COMPOSITIONS AND METHODS FOR TREATMENT OF A MALABSORPTIVE DISORDER
20220119772 · 2022-04-21
Inventors
Cpc classification
A61K31/522
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N2533/90
CHEMISTRY; METALLURGY
A61P1/14
HUMAN NECESSITIES
A61K31/403
HUMAN NECESSITIES
A61K31/522
HUMAN NECESSITIES
A61K31/165
HUMAN NECESSITIES
A61K31/4985
HUMAN NECESSITIES
A61K31/165
HUMAN NECESSITIES
A61K31/403
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K38/2278
HUMAN NECESSITIES
A61K31/4985
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
International classification
Abstract
Described herein are methods for treating a malabsorptive disorder. The malabsorptive disorder may be, in certain aspects, characterized by malabsorption of macronutrients in the intestine, and may include, for example, a disease selected from one or more of enteric anendocrinosis, short gut syndrome, enteric pathogen infection, malnutrition, genetic causes of malabsorption, Celiac disease, malabsorptive diarrhea, and inflammatory bowel. Such methods may include administration of peptide YY (PYY) to an individual in need thereof. Also described are medicaments for carrying out the disclosed methods.
Claims
1.-31. (canceled)
32. An intestinal organoid comprising a null mutation in NEUROG3 and lacking enteroendocrine cells (EECs), wherein the intestinal organoid is differentiated from pluripotent stem cells and do not express Chromogranin A (CHGA).
33. A method comprising contacting the intestinal organoid of claim 32 with a compound and assessing the effect of the compound on the intestinal organoid by immunofluorescence, flow cytometry, qPCR, a swelling assay, NHE3 activity assay, electrophysiology assay with an Ussing chamber, glucose uptake assay, or intracellular pH assay.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] This application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0006] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
DETAILED DESCRIPTION
Definitions
[0016] Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein may be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0017] As used herein and in the appended claims, the singular forms “a,” “and,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes a plurality of such methods and reference to “a dose” includes reference to one or more doses and equivalents thereof known to those skilled in the art, and so forth.
[0018] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” may mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” may mean a range of up to 20%, or up to 10%, or up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term may mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.
[0019] As used herein, the term “effective amount” means the amount of one or more active components that is sufficient to show a desired effect. This includes both therapeutic and prophylactic effects. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
[0020] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably to refer to an animal that is the object of treatment, observation and/or experiment. Generally, the term refers to a human patient, but the methods and compositions may be equally applicable to non-human subjects such as other mammals. In some embodiments, the terms refer to humans. In further embodiments, the terms may refer to children.
[0021] “Sequence identity” as used herein indicates a nucleic acid sequence that has the same nucleic acid sequence as a reference sequence, or has a specified percentage of nucleotides that are the same at the corresponding location within a reference sequence when the two sequences are optimally aligned. For example a nucleic acid sequence may have at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the reference nucleic acid sequence. The length of comparison sequences will generally be at least 5 contiguous nucleotides, preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides, and most preferably the full length nucleotide sequence. Sequence identity may be measured using sequence analysis software on the default setting (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Such software may match similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications.
[0022] The ability to absorb ingested nutrients is an essential function of all metazoans and utilizes a wide array of nutrient transporters found on the absorptive enterocytes of the small intestine. A unique population of patients has been identified with severe congenital malabsorptive diarrhea upon ingestion of any enteral nutrition.sup.1. The intestines of these patients are macroscopically normal, but lack enteroendocrine cells, a rare population of cells that release bioactive peptides in response to nutrient cues.sup.2. The mechanism by which enteroendocrine cells integrate nutrient sensing with nutrient absorption by neighboring cells is poorly understood. By using enteroendocrine-deficient human pluripotent stem cell-derived intestinal organoids and mouse models, Applicant has found that vasoactive intestinal peptide and peptide YY, two well-known regulators of ion and water secretion in the colon.sup.3, cooperate to regulate ion-coupled absorption of glucose and dipeptides in mouse and human small intestine. Applicant found that administration of peptide YY to enteroendocrine-deficient mice.sup.4 restored normal electrophysiology, improved glucose and peptide absorption, diminished diarrhea and rescued postnatal survival, suggesting that peptide YY may be used to treat patients with malabsorption. Applicant uncovered a novel role for crosstalk between enteroendocrine cells and the enteric nervous system in integrating nutrient sensing with nutrient absorption in mouse and human small intestine. As EECs are frequently dysregulated in inflammatory bowel and metabolic diseases, the mechanisms by which they modulate nutrient absorption has wide implications.
[0023] In one aspect, disclosed herein is a method of treating a malabsorptive disorder. The malabsorptive disorder may be characterized by, in certain aspects, the malabsorption of macronutrients in the intestine. The method may comprise administering peptide YY (PYY) to an individual in need thereof.
[0024] Peptide YY, or “PYY” is known and described in the art. The term PYY includes variants of PYY, including variants of the specific sequences disclosed herein. Variants to PYY will be readily determinable using routine methods in the art. For example, it will be appreciated that one or more amino acids may be modified to arrive at a PYY having similar or sufficient activity, that such activity may be readily determined using routine methods, and that the variant may be used with the disclosed methods. In one aspect, the PYY peptide may be PYY(1-36), available from Phoenix Pharmaceuticals: http://www.phoenixpeptide.com/products/view/Peptides/059-03. In one aspect, the PYY peptide may be identical in sequence to that of human PYY, having the following sequence: Tyr-Pro-Ile-Lys-Pro-Glu-Ala-Pro-Gly-Glu-Asp-Ala-Ser-Pro-Glu-Glu-Leu-Asn-Arg-Tyr-Tyr-Ala-Ser-Leu-Arg-His-Tyr-Leu-Asn-Leu-Val-Thr-Arg-Gln-Arg-Tyr-NH2 (SEQ ID NO 7) as described in https://www.sciencedirect.com/science/article/pii/S000691X88803085. In one aspect, the PYY peptide may Tyr-Pro-Ala-Lys-Pro-Glu-Ala-Pro-Gly-Glu-Asp-Ala-Ser-Pro-Glu-Glu-Leu-Ser-Arg-Tyr-Tyr-Ala-Ser-Leu-Arg-His-Tyr-Leu-Asn-Leu-Val-Thr-Arg-Gln-Arg-Tyr-NH2 (SEQ ID NO 8), or a variant thereof.
[0025] In one aspect, the administration of PYY improves absorption of nutrients in the small intestine. In one aspect, the administration may improve absorption of one or both of amino acids and carbohydrates in the intestines, particularly the small intestine. In one aspect, the administration may improve glucose absorption in the intestines, particularly the small intestine.
[0026] The methods may be used to treat a variety of disease states or conditions. For example, the method may be used to treat a malabsorptive disorder, for example, one or more of enteric anendocrinosis, short gut syndrome, enteric pathogen infection, malnutrition, genetic causes of malabsorption, Celiac disease, malabsorptive diarrhea, inflammatory bowel diseases such as Chron's and colitis, or any combination thereof. In one aspect, the individual to be treated may be one who is Enteroendocrine cells (EEC)—deficient, or who otherwise has a decreased EEC population, or decreased function of EECs. In one aspect, the individual treated using the disclosed methods may be an individual who is dependent on parenteral nutrition.
[0027] In certain aspects, the disclosed methods may include administration until carbohydrate and/or amino acid absorption in the intestine, in particular the small intestine, is improved or normalized. In other aspects, the administration may be carried out until dipeptide absorption in the intestines, in particular the small intestine, is improved or normalized.
[0028] In one aspect, the administration of PYY or a variant thereof may be in an amount of from about 1 mg/kg to about 200 mg/kg, or from about 5 mg/kg up to about 100 mg/kg, or from about 10 mg/kg to about 50 mg/kg. In certain aspects, the administration may be in an amount of up to or including about 200 pmol/kg lean body mass.
[0029] In certain aspects, one or more additional actives may be administered with PYY. For example, in one aspect, a dipeptidyl peptidase-4 (“DPP4”) inhibitor may be administered before, after, or concurrently with administration of PYY. Dipeptidyl peptidase-4 (or IV) cleaves the first two residues (Tyr-Pro) from the full-length PYY(1-36), converting to (3-36). (3-36) has anorectic effects on the central nervous system which is desirable to avoid, and (1-36) is more potent in the gut epithelium. DPP4 has many other peptide targets, and DPP4 inhibition is in clinical use for one of its other targets, GLP-1, for the treatment of type 2 diabetes. See, e.g., http://www.emdmillipore.com/US/en/product/DPP-IV-Inhibitor,MM_NF-DPP4-010. Dosages may include from about 1 to about 500 mg, or from about 2.5 mg to about 100 mg, though it is to be understood that desirable doses may be determined by routine experimentation and may be unique to the individual. The DPP4 inhibitor may be administered in an amount sufficient to prevent or reduce PYY cleavage. DPP4 inhibitors are known in the art and may include one or more of sitagliptin, vildagliptin, saxagliptin, alogliptin, linagliptin, and combinations thereof. In a further aspect, the additional active may be a vasoactive intestinal peptide (VIP) inhibitor. In one aspect, the VIP inhibitor may be VIP(6-28) and [D-p-Cl-Phe.sup.6,Leu.sup.17]-VIP. Suitable doses of a VIP inhibitor may be from about 1 mg/kg to about 200 mg/kg, or from about 5 mg/kg up to about 100 mg/kg, or from about 10 mg/kg to about 50 mg/kg, preferably up to or including about 200 pmol/kg lean body mass.
[0030] In one aspect, the PYY may be administered via a dosing regime, wherein one or more doses are administered to an individual in need thereof over a period of time. PYY may be administered for at least one day, or at least two days, or at least three days, or at least four days, or at least five days, or at least six days, or at least seven days, or from about one day to about 30 days, or for at least two months, or at least three months, or at least four months, or at least five months, or at least six months, or until improvement or resolution of malabsorption of a nutrient selected from one or both of carbohydrates and amino acids.
[0031] In a further aspect, a medicament for improving small and/or large intestine absorption of a macronutrient selected from one or both of a nutrient and a carbohydrate, or for the treatment of obesity is disclosed, wherein said medicament may comprise peptide YY (PYY). In certain aspects, the medicament may further comprise a Dipeptidyl peptidase-4 (“DPP4”) inhibitor. The DPP4 inhibitor may be selected from one or more of sitagliptin, vildagliptin, saxagliptin, alogliptin and linagliptin. In a further aspect, the medicament may comprise a vasoactive intestinal peptide (VIP) inhibitor. In one aspect, the VIP inhibitor may be VIP(6-28) and [D-p-Cl-Phe.sup.6,Leu.sup.17]-VIP.
[0032] In a yet further aspect, disclosed herein is a composition comprising parenteral nutrition and peptide YY (PYY). The PPY may be present in the parenteral nutrition an amount sufficient to improve absorption of one or both of amino acids and carbohydrates in the intestine, more particularly the small intestine, more particularly in an amount that improves/enhances absorption of glucose in the small intestine. The composition may further comprise a vasoactive intestinal peptide (VIP) inhibitor. In one aspect, the VIP inhibitor may be VIP(6-28) and [D-p-Cl-Phe.sup.6,Leu.sup.17]-VIP.
[0033] In a yet further aspect, disclosed herein is a method for treating obesity. The method may comprise administering a peptide YY (PYY) inhibitor to an individual in need thereof. In one aspect, the PYY inhibitor may be BIB03304. NPY1R is the PYY receptor in the gut, which is inhibited by BIBO3304, having the following structure: N-[(1R)-1-[[[[4-[[(Amirtocarbortyl)amino]methyl]phenyl]methyl]amino]carbonyl]-4-[(aminoiminomethyl)amino]butyl]-α-phenyl-benzeneacetamide ditrifluoroacetate (C.sub.29H.sub.35N.sub.7O.sub.3.2CF.sub.3CO.sub.2H). The method may further comprise administration of a vasoactive intestinal peptide (VIP) inhibitor, such as VIP(6-28) and [D-p-Cl-Phe.sup.6,Leu.sup.17]-VIP. In a further aspect, the method may further comprise administration of a Dipeptidyl peptidase-4 (“DPP4”) inhibitor, for example, one or more of sitagliptin, vildagliptin, saxagliptin, alogliptin and linagliptin.
Pharmaceutical Compositions
[0034] In one aspect, active agents provided herein may be administered in an dosage form selected from intravenous or subcutaneous unit dosage form, oral, parenteral, intravenous, and subcutaneous. In some embodiments, active agents provided herein may be formulated into liquid preparations for, e.g., oral administration. Suitable forms include suspensions, syrups, elixirs, and the like. In some embodiments, unit dosage forms for oral administration include tablets and capsules. Unit dosage forms configured for administration once a day; however, in certain embodiments it may be desirable to configure the unit dosage form for administration twice a day, or more.
[0035] In one aspect, pharmaceutical compositions are isotonic with the blood or other body fluid of the recipient. The isotonicity of the compositions may be attained using sodium tartrate, propylene glycol or other inorganic or organic solutes. An example includes sodium chloride. Buffering agents may be employed, such as acetic acid and salts, citric acid and salts, boric acid and salts, and phosphoric acid and salts. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
[0036] Viscosity of the pharmaceutical compositions may be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is useful because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. In some embodiments, the concentration of the thickener will depend upon the thickening agent selected. An amount may be used that will achieve the selected viscosity. Viscous compositions are normally prepared from solutions by the addition of such thickening agents.
[0037] A pharmaceutically acceptable preservative may be employed to increase the shelf life of the pharmaceutical compositions. Benzyl alcohol may be suitable, although a variety of preservatives including, for example, parabens, thimerosal, chlorobutanol, or benzalkonium chloride may also be employed. A suitable concentration of the preservative is typically from about 0.02% to about 2% based on the total weight of the composition, although larger or smaller amounts may be desirable depending upon the agent selected. Reducing agents, as described above, may be advantageously used to maintain good shelf life of the formulation.
[0038] In one aspect, active agents provided herein may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, or the like, and may contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. See, e.g., “Remington: The Science and Practice of Pharmacy”, Lippincott Williams & Wilkins; 20th edition (Jun. 1, 2003) and “Remington's Pharmaceutical Sciences,” Mack Pub. Co.; 18th and 19th editions (December 1985, and June 1990, respectively). Such preparations may include complexing agents, metal ions, polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, dextran, and the like, liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. The presence of such additional components may influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance, and are thus chosen according to the intended application, such that the characteristics of the carrier are tailored to the selected route of administration.
[0039] For oral administration, the pharmaceutical compositions may be provided as a tablet, aqueous or oil suspension, dispersible powder or granule, emulsion, hard or soft capsule, syrup or elixir. Compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and may include one or more of the following agents: sweeteners, flavoring agents, coloring agents and preservatives. Aqueous suspensions may contain the active ingredient in admixture with excipients suitable for the manufacture of aqueous suspensions.
[0040] Formulations for oral use may also be provided as hard gelatin capsules, wherein the active ingredient(s) are mixed with an inert solid diluent, such as calcium carbonate, calcium phosphate, or kaolin, or as soft gelatin capsules. In soft capsules, the active agents may be dissolved or suspended in suitable liquids, such as water or an oil medium, such as peanut oil, olive oil, fatty oils, liquid paraffin, or liquid polyethylene glycols. Stabilizers and microspheres formulated for oral administration may also be used. Capsules may include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredient in admixture with fillers such as lactose, binders such as starches, and/or lubricants, such as talc or magnesium stearate and, optionally, stabilizers.
[0041] Tablets may be uncoated or coated by known methods to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period of time. For example, a time delay material such as glyceryl monostearate may be used. When administered in solid form, such as tablet form, the solid form typically comprises from about 0.001 wt. % or less to about 50 wt. % or more of active ingredient(s), for example, from about 0.005, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 wt. % to about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, or 45 wt. %.
[0042] Tablets may contain the active ingredients in admixture with non-toxic pharmaceutically acceptable excipients including inert materials. For example, a tablet may be prepared by compression or molding, optionally, with one or more additional ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding, in a suitable machine, a mixture of the powdered active agent moistened with an inert liquid diluent.
[0043] In some embodiments, each tablet or capsule contains from about 1 mg or less to about 1,000 mg or more of an active agent provided herein, for example, from about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mg to about 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, or 900 mg. In some embodiments, tablets or capsules are provided in a range of dosages to permit divided dosages to be administered. A dosage appropriate to the patient and the number of doses to be administered daily may thus be conveniently selected. In certain embodiments two or more of the therapeutic agents may be incorporated to be administered into a single tablet or other dosage form (e.g., in a combination therapy); however, in other embodiments the therapeutic agents may be provided in separate dosage forms.
[0044] Suitable inert materials include diluents, such as carbohydrates, mannitol, lactose, anhydrous lactose, cellulose, sucrose, modified dextrans, starch, and the like, or inorganic salts such as calcium triphosphate, calcium phosphate, sodium phosphate, calcium carbonate, sodium carbonate, magnesium carbonate, and sodium chloride. Disintegrants or granulating agents may be included in the formulation, for example, starches such as corn starch, alginic acid, sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite, insoluble cationic exchange resins, powdered gums such as agar, or karaya, or alginic acid or salts thereof.
[0045] Binders may be used to form a hard tablet. Binders include materials from natural products such as acacia, starch and gelatin, methyl cellulose, ethyl cellulose, carboxymethyl cellulose, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, and the like.
[0046] Lubricants, such as stearic acid or magnesium or calcium salts thereof, polytetrafluoroethylene, liquid paraffin, vegetable oils and waxes, sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol, starch, talc, pyrogenic silica, hydrated silicoaluminate, and the like, may be included in tablet formulations.
[0047] Surfactants may also be employed, for example, anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate, cationic such as benzalkonium chloride or benzethonium chloride, or nonionic detergents such as polyoxyethylene hydrogenated castor oil, glycerol monostearate, polysorbates, sucrose fatty acid ester, methyl cellulose, or carboxymethyl cellulose.
[0048] Controlled release formulations may be employed wherein the active agent or analog(s) thereof is incorporated into an inert matrix that permits release by either diffusion or leaching mechanisms. Slowly degenerating matrices may also be incorporated into the formulation. Other delivery systems may include timed release, delayed release, or sustained release delivery systems.
[0049] Coatings may be used, for example, nonenteric materials such as methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and the polyethylene glycols, or enteric materials such as phthalic acid esters. Dyestuffs or pigments may be added for identification or to characterize different combinations of active agent doses.
[0050] When administered orally in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added to the active ingredient(s). Physiological saline solution, dextrose, or other saccharide solution, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol are also suitable liquid carriers. The pharmaceutical compositions may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil, such as olive or arachis oil, a mineral oil such as liquid paraffin, or a mixture thereof. Suitable emulsifying agents include naturally-occurring gums such as gum acacia and gum tragamayth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsions may also contain sweetening and flavoring agents.
[0051] Pulmonary delivery of the active agent may also be employed. The active agent may be delivered to the lungs while inhaling and traverses across the lung epithelial lining to the blood stream. A wide range of mechanical devices designed for pulmonary delivery of therapeutic products may be employed, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. These devices employ formulations suitable for the dispensing of active agent. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to diluents, adjuvants, and/or carriers useful in therapy.
[0052] The active ingredients may be prepared for pulmonary delivery in particulate form with an average particle size of from 0.1 um or less to 10 um or more, for example, from about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 um to about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, or 9.5 um. Pharmaceutically acceptable carriers for pulmonary delivery of active agent include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations may include DPPC, DOPE, DSPC, and DOPC. Natural or synthetic surfactants may be used, including polyethylene glycol and dextrans, such as cyclodextran. Bile salts and other related enhancers, as well as cellulose and cellulose derivatives, and amino acids may also be used. Liposomes, microcapsules, microspheres, inclusion complexes, and other types of carriers may also be employed.
[0053] Pharmaceutical formulations suitable for use with a nebulizer, either jet or ultrasonic, typically comprise the active agent dissolved or suspended in water at a concentration of about 0.01 or less to 100 mg or more of active agent per mL of solution, for example, from about 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg to about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 mg per mL of solution. The formulation may also include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure). The nebulizer formulation may also contain a surfactant, to reduce or prevent surface induced aggregation of the active agent caused by atomization of the solution in forming the aerosol.
[0054] Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the active ingredients suspended in a propellant with the aid of a surfactant. The propellant may include conventional propellants, such as chlorofluorocarbons, hydrochlorofluorocarbons, hydrofluorocarbons, and hydrocarbons. Example propellants include trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, 1,1,1,2-tetrafluoroethane, and combinations thereof. Suitable surfactants include sorbitan trioleate, soya lecithin, and oleic acid.
[0055] Formulations for dispensing from a powder inhaler device typically comprise a finely divided dry powder containing active agent, optionally including a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in an amount that facilitates dispersal of the powder from the device, typically from about 1 wt. % or less to 99 wt. % or more of the formulation, for example, from about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 wt. % to about 55, 60, 65, 70, 75, 80, 85, or 90 wt. % of the formulation.
[0056] In some embodiments, an active agent provided herein may be administered by intravenous, parenteral, or other injection, in the form of a pyrogen-free, parenterally acceptable aqueous solution or oleaginous suspension. Suspensions may be formulated according to methods well known in the art using suitable dispersing or wetting agents and suspending agents. The preparation of acceptable aqueous solutions with suitable pH, isotonicity, stability, and the like, is within the skill in the art. In some embodiments, a pharmaceutical composition for injection may include an isotonic vehicle such as 1,3-butanediol, water, isotonic sodium chloride solution, Ringer's solution, dextrose solution, dextrose and sodium chloride solution, lactated Ringer's solution, or other vehicles as are known in the art. In addition, sterile fixed oils may be employed conventionally as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono or diglycerides. In addition, fatty acids such as oleic acid may likewise be used in the formation of injectable preparations. The pharmaceutical compositions may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
[0057] The duration of the injection may be adjusted depending upon various factors, and may comprise a single injection administered over the course of a few seconds or less, to 0.5, 0.1, 0.25, 0.5, 0.75, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours or more of continuous intravenous administration.
[0058] In some embodiments, the active agents provided herein may be provided to an administering physician or other health care professional in the form of a kit. The kit is a package which houses a container which contains the active agent(s) in a suitable pharmaceutical composition, and instructions for administering the pharmaceutical composition to a subject. The kit may optionally also contain one or more additional therapeutic agents currently employed for treating a disease state as described herein. For example, a kit containing one or more compositions comprising active agents provided herein in combination with one or more additional active agents may be provided, or separate pharmaceutical compositions containing an active agent as provided herein and additional therapeutic agents may be provided. The kit may also contain separate doses of a active agent provided herein for serial or sequential administration. The kit may optionally contain one or more diagnostic tools and instructions for use. The kit may contain suitable delivery devices, e.g., syringes, and the like, along with instructions for administering the active agent(s) and any other therapeutic agent. The kit may optionally contain instructions for storage, reconstitution (if applicable), and administration of any or all therapeutic agents included. The kits may include a plurality of containers reflecting the number of administrations to be given to a subject.
EXAMPLES
[0059] The following non-limiting examples are provided to further illustrate embodiments of the invention disclosed herein. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches that have been found to function well in the practice of the invention, and thus may be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes may be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
[0060] Enteroendocrine cells (EECs) are a rare population of cells found in the gastrointestinal epithelium that sense nutrients that are passing through the gut and in response secrete more than 20 distinct biologically active peptides. These peptides act in an endocrine or paracrine fashion to regulate all aspects of nutrient homeostasis including satiety, mechanical and chemical digestion, nutrient absorption, storage and utilization.sup.2. Humans' and mice.sup.4 with genetic mutations that impact formation or function of EECs have intractable malabsorptive diarrhea, metabolic acidosis, and require parenteral nutrition or small-bowel transplant for survival. These findings were the first to link EECs to the absorption of macronutrients; however, the mechanism by which EECs contribute to this vital process is unknown. Poor absorption of macronutrients is a global health concern, with underlying etiology including short-gut syndrome, enteric pathogen infection, and malnutrition. Therefore, identification of factors regulating nutrient absorption has significant therapeutic potential.
[0061] Absorption of carbohydrate and protein require coordinated activity of nutrient and ion transporters in the small intestine. Glucose is primarily absorbed via sodium-glucose cotransporter SGLT1, which uses a downhill Na.sup.+ gradient to transport one glucose or galactose molecule with two sodium ions from the lumen into the enterocyte.sup.5. The majority of dietary protein absorption occurs via PEPT1, which imports di- and tri-peptides coupled with a hydrogen ion.sup.6. The electrochemical gradients that drive nutrient absorption are maintained in part by ion transporters, including the cystic fibrosis transmembrane receptor (CFTR), which exports chloride.sup.7, and sodium-hydrogen exchanger NHE3, which maintains intracellular pH.sup.8. Activity of CFTR and NHE3 are, in turn, regulated by levels of cyclic AMP (cAMP).sup.9,10. Given that most secreted EEC peptides signal via G protein-coupled receptors to effect second messenger cascades, Applicant investigated if EECs coupled nutrient sensing to nutrient absorption by regulating electrogenic transport in neighboring enterocytes. Two well-studied peptides governing ion and water homeostasis in the colon are vasoactive intestinal peptide (VIP) and peptide YY (PYY). VIP, secreted from enteric neurons, signals via the G.sub.αs-coupled VIPR1 (VPAC1) on epithelial cells to raise levels of intracellular cAMP. In the colon, EEC-derived PYY acts in a paracrine fashion to lower cAMP via the G.sub.αi coupled receptor NPY1R.sup.11-14. Applicant posited that the mechanism underlying malabsorptive diarrhea in patients lacking EECs might be due to loss of a similar EEC-ENS regulatory feedback in the small intestine. This would disrupt both the normal ion gradients and ion-coupled nutrient absorption.
[0062] To investigate this, Applicant used EEC-deficient mice.sup.4 (VillinCre;Neurog3.sup.flox/flox) and three different human intestinal tissue models all derived from pluripotent stem cells (PSCs): human intestinal organoids (HIOs) derived in vitro.sup.15, mature intestinal tissue isolated from HIOs that were grown in vivo.sup.16, and epithelial organoids (enteroids) derived from crypts of matured HIO tissues.sup.16. Applicant generated EEC-deficient human intestinal tissue by using PSC lines that had a null mutation in NEUROG3.sup.17, the basic helix-loop-helix transcription factor required for EEC formation in mice.sup.18 and humans.sup.1. As previously reported.sup.19, NEUROG3.sup.−/− intestinal tissue completely lacked EECs, but was otherwise normal in appearance (
[0063] Given that ion and water transport in the colon is regulated by EEC-derived PYY and ENS-derived VIP, Applicant investigated if disruption of the PYY-VIP axis might affect ion and water transport in EEC-deficient small intestine. Applicant measured CFTR-mediated ion and water efflux by quantifying the swelling response.sup.26 of enteroids to exogenous VIP. EEC-deficient enteroids swelled significantly more than did wild-type, which was blocked with the CFTR inhibitor CFTR-172 (
[0064] To investigate ion transport activities in full thickness intestinal mucosa, Applicant analyzed matured human intestinal tissue in parallel with jejunum isolated from wild-type and VillinCre;Neurog3.sup.flox/flox mice.sup.4 using a modified Ussing chamber.sup.28. Applicant inhibited voltage-gated neuronal firing in mouse jejunum by including tetrodotoxin.sup.11 in all experiments so that epithelial response to exogenous VIP could be precisely monitored. Applicant observed that the basal short-circuit current (I.sub.sc), a general measure of ion transport, was consistently higher in EEC-deficient mouse and human small intestine compared to normal (
[0065] While it is known that EECs sense nutrients, the mechanism linking sensing to the control of nutrient absorption is unclear. A hint came from the effects of enteral feeding of EEC-deficient patients, which resulted in a massive diarrheal response. This suggests that an inability to sense luminal nutrients uncoupled the ability to adequately absorb them. To explore this possibility, Applicant evaluated ion-coupled nutrient absorption in EEC-deficient small intestine. Applicant observed an accelerated initial response to luminal glucose in the presence of VIP in EEC-deficient mouse and human intestinal tissues in the Ussing chamber (
[0066] Approximately 80% of ingested amino acids were recovered in the stool of the index EEC-deficient patient.sup.1, suggesting a critical role for EECs in regulating protein absorption. Consistent with this, Applicant observed a striking loss of ion-coupled dipeptide absorption when human and mouse EEC-deficient small intestine were challenged with VIP (
[0067] In vivo, the mechanism of action of PYY could be paracrine or endocrine. While PYY-expressing EECs are found in increasing numbers in the distal intestine, they are also abundant in mouse and human small intestine.sup.30 (
[0068] The above data suggested that long-term treatment with PYY may restore normal carbohydrate and amino acid absorption the intestines of EEC-deficient patients. As a preclinical model of EEC-deficiency, Applicant used VillinCre;Neurog3.sup.flox/flox mice that suffer from malabsorptive diarrhea, resulting in impaired postnatal survival.sup.4 (
[0069] Applicant investigated if the animals that survived in response to PYY injections had restored electrophysiology and improved nutrient absorption in the small intestine. Applicant found that PYY-injections restored the basal I.sub.sc of jejunum to normal (
[0070] These data suggest that PYY is sufficient to rescue the electrophysiology and absorptive function of mouse and human small intestine in the absence of all other EEC peptides. Moreover, the improvements in glucose and dipeptide absorption suggest that PYY may be a viable therapeutic option for other malabsorptive disorders, such as short-gut syndrome, malnutrition and enteric pathogen infection. Loss of EECs resulted in profound imbalance of ion transport in the small intestine, with subsequent impairment of nutrient absorption. Moreover, macronutrient absorption in mice and humans is regulated, in part, by an unappreciated PYY-VIP axis in the small intestine that operates in a paracrine fashion. These findings lend some clarity on how EECs integrate their nutrient sensing function with nutrient absorption, providing a new way to approach management of diseases, such as obesity and inflammatory bowel, in which EECs are commonly dysregulated.
Methods
[0071] Pluripotent stem cell culture and directed differentiation of HIOs
[0072] Human embryonic stem cell (ESC) line WA01 (H1) was purchased from WiCell. Applicant used H1 cells with a CRISPR/Cas9 generated null mutation in NEUROG3 as previously described.sup.17. Additionally, Applicant inserted the CDH1-mRuby2 reporter construct.sup.33 into NEUROG3−/− H1 hESCs. CDH1-mRuby2 and non-reporter hESCs were used interchangeably. hESCs were maintained in feeder-free culture. Cells were plated on hESC-qualified Matrigel (BD Biosciences, San Jose, Calif.) and maintained at 37° C. with 5% CO.sub.2 with daily removal of differentiated cells and replacement of mTeSR1 media (STEMCELL Technologies, Vancouver, Canada). Cells were passaged routinely every 4 days using Dispase (STEMCELL Technologies). HIOs were generated according to protocols established in our lab.sup.15,34.
In Vivo Transplant of HIOs
[0073] 28-35 days after spheroid generation, HIOs were removed from Matrigel and transplanted under the kidney capsule of immune deficient NOD.Cg-Prkdc.sup.scidI12rg.sup.tmIWjl/SzJ (NSG) mice as previously described.sup.16. NSG mice were maintained on Bactrim chow for a minimum of 2 weeks prior to transplantation and thereafter for the duration of the experiment (8-14 weeks).
Generation and Maintenance of HIO-Derived Enteroids
[0074] After approximately 10 weeks of in vivo growth, crypts were isolated from transplanted HIOs and plated in 3D as previous described.sup.35. To promote growth, enteroids were maintained in Human IntestiCult components A+B (STEMCELL Technologies). To promote differentiation, HIOEs were cultured in 1:1 IntestiCult component A: Advanced DMEM/F12 with 15 mM HEPES for 5-7 days. Undifferentiated enteroids were passaged every 7-10 days into fresh Matrigel (Corning) using a 25Gx½ needle.
Immunofluorescence
[0075] Tissue was fixed in 4% paraformaldehyde, cryopreserved in 30% sucrose, embedded in OCT, and frozen at −80° C. until cryosectioned. 8 μm cryosections were mounted on Superfrost Plus slides and permeabilized, blocked and stained according to standard protocol. Primary antibodies used are listed in the table below, and all secondary antibodies were conjugated to Alexa Fluor 488, 546/555/568 or 647 (Invitrogen). Images were acquired using a Nikon A1 GaAsP LUNV inverted confocal microscope and NIS Elements software (Nikon).
Primary Antibodies
[0076]
TABLE-US-00001 Primary antibody Company Host Dilution CDX2 BioGenex Mouse 1:300 CDX2 Cell Marquis Rabbit 1:500 Chromogranin A DSHB Mouse 1:500 Chromogranin A ImmunoStar Rabbit 1:250 E-Cadherin (CDH1) R&D Goat 1:500 GLUT2 Santa Cruz Goat 1:500 Muc2 Santa Cruz Rabbit 1:250 NPY1R Abcam Rabbit 1:250 PEPT1 Santa Cruz Rabbit 1:500 PYY Abcam Rabbit 1:1000 SGLT1 Santa Cruz Rabbit 1:250 VIPR1 Millipore Mouse 1:200
qPCR
[0077] RNA was extracted using Nucleospin RNA extraction kit (Macharey-Nagel) and reverse transcribed into cDNA using Superscript VILO (Invitrogen) according to manufacturer's instruction. qPCR primers were designed using NCBI PrimerBlast. Primer sequences are listed in the table below. qPCR was performed using Quantitect SYBR® Green PCR kit (QIAGEN) and a QuantStudio 3 Flex Real-Time PCR System (Applied Biosystems). Relative expression was determined using the AACt method and normalizing to PPIA (cyclophilin A). Samples from at least three independent passages were used for quantification.
Primer Sequences
[0078]
TABLE-US-00002 PPIA (CPHA) FWD CCCACCGTGTTCTTCGACATT (SEQ ID NO: 1) PPIA (CPHA) REV GGACCCGTATGCTTTAGGATGA (SEQ ID NO: 2) CFTR FWD GGCACCCAGAGTAGTAGGTC (SEQ ID NO: 3) CFTR REV AGGCGCTGTCTGTATCCTTT (SEQ ID NO: 4) SLC9A3 (NHE3) FWD GCTGGTCTTCATCTCCGTGT (SEQ ID NO: 5) SLC9A3 (NHE3) REV CCAGAGGCTTGATGGTCAGG (SEQ ID NO: 6)
Swelling Assay
[0079] Enteroids were plated in 10 μL Matrigel on an 8-chamber glass bottom slide (Ibidi) and maintained as described above. 3-5 days post-plating, the slide was mounted on an inverted confocal microscope (Nikon) fitted with an incubation chamber set to 37° C. and 5% CO.sub.2. Media was changed to include 10 nM VIP (Tocris). In some experiments, the media was changed 24 hours prior to imaging to include 20 μM CFTR (inh)-172 (Millipore Sigma) or 10 nM PYY (Phoenix Pharmaceuticals). Images were acquired every 5 minutes at 4× magnification. After 6 hours, some HIOEs swelled to the point of bursting; therefore, Applicant used images acquired at time 0 and at 6 hours for quantification. The area of 10 representative enteroids per well was quantified using NIS Elements software at both time points. The outline of individual enteroids was traced manually and the area calculated by NIS Elements. Fold change at 6 hours over baseline was reported. Data include a minimum of three independent experiments per condition.
NHE3 Activity Assay
[0080] NHE3 activity was determined as previously described.sup.27 with minor modifications. Enteroids were plated in 5 μL Matrigel on an 8-chamber glass bottom slide (Ibidi) and maintained as described above. 3-5 days post-plating, media was changed to Na.sup.+ media containing 5 μM SNARF-4F 5-(and-6)-carboxylic acid, acetoxymethyl ester, acetate (Molecular Probes) and allowed to incubate for 30 minutes. The slide was then mounted on an inverted confocal microscope (Nikon), fitted with an incubation chamber set to 37° C. and 5% CO.sub.2. Fresh Na.sup.+ media was provided before image acquisition Images were acquired every 2 minutes for 2 hours at 10×magnification with excitation at 488 nm and emission at 561 nm and 640 nm. Media was changed to NH.sub.4Cl to acid-load the epithelium, then to tetramethylammonium (TMA) media to withdraw Na.sup.+. Na.sup.+ containing media was then added and NHE3 activity quantified as a measure of initial pH recovery. 1 mM probenecid and 5 μM SNARF were present in all buffers, and all buffers were set to pH 7.4. Intracellular pH was calibrated using the Intracellular pH Calibration Buffer kit (Invitrogen) at pH 7.5, 6.5 and 5.5 in the presence of 10 μM valinomycin and 10 μM nigericin at the conclusion of each experiment. The ratio of 561/640 was determined using NIS Elements software by drawing a region of interest and quantifying the fluorescence intensity of each wavelength over the period of the experiment. A minimum of 3 enteroids in 3 wells over two independent passages were quantified. The ratio of 561/640 was converted to intracellular pH using the equation provided by the manufacturer.
[0081] Na.sup.+ media: 130 mM NaCl, 5 mM KCl, 2 mM CaCl.sub.2, 1 mM MgSO.sub.4, 20 mM HEPES, 5 mM NaOH, 1 mM (Na)PO.sub.4, 25 mM D-glucose
[0082] NH.sub.4Cl media: 25 mM NH.sub.4Cl, 105 mM NaCl, 2 mM CaCl.sub.2, 1 mM MgSO.sub.4, 20 mM HEPES, 8 mM NaOH, 5 mM KCl, 1 mM (Na)PO.sub.4, 25 mM D-glucose
[0083] TMA media: 130 mM TMA-Cl, 5 mM KCl, 2 mM CaCl.sub.2, 1 mM MgSO.sub.4, 20 mM HEPES, 8 mM TMA-OH, 1 mM (TMA)PO.sub.4, 25 mM D-glucose
Electrophysiology
[0084] Electrophysiological experiments were conducted as described.sup.28 with minor modifications. Mouse jejunum and transplanted HIOs were dissected and immediately placed in ice-cold Krebs-Ringer solution. Tissues were opened to create a flat epithelial surface. Because seromuscular stripping is associated with release of cyclooxygenases and prostaglandins.sup.28, and prostaglandins can stimulate L-cells to release GLP1, GLP2 and PYY.sup.36, Applicant performed the Ussing chamber experiments in intestinal tissue with an intact muscular layer. Tissues were mounted into sliders (0.031 cm.sup.2 area slider, P2307, Physiological Instruments) and placed in an Ussing chamber with reservoirs containing 5 mL buffer (115 mM NaCl, 1.2 mM CaCl.sub.2, 1.2 mM MgCl.sub.2, 25 mM NaHCO.sub.3, 2.4 mM K.sub.2HPO.sub.4 and 0.4 mM KH.sub.2PO.sub.4). The mucosal and serosal tissue surfaces were bathed in the same solution, with the exception of 10 mM glucose in the serosal buffer and 10 mM mannitol in the luminal buffer. Mucosal and serosal reservoir solutions were gassed with 95% O.sub.2 and 5% CO.sub.2 to pH 7.4 and maintained at 37° C. by a circulating water bath behind the reservoir chambers. Electrophysiology parameters were recorded as previously described.sup.37. Tissue was allowed to equilibrate to a basal steady-state for a minimum of 30 minutes before the addition of chemicals or peptides. 10 nM tetrodotoxin (Tocris) was added to the serosal buffer bathing mouse intestine to inhibit voltage-gated neuronal firing and allowed to incubate for a minimum of 10 minutes before basal I.sub.sc recording. D-glucose and Gly-Sar were added to the luminal side of the chamber once the VIP-induced I.sub.sc had stabilized at a maximum value.
TABLE-US-00003 TABLE Tetrodotoxin Tocris 10 nM final BIBO3304 trifluoroacetate Tocris 300 nM final VIP Tocris 10 nM final PYY(1-36) Phoenix Pharmaceuticals 10 nM final CFTR-172 Millipore Sigma 20 μM D-glucose Sigma Aldrich 25 mM final Gly-Sar Sigma Aldrich 20 mM final
Glucose Uptake Assays
6-NBDG
[0085] Transplanted HIOs were removed from the murine kidney, bisected to expose the lumen, and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37° C. Tissues were washed with ice-cold 10 mM Tris/HEPES buffer, then dissociated to single-cell suspension in 5 mL Tryple Select (Gibco)+10 μM Y-27632 (Tocris), filtered, and subjected to analysis by flow cytometry.
Sodium Green
[0086] HIOEs were differentiated for 5-7 days, then were removed from Matrigel and enzymatically dissociated into single-cell suspension using 0.25% Trypsin-EDTA. Each cell preparation was split into two samples: one incubated with 25 mM D-glucose and one incubated in the absence of glucose. Each sample was incubated in Live Cell Imaging Solution (Invitrogen) containing 5 μM final concentration of Sodium Green tetraacetate (Molecular Probes) for 30 minutes at 37° C., washed with ice-cold PBS and analyzed by flow cytometry.
2-NBDG on Transwell filters
[0087] Undifferentiated enteroids that were “ready to split” were dissociated and plated on transwell inserts (Corning) as previously described.sup.38, with the exception of first coating the transwells with Collagen IV (Sigma-Aldrich). 300,000 cells were plated per 6.5 mm transwell insert. Differentiation was initiated at 24 hours post-plating and monolayers were analyzed after 5-7 days. 1 mM fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Life Technologies) was diluted in Live Cell Imaging Solution (Invitrogen) containing 25 mM D-glucose, added to the apical surface of HIOE monolayers and the fluorescence intensity of fresh Live Cell Imaging Solution in the basal chamber was quantified after 30 minutes at 37° C. Intact barrier function was confirmed by co-incubation, quantification and exclusion of Cascade Blue conjugated 3000 MW dextran (Life Technologies) in every experiment.
Intracellular pH Assay
[0088] Enteroids were differentiated for 5-7 days in the presence of vehicle (water), 10 nM VIP (Tocris) or 10 nM PYY (Phoenix Pharmaceuticals) and 10 nM VIP. On the final day, enteroids were removed from Matrigel and enzymatically dissociated into single-cell suspension using 0.25% Trypsin-EDTA. Cell suspensions were counted and equal cell numbers of dissociated HIOEs were incubated in pHrodo Green AM Intracellular pH indicator (ThermoFisher Scientific) according to manufacturer's directions for 30 minutes at 37 C., washed with 1X PBS, and analyzed by flow cytometry.
Flow Cytometry
[0089] After mechanical and enzymatic dissociation, tissues were filtered through a 40 μm cell strainer to obtain a single-cell suspension. In all experiments, samples were labeled with either CDH1-mRuby2 or Anti-EpCam-APC (BD Biosciences) to distinguish epithelial cells and incubated with SYTOX Blue dead cell stain (Life Technologies) or 7-AAD (BD Pharmingen). Forward scatter and side scatter were used to discriminate doublets and cellular debris. A minimum of 50,000 events per sample was recorded using an LSR Fortessa flow cytometer (BD Biosciences) and data was analyzed using FACSDiva software (BD Biosciences).
Mice
[0090] VillinCre; Neurog3.sup.flox/flox mice4 and B6.Cg-Gt(ROSA)26Sor.sup.tm9(CAG-tdTomato)Hze/J (tdTomato)39 mice were genotyped as previously described. Mice were housed in a specific pathogen free barrier facility in accordance with NIH Guidelines for the Care and Use of Laboratory Animals. All experiments were approved by the Cincinnati Children's Hospital Research Foundation Institutional Animal Care and Use Committee (IACUC2019-0006) and carried out using standard procedures. Mice were maintained on a 12-hour light/dark cycle and had ad libitum access to standard chow and water.
[0091] VillinCre;Neurog3.sup.flox/flox mice.sup.4 and their littermates were weighed, genotyped and visually examined for liquid feces daily beginning at postnatal day 10. Applicant established a diarrhea score, with 3 representing wet, yellow feces that smeared the perianal fur, and 0 representing normal, dry, brown, well-defined pellets. Mutant mice which suffered from diarrhea score 3 were included in the rescue experiment. 10 μg PYY (Phoenix Pharmaceuticals) was diluted in water and added to 20 μl DPP4 inhibitor (Millipore) to a final volume of 100 μl per mouse. Mice were injected intraperitoneally with this cocktail within 2 hours of the onset of the dark cycle (7 pm) daily until analysis at postnatal day 28-35. Mice were given access to solid chow on the floor of the cage beginning at postnatal day 10 and weaned at postnatal day 21.
[0092] NSG mice hosting HIOs were treated with 25 μg PYY (Phoenix Pharmaceuticals) diluted in water to 100 μL by intraperitoneal injection. Mice were treated daily for a minimum of 10 days after HIOs had been maturing for 8 weeks, then dissected and analyzed.
Statistics
[0093] Data is presented as the mean+s.e.m. unless otherwise indicated. Significance was determined using unpaired, two-tailed Student's t-test, with p>0.05 not significant; *p<0.05, **p<0.01, ***p<0.001.
REFERENCES
[0094] 1 Wang, J. et al. Mutant neurogenin-3 in congenital malabsorptive diarrhea. New England Journal of Medicine 355, 270-280 (2006).
[0095] 2 Gribble, F. M. & Reimann, F Function and mechanisms of enteroendocrine cells and gut hormones in metabolism. Nat Rev Endocrinol 15, 226-237, doi:10.1038/s41574-019-0168-8 (2019).
[0096] 3 Cox, H. M. Neuroendocrine peptide mechanisms controlling intestinal epithelial function. Current Opinion in Pharmacology 31, 50-56 (2016).
[0097] 4 Mellitzer, G. et al. Loss of enteroendocrine cells in mice alters lipid absorption and glucose homeostasis and impairs postnatal survival. The Journal of clinical investigation 120, 1708-1721 (2010).
[0098] 5 Wright, E. M., Loo, D. D. F. & Hirayama, B. A. Biology of human sodium glucose transporters. Physiological reviews 91, 733-794 (2011).
[0099] 6 Chen, M. et al. Gene ablation for PEPT1 in mice abolishes the effects of dipeptides on small intestinal fluid absorption, short-circuit current, and intracellular pH. American Journal of Physiology-Gastrointestinal and Liver Physiology 299, G265-G274 (2010).
[0100] 7 Wright, E. M., Hirsch, J. R., Loo, D. D. & Zampighi, G. A.
[0101] Regulation of Na+/glucose cotransporters. Journal of Experimental Biology 200, 287-293 (1997).
[0102] 8 Thwaites, D. T. et al. H+/dipeptide absorption across the human intestinal epithelium is controlled indirectly via a functional Na+/H+ exchanger. Gastroenterology 122, 1322-1333 (2002).
[0103] 9 Burleigh, D. E. & Banks, M. R. Stimulation of intestinal secretion by vasoactive intestinal peptide and cholera toxin. Autonomic Neuroscience 133, 64-75, doi:https://doi.org/10.1016/j.autneu.2006.08.004 (2007).
[0104] 10 Yun, C. H. C. et al. cAMP-mediated inhibition of the epithelial brush border Na+/H+ exchanger, NHE3, requires an associated regulatory protein. Proceedings of the National Academy of Sciences 94, 3010-3015 (1997).
[0105] 11 Hyland, N. P., Sjoberg, F., Tough, I. R., Herzog, H. & Cox, H. M. Functional consequences of neuropeptide Y Y 2 receptor knockout and Y2 antagonism in mouse and human colonic tissues. Br J Pharmacol 139, 863-871, doi:10.1038/sj.bjp.0705298 (2003).
[0106] 12 Cox, H. M. et al. Peptide YY is critical for acylethanolamine receptor Gpr119-induced activation of gastrointestinal mucosal responses. Cell Metab 11, 532-542, doi:10.1016/j.cmet.2010.04.014 (2010).
[0107] 13 Tough, I. R. et al. Endogenous peptide YY and neuropeptide Y inhibit colonic ion transport, contractility and transit differentially via Y1 and Y2 receptors. British journal of pharmacology 164, 471-484 (2011).
[0108] 14 Moodaley, R., Smith, D. M., Tough, I. R., Schindler, M. & Cox, H. M. Agonism of free fatty acid receptors 1 and 4 generates peptide YY-mediated inhibitory responses in mouse colon. British journal of pharmacology 174, 4508-4522 (2017).
[0109] 15 Spence, J. R. et al. Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature 470, 105 (2011).
[0110] 16 Watson, C. L. et al. An in vivo model of human small intestine using pluripotent stem cells. Nature medicine 20, 1310 (2014).
[0111] 17 McGrath, P. S., Watson, C. L., Ingram, C., Helmrath, M. A. & Wells, J. M. The Basic Helix-Loop-Helix Transcription Factor NEUROG3 Is Required for Development of the Human Endocrine Pancreas. Diabetes 64, 2497-2505, doi:10.2337/db14-1412 (2015).
[0112] 18 Jenny, M. et al. Neurogenin3 is differentially required for endocrine cell fate specification in the intestinal and gastric epithelium. Embo j 21, 6338-6347 (2002).
[0113] 19 Zhang, X. et al. A Comprehensive Structure-Function Study of Neurogenin3 Disease-Causing Alleles during Human Pancreas and Intestinal Organoid Development. Developmental Cell, doi:https://doi.org/10.1016/j.devce1.2019.05.017 (2019).
[0114] 20 Bohorquez, D. V. et al. An enteroendocrine cell-enteric glia connection revealed by 3D electron microscopy. PLoS One 9, e89881, doi:10.1371/journal.pone.0089881 (2014).
[0115] 21 Kaelberer, M. M. et al. A gut-brain neural circuit for nutrient sensory transduction. Science 361, eaat5236 (2018).
[0116] 22 Bohorquez, D. V. et al. Neuroepithelial circuit formed by innervation of sensory enteroendocrine cells. J Clin Invest 125, 782-786, doi:10.1172/jci78361 (2015).
[0117] 23 Panaro, B. L. et al. The melanocortin-4 receptor is expressed in enteroendocrine L cells and regulates the release of peptide YY and glucagon-like peptide 1 in vivo. Cell metabolism 20, 1018-1029 (2014).
[0118] 24 Egerod, K. L. et al. Profiling of G protein-coupled receptors in vagal afferents reveals novel gut-to-brain sensing mechanisms. Mol Metab 12, 62-75, doi:10.1016/j.molmet.2018.03.016 (2018).
[0119] 25 McCauley, H. A. Enteroendocrine regulation of nutrient absorption. Journal of Nutrition, doi:nxz191 (2019).
[0120] 26 Dekkers, J. F. et al. A functional CFTR assay using primary cystic fibrosis intestinal organoids. Nature Medicine 19, 939, doi:10.1038/nm.3201.
[0121] 27 Foulke-Abel, J. et al. Human Enteroids as a Model of Upper Small Intestinal Ion Transport Physiology and Pathophysiology. Gastroenterology 150, 638-649 e638 (2016).
[0122] 28 Clarke, L. L. A guide to Ussing chamber studies of mouse intestine. Am J Physiol Gastrointest Liver Physiol 296, G1151-1166, doi:10.1152/ajpgi.90649.2008 (2009).
[0123] 29 Anderson, C. M. H., Mendoza, M. E., Kennedy, D. J., Raldua, D. & Thwaites, D. T. Inhibition of intestinal dipeptide transport by the neuropeptide VIP is an anti-absorptive effect via the VPAC1 receptor in a human enterocyte-like cell line (Caco-2). British Journal of Pharmacology 138, 564-573, doi:10.1038/sj.bjp.0705049 (2003).
[0124] 30 Egerod, K. L. et al. A major lineage of enteroendocrine cells coexpress CCK, secretin, GIP, GLP-1, PYY, and neurotensin but not somatostatin. Endocrinology 153, 5782-5795 (2012).
[0125] 31 Mentlein, R., Dahms, P., Grandt, D. & Kruger, R. Proteolytic processing of neuropeptide Y and peptide YY by dipeptidyl peptidase IV. Regul Pept 49, 133-144 (1993).
[0126] 32 Batterham, R. L. et al. Gut hormone PYY3-36 physiologically inhibits food intake.
[0127] 33 Ouchi, R. et al. Modeling Steatohepatitis in Humans with Pluripotent Stem Cell-Derived Organoids. Cell Metabolism, doi:https://doi.org/10.1016/j.cmet.2019.05.007 (2019).
[0128] All percentages and ratios are calculated by weight unless otherwise indicated.
[0129] All percentages and ratios are calculated based on the total composition unless otherwise indicated.
[0130] It should be understood that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
[0131] The dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited. Instead, unless otherwise specified, each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value. For example, a dimension disclosed as “20 mm” is intended to mean “about 20 mm.”
[0132] Every document cited herein, including any cross referenced or related patent or application, is hereby incorporated herein by reference in its entirety unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone, or in any combination with any other reference or references, teaches, suggests or discloses any such invention. Further, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.
[0133] While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications may be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.