo22 depletion causes a poor prognosis to ERα-positive/HER2-negative breast cancer, irrelevantly to low Ki-67, negative lymphatic metastasis, low grade, or tamoxifen treatment.
TABLE-US-00005 TABLE 4 Univariate Multivariate Variable HR 95% CI P HR 95% CI P Fbxo22 Positive 1.00 1.00 Negative 2.847 1.248 to 8.493 0.012 2.6483 1.1148 to 6.291 0.0274 Node Negative 1.00 1.00 Positive 1.639 0.5936 to 3.872 0.26 1.5679 0.6520 to 3.771 0.3151 Grade Low 1.00 1.00 Medium/High 1.651 0.7231 to 3.768 0.234 1.483
0.639
to 3.442 0.3581 PR Negative 1.00 1.00 Positive 0.7685 0.2983 to 1.929 0.562 0.8473 0.3257 to 2.204 0.7341 Ki67 Negative 1.00 1.00 Positive 1.54 0.6856 to 3.582 0.313 1.0409 0.4293 to 2.524 0.92
3
Estimated from Cox proportional hazards model.
indicates data missing or illegible when filed
2-2. Endometrial Cancer
[0134] Estrogen is associated with the onset of endometrial cancer. Endometrium, as well as bone, has been known as an organ, on which tamoxifen exhibits an agonistic action. Thus, the risk of developing endometrial cancer is increased by tamoxifen. As such, the agonistic action of tamoxifen is considered to cause an increase in the risk of endometrial cancer. That is, when tamoxifen is administered, the tamoxifen acts as an antagonist on Fbxo22-positive breast cancers, but it acts as an agonist on Fbxo22-negative breast cancers. From this fact and the aforementioned results regarding breast cancer, it is likely that Fbxo22-negative endometrial cancer is developed by administration of an anti-hormonal agent such as tamoxifen, and that the prognosis thereof becomes poor.
[0135] In order to analyze this, the expression of Fbxo22 in 30 cases of endometrial cancer (EC), 29 cases of atypical endometrial hyperplasia (AEH) that is a non-invasive early endometrial cancer, 30 cases of endometrial hyperplasia (EH) as a precancerous lesion, and 22 cases of normal endometrium, was analyzed by immunostaining using an Fbxo22 antibody (St. Marianna University School of Medicine, Bioethics committee; approval number: 4230). The expression degree was evaluated according to H-Score in the cell nucleus (i.e., an evaluation method commonly applied in pathological inspections, comprising evaluating with a total score of positive cell percentage x strongly positive 3 points, intermediately positive 2 points, and weakly positive 1 point). Ki-67 and the progesterone receptor (PgR) were evaluated with positive percentage (%) used in clinical sites.
2-2-1. Expression of Fbxo22 in Normal Endometrium
[0136] In a normal endometrium, the expression of Fbxo22 was changed depending on the menstrual cycle, and the expression was negative in the proliferative phase and was positive in the secretory phase (
2-2-2. Expression of Fbxo22 in Endometrial Cancer
[0137] Regarding correlation with canceration, as expected, Fbxo22 was decreased in EC, and if the correlation is evaluated using H-Score, the score was gradually decreased such as EH: 124.2±69.1, AEH: 84.7±51.0, and EC: 25.0±35.3 (
[0138] As mentioned above, taking into consideration the fact that ER signals continue even if estrogen is depleted in an ERα-positive breast cancer model, it is likely that if Fbxo22 is decreased, introduction into the secretory phase caused by progesterone signals cannot be carried out smoothly, and that cell proliferation excessively occurs due to estrogen signals, thereby inducing cancer. As a clinical application, the expression of Fbxo22 is likely to become a predictive factor capable of predicting progression to AEH and EC in EH cases.
INDUSTRIAL APPLICABILITY
[0139] The present invention relates to a method for determining the prognosis of a hormone receptor cancer and a method for evaluating therapeutic effects. Therefore, it is expected that the present invention will be utilized in the medical field.