IMPROVED TRANSPOSON INSERTION SITES AND USES THEREOF

Abstract

The present invention relates to novel transposon constructs and uses thereof. The novel transposon constructs of this invention have been developed based on structure-guided engineering approaches of the IS608 transposon. Provided are polynucleotides encoding for transposon ends, which may advantageously be used for site-specific insertion of a nucleotide sequence of interest into the genome of a target cell or a target DNA molecule. The invention provides further nucleic acids, vectors and recombinant cells encoding or containing the improved polynucleotides encoding for transposon ends, as well as a transposase system. Hence, the invention provides many tools for molecular genetic approaches for genome alteration, such as cloning strategies. Furthermore provided are medical and non-medical uses of the polynucleotides of the invention. The invention is in particular useful as a tool for gene delivery in genetically modified cell based therapeutic approaches for treating various diseases and for genetic tagging of endogenous proteins in research.

Claims

1. A polynucleotide comprising a nucleic acid sequence encoding for, or being, at least one transposon end, wherein said at least one transposon end has the following structure in 5′ to 3′ direction: a 5′ flanking region, a transposase recognition site, such as a 5′ guide sequence, optionally a cloning cassette for introducing a genetic cargo construct, and a 3′ flanking region; characterized in that the 5′ flanking region and/or the 3′ flanking region comprise a target complementarity region having a sequence identity of at least 60% to a nucleic acid sequence in a target genome.

2. The polynucleotide according to claim 1, wherein the polynucleotide further comprises in 5′ to 3′direction: (a) Optionally, a 5′-cleavage site, (b) a 5′-guide sequence, (c) one or more 5′—transposon structural element(s), (d) optionally, the cloning cassette for introducing a genetic cargo construct, (e) a 3′ guide sequence, (f) One or more 3′ transposon structural element(s), (g) Optionally, a 3′-cleavage site.

3. The polynucleotide according to claim 2, wherein the target complementarity region is in close sequence proximity to the 5′-guide sequence, preferably not more than 100 nucleotides apart, more preferably not more than 50 nucleotides apart, most preferably between 15 to 40 (or 20 to 30) nucleotides apart from the 3′end of 5′ guide sequence.

4. The polynucleotide according to claim 2 or 3, wherein the target complementarity region is located 3′ of the first 5′ transposon structural element.

5. The polynucleotide according to any one of claims 2 to 4, wherein the 5′ and/or 3′ transposon structural element is a sequence, that is capable of forming a 3-dimensional structure, such as a hairpin, within the polynucleotide and preferably is selected from imperfect or perfect palindrome sequences, inverted terminal repeats (ITRs), and/or direct terminal repeats (DTRs), most preferably wherein said transposon structural element is an imperfect palindrome sequence.

6. The polynucleotide according to any one of claims 2 to 5, wherein (a) The 5′-cleavage site has the sequence TTAC; and/or (b) The 3′-cleavage site has the sequence TCAA; and/or (c) The 5′-guide sequence has the sequence AAAG; and/or (d) The 3′-guide sequence has the sequence GAAT; and/or optionally, with not more than one, preferably none, nucleotide variation of these sequences.

7. The polynucleotide according to any one of claims 1 to 6, wherein the polynucleotide does not comprise a sequence encoding for a functional transposase protein, preferably not comprising a tnpA and/or tnpB gene.

8. The polynucleotide according to any one of claims 1 to 7, wherein the cloning cassette comprises one or more restriction enzyme recognition sites.

9. The polynucleotide according to any one of claims 1 to 8, wherein the target complementarity region comprises a sequence complementary to a region within a target genome, which (i) is located outside of an expressible genetic element, or (ii) within an expressible genetic element, and preferably wherein (ii) the target complementarity region is selected such that the expressible genetic element is not expressible, or reduced expressible, or increased expressible and/or the expressed sequence is dis-functional after integration of the transposon.

10. The polynucleotide according to any one of claims 1 to 9, wherein the transposon is not capable of being mobilized within a target genome.

11. The polynucleotide according to any one of claims 1 to 10, wherein said polynucleotide is RNA, DNA, cDNA, PNA, or a combination thereof.

12. The polynucleotide according to any one claims 1 to 11, wherein said transposase recognition site comprises one or more transposon structural elements and comprises imperfect palindrome sequences, inverted terminal repeats (ITRs), and/or direct terminal repeats (DTRs), preferably wherein said transposase recognition site comprises imperfect palindrome sequences.

13. The polynucleotide according to any one of claims 1 to 12, wherein said transposon is a single-strand transposon, and/or a double-strand transposon, preferably wherein said transposon is a single-strand transposon.

14. The polynucleotide according to any one of claims 1 to 13, wherein said target complementarity region is 1 to 100 nucleotides long, more preferably 2 to 50, more preferably 4 to 20, and most preferably 8 to 13 nucleotides long.

15. The polynucleotide according to any one of claims 1 to 14, wherein no nucleic acid sequence is located between said target complementarity region and said transposase recognition site or wherein a nucleic acid sequence is located between said target complementarity region and said transposase recognition site, preferably wherein said sequence is between 1 and 100 nucleotides long, more preferably between 1 and 10 nucleotides long, even more preferably between 1 and 5 nucleotides long, and most preferably wherein said sequence is 2 or 3 nucleotides long.

16. The polynucleotide according to any one of claims 1 to 15, wherein said target complementarity region is located in the 3′ flanking region, preferably wherein said target complementarity region is located at the 5′ end of said 3′ flanking region, or wherein said target complementarity region is located in the 5′ flanking region, preferably wherein said target complementarity region is located at the 3′ end of said 5′ flanking region.

17. The polynucleotide according to any one of claims 1 to 16, wherein said polynucleotide is for site-specific insertion of a nucleotide sequence of interest to be inserted into the genome of a target cell, into a target plasmid, and/or into a target polynucleotide, preferably wherein said nucleotide sequence of interest is a modified transposon sequence, optionally wherein the transposase gene is replaced with a sequence of interest.

18. The polynucleotide according to any one of claims 1 to 17, wherein said transposon sequence comprises an insertion sequence (IS) of the IS200/IS605 family, such as IS608, ISDra2, IS605, or of IS630, IS701, IS607, IS982, IS3, IS1, IS6, IS5, IS4, or IS66, preferably wherein said insertion sequence (IS) is IS608.

19. The polynucleotide according to any one of claims 1 to 18, wherein said transposase recognition site comprises the nucleic acid sequence of SEQ ID No: 61 (CCCCTAGCTITTAGCTATGGGG).

20. A composition comprising the polynucleotide according to any one of claims 1 to 19, and a nucleic acid encoding an integrating enzyme, optionally wherein said nucleic acid is under the control of a promoter element, or an integrating polypeptide, such as an integrating enzyme polypeptide.

21. The composition according to claim 20, wherein the nucleic acid is DNA, cDNA, PNA, RNA, or a combination thereof, or an expression vector expressing said nucleic acid.

22. The composition according to claim 20 or 21, wherein the polynucleotide encoding for said transposon and the nucleic acid encoding said integrating enzyme are the same nucleic acid molecules.

23. The composition according to claim 20 or 21, wherein the polynucleotide encoding for said transposon and the nucleic acid encoding said integrating enzyme are separate nucleic acid molecules.

24. The composition according to any one of claims 20 to 23, wherein said integrating enzyme is a transposase of the IS200/IS605 family, such as IS608, or a IS630, IS701, IS607, IS982, IS3, IS1, IS6, IS5, IS4, or IS66 transposase.

25. The composition according to any one of claims 20 to 24, wherein said integrating enzyme is a histidine-hydrophobic-histidine endonuclease, such as the IS6o8-encoded transposase TnpA.

26. An expression construct, comprising an expressible polynucleotide according to any one of claims 1 to 19, or a composition according to any one of claims 20 to 25, and a promoter element, wherein the promoter element is operably linked to the expressible polynucleotide to allow for the expression of the polynucleotide.

27. A nucleic acid vector comprising a polynucleotide according to any one of claims 1 to 19, a composition according to any one of claims 20 to 25, and/or an expression construct according to claim 26.

28. A recombinant cell comprising a polynucleotide according to any one of claims 1 to 19, a composition according to any one of claims 20 to 25, an expression construct according to claim 26, and/or a nucleic acid vector according to claim 27.

29. A transposon system comprising (a) a polynucleotide according to any one of claims 1 to 19, an expression construct according to claim 26, a nucleic acid vector according to claim 27, and/or a recombinant cell according to claim 28; and (b) a transposase polypeptide of the IS200/IS605 family, such as IS6o8, or a IS630, IS701, IS607, IS982, IS3, IS1, IS6, IS5, IS4, or IS66, preferably wherein said transposase polypeptide is the IS6o8-encoded transposase TnpA.

30. In vitro use of a transposon system according to claim 29 for gene delivery into a target cell, a target plasmid, and/or a target polynucleotide.

31. An in vitro method for gene delivery into a target cell comprising the following steps: (a) bringing into contact the transposon system according to claim 29 with a target cell; and (b) culturing said target cell under conditions permissive to the culture of said target cell.

32. A pharmaceutical composition comprising a polynucleotide according to any one of claims 1 to 19, a composition according to any one of claims 20 to 25, an expression construct according to claim 26, a nucleic acid vector according to claim 27, a recombinant cell according to claim 28, and/or a transposon system according to claim 29, together with a pharmaceutically acceptable carrier and/or excipient.

33. A kit comprising (a) a polynucleotide according to any one of claims 1 to 19, an expression construct according to claim 26, a nucleic acid vector according to claim 27, and/or a recombinant cell according to claim 28; and (b) a transposase polypeptide of the IS200/IS605 family, such as IS6o8, or a IS630, IS701, IS607, IS982, IS3, IS1, IS6, IS5, IS4, or IS66 transposase, preferably wherein said transposase polypeptide is the IS6o8-encoded transposase TnpA.

34. A kit comprising a polynucleotide according to any one of claims 1 to 19, a composition according to any one of claims 20 to 25, an expression construct according to claim 26, a nucleic acid vector according to claim 27, a recombinant cell according to claim 28, or a transposon system according to claim 29; and instructions for use.

35. A compound for use in the treatment of a disease, wherein the compound is selected from the polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, the pharmaceutical composition according to claim 32, and/or the kit according to claim 33 or 34, preferably wherein the disease is an infectious and/or a proliferative disease, more preferably wherein said infectious disease is a bacterial infection, such as an H. pylori infection, and/or wherein said proliferative disease is cancer, such as non-small cell lung cancer, small cell lung cancer, renal cell cancer, brain cancer, gastric cancer, colorectal cancer, hepatocellular cancer, head and neck cancer, pancreatic cancer, prostate cancer, leukemia, breast cancer, Merkel cell carcinoma, melanoma, ovarian cancer, urinary bladder cancer, uterine cancer, gallbladder and bile duct cancer, esophageal cancer, or a combination thereof, preferably wherein said cancer is H. pylori-induced cancer.

36. The polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, the pharmaceutical composition according to claim 32, and/or the kit according to claim 33 or 34, for use in the diagnosis and/or treatment of an infectious and/or proliferative disease, or for use in the manufacture of a medicament against an infectious and/or proliferative disease, preferably wherein said infectious disease is a bacterial infection, such as an H. pylori infection, or wherein said proliferative disease is cancer, such as non-small cell lung cancer, small cell lung cancer, renal cell cancer, brain cancer, gastric cancer, colorectal cancer, hepatocellular cancer, head and neck cancer, pancreatic cancer, prostate cancer, leukemia, breast cancer, Merkel cell carcinoma, melanoma, ovarian cancer, urinary bladder cancer, uterine cancer, gallbladder and bile duct cancer, esophageal cancer, or a combination thereof, preferably wherein said cancer is H. pylori-induced cancer.

37. A method of preventing and/or treating an infectious and/or a proliferative disease in a subject, the method comprising administering to the subject an effective amount of a polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, the pharmaceutical composition according to claim 32, thereby preventing and/or treating said infectious and/or proliferative disease in the subject, preferably wherein said infectious disease is a bacterial infection, such as an H. pylori infection, or wherein said proliferative disease is cancer, such as non-small cell lung cancer, small cell lung cancer, renal cell cancer, brain cancer, gastric cancer, colorectal cancer, hepatocellular cancer, head and neck cancer, pancreatic cancer, prostate cancer, leukemia, breast cancer, Merkel cell carcinoma, melanoma, ovarian cancer, urinary bladder cancer, uterine cancer, gallbladder and bile duct cancer, esophageal cancer, or a combination thereof, preferably wherein said cancer is H. pylori-induced cancer.

38. The polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, the pharmaceutical composition according to claim 32, and/or the kit according to claim 33 or 34, for use in a gene delivery method, preferably wherein said method is for gene delivery into a cell selected from an eukaryotic and a prokaryotic cell, such as a cell of a human, a mouse, a rabbit, a dog, a monkey, a cat, a bacterium, or a yeast cell.

39. The polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, the pharmaceutical composition according to claim 32, and/or the kit according to claim 33 or 34, for use in manufacturing an engineered cell for a cell therapy, preferably wherein said cell is a T cell or a T cell progenitor, such as a CAR-T cell.

40. The method according to claim 39, wherein the T cell or T cell progenitor is autologous, or wherein the T cell or T cell progenitor is allogeneic.

41. A method of treating cancer in a subject in need thereof, comprising: (a) isolating a cell from said subject or from a healthy donor; (b) transfecting or transforming the cell with a polynucleotide according to any one of claims 1 to 19, the composition according to any one of claims 20 to 25, the expression construct according to claim 26, the nucleic acid vector according to claim 27, the recombinant cell according to claim 28, the transposon system according to claim 29, to produce a transfected or transformed cell; (c) expanding the transfected or transformed cell to produce a plurality of transfected or transformed cells; and (d) administering the plurality of transfected or transformed cells to said subject.

42. The method of claim 41, wherein the cell is a T cell or a T cell progenitor, optionally wherein said T cell or T cell progenitor is autologous or allogeneic.

Description

BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCES

[0103] The figures show:

[0104] FIG. 1: shows sequence hallmarks affecting IS6o8 target selection.

[0105] FIG. 2: shows that IS6o8 can be specifically targeted to longer integration sites by extended LE/target base pairing. (A) Close-up of the TnpA/LE29/T6′ structure, highlighting the proximity between the 3′ end of IPL and the 5′ end of the target oligonucleotide. (B) shows a schematic design of the IS608 transposon junction (Ji, where ‘i’ is a variable indicating a specific variant number) and complementary target substrates (Tic, with ‘i’ marking a specific variant as above) used for retargeting. (C) Sequencing DNA PAGE gel monitoring J1 cleavage and integration into its T1c complementary target. (D) J1 integrates selectively into its complementary target substrate (Tic) even in the excess of scrambled target substrates.

[0106] FIG. 3: shows the IS6o8 integration specificity can be enhanced to 17 nt sites and retargeted to non-native target sites.

[0107] The sequences show: [it might make sense to include the Cas9 protein sequence of the Cas9 protein used in the experiments]

TABLE-US-00001 (cleavage target site, CT) SEQ ID No: 1 TTAC (LE29) SEQ ID NO: 2 AAAGCCCCTAGCTTTTAGCTATGGGGATA (T6′ Activity Assays) SEQ ID NO: 3 ATTACC (LE) SEQ ID NO: 4 CGGGCTGCAGGAATTCGATTTGCGCTAGTGCAAAAATTACCAAAACTA ACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGATACAAGGCGAAACG CCTT (LE1) SEQ ID NO: 5 CGGGCTGCAGGAATTCGATTTGCGCTAGTGCAAAAATTACCAAAACTA ACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTCGCCCGGAAAACG CCTT (RE) SEQ ID NO: 6 RE CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTAT GTCAACAAATT (Jwt) SEQ ID NO: 7 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGATACA AGGCGAAACGCCTT (Jwt-oh) SEQ ID NO: 8 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGATACA AGGCGAAATAAAGG (Jwt-oh-42T) SEQ ID NO: 9 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTACA AGGCGAAATAAAGG (J1) SEQ ID NO: 10 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTCGC CCGGAAAACGCCTT (J1-h) SEQ ID NO: 11 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTCGC CCGGAAAATCCGGG (J2) SEQ ID NO: 12 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTGCC CGAACAAACGCCTT (J3) SEQ ID NO: 13 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGTTCGC CCGGATGATTCCTT (J4) SEQ ID NO: 14 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTAAACCCCCTAGCTTTTAGCTATGGGGTTCGC CCGGAAAACGCCTT (J5) SEQ ID NO: 15 CTCATGCTTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTC AACAAAACTAACGCCTTCAAACCCCTAGCTTTTAGCTATGGGGTTCGC CCGGAAAACGCCTT (Tr) SEQ ID NO: 16 CCGATGATGAGGAACCCCCCCCTAGAGCTTTTATTACTGATGATGAGG AACCCCCCCCTAGTGATGA (Twtc) SEQ ID NO: 17 CCGATGATGAGGAACCCCCCCCCGCCTTGTTTATTACTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T1c) SEQ ID NO: 18 CCGATGATGAGGAACCCCCCCCTCCGGGCGTCGTTACTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T2c) SEQ ID NO: 19 CCGATGATGAGGAACCCCCCCCGTTCGGGCTGATTACTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T3c_1) SEQ ID NO: 20 CCGATGATGAGGAACCCAATCATCCGGGCGTCGTTACTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T3c_2) SEQ ID NO: 21 CCGATGATGAGGAACCCCCCCCTAGGGGCGTCGTTACTGATGATGAGG AACCCCCCCCTAGT (T4c) SEQ ID NO: 22 CCGATGATGAGGAACCCCCCCCTCCGGGCGTCGTTAGTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T5c) SEQ ID NO: 23 CCGATGATGAGGAACCCCCCCCTCCGGGCGTCGTGATTGATGATGAGG AACCCCCCCCTAGTGATGATGAGGATT (T4r) SEQ ID NO: 24 CCGATGATGAGGAACCCCCCCCTAGAGCTTTTATTAGTGATGATGAGG AACCCCCCCCTAGTGATGA (T5r) SEQ ID NO: 25 CCGATGATGAGGAACCCCCCCCTAGAGCTTTTATGATTGATGATGAGG AACCCCCCCCTAGTGATGA (right cleavage site, CR) SEQ ID NO: 26 TCAA (left cleavage site, CL) SEQ ID NO: 27 TTAC (right guide sequence, GR) SEQ ID NO: 28 GAAT (left guide sequence, GL) SEQ ID NO: 29 AAAG SEQ ID NO: 30 AAAC SEQ ID NO: 31 CAAA SEQ ID NO: 32 TTCGCCCGGA SEQ ID NO: 33 TCCGGGCGTCGTTAC (SET-1 ‘1.1’) SEQ ID NO: 34 GTTCGGGCTGATTACCTGACACTGGGCCTGC (SET-1 ‘1.2’) SEQ ID NO: 35 GTGGCGGAAAATTACCCGCAGGCTGGTATCA (SET-1 ‘1.3’) SEQ ID NO: 36 TCCCGTGAACTTTACCCGGTGGTGCATATCG (SET-1 ‘1.4’) SEQ ID NO: 37 TGACGGTCCTTTTACCCGCAAACATGCCGAA (SET-1 ‘1.5’) SEQ ID NO: 38 AATCACACAGATTACCCGTAAACAGCCTGAA (SET-1 ‘1.6’) SEQ ID NO: 39 AGGCTGCGCAGTTACCGGGTATATATAAGAT (SET-1 ‘1.7’) SEQ ID NO: 40 AAAATACCTGGTTACCCAGGCCGTGCCGGCA (SET-1 ‘1.8’) SEQ ID NO: 41 CTGGGTGATATTTACCTGAATCATAAATACA (SET-2 ‘2.1’) SEQ ID NO: 42 TGGCAATGGTGTTACTGAACGCAGCCGTCAG (SET-2 ‘2.2’) SEQ ID NO: 43 ACGTCCACGCCTTACGAATCCCTGCTTGTAA (SET-2 ‘2.3’) SEQ ID NO: 44 GCGAATGCTGTTTACGGGGTTTTTTACTGGT (SET-2 ‘2.4’) SEQ ID NO: 45 CCATCCGTCCTTTACGGTGGTTTCTGAGCAG (SET-2 ‘2.5’) SEQ ID NO: 46 TCCGGGCGTCGTTACAGGGGGCCAGTATCAC (SET-2 ‘2.6’) SEQ ID NO: 47 TGGCAATGGTGTTACAGGGGGCCAGTATCAC (SET-2 ‘2.2u’) SEQ ID NO: 48 ACGTCCACTGATTACGAATCCCTGCTTGTAA (SET-2 ‘2.2d’) SEQ ID NO: 49 ACGTCCACGCCTTACCTGACACTGGGCCTGC (SET-2 ‘2.2ud’) SEQ ID NO: 50 ACGTCCACTGATTACCTGACACTGGGCCTGC (‘1.8a’) SEQ ID NO: 51 CTGGGTGATATTTACATGAATCATAAATACA (‘1.8g’) SEQ ID NO: 52 CTGGGTGATATTTACGTGAATCATAAATACA (‘1.8t) SEQ ID NO: 53 CTGGGTGATATTTACTTGAATCATAAATACA (‘2.1c) SEQ ID NO: 54 TGGCAATGGTGTTACCGAACGCAGCCGTCAG (‘2.6c) SEQ ID NO: 55 TGGCAATGGTGTTACCGGGGGCCAGTATCAC (‘2.6g) SEQ ID NO: 56 TGGCAATGGTGTTACGGGGGGCCAGTATCAC (‘2.6t) SEQ ID NO: 57 TGGCAATGGTGTTACTGGGGGCCAGTATCAC SEQ ID NO: 58 NNTTACCAAAACTAACGCCTTAAAGC SEQ ID NO: 59 AATTACCAAAACTAACGCCTTAAAGCCCCTAGCTTTTAGCTATGGGGA TACAAGGCGAAACGCCTT SEQ ID NO: 60 TTTAGCTAGAATCCCCTAGCTTTAGCTATGGGGAGTATGTCAANNNN SEQ ID NO: 61 CCCCTAGCTTTTAGCTATGGGG

EXAMPLES

[0108] Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the description, figures and tables set out herein. Such examples of the methods, uses and other aspects of the present invention are representative only, and should not be taken to limit the scope of the present invention to only such representative examples.

The Examples Show

Example 1: TnpA Prefers Target Sites with a C in Position+1

[0109] To determine whether the cleavage activity of TnpA is affected by the sequence surrounding the target cleavage site (TTAC, CT) and in particular by the identity of the nucleotide in position+1 downstream of the cleavage site, the inventors performed in vitro target cleavage assays with target oligonucleotides containing variable sequences at both sides of the TTAC sequence. FIG. 1(A) shows a scheme of the IS6o8 left end (LE) and target oligos (Ti) used to monitor TnpA mediated cleavage with variable sequences upstream and downstream of the core TTAC target sequence (CT). Arrow indicates the position of target cleavage.

[0110] In FIG. 1(B), cleavage assays monitoring covalent TnpA-DNA complex formation on SDS-PAGE gels are shown. For this, TnpA/LE complexes were incubated with different targets, and the cleavage activity was monitored by comparing the ratio of free TnpA and TnpA covalently bound to the 3′ flank of cleaved substrates in SDS-gels. Upon Ti cleavage, TnpA becomes covalently attached to the variable 16 nt sequence downstream of the cleavage position and can be resolved from unmodified TnpA. Based on the levels of covalent complexes formed, targets were classified as: SET-1, with good cleavage activity; and SET-2, with poor activity, as shown below the gel. Cleavage reactions are shown for representative SET-1 and SET-2 targets (lanes 2-4). The negative control (lane 1) does not contain target DNA. Cleavage reactions for derivatives of target 2.2, with the sequence upstream (u), downstream (d) of TTAC or both (ud) replaced by the corresponding sequence from target 1.1 (see sequences below SET-2) are shown in lanes 5-7. Remarkably, SET-1 contained only targets with a C in position+1, whereas SET-2 included other nucleotides. The inventors then replaced the sequence upstream and/or downstream of CT in a SET-2 representative oligo (2.2) with the corresponding sequence from an efficient SET-1 target (1.1). This showed that the upstream sequence had little effect on cleavage activity, whereas replacement of the sequence downstream of CT greatly increased cleavage, indicating its role in determining cleavage efficiency.

[0111] In FIG. 1(C), covalent complex formation is monitored on SDS-PAGE and target sequences are shown. To directly test the specific impact of C+1 on cleavage activity in particular, the inventors performed gain and loss-of-activity experiments by changing only the nucleotide in this position in target oligos from SET-1 (1.8) and SET-2 (2.1 and 2.6) (FIG. 1C). The results revealed that replacing C+1 with other nucleotides in a SET-1 target reduced TnpA cleavage activity, whereas introducing a Cin position+1 in a SET-2 target rescued cleavage, clearly showing that substrates with C in this position are better targets for TnpA.

Example 2: IS6o8 Target Specificity can be Increased by Rational Design of Extended Base Pairing

[0112] One remarkable feature of the TnpA/LE29/T6′ structure is that the 5′-end of T6′ is located near the 3′ base of the IPL stem loop in LE29. FIG. 2(A) shows a close-up of the TnpA/LE29/T6′ structure, highlighting the proximity between the 3′ end of IPL and the 5′ end of the target oligonucleotide. The distance between the 05′ oxygen atom of A-5 in T6′ and the phosphorous atom (P) of A+44 in LE29 is 10.5° A (dashed line). This suggested that introducing additional base pairing interactions at this transposon/target interface might provide a strategy for increasing target site specificity. Therefore, the inventors designed transposon sequences including specific 8 nt long sequences at positions+44 to +51 in LE and corresponding target substrates with a complementary 8 nt sequence upstream of CT. FIG. 2(B) shows a schematic design of the IS6o8 transposon junction (Ji, where ‘i’ is a variable indicating a specific variant number) and complementary target substrates (Tic, with ‘i’ marking a specific variant as above) used for retargeting. Each set of Ji/Tic oligos was designed to include an 8 bp complementary region between the 3′ extension of the IPL and the sequence upstream of the native TTAC target site (light blue shade). The 8 bp complementary sequence displayed here corresponds to the Ji/Tic pair. 32P radioisotope labeling is indicated by an asterisk. Upon target cleavage and integration (at the arrow), the radiolabeled 5′ segment of the junction upstream of the cleavage site (5o nt) is attached to the 3′ segment of the target (38 nt). The region of extended complementarity in the target was placed 3 nt apart from CT to provide flexibility for optimal interaction. The 3 nt linker size was chosen as it best supported TnpA cleavage in the initial tests of the inventors. Moreover, the triplet-forming A+42 base at the 3′ end of LE was mutated to T, to minimize steric constrains while maintaining the triplet interaction. The inventors then assayed TnpA-mediated cleavage and strand exchange activities of these engineered transposon sequences in vitro as previously described, which showed that these modified elements were as competent as the wild type element in performing all transposition steps in vitro, including LE and RE cleavage, generation of a RE-LE transposon junction and insertion of this junction into a target substrate.

[0113] To investigate target site specificity, the inventors analyzed the integration activities of engineered transposon junctions (Ji, with ‘i’ indicating a specific variant number) into complementary targets (Tic) in vitro on sequencing PAGE. 14 nM of 5′-labeled oligonucleotide (either IS6o8 LE, RE, RE-LE junction or target, as indicated) was incubated with 10 μM TnpA for 1 h at 37° C., in buffer containing 20 mMHEPES [pH 7.5], 160 mM NaCl, 5 mM MgCl.sub.2, 10 mMDTT, 20 μg/ml BSA, 0.5 μg of poly-dIdC and 20% glycerol. For strand transfer reactions, additional unlabeled oligonucleotide substrates were added at 1 μM final concentration. Reactions were terminated by addition of 0.1% SDS and incubation for 15 min at 37° C. Products were heat-denatured, separated on a 10% sequencing TBE-Urea PAGE gel and analyzed by phosphorimaging on a Typhoon™ FLA 9500 (GE Healthcare Life Sciences). A 20/100 Oligo Length Standard (IDT) was radioactively labeled (5′-32P) as described above and loaded in every gel.

[0114] Several sequence pairs were tested and two representative examples, Ji/Tic and J2/T2c, are shown in FIG. 2C. In FIG. 2(C), sequencing DNA PAGE gel monitoring J1 cleavage and integration into its T1c complementary target is shown. A random target substrate containing a TTAC site but no additional complementarity to the junction (marked as Tr) was used in a competition reaction with T1c (in 1:1 molar ratio) to monitor integration specificity (lane 5). Tr contains a shorter (30 nt) 3′ segment following the cleavage site than Tic, so that the integration products can be clearly distinguished. Schematics for the labeled junction substrate (a), the cleavage product (d) and integration products with T1c (b) or Tr (c) are shown on the right. The modified transposon junctions integrated efficiently into their complementary target, as shown by the specific formation of strand transfer products between J1 and T1c in all cases (lane 3 in both FIG. 2C). Integration reactions including equimolar concentrations of the complementary target and a random target with no extra complementarity to the junction substrate beyond the canonical TTAC (CT), showed an explicit preference for integration into the complementary target (lane 5 in FIG. 2C). The preferential selection of targets with the extra complementarity region was also clearly observed in the presence of two different pools of random targets containing scrambled sequences in the 8 nt variable region (TsI and TsII; see FIG. 4B) at various Tic:Ts concentration ratios (FIG. 2D, lanes 6-15). FIG. 2(D) shows that J1 integrates predominantly into its complementary target (Tic), even in the presence of 20-fold molar excess of random target substrates. Competition assays with 2 different scrambled target pools (TsI and TsII), containing a conserved TTAC site and different sets of scrambled sequences in the 8 nt variable region, are shown. The molar ratio of T1c:TsI or T1c:TsII is indicated above the gel. Positions of the J1 substrate (a), cleavage (d) and strand transfer products with T1c (b) or TsI/TsII (c) in the sequencing gel are indicated by arrows.

Example 3: Extended LE/Target Recognition can be Combined with Targeting of Altered CT Sequences

[0115] It was previously demonstrated that IS6o8 insertion can be redirected to alternative tetranucleotide target sequences by mutating the transposon guide sequence. Although engineered transposons were less efficient, they were very specific for integration into the intended sites. To further explore the scope of the targeting strategy of this invention, the inventors tested the ability of IS608 to select even more specific targets by further increasing the region of base complementarity. FIG. 3(A) shows representative data for a junction/target pair with a 13 bp complementary region in addition to the GL/CT interaction (see light blue shade in the scheme; J3/T3c 1). Integration of J3 to T3c 1 (lane 5) was compared with a target containing only 5 nt complementarity in the variable region (light blue; T3c 2) or a random target (Tr, which contains only GL/CT complementarity, lane 3) maintaining only the GL/CT interaction and to a target containing 5 complementary bases in addition to the CT site (T3c 2, lane 4). Target substrates contain various 3′ segments following the cleavage site to distinguish integration products. In competition reactions (lanes 6, 7), targets were combined in 1:1 molar ratio. Bands corresponding to the substrates and products are indicated on the right. Remarkably, while the 5 bp long complementarity did not enable efficient selection of T3c 2 over Tr (lane 6), integration was exclusively directed to T3c 1 in the presence of an equimolar amount of T3c 2 (lane 7). These results provide proof of concept for specific targeting of engineered IS6o8 transposons to selected 12-17 nt long sequences, with 4 nt defined by the native GL/CT interaction and extra 8-13 nt defined by engineered extended complementarity.

[0116] The inventors analyzed the potential of combining the previous CT resetting strategy with this new extended target recognition method for two different junction/target complementary pairs with mutations in GL and CT, J4/T4c and J5/T5c. FIG. 3(B) shows IS6o8 targeting to integration sites with alternative CT sequences. Light-blue shade highlights the complementary regions and arrow marks the cleavage positions. The engineered substrates contain the same 8 bp extended complementary region as Ji/Tic, but with one or two GL-CT base pairs also modified (FIG. 3B). The inventors assayed TnpA mediated cleavage and integration activity with these substrates on a sequencing gel, including competition reactions with random targets T4r and T5r as control (containing the same CT as in T4c and T5c, respectively, but without extended complementarity to LE, i.e. a random sequence in the 8 nt variable region). Integration products with J4/T4r and J5/T5r substrate pairs were not detected, even with 10-fold excess of the random target (FIG. 3B, lanes 4-6 and 11-13), in agreement with the previously observed decrease in activity with redirected GL/CT sites. T4r and T5r contain a shorter (30 nt) 3′ segment following the cleavage site. Interestingly, integration activity was greatly enhanced by introduction of the extra 8 bp complementary sequence in the engineered J4/T4c and J5/T5c pairs (lanes 3 and 10), indicating that extended base pairing with the target can rescue transposon integration. The extended complementary target sites were also preferentially chosen in competition experiments, compared with the random targets (FIG. 3B, lanes 7 and 14). Substrates and products are shown schematically on the right of FIG. 3B.