METHODS TO QUANTIFY VIRUS FROM WASTEWATER
20220119897 · 2022-04-21
Assignee
Inventors
Cpc classification
C12Q1/705
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a method of detecting and quantifying a virus-of-interest from human viral shed in a community, including: concentrating viral material from a wastewater sample to form a viral nucleic acid material; measuring an amount of a virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; measuring an amount of a marker or bacteriophage nucleic acid in the viral nucleic acid material to obtain a second amount; and forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest from human viral shed within a community. In embodiments, methods for quantifying, monitoring, and/or identifying virus-of-interest such as SARS-CoV-2 are also disclosed.
Claims
1. A method of detecting and quantifying a virus-of-interest from human viral shed in a community, comprising: concentrating viral material from a wastewater sample to form a viral nucleic acid material; measuring an amount of a virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; measuring an amount of a bacteriophage nucleic acid in the viral nucleic acid material to obtain a second amount; and forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest from human viral shed within a community.
2. The method of claim 1, wherein the virus-of-interest is an orthomyxovirus, influenza virus, influenza A, influenza B, an RNA virus, or a DNA virus.
3. The method of claim 2, wherein the RNA virus is characterized as one of Reoviridae, Picornaviridae, Caliciviridae, Togaviridae, Arenaviridae, Retroviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, Bunyaviridae, Rhabdoviridae, Filoviridae, Coronaviridae, Astroviridae, or Bornaviridae.
4. The method of claim 2, wherein the DNA virus is characterized as Adenoviridae, Papovaviridae, Parvoviridae, Herpesviridae, Poxviridae, or Hepadnaviridae.
5. The method of claim 1, wherein the virus-of-interest is SARS-CoV-2 or a SARS-CoV-2 variant.
6. The method of claim 1, wherein the bacteriophage nucleic acid is cross-assembly phage nucleic acid.
7. The method of claim 1, wherein concentrating viral material further comprises centrifuging the viral material through a sugar cushion in an ultracentrifuge.
8. The method of claim 1, wherein concentrating viral material further comprises centrifuging the viral material through a sugar gradient in an ultracentrifuge.
9. The method of claim 7, wherein centrifuging the viral material through a sugar cushion in an ultracentrifuge further comprises forming a solution comprising a buffer and sugar.
10. The method of claim 9, wherein the solution comprises a sugar in the amount of 40 to 60 percent weight of the total solution.
11. The method of claim 10, wherein the sugar comprises sucrose in an amount of about 50 percent weight of the total solution.
12. The method of claim 1, wherein the viral material comprises inactivated or fragmented virus.
13. The method of claim 1, wherein concentrating viral material from a wastewater sample to form a viral nucleic acid material is performed under conditions to purify the viral material.
14. The method of claim 1, wherein measuring the amount of virus-of-interest nucleic acid and bacteriophage nucleic acid is performed by qPCR analysis comprising one or more fluorescent materials.
15. A method of monitoring a virus-of-interest human transmission in a community, comprising: (a) concentrating viral material from a wastewater sample to form a viral nucleic acid material; (b) measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; (c) measuring an amount of bacteriophage nucleic acid in the viral nucleic acid material to obtain a second amount; (d) forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest human viral shed within a community; and (e) repeating (a)-(d) in an amount sufficient to monitor virus-of-interest transmissions within a community.
16. The method of claim 15, wherein concentrating viral material further comprises centrifuging the viral material through a sugar cushion in an ultracentrifuge.
17. The method of claim 16, wherein centrifuging the viral material through a sugar cushion in an ultracentrifuge further comprises forming a solution comprising a buffer and sugar.
18. The method of claim 17, wherein the solution comprises a sugar in the amount of 40 to 60 percent weight of the total gradient-forming solution.
19. The method of claim 18, wherein the sugar comprises sucrose in an amount of about 50 percent weight of the total solution.
20. The method of claim 15, wherein the virus-of-interest is SARS-CoV-2.
21. A method of detecting and/or quantifying a virus-of-interest in wastewater, comprising: concentrating viral material from a wastewater sample to form a viral nucleic acid material, wherein concentrating comprises centrifuging the viral material through a sugar cushion in an ultracentrifuge; measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to detect and/or quantify the virus-of-interest.
22. The method of claim 21, wherein centrifuging the viral material through a sugar cushion in an ultracentrifuge further comprises forming a solution comprising a buffer and sugar.
23. The method of claim 22, wherein the solution comprises a sugar in the amount of 40 to 60 percent weight of the total solution.
24. The method of claim 23, wherein the sugar comprises sucrose in an amount of about 50 percent weight of the total solution.
25. The method of claim 21, wherein the wastewater is characterized as an aliquot of less than 50 mL of raw wastewater.
26. The method of claim 21, wherein concentrating viral material comprises purifying the nucleic acid of the viral material.
27. The method of claim 21, wherein the virus-of-interest is SARS-CoV-2 or a SARS-CoV-2 variant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTINGS
[0017] Embodiments of the present disclosure, briefly summarized above and discussed in greater detail below, can be understood by reference to the illustrative embodiments of the disclosure depicted in the appended drawings. However, the appended drawings illustrate only typical embodiments of the disclosure and are therefore not to be considered limiting of scope, for the disclosure may admit to other equally effective embodiments.
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038] SEQ ID NO: 1 oligonucleotide sequence for nCoV_IP2-12669Fw. [0039] SEQ ID NO: 2 oligonucleotide sequence for nCoV_IP2-12759Rv. [0040] SEQ ID NO: 3 oligonucleotide sequence for nCoV_IP2-12696bProbe(+). [0041] SEQ ID NO: 4 oligonucleotide sequence for nCoV_IP4-14059Fw. [0042] SEQ ID NO: 5 oligonucleotide sequence for nCoV_IP4-14-14146Rv. [0043] SEQ ID NO: 6 oligonucleotide sequence for nCoV_IP4-14084Probe(+). [0044] SEQ ID NO: 7 oligonucleotide sequence for 056F1. [0045] SEQ ID NO: 8 oligonucleotide sequence for 056R1. [0046] SEQ ID NO: 9 oligonucleotide sequence for056P1. [0047] SEQ ID NO: 10 is a primer for the 69-70 S deletion assay described below. [0048] SEQ ID NO: 11 is a primer shown in Table 21 below. [0049] SEQ ID NO: 12 is a primer shown in Table 21 below. [0050] SEQ ID NO: 13 is depicted in
[0052] It is noted that the drawings of the disclosure are not necessarily to scale. The drawings are intended to depict only typical aspects of the disclosure, and therefore should not be considered as limiting the scope of the disclosure. In the drawings, like numbering represents like elements between the drawings.
DETAILED DESCRIPTION
[0053] The compositions and methods described herein include methods for detecting and/or quantifying virus-of-interest in wastewater, such as from a sewer system, methods of recovering nucleic acids from virus-of-interest in wastewater, methods of concentrating, enriching, and/or purifying viral nucleic acids from wastewater, and methods of surveilling wastewater to estimate or determine incidence of viral disease in a community. In some embodiments, the methods described herein advantageously: detect low levels of viral nucleic acid from wastewater such as wastewater having high levels of contamination; enable small volume sample collection, such as e.g, less than 50 mL of wastewater; and provide for a marker in wastewater useful in surveilling wastewater and estimating or determining incidence of viral disease in a community. Moreover, as SARS-CoV-2 variants continue to develop, the methods of the present disclosure are suitable for determining the relative frequency of one or more viral strains in a wastewater sample and/or performing mixture modelling to determine the relative frequency of one or more viral strains/isolates, such as one or more of SARS-CoV-2 or a variant thereof causing disease in an upstream geographical location. Performing the methods of the present disclosure is beneficial from an epidemiological perspective in that data generated may be used to form or alter containment or treatment strategies for communities and individuals therein.
Definitions
[0054] As used in the present specification, the following words and phrases are generally intended to have the meanings as set forth below, except to the extent that the context in which they are used indicates otherwise.
[0055] As used herein, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “a compound” include the use of one or more compound(s).
[0056] As used herein the terms “about,” “approximately,” and the like, when used in connection with a numerical variable, generally refers to the value of the variable and to all values of the variable that are within the experimental error (e.g., within the 95% confidence interval [CI 95%] for the mean) or within ±10% of the indicated value, whichever is greater.
[0057] As used herein the term “cDNA” refers to a DNA molecule that can be prepared by reverse transcription from an RNA molecule obtained from a eukaryotic or prokaryotic cell, a virus, or from a sample solution in embodiments, cDNA lacks introns or intron sequences that may be present in corresponding genomic DNA. In embodiments, cDNA may refer to a nucleotide sequence that corresponds to the nucleotide sequence of an RNA from which it is derived. In embodiments, cDNA refers to a double-stranded DNA that is complementary to and derived from mRNA.
[0058] As used herein the “degree of identity” refers to the relatedness between two amino acid sequences or between two nucleotide sequences and is described by the parameter “identity”. In embodiments, the degree of sequence identity between a query sequence and a reference sequence is determined by: 1) aligning the two sequences by any suitable alignment program using the default scoring matrix and default gap penalty; 2) identifying the number of exact matches, where an exact match is where the alignment program has identified an identical amino acid or nucleotide in the two aligned sequences on a given position in the alignment; and 3) dividing the number of exact matches with the length of the reference sequence. In one embodiment, the degree of sequence identity between a query sequence and a reference sequence is determined by: 1) aligning the two sequences by any suitable alignment program using the default scoring matrix and default gap penalty; 2) identifying the number of exact matches, where an exact match is where the alignment program has identified an identical amino acid; or nucleotide in the two aligned sequences on a given position in the alignment; and 3) dividing the number of exact matches with the length of the longest of the two sequences. In some embodiments, the degree of sequence identity refers to and may be calculated as described under “Degree of Identity” in U.S. Pat. No. 10,531,672 starting at Column 11, line 56. U.S. Pat. No. 10,531,672 is incorporated by reference in its entirety. In embodiments, an alignment program suitable for calculating percent identity performs a global alignment program, which optimizes the alignment over the full-length of the sequences. In embodiments, the global alignment program is based on the Needleman-Wunsch algorithm (Needleman, Saul B.; and Wunsch, Christian D. (1970), “A general method applicable to the search for similarities in the amino acid sequence of two proteins”, Journal of Molecular Biology 48 (3): 443-53). Examples of current programs performing global alignments using the Needleman-Wunsch algorithm are EMBOSS Needle and EMBOSS Stretcher programs, which are both available on the world wide web at www.ebi.ac.uk/Tools/psa/. In some embodiments a global alignment program uses the Needleman-Wunsch algorithm and the sequence identity is calculated by identifying the number of exact matches identified by the program divided by the “alignment length”, where the alignment length is the length of the entire alignment including gaps and overhanging parts of the sequences. In embodiments, the mafft alignment program is suitable for use herein.
[0059] The terms “deoxyribonucleotide” and “DNA” refer to a nucleotide or polynucleotide including at least one ribosyl moiety that has an H at the 2′ position of a ribosyl moiety. In embodiments, a deoxyribonucleotide is a nucleotide having an H at its 2′ position
[0060] The term “isolated” refers to a protein or DNA sequence that is removed from at least one component with which it is naturally associated.
[0061] By “hybridizable” or “complementary” or “substantially complementary” a nucleic acid (e.g. RNA, DNA) includes a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and/or G/U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine/adenosine) (A) pairing with thymidine/thymidine (T), A pairing with uracil/uridine (U), and guanine/guanosine) (G) pairing with cytosine/cytidine (C). In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g., when a DNA target nucleic acid base pairs with a guide RNA, etc.): G can also base pair with U. For example, G/U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. In embodiments, hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more). It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure, a ‘bulge’, and the like). A polynucleotide can include 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. The remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).
[0062] An “isolated nucleic acid molecule” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid molecule in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
[0063] The term “nucleotide” refers to a ribonucleotide or a deoxyribonucleotide or modified form thereof, as well as an analog thereof.
[0064] As used herein, the term “nucleic acid molecule” refers to any molecule containing multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). As described further below, bases include C, T, U, C, and G, as well as variants thereof. As used herein, the term refers to ribonucleotides (including oligoribonucleotides (ORN)) as well as deoxyribonucleotides (including oligodeoxynucleotides (ODN)). The term shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but include synthetic (e.g., produced by oligonucleotide synthesis). In embodiments, the terms “nucleic acid” “nucleic acid molecule” and “polynucleotide” may be used interchangeably herein, and refer to both RNA and DNA, including cDNA, genomic DNA, synthetic DNA, and DNA (or RNA) containing nucleic acid analogs. Polynucleotides can have any three-dimensional structure. A nucleic acid can be double-stranded or single-stranded (i.e., a sense strand or an antisense strand). Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA) and portions thereof, transfer RNA, ribosomal RNA, siRNA, micro-RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers, as well as nucleic acid analogs.
[0065] In embodiments, the term “oligonucleotide” refers to a polynucleotide of between 4 and 100 nucleotides of single- or double-stranded nucleic acid (e.g., DNA, RNA, or a modified nucleic acid). However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as “oligomers” or “oligos” and can be isolated from genes, transcribed (in vitro and/or in vivo), or chemically synthesized.
[0066] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
[0067] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, terms “polynucleotide” and “nucleic acid” encompass single-stranded DNA; double-stranded DNA; multi-stranded DNA; single-stranded RNA; double-stranded RNA; multi-stranded RNA; genomic DNA; cDNA; DNA-RNA hybrids; and a polymer including purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms “polynucleotide” and “nucleic acid” should be understood to include, as applicable to the embodiments being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
[0068] As used herein the term “prevent”, “preventing” and “prevention” of viral disease means (1) reducing the risk of a patient who is not experiencing symptoms of viral infection from developing viral disease, or (2) reducing the frequency of, the severity of, or a complete elimination of viral symptoms already being experienced by a subject.
[0069] As used herein, the term “virus-of-interest” refers to a virus or a portion of a virus subject to detecting, quantifying, concentrating, or monitoring in accordance with the present disclosure. In some embodiments, a virus-of-interest may include a Coronavirus such as SARS-CoV-2, SARS-CoV-2 variant, or a fragment thereof.
[0070] As used here, the term “SARS-CoV-2” refers to virus classified within the genus Betacoronavirus (subgenus Sarbecovirus) in the family Coronaviridae (subfamily Orthocoronavirinae), a family of single-strand positive-sense RNA viruses. In embodiments, the term “SARS-CoV-2” includes variants of SARS-CoV-2.
[0071] The term “substantially purified,” as used herein, refers to a component of interest that may be substantially or essentially free of other components which normally accompany or interact with the component of interest prior to purification. By way of example only, a component of interest may be “substantially purified” when the preparation of the component of interest contains less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% (by dry weight) of contaminating components. Thus, a “substantially purified” component of interest may have a purity level of about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or greater. In embodiments, a component of interest includes a virus-of-interest, such as SARS-CoV-2 or a variant thereof.
[0072] “Substantially similar” refers to nucleic acid molecules wherein changes in one or more nucleotide bases result in substitution of one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. “Substantially similar” also refers to nucleic acid molecules wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid molecule to mediate alteration of gene expression by antisense or co-suppression technology. “Substantially similar” also refers to modifications of the nucleic acid molecules of the instant disclosure (such as deletion or insertion of one or more nucleotide bases) that do not substantially affect the functional properties of the resulting transcript vis-a-vis the ability to mediate alteration of gene expression by antisense or co-suppression technology or alteration of the functional properties of the resulting protein molecule. The disclosure encompasses more than the specific exemplary sequences.
[0073] As used herein the term “treat”, “treating” and “treatment” of viral disease means reducing the frequency of symptoms of viral disease, eliminating the symptoms of viral disease, avoiding or arresting the development of symptoms of viral disease, ameliorating or curing an existing or undesirable symptom caused by viral disease, and/or reducing the severity of symptoms of viral disease.
[0074] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.
[0075] Before embodiments are further described, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0076] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0077] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
Description of Certain Embodiments
[0078] The present disclosure relates to a combined set of methods for detecting, enriching, and/or quantifying virus-of-interest in wastewater, such as from a sewer system. In embodiments, methods of the present disclosure include: recovering nucleic acids from virus-of-interest in wastewater; concentrating, enriching, and/or purifying or substantially purifying viral nucleic acids from wastewater; and surveilling wastewater to estimate or determine incidence of viral disease in a community. In embodiments, the virus-of-interest is SARS-CoV-2 and/or one or more variants of SARS-CoV-2. In embodiments, virus-of-interest is characterized as substantially purified by the methods of the present disclosure.
[0079]
[0080] In embodiments, virus-of-interest includes SARS-CoV-2 and variants of SARS-CoV-2. In embodiments, the term SARS-CoV-2 includes virus from a reference strain of SARS-CoV-2 referred to as Wuhan-Hu-1 (GenBank accession MN908947) or ‘the original Wuhan strain’, sampled from a patient in Wuhan, China, on 26 Dec. 2019. As used herein the term SARS-CoV-2 includes variants of SARS-CoV-2. Although nomenclature for SARS-CoV-2 variants is not uniform one of ordinary skill in the art understands that established nomenclature for naming and tracking SARS-CoV-2 genetic lineages by GISAID, Nextstrain, and Pango are currently in use. Recently, the World Health Organization (WHO) recommended labeling SARS-CoV-2 variants using letters of the Greek Alphabet to refer to variants, such as variants of concern and variants of interest (See e.g., the world wide web at www.who.int/en/activities/tracking-SARS-CoV-2-variants/.). Accordingly, non-limiting examples of SARS-COV-2 variants include variants of concern, or variants having an observed increase in transmissibility or detrimental change in the COVID 19 epidemiology, increase in virulence or change in clinical presentation, or decrease in effectiveness of preventative measures such as social distancing and vaccination. Non-limiting examples of current variants-of-concern include the Alpha, Beta, Gamma, and Delta (WHO labelled variants), or B.1.17 (documented first in the U.K.), B.1.351 (documented first in South Africa), P.1 (documented first in Brazil), B.1.617.2 (documented first in India) (Pango lineage), respectively. Variants of interest include SARS-CoV-2 isolate, that when compared to a reference isolate, its genome has mutations with established or suspected phenotypic implications. Non-limiting examples of current variants of interest include Epsilon, Zeta, Eta, Theta, Iota, and Kappa (WHO labelled variants), or B.1427/B1.429, P2, B.1.525, P3, B,1.526, B.1.6171.1 (Pango lineage), respectively. Variants also include natural or manmade variants of SARS-CoV-2 that have not yet formed, thus are not yet identified or named.
[0081] In some embodiments, SARS-CoV-2 refers to Wuhan-Hu-1 (GenBank accession MN908947), sampled from a patient in Wuhan, China, on 26 Dec. 2019 (See e.g., Wu F, Zhao S, Yu B, Chen Y-M, Wang W, Song Z-G et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579:265-9. doi: 10.1038/s41586-020-2008-3). That genome is 29 903 nucleotides (nt) in length and includes a gene order of similar structure to that seen in other coronaviruses: 5′-replicase ORF1ab-S-E-M-N-3′. The predicted replicase ORF1ab gene of Wuhan-Hu-1 is 21 291 nt in length. The ORF1ab polyprotein is predicted to be cleaved into 16 nonstructural proteins. ORF1ab is followed by a number of downstream open reading frames (ORFs). These include the predicted S (spike), ORF3a, E (envelope), M (membrane) and N (nucleocapsid) genes of lengths 3822, 828, 228, 669 and 1260 nt, respectively. Like SARS-CoV, Wuhan-Hu-1 also contains a predicted ORF8 gene (366 nt in length) located between the M and N genes. Finally, the 5′ and 3′ terminal sequences of Wuhan-Hu-1 are also typical of betacoronaviruses and have lengths of 265 nt and 229 nt, respectively. See e.g., Genomic sequencing of SARS-CoV-2: a guide to implementation for maximum impact on public health, 8 January 2021, COVID-19: Laboratory and diagnosis available on the world wide web at www.who. int/publications/i/item/9789240018440.
[0082] Referring now to
[0083] In some embodiments, concentrating viral material may include centrifuging the viral material through a sugar cushion in an ultracentrifuge, or in embodiments, centrifuging the viral material through a sugar gradient in an ultracentrifuge. In some embodiments, centrifuging the viral material through a sugar cushion in an ultracentrifuge further includes forming a solution including a buffer and sugar. In some embodiments, the solution includes a sugar such as sucrose in the amount of 40% to 60 percent weight of the total solution. In some embodiments, a sucrose cushion includes 40% to 60% sucrose, such as about 50% sucrose disposed within a buffer. In some embodiments, the sugar includes or consists of sucrose in an amount of about 50 percent weight of the total solution. In embodiments, the solution is provided below a wastewater or biological sample in a tube such as an ultracentrifuge tube.
[0084] In embodiments, suitable buffer may include e.g., THE buffer such as [20 mM Tris-HCl (pH 7.0), 100 mM NaCl, 2 mM EDTA]) added adjacent to or underneath the wastewater aliquot within a centrifuge tube to form one or more distinct layers. In some embodiments, pH value of the sugar, e.g., sucrose and buffer mixture or solution may be 5.5 to 8.5, or about 5.5, about 6.5, or about 7. In some embodiments, a sucrose gradient is formed including a first sugar layer including for example 40 to 60% sucrose, or about 50% sucrose combined with a buffer disposed atop or below a second sugar layer including for example 40 to 60% sucrose, or about 50% sucrose combined with a buffer, wherein the first layer and second layer include different amounts of sugar and the combination of layers forms a gradient within a centrifuge tube.
[0085] Still referring to process sequence 110 samples may be concentrated and/or purified by centrifugation. In embodiments centrifugation is performed at about 100,000 to 300,000×g below room temperature, such as e.g., 150,000×g at 4° C. In embodiments, the duration of the centrifugation may be between about 30 to 100 minutes such as 45 to 90 minutes. Non-limiting examples of an ultracentrifuge suitable for use herein include a Sorvall WX Ultra series with a Sorvall SURESPIN™ 630 rotor (ThermoFisher). In embodiments, supernatant may be decanted. In embodiments, viral nucleic acid material such as total viral nucleic acid material including DNA and RNA may form in pellets. Pellets containing viral nucleic acid material may be resuspended in liquid such as e.g., 200 μL 1× PBS. In some embodiments, viral nucleic acid material such as pellets may be stored at −20° C. for <12 hours prior to nucleic acid extraction.
[0086] Still referring to
[0087] In embodiments, to detect a virus-of-interest such as SARS-CoV-2 or variants thereof, RT-qPCR may be used with a multiplex reaction containing the IP2 and IP4 assays (see e.g., Institut Pasteur, Real-time RT-PCR assays for the detection of SARS-CoV-2, 2020). In embodiments, reactions may include 6.25 uL Reliance One-Step Multiplex RT-qPCR Supermix, 0.4 μM each primer, 0.16 μM probes, molecular grade water, and 2.5 uL template total nucleic acids for a total reaction volume of 25 μL. In embodiments, PCR thermal cycling conditions may include 10 minutes at 50° C., 10 minutes at 95° C., followed by 45 cycles of 95° C. for 10 seconds and 59° C. for 30 seconds. In embodiments, a standard curve, including amplicons spanning the region of the SARS-CoV-2 virus interrogated by the IP2 and IP4 assays, ranging from 250 to 2.5 copies/reaction, may be used to convert Ct values to gene copies per reaction. Other known methods for quantifying the SARS-CoV-2 virus that have been used successfully on the wastewater samples by the inventors to provide quantitative information about SARS-CoV-2 levels include digital droplet PCR (ddPCR).
[0088] Still referring to
[0089] In embodiments, nucleic extraction and synthesis of cDNA may be employed to measure bacteriophage nucleic acid. For example, embodiment of the present disclosure includes nucleic acid extraction and synthesis of cross-assembly phage (crAssphage) cDNA. In embodiments, total nucleic acids may be extracted using known methods in the art including ALLPREP® POWERVIRAL® DNA/RNA Kit (Qiagen, Hilden, Germany) according to manufacturer's protocol. Samples may be eluted in RNase fee water such about 50 μL RNase free water. To assess the recovery of crAssphage RNA through the methods previously described, cDNA may be generated using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer's protocol.
[0090] In some embodiments, qPCR is used to detect the presence of crAssphage using the a CPQ_056 assay described in Stachler, et al, Quantitative CrAssphage PCR Assays for Human Fecal Pollution Measurement. Environmental science & 4technology 2017, 51, (16), 9146-9154 (herein entirely incorporated by reference). In embodiments, reactions may include 12.5 μL TaqMan® Environmental MasterMix (ThermoFisher), 1 μM primers, 80 nM probe, molecular grade water, and 2 μL template DNA for a total reaction volume of 25 μL. Each reaction may be run on either a QuantStudio3™ or QuantStudio5™ (ThermoFisher) under thermal cycling conditions including: 10 minutes at 95° C., followed by 40 cycles of 95° C. for 15 seconds and 60° C. for 1 minute. A DNA standard may be generated by purification of amplified PCR product using Roche High Pure PCR Template Preparation Kit. In embodiments, standard DNA quantity was assessed on NanoDrop spectrophotometer and Qubit® fluorometer. In embodiments, a standard curve, including purified amplicons ranging from 1×10.sup.6 to 5 copies/reaction, may be used to convert Ct values to gene copies per reaction.
[0091] Still referring to process sequence 130, in some embodiments, the CPQ_056 assay described above may be modified for SYBR Green chemistry. For example, SYBR Green qPCR may be used to assess recovery of bacteriophage such as crAssphage markers. In embodiments, reactions may include 12.5 μL TaqMan Environmental MasterMix, 1 μM CPQ_056 primers, 0.25 μL 10× SYBR Green dye, molecular grade water, and 2 μL template DNA for a total reaction volume of 25 μL. Thermal cycling conditions include 10 minute at 95° C., followed by 40 cycles of 95° C. for 15 seconds and 60° C. for 1 minute followed by a melt curve. In embodiments, a standard curve, including purified amplicons ranging from 1×10.sup.6 to 5 copies/reaction, may be used to convert Ct values to gene copies per reaction.
[0092] Still referring to
[0093] In some embodiments, in order to assess the proportion of viral nucleic acids remaining in each phase (including the pellet) after centrifugation, wastewater samples (2×20 ml) may be spiked with virus-of-interest such as SARS-CoV-2 or a variant thereof (resulting in approximately 580 gene copies per ml wastewater). For example, pellets may be generated by ultracentrifugation at 150,000×g for 45 minutes and the following layers were removed; aqueous upper (top 10 ml), aqueous lower (second 9 ml), cushion interface (1.5 ml, specifically targeting visible suspended particles on top of sucrose layer), sucrose upper (6 ml), sucrose lower (6 ml), and pellet (appx. 200 μL). In embodiments, an aliquot such as a 200 μL aliquot of each layer may be extracted using the PowerViral kit (Qiagen) and extracts analyzed with the IP2IP4 assay in 25 μL reaction volumes under the conditions described previously.
[0094] In some embodiments, process 100 may be performed in a duration between 1-5 hours, 2-5 hours, 3-5 hours, less than 5 hours, less than 4 hours, or less than 3 hours from the time a wastewater sample is collected or from the time the process sequence 100 commences.
[0095] In some embodiments, correlating evidence of virus-of-interest to disease transmission in wastewater may be performed by retrieving a total number of known viral disease (caused by the virus-of-interest) in a known geographical area such as a wastewater catchment area. In embodiments, a standardized number of incidence of disease caused by the virus-of-interest is generated to calculate cumulative incidence per 1,000 residents. Cumulative incidence may be used to form a ratio of virus-of-interest to the marker such as a bacteriophage. For example, in embodiments, standardizing the number of COVID-19 cases may be performed using one or more predetermined geographical areas, such as by ZIP code to the ZIP code population to calculate a cumulative incidence per 1,000 residents. This may provide a visualization of the cumulative incidence alongside the ratio of log.sub.10(SARS-CoV-2): log.sub.10(crAssphage).
[0096] In some embodiments, non-limiting examples of variations of the ratio of the present disclosure includes, log 10(SARS-CoV-2:crAssphage) and variations thereof useful at predicting community transmission such as e.g., either crAssphage cDNA or crAssphage DNA. In some embodiments, the following non-limiting values may be important for evaluating community spread: log 10(SARS-CoV-2): log 10(crAssphage DNA): 0.14 to 0.40; log 10(SARS-CoV-2): log 10(crAssphage cDNA): 0.3 to 0.75; log 10(SARS-CoV-2:crAssphage DNA): −4.7 to −2.5; log 10(SARS-CoV-2:crAssphage cDNA): −2.0 to −0.4. In some embodiments, the following relationship and ranges of values may be predictive of transmission: SARS-CoV-2 copies/ml/(log 10(crAssphage cDNA): log 10(crAssphage DNA)): 10 to 65 copies/ml or higher. In some embodiments, the latter may more accurately account for decay of viruses in the wastewater infrastructure.
[0097] Referring now to
[0098] Referring now to
[0099] Still referring to
[0100] Still referring to
[0101] Still referring to
[0102] Referring now to
[0103] In embodiments, method 300 includes at process sequence 320 measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to detect and/or quantify the virus-of-interest. For example, in embodiments, nucleic acid from the virus-of-interest may be quantified by methods described above such as Reverse Transcriptase quantitative PCR (RT-qPCR), and methodology such as described in Institut Pasteur, Real-time RT-PCR assays for the detection of SARS-CoV-2, 2020 (herein incorporated by reference).
[0104] In embodiments, the present disclosure relates to a method of detecting and quantifying a virus-of-interest from human viral shed in a community, including: concentrating viral material from a wastewater sample to form a viral nucleic acid material; measuring an amount of a virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; measuring an amount of a marker or bacteriophage nucleic acid in the viral nucleic acid material to obtain a second amount; and forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest from human viral shed within a community. In some embodiments, the virus-of-interest is an orthomyxovirus, influenza virus, influenza A, influenza B, an RNA virus, or a DNA virus. In some embodiments, the RNA virus is characterized as one of Reoviridae, Picornaviridae, Caliciviridae, Togaviridae, Arenaviridae, Retroviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, Bunyaviridae, Rhabdoviridae, Filoviridae, Coronaviridae, Astroviridae, or Bornaviridae. In some embodiments, the DNA virus is characterized as Adenoviridae, Papovaviridae, Parvoviridae, Herpesviridae, Poxviridae, or Hepadnaviridae. In some embodiments, the virus-of-interest is SARS-CoV-2 or a variant thereof. In some embodiments, the virus-of-interest is a Dengue virus. In some embodiments, the bacteriophage nucleic acid is cross-assembly phage nucleic acid. In some embodiments, concentrating viral material further includes centrifuging the viral material through a cushion such as a sugar cushion in an ultracentrifuge. In some embodiments, concentrating viral material further includes centrifuging the viral material through a gradient such as a sugar gradient in an ultracentrifuge. In some embodiments, centrifuging the viral material through a sugar cushion in an ultracentrifuge further includes forming a solution including a buffer and sugar. In some embodiments, the solution includes a sugar in the amount of 40 to 60 percent weight of the total solution. In some embodiments, the sugar includes or consists of sucrose in an amount of about 50 percent weight of the total solution. In some embodiments, the viral material includes inactivated or fragmented virus. In some embodiments, concentrating viral material from a wastewater sample to form a viral nucleic acid material is performed under conditions to purify the viral material. In embodiments, viral material is substantially purified. In some embodiments, measuring the amount of virus-of-interest nucleic acid and bacteriophage nucleic acid is performed by qPCR analysis including one or more fluorescent materials.
[0105] In some embodiments, the present disclosure relates to a method of monitoring a virus-of-interest human transmission in a community, including: (a) concentrating viral material from a wastewater sample to form a viral nucleic acid material; (b) measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; (c) measuring an amount of marker or bacteriophage nucleic acid in the viral nucleic acid material to obtain a second amount; (d) forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest human viral shed within a community; and (e) repeating (a)-(d) in an amount sufficient to monitor virus-of-interest transmissions within a community. In embodiments, concentrating viral material further includes centrifuging the viral material through a sugar cushion in an ultracentrifuge. In some embodiments, centrifuging the viral material through a sugar cushion in an ultracentrifuge further includes forming a solution comprising a buffer and sugar. In some embodiments, the solution includes a sugar in the amount of 40 to 60 percent weight of the total gradient-forming solution. In some embodiments, the sugar includes sucrose in an amount of about 50 percent weight of the total solution. In some embodiments, the virus-of-interest is SARS-CoV-2.
[0106] In some embodiments, the present disclosure relates to a method of detecting and/or quantifying a virus-of-interest in wastewater, including: concentrating viral material from a wastewater sample to form a viral nucleic acid material, wherein concentrating includes centrifuging the viral material through a cushion such as a sugar cushion in an ultracentrifuge; and measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to detect and/or quantify the virus-of-interest. In embodiments, centrifuging the viral material through a cushion such as a sugar cushion in an ultracentrifuge further includes forming a solution including a buffer and sugar. In some embodiments, the solution includes a sugar in the amount of 40 to 60 percent weight of the total solution. In some embodiments, the sugar includes sucrose in an amount of about 50 percent weight of the total solution. In some embodiments, the wastewater is characterized as an aliquot of less than 50 mL of raw wastewater, or less than 25 mL of raw wastewater, or between 1 to 25 mL of raw wastewater, or about 15 to about 20 mL of wastewater. In some embodiments, concentrating viral material includes purifying or substantially purifying the nucleic acid of the viral material. In some embodiments, the virus-of-interest is SARS-CoV-2 or a variant thereof.
[0107] In some embodiments, the present disclosure relates to a method of detecting and quantifying a virus-of-interest from human viral shed in a community, including: concentrating viral material from a wastewater sample to form a viral nucleic acid material; measuring an amount of a virus-of-interest nucleic acid in the viral nucleic acid material to obtain a first amount; measuring an amount of a marker nucleic acid in the viral nucleic acid material to obtain a second amount; and forming a ratio of the first amount to the second amount to estimate a level of virus-of-interest from human viral shed within a community. In embodiments, the marker nucleic acid is from human gut derived virus or bacteriophage such from bacteria or virus abundant in the human gut. In embodiments, the marker is a bacteriophage such as ϕ6 (Phi 6) a bacteriophage of the virus family Cystoviridae, Escherichia virus MS2 bacteriophage, crAssphage, or combinations thereof.
[0108] In some embodiments, a method of detecting and/or quantifying a virus-of-interest in wastewater, includes: concentrating viral material from a wastewater sample to form a viral nucleic acid material, or substantially purse nucleic acid material, wherein concentrating includes centrifuging the viral material through a cushion or gradient in an ultracentrifuge; measuring an amount of virus-of-interest nucleic acid in the viral nucleic acid material to detect and/or quantify the virus-of-interest. In embodiments, suitable cushion for use herein includes dextran, colloidal silica such as used in PERCOLL™ brand gradient, or sugar. Non-limiting examples of sugar includes monosaccharides, disaccharides, such as sucrose. In embodiments, suitable cushion for use herein includes iodixanol. In some embodiments, suitable gradient for use herein includes two or more layers of dextran, colloidal silica such as used in PERCOLL™ brand gradient, or sugar. Non-limiting examples of sugar for use in a gradient includes monosaccharides, disaccharides, such as sucrose. In embodiments, suitable gradient for use herein includes two or more layers of iodixanol. In some embodiments, the gradient layers are configured within a centrifuge two and the gradient layers have a different density.
[0109] In some embodiments, the present disclosure includes a method of determining the relative frequency of one or more viral strains is a wastewater sample. In embodiments, mixture modelling is performed to determine the relative frequency of one or more viral strains, such as one or more of SARS-CoV-2 or a variant thereof. See, e.g. example IV below. In embodiments, the methods of the present disclosure include: monitoring for one or more nucleotide changes in a virus-of-interest. In embodiments, the methods include monitoring for one or more specific or individual nucleotide changes; and generating whole genome sequence data for wastewater samples. In embodiments, a suitable sequencing protocol includes a sequencing protocol modified from the ARCTICv3 method, that achieves whole-genome viral sequence coverage sufficient to clearly identify variant lineages (
EXAMPLES
Example I
[0110] Materials and Methods—(The methods include those described in Green, et al., Quantification of SARS-CoV-2 and cross-assembly phage (crAssphage) from wastewater to monitor coronavirus transmission within communities (herein incorporate by reference in its entirety). This reference can be found on the world wide web at www.medrxiv.org/content/10.1101/2020.05.21.20109181v1.
Wastewater Ultracentrifugation
[0111] Twenty-four-hour composite wastewater samples (1.9 L) were collected from 11 access points (i.e., wastewater treatment plants, influent pump stations, or interceptor lines) in Syracuse, N.Y. and other locations in Onondaga County, N.Y. on May 6 and May 13, 2020 (Table 1).
TABLE-US-00001 TABLE 1 Facility Characteristics and average flow (millions of gallons per day) on May 6 and May 13, 2020. Table 1: Flow Flow Facility/ Population May 6, 2020 May 13,2020 Catchment ID Facility Type Served (M.G.D.) (M.G.D.) 600 Contributor to 3,841 1.25 0.95 604 601 WWTP 25,300 5 4.5 603 Contributor to 47,688 11.16 9.36 604 604 WWTP 223,900 70.3 62.2 605 WWTP 25,600 4.1 4.7 606 WWTP 37,800 5.4 4.9 610 Contributor to 112,747 29.1 25.7 604 617 WWTP 20,500 3.4 3.5 619 WWTP 12,800 1.9 1.7 725 Contributor to 39,262 11.2 10.01 604 1700 Contributor to 20,347 17.58 16.16 604
[0112] Samples were stored at 4° C. following collection and transported on ice to Upstate Medical University (Syracuse, N.Y.) for processing the next morning. Upon receipt, samples were mixed to resuspend particulates and 20 ml was aliquoted to a 38.5 ml ultracentrifuge tube (e.g., ThermoFisher, #750000471 brand ultracentrifuge tube). A 12 ml sucrose cushion (50% sucrose in THE buffer [20 mM Tris-HCl (pH 7.0), 100 mM NaCl, 2 mM EDTA]) was carefully added underneath the wastewater with a 10 ml disposable serological pipette so that two distinct layers were formed (
TABLE-US-00002 TABLE 2 Mean DNA Copies crAssphage/ Sucrose Spin Time mL Initial WW Source Concentration (Minutes) Replicate (+/−SD) 20% 20 1 1.95E4 (4.40E2) 20% 20 2 2.53E4 (5.95E2) 50% 90 1 9.04E4 (3.56E3) 50% 90 2 1.27E5 (1.88E3) 75% 150 1 3.26E4 (3.41E2) 75% 150 2 7.52E4 (8.55E2)
[0113] In batches of six, samples were then purified by centrifugation at 150,000×g at 4° C. for either 90 minutes (May 6) or 45 minutes (May 13) on a Sorvall WX Ultra series with a Sorvall SURESPIN™ 630 rotor (ThermoFisher). Centrifugation times of 45 and 90 minutes provided roughly the same recovery of viral nucleic acids (See Table 3 below).
TABLE-US-00003 TABLE 3 Mean DNA Copies crAssphage/ Mean cDNA Copies crAssphage/ Spin Time mL Initial WW Source mL Initial WW Source (Minutes) Replicate (+/−SD) (+/−SD) 30 1 6.74E4 (1.57E3) 1.40E1 (3.68E0) 30 2 7.21E4 (4.47E3) <LOQ 45 1 9.89E4 (4.16E3) 3.46E1 (6.72E0) 45 2 9.90E4 (2.82E3) 3.42E1 (1.36E1) 75 1 9.39E4 (5.86E3) <LOQ 75 2 1.19E5 (3.80E3) 1.14E1 (5.77E0)
[0114] Supernatant was then decanted, and pellets (
Distilled water (20 ml) was used as a processing blank.
Nucleic Extraction and Synthesis of CrAssphage cDNA
[0115] Total nucleic acids were extracted using the AlIPrep® PowerViral® DNA/RNA Kit (Qiagen, Hilden, Germany) according to manufacturer's protocol. Samples were eluted in 50 μL RNase free water. Extraction blanks using distilled water were performed in each extraction batch to assess contamination. To assess the recovery of crAssphage RNA through the methods previously described, cDNA was generated using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer's protocol.
CrAssphage qPCR
[0116] qPCR was used to detect the presence of crAssphage using the previously developed CPQ_056 assay (See Table 4 below).
TABLE-US-00004 TABLE 4 qPCR ASSAY USED ASSAY OLIGONUCLEOTIDE OLIGONUCLEOTIDE Amplicon NAME TARGET NAME SEQUENCE (5′-3′) Length Reference IP21 SARS- nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 108 bp 12-Institute P4 CoV-2 (SEQ ID NO: 1) Pasteur, Multi nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT Real-time plex (SEQ ID NO: 2) RT-PCT nCoV_IP2- [5′]Hex Assays for 12696bProbe(+) AGATGTCTT[Zen]GTGC detection TGCCG of SARS- GTA[3′]IABkFQ CoV-2. 2020. (SEQ ID NO: 3) (Herein nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 107 bp incorporated (SEQ ID NO: 4) entirely by nCoV_IP4-14- CTGGTCAAGGTTAATA reference). 14146Rv TAGG (SEQ ID NO: 5) nCoV_IP4- [5′]Hex 14084Probe(+) TCATACAAA[Zen]CCAC GCCAGG [3′]IABkFQ (SEQ ID NO: 6) CPQ_ CrAssph 056F1 CAGAAGTACAAACTCC 126 bp 11-Stachler, 056 age TAAAAAA E., et al. CGTAGAG Quantitative (SEQ ID NO: 7) CrAssphage 056R1 GATGACCAATAAACAA PCR Assays for GCCATTAGC Human Fecal (SEQ ID NO: 8) Pollution 056P1 [FAM] Measurement. AATAACGATTTACGTG Environmental ATGTAAC science and [MGB] technology (SEQ ID NO: 9) 2017, 51, (16), 9146- 9154). (Herein incorporated entirely by reference).
[0117] Reactions consisted of 12.5 μL TaqMan® Environmental MasterMix (ThermoFisher), 1 μM primers, 80 nM probe, molecular grade water, and 2 μL template DNA for a total reaction volume of 25 μL. Each reaction was run on either a QuantStudio3™ QuantStudio5™ (ThermoFisher) under the following thermal cycling conditions: 10 minutes at 95° C., followed by 40 cycles of 95° C. for 15 seconds and 60° C. for 1 minute. A DNA standard was generated by purification of amplified PCR product using Roche High Pure PCR Template Preparation Kit. Standard DNA quantity was assessed on NanoDrop spectrophotometer and Qubit® fluorometer. A standard curve, including or consisting of purified amplicons ranging from 1×10.sup.6 to 5 copies/reaction, was used to convert Ct values to gene copies per reaction (see Table 5 below). A CPQ_056 assay modified for SYBR Green chemistry was used in some optimization trials.
TABLE-US-00005 TABLE 5 Assay R.sup.2 Intercept Slope Efficiency CPQ_056 0.974 39.568 −3.406 0.97 IP2IP4 0.849 41.026 −3.508 0.93
SARS-CoV-2 RT-QPCR
[0118] To detect SARS-CoV-2, RT-qPCR was used with a multiplex reaction containing the previously published IP2 and IP4 assays (Table 4). Reactions consisted of 6.25 μL Reliance One-Step Multiplex RT-qPCR Supermix, 0.4 μM each primer, 0.16 μM probes, molecular grade water, and 2.5 μL template total nucleic acids for a total reaction volume of 25 μL. Thermal cycling conditions were 10 minutes at 50° C., 10 minutes at 95° C., followed by 45 cycles of 95° C. for 10 seconds and 59° C. for 30 seconds. A standard curve, consisting of amplicons ranging from 250 to 2.5 copies/reaction, was used to convert Ct values to gene copies per reaction (Table 5). All no-template controls for both crAssphage and IP21P4 (n>40) were negative throughout the entire study.
Recovery of CrAssphage and SARS-CoV-2
[0119] To assess the proportion of viral nucleic acids remaining in each phase (including the pellet) after centrifugation, wastewater samples (2×20 ml) were spiked with SARS-CoV-2 (resulting in approximately 580 gene copies per ml wastewater). Pellets were generated by ultracentrifugation at 150,000×g for 45 minutes and the following layers were removed; aqueous upper (top 10 ml), aqueous lower (second 9 ml), cushion interface (1.5 ml, specifically targeting visible suspended particles on top of sucrose layer), sucrose upper (6 ml), sucrose lower (6 ml), and pellet (appx. 200 μL). A 200 μL aliquot of each layer was extracted using the PowerViral kit (Qiagen) and extracts were analyzed with the IP2IP4 assay in 25 μL reaction volumes under the conditions described previously.
Cumulative Incidence of COVID-19
[0120] To correlate evidence of SARS-CoV-2 transmission in wastewater with cases of COVID-19 in the wastewater catchment area we retrieved the total number of COVID-19 cases by ZIP code from the Upstate Hospital electronic medical record system. These records reflect approximately 40% of the total COVID-19 cases in Onondaga County. The number of COVID-19 cases was standardized by a geographic location , in this case by ZIP code to the ZIP code population to calculate a cumulative incidence per 1,000 residents. The cumulative incidence was visualized alongside the ratio of log.sub.10(SARS-CoV-2): log.sub.10(crAssphage).
Results
Recovery of Viral Nucleic Acids
[0121] Direct ultracentrifugation of a wastewater sample through a % 50 sucrose cushion resulted in the formation of a translucent, but visible, pellet often bordered by darker, lower density residue, presumably organics, metal sulfides, and/or other impurities in the wastewater (See e.g.,
[0122] Depending on the wastewater sample, lower density impurities were often resting at the cushion interface. Recovery trials with inactive SARS-CoV-2 spiked samples indicated that no quantifiable SARS-CoV-2 RNA, crAssphage RNA, or crAssphage DNA remained in the upper aqueous phase or sucrose layer after centrifugation (See e.g., Table 6).
TABLE-US-00006 TABLE 6 SARS-CoV-2 Replicate Mean Copies SARS-CoV-2 Rxns Positive Layer Tube (+/−SD) (out of three) Aqueous 1 <LOQ 0 Upper 2 <LOQ 0 Aqueous 1 <LOQ 0 Lower 2 <LOQ 0 Cushion 1 <LOQ 0 Interface 2 <LOQ 2 Sucrose 1 <LOQ 0 Upper 2 <LOQ 0 Sucrose 1 <LOQ 0 Lower 2 <LOQ 0 Pellet 1 1.37E3 (7.39E2) per pellet 3 2 1.42E3 (7.19E2) per pellet 3
[0123] Given that only a portion of each layer was tested, there may have been some non-pelleted residual viral nucleic acids at concentrations below the limit of detection, but it is clear that the vast majority of SARS-CoV-2 and crAssphage viral nucleic acids are pelleted under these conditions. After nucleic acid extraction and qPCR, recovery of SARS-CoV-2 is estimated based on the addition of a known quantity of SARS-CoV-2 to be about 12% attributing some loss to non-pelleted viral RNA, but most to the subsequent nucleic acid extraction procedure.
Yield and Quality Assessment of Total RNA
[0124] The direct ultracentrifugation and purification of wastewater resulted in recovery of a considerable amount of total RNA. In the samples that were collected on May 6 the average yield was 26.3 ng/μL (std. dev. =11.7) (
Detection and Quantification of Viral Nucleic Acids in Wastewater
[0125] Over a two-week period, some level of SARS-CoV-2 were detected in 18 out of 22 samples, 13 of which were in the quantifiable range (See e.g., Table 7).
TABLE-US-00007 TABLE 7 Concentrations of SARS-CoV-2 and crAssphage DNA and RNA in sampled catchments. SARS-CoV-2 Mean copies crAssphage Mean Copies Date Facility/ (CPQ_056)/mL wastewater (+/−SD) SARS-CoV-2/mL Rxns Positive Collected Catchment DNA RNA (+/−SD) (cut of three) May 6 600 5.79E4 (3.58E3) 2.76E2 (4.50E0) <LOQ 0 May 6 601 1.76E5 (3.36E4) 5.33E2 (1.33E1) 1.12E2 (8.01E0) 3 May 6 603 5.44E4 (4.03E3) 1.65E2 (3.75E1) 1.51E1 (7.89E0) 3 May 6 604 9.29E4 (5.65E3) 3.95E2 (5.08E1) 4.59E1 (1.29E1) 3 May 6 605 1.19E5 (1.26E4) 3.31E2 (7.55E1) <LOQ 0 May 6 606 7.36E4 (1.47E3) 2.48E2 (4.61E1) <LOQ 2 May 6 610 3.33E4 (1.19E3) 1.37E2 (1.59E1) 2.25E1 (1.45E1) 3 May 6 617 1.47E5 (8.78E3) 2.73E2 (5.12E1) <LOQ 2 May 6 619 7.58E4 (1.18E4) 1.62E2 (2.35E1) <LOQ 0 May 6 725 1.01E5 (8.28E3) 2.32E2 (2.99E1) <LOQ 0 May 6 1700 2.50E4 (2.25E3) 1.02E2 (2.30E1) <LOQ 1 May 13 600 1.07E5 (6.97E3) 1.03E2 (2.44E1) 7.50E0(2.94E0) 3 May 13 601 8.44E4 (7.8E33) 1.40E2 (3.44E1) 2.82E1 (4.67E0) 3 May 13 603 6.43E4 (1.43E3) 1.32E1 (6.52E0) 3.04E1 (3.14E1) 3 May 13 604 6.74E4 (1.03E3) 5.50E1 (1.57E1) 5.72E1 (2.62E1) 3 May 13 605 9.15E4 (1.81E3) 3.94E1 (1.57E1) 1.20E1 (2.39E0) 3 May 13 606 9.65E4 (1.38E3) 4.00E1 (1.60E1) 4.90E1 (6.33E0) 3 May 13 610 2.21E4 (1.02E3) <LOQ (0/3) 6.92E1 (7.89E0) 3 May 13 617 9.81E4 (3.15E3) 4.00E1 (1.17E1) <LOQ 1 May 13 619 1.54E5 (7.35E3) 4.21E1 (8.88E0) <LOQ 1 May 13 725 1.95E5 (7.73E3) 1.13E2 (7.16E0) 1.30E1 (8.34E0) 3 May 13 1700 4.96E5 (3.66E3) 8.29E1 (3.43E1 9.41E1 (2.00E1) 3
[0126] SARS-CoV-2 was more prevalent in the May 13 samples (detected in 11 out of 11 samples) compared to the May 6 samples (7 out of 11), possibly due to a significantly lower flow on May 13 (paired t-test, p=0.045). If any of the three reaction wells crossed the fluorescence threshold, the sample was interpreted as positive due to all negative controls throughout the study testing negative. Likewise, SARS-CoV-2 fell within the quantifiable range in 9 out of 11 May 13 samples and only 4 out of 11 May 6 samples. The average number of SARS-CoV-2 genome copies within quantifiable samples over the two-week period was 42.7 (std.dev=32.9) genomes/ml while the highest observed was 112.35 (std. dev.=8.01) genome/ml of wastewater.
[0127] In contrast, crAssphage DNA was abundant in every sample analyzed with an average of 1.11×10.sup.5 copies/ml across the two-week period with no significant difference between the two sample sets. crAssphage RNA was detected in every sample except the sample from Facility 610 on May 13. crAssphage RNA was much less abundant than crAssphage DNA with an average of 1.68×10.sup.2 copies/ml. Interestingly, while there was no significant difference in crAssphage DNA between the two sample sets, crAssphage RNA was significantly lower on May 13 than May 6 (paired and unpaired t-tests, p<0.001).
Association Between crAssphage Loads and Population Served
[0128] While crAssphage DNA concentrations were not significantly associated with population served, flow, SARS-CoV-2 concentrations, or crAssphage RNA concentrations, there was a significant linear relationship between the loads of both crAssphage DNA (p<0.001) and RNA (p<0.01) and population served in each catchment (
Spatial Association Between SARS-CoV-2:CrAssphage Ratios in Wastewater and CO VID-19 Incidence
[0129] Although the number of cases in each catchment would allow a better assessment of the relationship between viral concentrations in wastewater and the level of transmission in the respective community, visual inspection suggests a spatial correlation between the cumulative incidence of cases by zip code from the Upstate hospital system and the ratio of SARS-CoV-2:crAssphage in wastewater with higher ratios occurring in areas or geographical locations of higher incidence
Discussion
[0130] The first demonstration that surveillance of SARS-CoV-2 in wastewater could be used to inform the public health response to COVID-19 instantly expanded the tools available to fight the pandemic. However, many recent reports of SARS-CoV-2 detection, or variants thereof, in wastewater are limited by the low levels of viral RNA recovered which can limit quantitative interpretation. Here, a sugar cushion ultracentrifugation method is reported for the recovery of SARS-CoV-2 from wastewater that provided quantitative results from a relatively small sample size (20 ml) in about 8 hours depending on the number of samples processed at one time. It is understood that the requirement of an ultracentrifuge is unrealistic for many and that other approaches will be required in the absence of this equipment. Nonetheless, using a single centrifuge, a modest throughput of about 60 samples in 24 hours with these methods is estimated.
[0131] Much of the prior work on crAssphage, specifically those targeted by the CPQ_056 assay, has been focused on its utility as an indicator of human fecal pollution in natural waterbodies. Many of the same attributes that make crAssphage an attractive indicator organism, such as its prevalence and abundance in the human population as well as its scarcity in other hosts, are also helpful in gauging the degree of SARS-CoV-2 transmission within the community. In addition to using crAssphage as an abundant surrogate for SARS-CoV-2 during method development and optimization, crAssphage can be used to ensure sufficient viral recovery, which may become an important quality assurance measure when comparing wastewater surveillance data within and between labs. Furthermore, like SARS-CoV-2, crAssphage is subject to decay and dilution within the wastewater infrastructure and while concentrations of SARS-CoV-2 alone are difficult to interpret, the ratio of SARS-CoV-2:crAssphage is likely more robust to processes that contribute to the loss of viral nucleic acids during transport. It is conceivable that these ratios could then be used to rank catchment areas by their relative degree of transmission independent of mass-balance calculations.
[0132] Enveloped RNA viruses, like SARS-CoV-2, are known to be less resilient under environmental conditions than non-enveloped DNA viruses, like crAssphage. Furthermore, DNA released from lysed viral particles is thought to be more resilient to degradation than RNA. The hypothesized rapid decay of SARS-CoV-2 compared to crAssphage would likely result in the underestimation of SARS-CoV-2 transmission within the community when using this approach. Decay rates of the two viruses and their genetic material within water infrastructure are needed to further refine predictions of transmission within the population using this approach. Decay may also play a larger role in larger service areas with longer average wastewater transit times and may explain why only low levels of SARS-CoV-2 were detected in some areas with known cases.
[0133] In summary, it has been demonstrated that an ultracentrifugation method using a sugar cushion such as sucrose can be used for quantitative environmental surveillance of SARS-CoV-2 transmission. It has further been shown herein that the ratio of SARS-CoV-2:RNA:crAssphage DNA found in wastewater may be spatially associated with incidence of the disease and could potentially be used to guide public health and economic intervention strategies. Regional or national surveillance of wastewater, in conjunction with clinical testing, may provide a robust decision-making platform that authorities can use to continue restarting local economies while prioritizing public health. Furthermore, frequent and widespread wastewater surveillance has the potential to indicate when and where a resurgence of SARS-CoV-2 or outbreaks of future pathogens might occur.
Example II
Sucrose Cushion Alterations
Concentration and Centrifugation Time Assessment
[0134] To optimize the sugar cushion (such as sucrose cushion) purification method, recovery of crAssphage markers was assessed with varying sucrose concentrations and ultracentrifugation times. Three sucrose concentrations were used between 20-70%, namely 20%, 50%, and 70% (in TNE buffer [20 mM Tris-HCl (pH 7.0), 100 mM NaCl, 2 mM EDTA]) with two total replicates of each treatment. Prior to cushion purification, wastewater samples were centrifuged at 2,000×for 25 mins to remove large particles and debris (sample clarification). Six 20 ml aliquots were then distributed to 38.5 ml ultracentrifuge tubes. To the bottom of each tube, 12 ml of a solution of sucrose in TNE was slowly added with a 10 ml serological pipette so that the sucrose formed a distinct layer below the wastewater. A pellet was generated by ultracentrifugation at 4° C. at 150,000×g for between 20 and 150 minutes depending on the sucrose concentration (See Table 2 above). Supernatant was then decanted, and pellets were resuspended in 200 μL 1× PBS (20% treatment) or RNA/ater (50% and 70% treatments). Resuspended pellets were stored at −20° C. for <12 hours prior to nucleic acid extraction using the methods previously described.
[0135] A 50% sucrose cushion combined with a 90 minute ultracentrifugation spin time resulted in the highest concentration of recovered crAssphage markers and was thus used for subsequent optimization and wastewater sample processing until it was clear shorter centrifuge times resulted in approximately the same recovery of viral nucleic acids.
50% Sucrose Concentration Centrifuge Time Assessment
[0136] Further optimization was performed by assessing varying spin times with a 50% sucrose cushion (See Table 3 above). Six samples were prepared using the methods previously described, with the omission of the initial 2,000×g clarification spin. Pellets were generated by ultracentrifugation at 4° C. at 150,000×g for 30, 45, and 75 minutes (2 replicates per centrifuge time). Pellets were examined for physical differences (
[0137] A 45-minute centrifugation time resulted in the highest concentration of recovered crAssphage cDNA markers and approximately the same amount of crAssphage DNA markers as longer spins. Due to these recovery data, and the benefit of increased processing throughput provided by a shorter spin time, wastewater samples were purified with 45 minutes of ultracentrifugation starting on May 13th.
Quantification of CrAssphage using SYBR Green Chemistry
[0138] For optimization of our sample processing approach, SYBR Green qPCR was used to assess recovery of crAssphage markers. Reactions consisted of 12.5 μL TaqMan Environmental MasterMix, 1 μM CPQ_056 primers, 0.25 μL 10× SYBR Green dye, molecular grade water, and 2 μL template DNA for a total reaction volume of 25 μL. Thermal cycling conditions were 10 minute at 95° C., followed by 40 cycles of 95° C. for 15 seconds and 60° C. for 1 minute followed by a melt curve. A standard curve, consisting of purified amplicons ranging from 1×10.sup.6 to 5 copies/reaction, was used to convert Ct values to gene copies per reaction (See Table 8).
TABLE-US-00008 TABLE 8 Detection Assay Chemistry R.sup.2 Intercept Slope Efficiency CPQ_056 SYBR Green 0.997 35.626 −3.343 0.99
Example III
[0139] Introduction—The materials and methods also include those described in Wilder, et al., Co-quantification of crAssphage increases confidence in wastewater-based epidemiology for SARS-CoV-2 in low prevalence, Water Research X 11 (2021) 100100 (herein incorporated by reference in its entirety). It is noted that information in this Example may include information from Example I above, however, additions are provided.
[0140] The presence of a substantial quantity of viral RNA in feces and urine provides the opportunity for wastewater-based epidemiology (WBE) approaches to be applied to the surveillance of COVID-19, tracking the emergence of disease, and transmission trends over time. A robust and effective wastewater monitoring program for SARS-CoV-2 is provided that may help to inform resource allocation decisions (e.g. where to prioritize testing and contact tracing), target community interventions such as social distancing measures or other restrictions, and provide an additional tool by which policy makers could assess when and how to reopen local economies. In embodiments, an effective wastewater monitoring approach is provided suitable for use in the surveillance of facilities such as jails, university dormitories, and assisted living facilities which may be especially susceptible to COVID-19 outbreaks. Information obtained from the methods of the present disclosure beneficially provide officials with the tools to limit the spread of the virus both within and from these types of facilities.
[0141] To date, large scale monitoring efforts are problematically limited by factors such as turnaround time (e.g. the time from sample acquisition to data generation) and dependence on supply chain continuity for single use materials such as charged membranes or centrifugal filtration units. The inventors have found ultracentrifugation is an attractive approach because once the initial investment in equipment is made, the material cost and sample processing time are low. Furthermore, the ability to manipulate the amount and viscosity of the sedimentation medium as well as the ultracentrifugation time and speed permit partial nucleic acid purification concurrent with concentration.
[0142] In embodiments, the present disclosure provides a reliable and scalable method for detecting and quantifying SARS-CoV-2 wastewater RNA (and variants thereof) from areas with low infection rates and/or b) integrate co-quantification of viral nucleic acids from crAssphage, an abundant human gut bacteriophage, into SARS-CoV-2 wastewater monitoring to help account for sources of both inter- and intra-sewershed variability. The inventors have measured both crAssphage DNA and RNA because it is currently unclear which serves as a better fecal normalizer when trying to associate SARS-CoV-2 wastewater RNA concentrations to relevant epidemiological parameters. In embodiments, ultracentrifugation optimization trials were initially conducted prior to analyzing 181 wastewater influent samples collected from six Upstate New York counties.
Materials and methods
Sampling Locations and Sample Collection and Transport
[0143] Twenty-four-hour composite influent wastewater samples (110 mL-1.9 L) were collected from 28 different access points in combined sewage networks across Upstate New York in Onondaga, Cayuga, Cortland, Tompkins, Oswego, and Warren Counties (Table 9,
TABLE-US-00009 TABLE 9 Summary of locations and dates of sampling in New York State Average Test N Access Appx. Daily Positivity.sup.b Points Total N County Population Incidence.sup.a (%) Sampled Time Period Sampled Samples Onondaga 460,000 34.5 2.94 16 4/28-Jun. 24, 2020 122 Cayuga 75,000 1.1 0.47 4 5/19-Jun. 22, 2020 24 Warren 70,000 0.4 0.20 3 5/27-Jun. 23, 2020 15 Oswego 120,000 3.6 1.10 2 6/03-Jun. 23, 2020 8 Tompkins 100,000 0.5 0.16 2 6/02-Jun. 22, 2020 7 Cortland 50,000 0.2 0.11 1 5/27-Jun. 22, 2020 5 .sup.aAverage daily incidence is calculated as the total number of new positive cases that occurred over the time period sampled divided by the length of the time period (days). .sup.bTest positivity is calculated as the total number of positive tests out of the total number of tests performed in each county during the time period sampled. Diagnostic test results include the results of both PCR and antigen tests.
[0144] Information on the age of wastewater in these systems was only available for six Onondaga County access points (Table 10), where mean transit time ranged from 1.2 to 4.4 hours. Samples were stored at approximately 4° C. following collection and were transported on ice to Upstate Medical University (Syracuse, N.Y.) the following morning for processing and viral concentration (with the exception of Onondaga County samples collected on the 28th of April, which were frozen at −20° C. for processing at a later date following methodological optimizations). From April 28 to June 24 , 2020 a total of 181 wastewater samples were collected and processed for the detection of SARS-CoV-2 and crAssphage nucleic acids. During the sample collection process, influent flow rate, pH, and water temperature were also measured at some access points. Average daily minimum air temperature in each county during this time period ranged from 9.2 to 14.6° C., average daily maximum air temperature ranged from 21.8 to 25.9° C., average daily precipitation ranged from 0.07 to 0.21 cm, and daily relative humidity ranged from 36 to 86% (NOAA). Information on the topographical area of each sewershed was accessed through New York State and/or County databases and the size of the population served was estimated using census data. Characteristics of individual access points within each county are summarized in Table 10 below.
TABLE-US-00010 TABLE 10 N Population Area Transit County Samples Served (N Served Time Site ID (NY) Collected Individuals) (Km.sup.2) (Hrs).sup.a CCWW1 Cayuga 5 31,814 42.71 NA CCWW2 Cayuga 5 7,374 12.16 NA CCWW3 Cayuga 5 7,575 16.41 NA CCWW4 Cayuga 5 17,250 12.79 NA Cortland Cortland 4 26,950 147.29 NA 600 Onondaga 8 3,838 4.17 NA 601 Onondaga 9 25,965 29.55 1.2 ± 0.4 603 Onondaga 8 49,097 69.62 NA 604 Onondaga 9 242,377 253.69 2.5 ± 1.3 605 Onondaga 9 39,352 93.07 2.5 ± 1.3 606 Onondaga 9 50,727 113.6 3.5 ± 1.3 610 Onondaga 8 128,021 73.63 NA 617 Onondaga 9 30,613 91.56 1.8 ± 0.9 619 Onondaga 9 16,168 58.9 4.4 ± 2.3 725 Onondaga 8 45,538 96.79 NA 727 Onondaga 4 NA NA NA 1700 Onondaga 8 16,260 9.48 NA 999A Onondaga 6 87,743 60.51 NA 999B Onondaga 6 9,577 4.31 NA 999C Onondaga 6 19,586 5.44 NA 999D Onondaga 6 11,521 3.33 NA Oswego_E Oswego 3 12,357 68.64 NA Oswego_W Oswego 3 14,182 14.21 NA Ithaca Tompkins 3 60,575 100.4 NA Cayuga Tompkins 2 13,801 147.29 NA GFI Warren 4 23,462 34.68 NA SGF Warren 4 5,603 21.07 NA MBPS Warren 4 3,572 3.41 NA .sup.aTransit times calculated by Wang et al 2020.
Ultracentrifugation of Wastewater through a Sucrose Cushion
[0145] Prior to ultracentrifugation, wastewater samples were blended to resuspend particulates that had settled during transport or storage. Twenty milliliters were transferred into a disposable 38.5 mL ultracentrifuge tube (Product No. 75000471, ThermoFisher®, Mass., USA) using a disposable serological pipette. Unless otherwise noted in the optimization experiments described in the section 2.3, a 12 mL sucrose cushion (50% sucrose in THE buffer [20 mM Tris-HCL (pH 7.0), 100 mM NaCl, 2 mM EDTA]) was then carefully added underneath the wastewater using a serological pipette so that wastewater and the sucrose solution formed distinct layers in the ultracentrifuge tube (
[0146] In embodiments, a process sequence of sucrose cushion methodology includes: 1) Sterilize workplace with hydrogen peroxide; 2) thoroughly mix/blend wastewater samples to resuspect particles which may have settled during transport; 3) aliquot 20 mL of wastewater into a 38.5 mL ultracentrifuge tube using a disposable serological pipette; 4) with a new disposable serological pipette, carefully add 12 ml of 50% sucrose solution (or any sucrose solution in accordance with the present disclosure) to the bottom of the ultracentrifuge tube so that wastewater and sucrose are in distinct layers. Repeat for remaining samples; 5) prepare at least one processing blank by substituting distilled or molecular grade water for wastewater (creating a tube with a layer of DI or MG water above sucrose cushion); 6) ensure all tubes are the same mass by adding small quantities of distilled water to the upper layer; 7) ultracentrifuge at 150,000×g and 4° C. for 45 min.; 8) remove supernatant using a pipette. Be careful not to disturb or remove pellet; 9) resuspend pellet in 200 microliter PBS (1×) and transfer to 1.5-2.0 mL microcentrifuge tube; 10) proceed immediately to DNA/RNA extraction or store resuspended pellet at −20 deg. C for extraction within 24 hours; and 11) sterilize workplace and equipment with hydrogen peroxide.
[0147] In batches of six, samples were balanced by the addition of distilled water (<500 μL) and then ultracentrifuged at 150,000×g at 4° C. on a Sorvall® WX Ultra series with a Sorvall® SureSpin® 630 (6×36 mL) Swinging-Bucket Rotor (ThermoFisher®). Prepared samples were ultracentrifuged for 45 minutes unless otherwise noted for optimization experiments. Following ultracentrifugation and the generation of pellets containing viral particles and nucleic acids (
Optimization of Viral Nucleic Acid Recovery
[0148] Samples collected from Onondaga County on April 28, May 6, and May 13, 2020 were used to perform optimization experiments. To identify sucrose concentrations and ultracentrifugation times that resulted in higher levels of viral nucleic acid recovery, crAssphage was used as a surrogate since native SARS-CoV-2 concentrations were too low to be used as reliable indicator of recovery. First, well-blended wastewater subsamples were ultracentrifuged with 20, 50, and 70% sucrose cushions for 20, 90, and 120 minutes, respectively, with lower concentration cushions receiving shorter ultracentrifugation times. Pellets were then analyzed for crAssphage DNA.
[0149] Next, once the optimal sucrose concentration was identified, the effect of reducing ultracentrifugation time was tested by making six replicate subsamples and ultracentrifuging for 30 (n=2), 45 (n=2), and 75 minutes (n=2) while holding sucrose concentration constant. Pellets were then analyzed for both crAssphage DNA and RNA.
[0150] Then, to estimate the efficiency with which SARS-CoV-2 RNA is pelleted, 20 mL wastewater aliquots (n =2) with low initial concentrations of SARS-CoV-2 RNA (appx. 8 genome copies per mL) were spiked (spike equivalent to appx. 580 genome copies per mL wastewater) with heat deactivated SARS-CoV-2 (Catalog No. NR-52286, BEI Resources®, Virginia, USA) prior to ultracentrifugation for 45 minutes. After ultracentrifugation, the following layers were analyzed: aqueous upper (top 10 mL), aqueous lower (second 9 mL), cushion interface (1.5 mL, targeting particles suspended just above the sucrose cushion), sucrose upper (6 mL), sucrose lower (6 mL), and pellet (appx. 200 uL). Two hundred microliter subsamples of each layer and the resuspended pellets were then analyzed for recovery of SARS-CoV-2 RNA, crAssphage DNA, and crAssphage RNA.
[0151] Finally, to estimate the loss of nucleic acids through the nucleic acid purification procedure specifically, wastewater pellets (n=7) generated from homogenized samples originating from several access points were spiked with appx. 125,000 genome copies of bovine coronavirus (BCoV) RNA extracted from a vaccine (Bovine Rotavirus-Coronavirus Vaccine from Zoetis, N.J., USA). Extraction of total nucleic acids from wastewater pellets was carried out by the method described below. BCoV RNA concentrations were determined via RT-qPCR using a previously published assay See e.g., Decaro, N., Elia, G., Campolo, M., Desario, C., Mari, V., Radogna, A., Colaianni, M. L., Cirone, F., Tempesta, M., Buonavoglia, C., 2008. Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay. Journal of Virological Methods 151, 167-171. doi:10.1016/j.jviromet.2008.05.016 (herein incorporated by reference) and Table 11.
TABLE-US-00011 TABLE 11 BCoV qPCR assay performance. LOQ Assay R.sup.2 Intercept Slope Efficiency (copies/rxn) BCoV 0.99 37.858 −3.366 0.98 10
[0152] In routine processing, deactivated SARS-COV-2 and bovine coronavirus vaccine were not used to estimate nucleic acid recoveries. Instead, crAssphage was used to confirm recovery of nucleic acids and as a fecal normalizer for SARS-COV-2.
Nucleic Acid Extraction and Synthesis of CrAssphage cDNA
[0153] Total nucleic acids were extracted from resuspended pellets using the AlIPrep® PowerViral® DNA/RNA Kit (Qiagen®, Hilden, Germany) according to manufacturer's protocol with the omission of the optional bead beating step. Nucleic acids were eluted in 50 μL elution buffer, five of which was used immediately to generate total cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen®) according to manufacturer's protocol to allow estimation of crAssphage RNA. Total nucleic acid samples and cDNA were immediately stored at −80 □C until viral quantification via RT-qPCR and qPCR.
Quantification of Viral Nucleic Acids
[0154] RT-qPCR was used to detect the presence of SARS-CoV-2 RNA in undiluted total nucleic acid extracts using a multiplex reaction with the previously published IP2 and IP4 assays targeting separate regions of the RdRp gene (Institut Pasteur, 2020). Reactions consisted of 6.25 μL Reliance One-Step Multiplex RT-qPCR Supermix (Bio-Rad®, California, USA), 0.4 μM each primer, 160 nM each probe (both HEX), molecular grade water, and 2.5 μL nucleic acid template for a total reaction volume of 25 μL. Thermal cycling conditions were 10 minutes at 50 deg. C. 10 minutes at 95 deg. C., followed by 45 cycles of 95 deg. C. for 10 seconds and 59 deg. C. for 30 seconds. crAssphage nucleic acids were quantified using the previously published CPQ_056 assay. Reactions consisted of 12.5 μL TaqMan® Environmental MasterMix (ThermoFisher®), 1 μM primers, 80 nM probe, molecular grade water, and 2 μL nucleic acid template for a total reaction volume of 25 μL. Thermal cycling conditions were 10 minutes at 95 deg. C., followed by 40 cycles of 95 deg. C. for 15 second and 60 deg. C. for 1 minute. A standard curve, ranging from 1×10.sup.6 to 5 copies per reaction of a diluted gBlock® (IDT®, Iowa, USA) containing targets for the IP2IP4 assay or diluted purified crAssphage amplicons (produced with DNA Clean and Concentrator™ 25, ZYMO, USA) was used to convert Ct values to gene copies per reaction. Nucleic acid concentrations for gBlocks and purified amplicons were measured using a Qubit® 3.0 Fluorometer) (Invitrogen®), allowing copy number to be determined from the known length of the amplicon or gBlock. Samples were quantified using either PCR plate specific standard curves or a composite standard curve from recent plates (Table 2). All qPCR reactions were carried out on either QuantStudio® 3 or QuantStudio® 5 (ThermoFisher®) real-time PCR systems.
Quality Assurance
[0155] For all days on which wastewater samples were purified via ultracentrifugation, at least one processing blank was prepared by processing 20 mL distilled water instead of wastewater and measuring levels of SARS-CoV-2 RNA, crAssphage DNA, and crAssphage RNA. Throughout the study, 2 of 22 processing blanks contained quantifiable levels of crAssphage DNA (mean Ct=36.019±2.259) which was several orders of magnitude less than crAssphage quantities obtained from wastewater influent samples (mean Ct=22.662±1.418). For SARS-CoV-2, 2 of 22 processing blanks showed some degree of amplification, with one being quantifiable (Jun. 10, 2020, Ct=35.637±0.192, appx. 10 copies/mL). No processing blanks had amplification for crAssphage cDNA.
[0156] Following ultracentrifugation, at least one additional blank was prepared during total nucleic acid extraction by substituting 200 μL dissolved pellet for 200 μL molecular grade water. Throughout the study, 1 of 18 extraction blanks contained quantifiable levels of crAssphage DNA (Ct=35.982±0.545). For SARS-CoV-2, 1 of 18 extraction blanks contained quantifiable RNA (Jun. 9, 2020, Ct=34.323±0.515, appx. 24 copies/mL). No extraction blanks contained detectable levels of crAssphage cDNA. Due to suspected SARS-CoV-2 contamination, data from 9 and 10 of Jun. 2020 were omitted from our analysis, effectively reducing the number of samples analyzed from 181 to 169.
[0157] For RT-qPCR and qPCR, plates contained at least three no template control (NTC) reactions. Throughout the study, 1 of 128 (0.8%) IP2IP4 NTC wells amplified (Ct=40.957) and 9 of 198 (4.5%) of CPQ_056 NTC wells amplified. For CPQ_056, six of these NTC amplifications occurred on May 11, 2020. On this plate, wastewater samples had a mean CPQ_056 Ct of 23.350 and positive NTCs had a mean Ct of 38.580 which suggests that contamination did not greatly affect estimates of crAssphage from wastewater on this run. Therefore, since the sole IP2IP4 NTC that showed amplification was >40 cycles and the few positive CPQ_056 NTCs were largely isolated to one plate and represented DNA quantities several orders of magnitude less than our wastewater nucleic acid extracts, no data were excluded from analysis based on the assessment of NTCs.
[0158] Kinetic outlier detection (KOD) was performed as described previously (Green and Field, 2012; Kirtane et al., 2019; Tichopad et al., 2010) on all 3,032 reactions to determine if qPCR inhibition affected the amplification of SARS-CoV-2 or crAssphage nucleic acid targets. Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the perbatch function in R package qpcR version 1.4-1 (Ritz and Spiess, 2008; Spiess, 2018). The first and second derivative maxima of each fitted model was then estimated. Using a 10 Ct difference between the first and second derivative maxima as a quality criterion (i.e., “uni2” criteria in function perbatch), KOD analysis indicated that all wells with a Ct value <45 (maximum possible Ct value) displayed no signs of inhibition. Inherent in these methods is the assumption that DNA polymerase and reverse transcriptase are equally susceptible to PCR inhibitors. Nonetheless, the total absence of signs of qPCR inhibition as indicated by sensitive KOD methods suggests that the purification methods used were effective at removing compounds that commonly affect qPCR amplification.
Integration of COVID-19 Case Data
[0159] COVID-19 testing data, including all diagnostic tests including PCR and antigen-based methods, were obtained from The Electronic Clinical Laboratory Reporting System (ECLRS) (NYSDOH, 2020a,b). All test results were classified as positive, negative, inconclusive, or invalid. After excluding tests for out of state residents, all tests for COVID-19 during the study period were geocoded using the New York State Street Address Maintenance (SAM) Program (“NYS Street Address Mapping (SAM),” 2020). Additional geocoding was performed with geocoders from SAS and MapMarker to improve accuracy. Shape files of each service area were obtained from each corresponding municipality. Addresses occurring within the studied service areas were retained while addresses occurring outside the study area were excluded. Residences with private septics were identified using statewide tax parcel data from the New York State GIS Clearinghouse (“NYS GIS-Parcels,” 2020). Any addresses with private septics, which accounted for approximately 5% of COVID-19 tests, were excluded from the analysis. A daily count of positive test results by service area was tabulated after excluding inconclusive or invalid results. Human subject involvement with regards to COVID-19 diagnostic testing was approved by the New York State Department of Health's Institutional Review Board.
Data Interpretation and Analysis
[0160] To aid interpretation, SARS-CoV-2 wastewater RNA levels were classified into three distinct categories prior to data analysis. Samples that had all three qPCR replicates amplify above the LOQ of 5 genome copies per reaction were classified as quantifiable. Because both assays were able to amplify 5 copies per reaction consistently, samples that had at least one qPCR replicate amplify with a Ct <40 were considered detected but not quantifiable (DNQ). Many of the samples classified as DNQ had one or two qPCR replicates above the LOQ of 5 copies but were still conservatively classified as DNQ for our analysis. Samples that had no amplification in any of the three wells (i.e., all three wells were “Undetermined”, Ct >45) were considered below the limits of detection (BLOD; i.e., a “negative” sample).
[0161] To facilitate comparison of crAssphage concentrations between service areas, we used prior 24-hour flow and population serviced to calculate a per capita crAssphage nucleic acid load as follows:
[0162] Per capita nucleic acid load represents the estimated average daily contribution of crAssphage nucleic acids by an individual.
[0163] Pair-wise t-tests were used to test for significant differences in mean recovery using different sucrose concentrations and spin times. Conditional inference trees (CTrees) were developed using the partykit (version 1.2-10) package in R (version 1.2.5019) as done previously (Weller et al., 2020) to assess the effects of service area size, average influent temperature, and pH on crAssphage DNA and RNA concentrations (R code available one the world wide web at github.com/Maxwell-Wilder/Co-quantification-of-crAssphage-increases-confidence-in-wastewater-based-epidemiology-for-SARS-CoV-2). Transit times were also used a predictor variable, but only for sites 601, 604, 605, 606, 617, and 619 as available (Wang et al., 2020).
Results
Optimizing Recovery of Viral Nucleic Acids
[0164] In an assessment of sucrose concentration and ultracentrifugation (“spin”) time, it was found that a 50% cushion paired with a 90-minute spin time yielded greater crAssphage DNA concentrations than both a 20% cushion paired with a 20-minute spin time and a 70% cushion paired with a 150-minute spin time (p<0.05, See Table 12 below).
TABLE-US-00012 TABLE 12 Sucrose Spin Time Replicate crAssphage DNA (Copies/ Concentration (Minutes) Tube L WW Source +/− SD) 20% 20 1 1.95 × 10.sup.7 (4.40 × 10.sup.5) 2 2.53 × 10.sup.7 (5.95 × 10.sup.5) 50% 90 1 9.04 × 10.sup.7 (3.56 × 10.sup.6) 2 1.27 × 10.sup.8 (1.88 × 10.sup.6) 70% 150 1 3.26 × 10.sup.7 (3.41 × 10.sup.5) .sup.2 7.52 × 10.sup.7 (8.55 × 10.sup.5)
[0165] The impact of 30, 45, and 75-minute spin times was then assessed on crAssphage nucleic acid recovery using a 50% sucrose cushion in an attempt to reduce processing time. It was found that while both 45 and 75-minute spin times yielded greater quantities of crAssphage DNA than a 30-minute spin (p=<0.01, See Table 13), there was no significant difference in crAssphage DNA recovery between 45 and 75-minute spins. Quantifiable amounts of crAssphage RNA were only recovered with a 45-minute spin time (Table 13).
TABLE-US-00013 TABLE 13 crAssphage DNA crAssphage RNA Spin Time Replicate (Copies/L WW (Copies/L WW Minutes) Tube Source +/− SD) Source +/− SD) 30 1 6.74 × 10.sup.7 (1.57 × 10.sup.6) DNQ 2 7.21 × 10.sup.7 (4.47 × 10.sup.6) BLOD 45 1 9.89 × 10.sup.7 (4.16 × 10.sup.6) 3.46 × 10.sup.4 (6.72 × 10.sup.3) 2 9.90 × 10.sup.7 (2.82 × 10.sup.6) DNQ 75* 1 9.39 × 10.sup.7 (5.86 × 10.sup.6) DNQ 2 1.19 × 10.sup.8 (3.80 × 10.sup.6) DNQ *Among-treatment crAssphage DNA recovery was statistically different only for the 75-minute spin time (p = 0.005).
Low quantities of crAssphage RNA (DNQ) are potentially due to degradation, as RNA may have degraded while the wastewater sample was stored at 4° C. for approximately 5 days. Because 75-minute and 45-minute spin times yielded similar results, with 45-minutes being the only treatment to recover quantifiable crAssphage RNA, we proceeded with this spin time for further experiments and the analysis of wastewater samples.
[0166] Having determined an optimal sucrose concentration and ultracentrifugation time, the approximate nucleic acid recovery was determined for the total process using spiked heat deactivated SARS-CoV-2 (BEI Resources® and native crAssphage DNA and RNA as surrogates. Quantifiable levels of SARS-CoV-2 RNA and crAssphage RNA were found only in the pellet indicating that the majority of viral RNA is likely pelleted under these conditions (See Table 14 below).
TABLE-US-00014 TABLE 14 Volume Replicate SARS-CoV-2 RNA crAssphage RNA crAssphage DNA Layer (mL) Tube (Copies +/− SD) (Copies +/− SD) (Copies +/− SD) Aqueous 10 1 BLOD BLOD DNQ Upper 2 BLDD BLOD DNQ Aqueous 9 1 BLOD BLOD 2.30 × 10.sup.2 (6.36 × 10.sup.1) Lower 2 BLOD BLOD DNQ Cushion 15 1 BLOD BLOD 4.10 × 10.sup.3 (7.07 × 10.sup.1) Interface 2 DNQ BLOD 8.59 × 10.sup.3 (3.97 × 10.sup.2) Sucrose 6 1 BLOD DNQ 1.13 × 10.sup.4 (3.92 × 10.sup.2) Upper 2 BLOD BLOD 4.72 × 10.sup.3 (5.43 × 10.sup.3) Sucrose 6 1 BLOD DNQ 1.88 × 10.sup.4 (1.24 × 10.sup.3) Lower 2 BLOD DNQ 8.19 × 10.sup.3 (4.71 × 10.sup.2) Pellet 0.2 1 1.37 × 10.sup.3 (7.39 × 10.sup.2) 1.60 × 10.sup.3 (3.57 × 10.sup.2) 2.26 × 10.sup.6 (7.93 × 10.sup.4) 2 1.42 × 10.sup.3 (7.19 × 10.sup.2) DNQ 3.54 × 10.sup.6 (1.80 × 10.sup.5)
[0167] Trace levels of RNA recovered from the cushion interface (SARS-CoV-2) and in the sucrose layers (crAssphage) suggest that low levels of SARS-COV-2 RNA also remain unpelleted. While quantifiable levels of crAssphage DNA were present in most layers post-ultracentrifugation, quantities found in the pellet were far greater than that of any other layer (p<0.001, See table 14). Although the magnitude of crAssphage DNA recovered from the pellet varied significantly among the two replicates (p=0.002), SARS-CoV-2 RNA recovery was not statistically different. Based on the amount initially spiked, we estimated that 12% (s.d.=5.5%) of deactivated SARS-CoV-2 RNA was recovered after both ultracentrifugation and nucleic acid extraction processes. A follow-up experiment in which BCoV RNA was added to pellets resulted in an average extraction recovery of 6.89% (s.d.=1.58%) suggesting that the majority of nucleic acid loss in the total process occurred at the nucleic acid extraction step.
Abundance of SARS-CoV-2 and CrAssphage in Wastewater Samples
[0168] While the vast majority of crAssphage DNA and RNA values fell within the quantifiable range, most SARS-CoV-2 RNA levels were either DNQ (49%) or BLOD (34%, Table 15).
TABLE-US-00015 TABLE 15 Target Quantifiable (%) DNQ (%) BLOD (%) crAssphage DNA 100 0 0 crAssphage RNA 93 6 1 SARS-CoV-2 RNA 17 49 34
[0169] Detecting or quantifying SARS-CoV-2 RNA from wastewater was obtained in 111 of the 169 samples that were analyzed over the study period. Of these 111 samples, 29 had quantifiable levels of SARS-CoV-2 RNA. In these samples, the average quantity of SARS-CoV-2 RNA recovered was 2.16×10.sup.4 (s.d.=2.11×10.sup.4) genome copies per L of wastewater while the maximum observed quantity was 1.02×10.sup.5 (s.d.=7.96×10.sup.3) genome copies per L of wastewater.
[0170] crAssphage nucleic acids were quantifiable from the vast majority of wastewater samples (Table 15). Over the course of the study period, the average and maximum quantities of crAssphage DNA recovered were 2.05×10.sup.8 (s.d.=2.18×10.sup.8) and 1.73×10.sup.9 (s.d.=7.72×10.sup.7) genome copies per L of wastewater. For crAssphage RNA, the average and maximum quantities recovered were 4.00×10.sup.5 (s.d.=4.61×10.sup.5) and 2.88×10.sup.7 (s.d.=1.47×10.sup.5) genome copies per L.
Association between CrAssphage Loads, Influent Flow, and Population Served
[0171] A significant negative relationship was observed between crAssphage concentrations detected and influent wastewater flow rates across all sites (Table 16). Table 16 depicts regression parameters for the relationship between crAssphage nucleic acid (log.sub.10 copier per L wastewater) concentration and flow (millions of liters per day) at six sites (corresponds to
TABLE-US-00016 TABLE 16 crAssphage Regression p Site Nucleic Acid Equation R.sup.2 value All DNA Y = −0.0013X + 0.027 0.031 8.197 RNA Y = −0.0018X + 0.046 0.007 5.442 601 DNA Y = −0.115X + 0.418 0.050 10.201 RNA Y = −0.039X + −0.109 0.549 6.146 604 DNA Y = −0.017X + 0.512 0.028 12.254 RNA Y = −0.008X + 0.142 0.192 7.085 605 DNA Y = −0.183X + 0.606 0.014 11.384 RNA Y = −0.057X + −0.060 0.484 6.291 606 DNA Y = −0.149X + 0.481 0.034 11.223 RNA Y = −0.031X + −0.130 0.784 5.935 617 DNA Y = −0.092X + 0.360 0.052 9.333 RNA Y = −0.106X + 0.084 0.229 6.611 619 DNA Y = −0.233X + 0.450 0.029 9.913 RNA Y = −0.125X + −0.054 0.467 6.230
[0172] Six sites were selected with the greatest number of sampling events (n=9 each) to look at this relationship on an individual basis and found significant negative relationships between crAssphage DNA concentration and flow, but no significant relationship between crAssphage RNA concentration and flow, potentially due to increased variability in crAssphage RNA measurements (
Variability in Physical-Chemical Parameters and CrAssphage Loads between Service Areas
[0173] At each site (n=8) where temperature and flow data were recorded, a significant positive correlation was observed between temperature and sampling date (Pearson's r=0.94-0.97, p<0.05) and significant negative correlation between flow and sampling date (r=−0.82-−0.96, p<0.05) reflecting the change toward warmer, dryer weather. At facilities 605 and 606, we also observed a significant negative correlation between pH and both sampling date (r=−0.75 , −0.86, p<0.05) and water temperature (r=−0.76 , −0.88, p<0.05), but at other sites no significant correlation was observed.
[0174] On average, estimated per capita crAssphage contributions were 1.35×10.sup.11 genome copies per day (std. dev.=1.99×10.sup.11) and 2.42×10.sup.8 genome copies per day (std. dev.=2.77×10.sup.8) for DNA and RNA, respectively (
[0175] Using CTrees, variability in per capita crAssphage RNA loads could be explained by service area size. Per capita crAssphage RNA loads were 2.09×10.sup.8 gene copies higher in service areas smaller than 34.681 km.sup.2 (
Association between SARS-CoV-2 Concentrations and COVID-19 Incidence Following Wastewater Sample Collection
[0176] Overall study areas, the highest positive test rates for which SARS-CoV-2 RNA remained BLOD corresponded to a weekly positive test rate of 12.4% and a weekly average of 2.19 daily positive tests per 10,000 population. The highest weekly positive test rates for samples classified as BLOD or DNQ were 20.9% or 3.97 daily positive tests per 10,000 population. Weekly positive test rates corresponding to quantifiable samples ranged from 1.68-15.11% or 0.37-5.95 daily positive tests per 10,000 population depending on the site.
[0177] From a qualitative perspective, samples with quantifiable levels of SARS-Cov-2 RNA were associated with higher levels of positive test results the week following sampling (
[0178] Although the number of samples with quantifiable levels of SARS-CoV-2 RNA was limited (n=29), we did observe a significant relationship between the ratio of SARS-CoV-2 RNA to crAssphage DNA (p=0.005, R.sup.2=0.27) and the number of positive tests per 10,000 population. This relationship was somewhat improved after excluding samples for which no crAssphage RNA was recovered (p=0.004, R.sup.2=0.31). A similar association was found between the SARS-CoV-2:crAssphage DNA ratio and the number of positive tests per 10,000 population the week following sampling (p=0.003, R.sup.2=0.30), which also improved slightly after excluding samples with no recoverable crAssphage RNA (p=0.004, R.sup.2=0.33). Interestingly, significant positive associations between ratios and test rates were identified only when testing was expressed as a proportion of the population served and not as a proportion of total tests conducted (i.e., test positivity). No significant linear associations were identified between SARS-CoV-2 wastewater RNA concentrations and epidemiological parameters without first normalizing to crAssphage DNA.
Discussion
[0179] Advantages of Ultracentrifugation through a Sucrose Cushion
[0180] A sensitive, rapid, and scalable method has been developed for the detection and quantification of SARS-CoV-2 wastewater RNA based on direct ultracentrifugation though a sugar cushion such as a sucrose cushion. The methods capitalize on the ability of ultracentrifugation to remove low-density contaminants that could potentially interfere with subsequent nucleic acid extraction and qPCR. Despite loss of RNA in the extraction process, SARS-CoV-2 was quantified in areas with less than 1 positive test per 10,000 individuals. With this approach, it is possible to obtain wastewater testing results for both SARS-CoV-2 and crAssphage within 4.5 hours (such as less than 5 hours) of a sample being received. The major limiting factor to this method is both ultracentrifuge availability and capacity, as the rotor used here can hold only six samples. However, the use of small volumes of wastewater (only 20 mL per sample) provides advantages in terms of transport, storage, and biosafety, although the use of larger volumes of wastewater may improve sensitivity. Other groups have since found the method to outperform other common concentration procedures for the analysis of wastewater from individual facilitie. This sensitivity, relatively quick turnaround time, and limited dependence on supply chain continuity may be an attractive option for groups considering wastewater surveillance.
[0181] Different concentration and nucleic acid extraction approaches should also be considered in an attempt to improve upon the 7-12% recovery that we estimated in this study. While approaches other than ultracentrifugation have reported higher recovery rates and variable cost and processing times (Table 17), Colosi and colleagues (2020) recently found sucrose cushion-based ultracentrifugation using a fixed-angle rotor, which accommodates tubes with twice the sample volume used in this study, and a NucleoSpin° extraction kit to outperform both electropositive filtration and PEG-precipitation methods. While the ultracentrifugation approach described by Colosi et al. (2020) demonstrated success, it is difficult to compare our methodologies without a direct measurement of nucleic acid percent recovery.
TABLE-US-00017 TABLE 17 Comparison of concentration methods for SARS-CoV-2 wastewater surveillance Table 17 Estimated Appx. Material Viral Turnaround Cost per Nucleic Target for Concentration Time.sup.a Sample.sup.b Acid Recovery Method (hrs) (USD) Recovery Estimation Reference PEG 14-18 16.18 0.28 ± 0.10% PMMoV (Gerrity et al., Precipitation 11 ± 8.4% and BCoV 2021) 6.42 22.63 44.0 ± 27.7% MHV (Ahmed et al., 2020b) 14-18 33.01 2.04 ± 0.70% HCoV 229E (La Rosa et al., 2020) Aluminum 4.33 12.00 11 ± 2.1% MgV and (Randazzo et Flocculation 11 ± 3.5% PEDV al., 2020) 4.58 18.05 45 ± 19% FCV (Barril et al., 2021) Centrifugal 3.67 53.19 73 ± 53% F-specific (Medema et al., Filtration RNA 2020) phages 3.58 53.19 28 ± 9.1% MHV (Ahmed et al., 3.58 32.19 .sup. 56 ± 32.3% MHV 2020b) 4.58 48.41 1.3 ± 0.16% PMMoV (Gerrity et al., 55 ± 38% and BCoV 2021) High Flow Not 31.97 4.0 ± 2.2% PMMoV (Gerrity et al., Ultrafiltration Reported 54 ± 11% and BCoV 2021) Not 42.17 22 ± 4% OC43 (McMinn et al., Reported 2021) Electronegative 3.25 18.89 26.7 ± 15.3% MHV (Ahmed et al., Membranes to 2020b) 65.7 ± 23.8% Sucrose- 4.50 23.45 7-12% BCoV and This Study Cushion SARS-CoV-2 Ultracentrifugation .sup.aTurnaround time defined as the length of time between sample receipt and RT-qPCR data. .sup.bProcessing cost does not reflect the cost of items such as centrifuges, rotors, refrigerator/freezers, qPCR machines, disposables, etc. This estimation also is made assuming all approaches have the same RT-qPCR cost and that reactions are performed in triplicate.
[0182] Results from optimization trials indicate that viral particles in wastewater exist in a mixture of states and a range of sedimentation properties that are likely to change from sample to sample. More sensitive methods, but also improved interpretation of wastewater surveillance data, would be facilitated by a better understanding of the state of both SARS-CoV-2 RNA and surrogate nucleic acids within wastewater and, specifically, what proportion are a) contained within viral particles, b) released and dissolved, or c) released and bound to other particles. While some studies have explored viral associations to various wastewater particles in terms of size and charge variability in particle association between different types of viruses suggests that both SARS-CoV-2 and surrogate viral particle associations may require specific study with an additional focus on the state(s) of nucleic acids. If some DNA or RNA is bound, knowing the size and mass of the particles and how they vary over time and across locations would greatly improve the precision of methods based on size (e.g., ultrafiltration), charge (e.g., electropositive filtration), or mass (e.g., ultracentrifugation). Additionally, variability in wastewater particle composition between service areas and/or sampling locations may affect viral decay, as different particle associations have been shown to impact the survival of pathogens (as reviewed in Chahal et al. 2016). Bivins et al., (2020) estimated that 90% of SARS-CoV-2 RNA is degraded after 3.3 days in wastewater. A better understanding of how particle associations alter decay these rates is needed.
Epidemiologically Relevant Limits of Detection
[0183] Although method performance varied across sites, SARS-CoV-2 wastewater RNA could be quantified in some areas experiencing as low as a 1.68% positivity rate. The method's ability to quantify such low levels of SARS-CoV-2 RNA suggests that the results are likely to be useful in managing public health responses at the initial stages of community spread, making this an important public health tool for COVID-19 surveillance. Observation that SARS-CoV-2 RNA detection was associated with a higher incidence of COVID-19 in the next seven days further supports the use of wastewater surveillance as an early warning system with the amount of early warning dependent on a wide range of factors including frequency of wastewater sampling, site and sample characteristics affecting the sensitivity of detection, and the rate of the spread of infection. Further characterization of the service areas themselves and their wastewater infrastructure is needed to determine more precisely the areas where WBE for SARS-CoV-2 would be most useful.
CrAssphage as a Normalizer for Spatiotemporal Variability
[0184] Quantification of a surrogate organism in addition to SARS-CoV-2 can not only serve as a quality assurance measure, ensuring sufficient amounts of nucleic acids are recovered, but can also be used to normalize measured SARS-CoV-2 values to help account for the fluctuating concentrations of fecal material in wastewater. Observation that SARS-CoV-2:crAssphage DNA ratios were significantly associated with the number of positive tests per 10,000 individuals, both 7 days before and after sampling, supports the use of crAssphage as a surrogate for SARS-CoV-2. As the significance of this association was improved following the exclusion of samples from which crAssphage RNA was not recovered, the quantification of both DNA and expressed RNA may be advantageous when using a DNA virus as a surrogate. Other viruses, such as pepper mild motile virus (PMMoV), have been used to facilitate the interpretation of SARS-CoV-2 WBE data. Despite being an RNA virus like SARS-CoV-2, PMMoV is a rod-shaped virus that is very stable in the environment and has high temperature tolerance and resilience in adverse physiochemical conditions (Kitajima et al., 2018), which likely contributes to its relatively consistent abundance across wastewater treatment facilities (D′Aoust et al., 2021b, 2021a). In contrast, results herein show that crAssphage nucleic acid concentrations are somewhat reflective of site differences and that crAssphage DNA concentrations respond to changes in flow and crAssphage RNA fluctuates in part as a function of sewershed area. Lower crAssphage RNA levels from larger sewersheds likely reflects the relative instability of RNA and suggests that measures of sewershed area, or other proxies for waste transit time, could help link SARS-CoV-2 wastewater RNA levels to relevant epidemiological parameters.
[0185] The assay used to target crAssphage, CPQ_056, has been shown to cross-react with poultry litter (Ahmed et al., 2018). However, CPQ_056 marker concentrations were over 2-3 orders of magnitude lower in poultry litter compared to untreated wastewater and likely had little effect on our quantification of crAssphage nucleic acids. Nonetheless, use of this marker in areas heavily affected by poultry fecal contamination is not recommended.
Conclusions
[0186] The ultracentrifugation-based method described here is a rapid and sensitive approach for the detection of SARS-CoV-2 in wastewater from areas with low numbers of COVID-19 cases. In embodiments, after normalization with crAssphage DNA, higher concentrations of SARS-CoV-2 wastewater RNA were significantly associated with positive COVID-19 tests the week following wastewater sample collection suggesting the approach could help predict near-term COVID-19 case levels.
Example IV
Ultracentrifugation Alterations
Increased Sensitivity by Increasing Volume of Wastewater Analyzed
[0187] Studies were initially conducted using 38.5 ml tubes containing 12 ml sucrose cushion and 20 ml wastewater. Subsequent studies were conducted using the F37L-8x100 rotor equipped with 100 ml tubes that could hold 17 ml of sucrose cushion and 45 ml wastewater (37,000 rpm [182,500×g] for 32 minutes) thereby more than doubling the sensitivity of the method.
Nucleic Acid Extraction
[0188] Studies were conducted using a Qiagen PowerViral/Allprep Kit for nucleic acid extraction. However, the availability of this extraction method may be limited, and alternative methods were investigated for efficient recovery of nucleic acids. The ZYMO Quick-RNA Fungal/Bacterial Microprep Kit resulted in the best recovery of nucleic acids and was used for all subsequent analyses. Briefly, after ultracentrifugation and removal of the supernatant, 800 ul RNA Lysis buffer is added directly to the pellet. The dissolved pellet is then transferred to 2 ml tubes and stored at −20 C (same day extraction) or −80 C (next day extraction) before extraction following the manufacturer's procedure. Nucleic acids are eluted in 30 ul DNase/RNase-free water and used immediately or stored at −80 C.
Integration of Bovine Coronavirus Spike-and-Recovery System
[0189] A spike and recovery system comprised of a commercially available bovine coronavirus vaccine and a previously developed qPCR assay has been incorporated into the workflow to estimate the recovery of nucleic acids. Briefly, lyophilized vaccine (Zoetis, VLN190/PCN 1931.20) containing bovine coronavirus RNA (publicly available NC_003045.1) is mixed with 500 ul filter-sterilized 1× PBS to create single-use aliquots of approximately 10.sup.6 copies per ul. Ten microliters is added directly to the wastewater sample upon receipt. Following ultracentrifugation and nucleic acid extraction the previously developed bovine coronavirus assay (‘BCoV’, Decaro et al 2008) is used to quantify the amount of recovered spike to provide a percentage recovery.
Variant Detection
69-70 S Deletion Assay
[0190] There is a tremendous need to monitor viral variants within the population that may confer increased transmissibility or immune escape. Therefore, a qPCR assay has been developed targeting the 69-70 S deletion that is common in the SARS-CoV-2 variant B.1.1.7 (Alpha' or previously, the ‘UK’ variant) that can be integrated into the wastewater analysis workflow (Table 21,
Sequencing
[0191] In addition to monitoring for specific individual nucleotide changes, generating whole genome sequence data for wastewater samples is demonstrated, using an optimized sequencing protocol modified from the ARCTICv3 method, that achieves whole-genome viral sequence coverage sufficient to clearly identify variant lineages (
[0192] In embodiments, the present disclosure includes a sequencing and variant analysis protocol, including one or more of the steps below: [0193] 1. The purity and concentration of each nucleic acid is checked by UV spectrophotometry, and recorded for QC purposes. [0194] 2. The composite RNA plate is then subjected to the optimized SARS-CoV-2 sequencing protocol, which incorporates the ARCTICv3 method. Briefly, samples are subjected to reverse transcription in 20 uL volumes using NEB LunaScript MasterMix, followed by multiplex PCR using Q5 HostStart High-Fidelity 2x MasterMix (NEB) with the ARCTIC Primer Pools 1 and 2 (from IDT) in 24 uL volumes. Once complete, plates are evaluated for amplification using a PicoGreen assay to ensure PCR yields in the expected range and diluted by addition of molecular biology grade water to approximately 2.5 ng/uL. These diluted DNA samples are then processed using the plexWell 384 Library Preparation Kit (Seq Well), enabling a single technician to complete library synthesis (including sample barcoding, pool barcoding, library amplification, and purification) of 282 samples plus positive and negative controls in 1.5 days. [0195] 3. Sequencing library sizes are assessed using the High Sensitivity DNA Kit on the Agilent Bioanalyzer 2100, quantified with the Qubit fluorometer using the Invitrogen Qubit dsDNA HS Assay Kit, and sequenced on the Illumina MiSeq or NextSeq 500 instrument, using a NextSeq Mid Output Kit (for up to 3 pools) or a NextSeq High Output Kit (for up to 9 pools) with paired end 2x151bp reads containing 1% PhiX spike-in. This requires approximately 25 hours to complete, and typically generates >130M paired-end (Mid-Output) or >400M paired-end (High-Output) reads with more than 80% of all bases exceeding a QC phred score of 30. [0196] 4. After sequencing is completed, data are converted to base calls in the SUNYMAC core using the Illumina Bcl2FastQ in a Linux command line format and uploaded to Illumina BaseSpace using the command line interface. In BaseSpace, the Dragen COVID Lineage application (v.3.5.2) is used to perform QC analysis as well as genome assembly, variant calling and annotation, and FASTQ file generation. The results of this are examined for various QC metrics, including high viral kmer counts, lack of host kmer counts, coverage depth, missingness, and mutation numbers, which are downloaded in their entirely for deposition into the sample specific database. [0197] 5. FASTQ sequences are uploaded to GISAID NextClade for confirmation of all sequence and variant calls obtained by Dragen, and sequences visualized with the web-based clustering tools to map divergence of the different lineages. [0198] 6. For sequence deconvolution, the raw FASTQ sequences are subjected to adapter and index trimming, followed by alignment to the SARS-CoV-2 genome (accession number NC_045512.2) using Bowtie2 or the BWA algorithm. Aligned sequences are then used to call variants using SamTools and FreeBayes open source tools compared to the reference sequence. Only high-quality variants found with both programs are carried through to the next stage. [0199] 7. Where variants were observed, the majority of reads are used to identify the primary variant sequence present in the sample (top sequence in blue,
An example of the results of these calculations is shown for one representative wastewater sample obtained in Syracuse N.Y., March 2021. This sample yielded an estimate of 1% UK variant reads and 5.8% NY variant reads. The remaining viral variants identified did not help delimit the fractions any further in this specific case.
Tables
[0201]
TABLE-US-00018 TABLE 21 Primer names and sequences for the 69-70 S deletion assay. Primer Name Sequence (5′-3′) Reference Yale/ESF_69/70_F_01 CAA TGT TAC TTG GTT CCA TGC TAT Modified from CTC (SEQ ID NO: 10) Vogels et al 2021 ESF_69/70_R_01 CCA GCC TCT TAT TAT GTT AGA CTT This study CTC AG (SEQ ID NO: 11) ESF_69/70_P_01 [Cy5] GGT ATC AAA [TAO] CCT CTT AGT This study ACC ATT GGT CCC AGA GA [IBRQ]* (SEQ ID NO: 12) *IDT oligo entry format: /5Cy5/GGTATCAAA/TAO/CCTCTTAGTACCATTGGTCCCAGAGA/3IAbRQSp/(SEQ ID NO: 13
TABLE-US-00019 TABLE 22 Performance parameters of the 69-70 S deletion assay on synthetic DNA standards. Table 22 Assay Name R.sup.2 Intercept Slope Efficiency LOQ ESF_69/70 0.999 38.132 −3.404 96.68% 5
TABLE-US-00020 TABLE 23 Use of newly developed 69-70 deletion assay to estimate the prevalence or maximum prevalence of variants containing the 69-70 deletion from wastewater. In cases where the 69-70 deletion was not detected, the limit of detection/quantification (5 copies/reaction) was used to estimate the maximum prevalence. If the 69-70 deletion was in the quantifiable range, prevalence of variants containing the 69-70 deletion was estimated based on the proportion of ESF_69-70: IP2/IP4. Table 23 SARS-CoV-2 (IP2/IP4, 69-70 deletion Maximum Date Sample Wuhan strain) (ESF_69-70) Prevalence prevalence Sample ID Received copies/mL copies/mL (%) (%) WW-4025 Feb. 26, 2021 117.0 Not NA 0.6 Detected WW-4026 Feb. 26, 2021 3.0 Not NA 22.3 Detected WW-4058 Mar. 1, 2021 39.5 Not NA 1.7 Detected WW-4066 Mar. 2, 2021 18.2 Not NA 3.7 Detected WW-4072 Mar. 2, 2021 26.4 Not NA 2.5 Detected WW-4073 Mar. 2, 2021 34.1 0.895 2.6 NA
TABLE-US-00021 TABLE 24 Sequencing QC and alignment metrics for wastewater and reference samples. Sample Virus Load Total Total Aligned Sample name Sample Source PCR date (copies/uL) reads alignments % P18A11_S177 Syracuse University Apr. 4, 2021 255.6 181145 45226 13.42 P18A12_S185 SUNY Oneonta Mar. 28, 2021 25.4 113660 10025 5.05 P18811_S178 Onondaga County Mar. 28, 2021 11.1 46585 36171 39.51 P18812_S185 SUNY Oswego Apr. 4, 2021 44.9 79152 29955 19.78 P18C11_S179 Siena College Mar. 28, 2021 65.7 56481 9653 9.27 P18C12_S187 St. John Fisher Mar. 21, 2021 72.8 22067 8338 19.91 P18D11_S180 RIT Mar. 28, 2021 50.6 36999 30522 41.96 P18D12_S188 Syracuse University Mar. 14, 2021 723.8 132706 222640 84.56 P18E11_S181 Oswego City Apr. 4, 2021 27.1 68679 21291 16.10 P18E12_S1S9 RIT Jan. 31, 2021 46.8 88986 112981 64.21 P18F11_S182 Cortland City Mar. 28, 2021 12.4 50578 61238 61.40 P18F12_S190 Oneonta City Jan. 31, 2021 79.3 106634 7123 3.81 P18G11_S183 Oneonta City Apr. 4, 2021 30 24193 17365 36.87 P18H11_S184 Jefferson County Apr. 4, 2021 45.4 32796 35690 55.31 P18G12_S191 Wuhan Reference RNA Jan. 1, 2020 50 325501 631631 97.75 Total Total Total Avg. unaligned unique unique Coverage coverage Avg. Avg. Sample name reads singleton paired % depth length quality P18A11_S177 156829 3406 20910 99.2 194.1 136.4 32.4 P18A12_S185 107924 1446 4290 97.9 40.5 134.6 32.9 P18811_S178 28179 643 17764 94.4 169.1 135.3 33.1 P18812_S185 63499 1351 14302 96.0 133.4 134.8 33.0 P18C11_S179 51246 817 4418 92.7 43.7 136.1 32.9 P18C12_S187 17674 448 3945 93.0 36.6 131.1 33.0 P18D11_S180 21475 526 14998 96.7 138.2 134.6 33.2 P18D12_S188 20357 2058 110291 99.9 999.0 136.0 33.0 P18E11_S181 57620 827 10232 96.2 95.5 135.4 33.0 P18E12_S1S9 31848 1295 55843 99.7 504.1 135.3 33.1 P18F11_S182 19525 868 30185 98.4 277.5 135.9 33.1 P18F12_S190 102572 1001 3061 98.3 28.7 137.2 32.6 P18G11_S183 15274 473 8446 92.4 81.6 134.4 33.0 P18H11_S184 14657 588 17551 93.6 168.1 134.6 32.9 P18G12_S191 7327 4717 313457 99.9 2866.7 136.8 33.0
TABLE-US-00022 TABLE 5 Deconvolution results for variant strain detection, for alleles >1% of total raw reads. % of % REF % ALT Total Adjusted Position Mutation Present in Clades (Lineages) alleles alleles Reads Prevalence 1059 Orf1a 20C, 20G, 20H (Beta-SA, V2), 12% 88% 7.5% 6.5% C1059T 21C (Epsilon-CA), 21F (Iota-NY) 5986 Orf1a 20I (Alpha-UK) 43% 57% 1.4% 0.8% C5986T 15279 Orf1b 20I (Alpha-UK) 36% 64% 1.5% 1.0% C15279T 25517 Orf3a 2IF (Iota-NY) 8% 92% 6.2% 5.7% C25517T 25563 Orf3a 20G, 20H (Beta-SA, V2), 21C 7% 93% 5.5% 5.1% Q57H (Epsilon-CA), 21F (Iota-NY) 28048 Orf8 20I (Alpha-UK) 52% 48% 3.2% 1.6% R52I 28977 N S235F 20I (Alpha-UK) 41% 59% 1.3% 0.8% Mean adjusted prevalence of 21F 5.8% (Iota-NY) in wastewater composite: Mean adjusted prevalence of 20I 1.0% (Alpha-UK) in wastewater composite: % REF indicates the percentage of reads covering this allele that match the Wuhan reference sequence, % ALT indicates the percentage of reads covering the same allele that match a variant base sequence, % of Total Reads indicates the percent of the combined coverage of each allele out of the total mapped reads in the sample, Adjusted Prevalence is the produce of the % ALT and % of Total Reads.
[0202] The entire disclosure of all applications, patents, and publications cited herein are herein incorporated by reference in their entirety.