TREATMENT AND/OR PREVENTION OF A DISEASE OR A SYNDROME RELATED TO A VIRUS INFECTION

Abstract

The present invention provides compositions and methods for the treatment and/or prevention of disease or syndrome related to a virus infection. The invention further relates to methods for determining the susceptibility of a subject for such a treatment as well as a method for determining the amount of the composition required for an effective treatment.

Claims

1. A method for treating and/or preventing a disease or syndrome related to a virus infection in a subject in need thereof, comprising administering a therapeutically effective amount of an alpha1-antitrypsin (AAT) protein, a variant, an isoform and/or a fragment thereof.

2. The method according to claim 1, wherein the subject in need thereof has at least one selected from the group consisting of: 1. a lower level of endogenous alpha-antitrypsin (AAT) prior to a virus infection or during a virus infection compared to at least one subject during a virus infection, which is asymptomatic or has mild symptoms, 2. a higher level of at least one spike protein priming protease prior to a virus infection or during a virus infection compared to at least one subject during a virus infection, which is asymptomatic or has mild symptoms, 3. a higher level of angiotensin converting enzyme 2 (ACE2 receptor) in a subject prior to a virus infection or during a virus infection compared to at least one subject during a virus infection, which is asymptomatic or has mild symptoms, and 4. a higher level of interferon-gamma (IFN-γ) in a subject prior to a virus infection or during a virus infection compared to at least one subject during a virus infection, which is asymptomatic or has mild symptoms.

3. The method according to claim 2, wherein the lower level of endogenous AAT prior to a virus infection or during a virus infection is caused by AAT-deficiency.

4. The method according to claim 2 wherein the spike protein priming protease is at least one selected from the group consisting of transmembrane protease serine subtype 2 (TMPRSS2), transmembrane protease subtype 6 (TMPRSS6), cathepsin L, cathepsin B, proprotein convertase 1 (PC1), trypsin, elastase, neutrophil elastase, matriptase and furin, preferably cathepsin L and furin.

5. The method according to claim 2 wherein the higher level of at least one spike protein priming protease is caused by age and/or a genetic predisposition.

6. The method according to claim 2 wherein the higher level of ACE2 receptor is caused by at least one selected from the group of an infection, inflammation, age and a genetic predisposition.

7. The method according to claim 2 wherein the higher level of IFN-γ is caused by at least one selected from the group of an infection, inflammation, age and a genetic predisposition.

8. The method according to claim 2 wherein the subject in need thereof has: i) a lower level of endogenous AAT, and a higher level of at least one spike protein priming protease; ii) a lower level of endogenous AAT and a higher level of ACE2 receptor; and/or iii) a lower level of endogenous AAT and a higher level of IFN-γ.

9-10. (canceled)

11. The method according to claim 8, wherein the higher level of IFN-γ is caused by at least one disease or condition selected from the group consisting of AAT-deficiency, a liver disease such as a non-alcoholic fatty liver disease, diabetes, obesity and a cardiovascular condition.

12. The method according to claim 2, wherein the subject in need thereof has i) a lower level of endogenous AAT, ii) a higher level of at least one spike protein priming protease, and iii) a higher level of ACE2 receptor and/or iv) a higher level of IFN-γ.

13. The method according to claim 2 wherein the alpha1-antitrypsin (AAT) protein, a variant, an isoform and/or a fragment thereof is: (a) human plasma-extracted; or (b) a recombinant alpha1-antitrypsin (rhAAT), a variant, an isoform and/or a fragment thereof.

14. (canceled)

15. The method according to claim 13, wherein the alpha1-antitrypsin protein is: (a) as set forth in SEQ ID NO: 1; or (b) a C-terminal sequence fragment, or any combination thereof.

16. (canceled)

17. The method according to claim 13, wherein the alpha1-antitrypsin variant is selected from the group comprising short cyclic peptides derived from the C-terminal sequence as set forth in SEQ ID NO: 2.

18. The method according to claim 17, wherein the short cyclic peptides derived from the C-terminal sequence of Alpha1-Antitrypsin is selected from the group comprising Cyclo-(CPFVFLM)-SH, Cyclo-(CPFVFLE)-SH, Cyclo-(CPFVFLR)-SH, and Cyclo-(CPEVFLM)-SH, or any combination thereof.

19. The method according to claim 1, wherein the alpha1-antitrypsin (AAT) protein, a variant, an isoform and/or a fragment thereof is administered as a composition comprising a pharmaceutically acceptable excipient or carrier.

20. The method according to claim 1 wherein the composition further comprises a nucleoside analog, a protease inhibitor, an immune-suppressor (e.g. sarilumab or tocilizumab), an antibiotic, an antibody directed against structural components of the virus, or fragment thereof (e.g. passive immunotherapy), interferon beta (e.g. interferon beta-1a), and/or a vaccine.

21. The method according to claim 1, wherein said composition is administered by intravenous injection, intravenous infusion, infusion with a dosator pump, inhalation nasal-spray, eye-drops, skin-patches, slow release formulations, ex vivo gene therapy or ex vivo cell-therapy, preferably by intravenous injection.

22. A method for determining the susceptibility of a subject of interest for treatment and/or prevention of a disease or syndrome related to a virus infection using a composition comprising a therapeutically effective amount of an alpha1-antitrypsin (AAT) protein, a variant, an isoform and/or a fragment thereof comprising the steps of: a) determining the level of at least one of the group comprising endogenous alpha1-antitrypsin, at least one spike protein priming protease, ACE2 receptor and interferon-gamma in the subject of interest prior to a virus infection or during a virus infection, b) determining the level of at least one of the group comprising endogenous alpha1-antitrypsin, at least one spike protein priming protease, ACE2 receptor and interferon-gamma in at least one reference subject during a virus infection, wherein the reference subject is asymptomatic or has mild symptoms, c) comparing the level of interest determined in step a) to the reference level determined in step b), wherein the subject of interest is more susceptible for treatment and/or prevention of a disease or syndrome related to a virus infection if the subject of interest has at least one selected from the group consisting of: 1. a lower level of interest of endogenous alpha-antitrypsin (AAT) compared to the reference level of endogenous AAT, 2. a higher level of interest of at least one spike protein priming protease compared to the reference level of at least one spike protein priming protease, 3. a higher level of interest of angiotensin converting enzyme 2 (ACE2 receptor) compared to the reference level of the ACE2 receptor and 4. a higher level of interest of interferon-gamma (IFN-γ) compared to the reference level of IFN-γ.

23. A method for determining the therapeutically effective amount of alpha1-antitrypsin (AAT) for an effective treatment and/or prevention of a disease or syndrome related to a virus infection using a composition comprising a therapeutically effective amount of an alpha1-antitrypsin (AAT) protein, a variant, an isoform and/or a fragment thereof comprising the steps of: a) determining the level of endogenous alpha1-antitrypsin in a subject of interest prior to a virus infection or during a virus infection, b) determining the amount of AAT in the composition, which is required to achieve a level of AAT in the subject of at least 10 .Math.M, preferably at least 20 .Math.M, more preferably at least 50 .Math.M, even more preferably at least 100 .Math.M, and most preferably at least 200 .Math.M.

24. The composition for use method according to any one of the claims 1 to 21, or the method according to claim 22 and 23 claim 1, wherein the virus is a coronavirus.

25. The composition for use method according to claim 24, of the method according to claim 24, wherein the virus is a SARS-CoV-2.

26. The method according to claim 1, wherein the disease or syndrome is a: (a) respiratory syndrome or a severe acute respiratory syndrome; or (b) an inflammatory disease or syndrome of the nervous system selected from the group of multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer’s disease, Parkinson’s disease and Huntington’s disease.

27-28. (canceled)

Description

FIGURE LEGENDS

[0296] FIG. 1: Schematic illustration of the SARS-CoV-2 infection cycle and AAT’s role in blocking viral-entry into the host’s cell.

[0297] FIG. 2(a): Endogenous mRNA levels of Cathepsin L, Furin, ACE2 and TMPRSS2 in A549 and HeLa cells, show that neither HeLa cells, nor A549 cells express relevant amounts of ACE2 mRNA nor TMPRSS2. Both cell lines express Furin and Cathepsin L (a priming protease of spike protein from SARS-CoV-1 and SARS-CoV-2).

[0298] FIG. 2(b): SARS-CoV-2 Spike D614G pseudoviral variant shows increased infectivity. Lentiviruses expressing Luciferase and pseudotyped with SARS-CoV-2- Spike wild type (D614) or D614G mutant (G614) were used to transduce HeLa cells overexpressing or not either ACE2 and/or TMPRSS2. Results show no inhibitory effect by plasma derived AAT at 10 micromolar (10 .Math.M) concentrations on the SARS-CoV-2 pseudoviral cell-entry in HeLa cells overexpressing TMPRSS2 and up to 25% in HeLa cells expressing ACE2 only.

[0299] FIG. 3: a) ACE2 gene expression in different cell lines. b) TMPRSS2 gene expression in different cell lines (tissues).

[0300] FIG. 4: ACE2 expression in A549 in response to treatment with IFN-γ.

[0301] FIG. 5: ACE2 expression in HeLa in response to treatment with IFN-γ.

[0302] FIG. 6: SARS-CoV-2 pseudoviral entry assay. a) to b) A549 cells - WT pseudovirus. a) A549-ACE2 cells with WT D614 pseudovirus. b) A549 – ACE2 – TMPRSS2 cells with WT D614 pseudovirus. c to d) A549 cells – spike G416 mutated pseudovirus. c) A549 ACE2 cells with mutant G416 pseudovirus. d) A549 – ACE2 – TMPRSS2 cells with mutant G614 pseudovirus.

[0303] Respikam = Glassia, FDA approved plasma derived AAT (clinical grade), Sigma = plasma derived AAT bought from Sigma (non-GMP grade).

[0304] FIG. 7: SARS-CoV-2 pseudoviral entry is blocked by 50-75% in ACE2 enhanced A549 cells at both 100 and 200 micromolar concentrations of AAT. (Respikam 100 uM in PBS 5x, Sigma 100 uM in PBS 5x, Sigma 200 uM in PBS 2.5x, Portland 100 uM in PBS 5x, Genfaxon in PBS 5x, Camostat 10 uM and 100 uM in DMSO 0.2%, Bromhexine 10 uM and 100 uM in DMSO 0.2%, Benzenesulfonyl 10 uM and 100 uM in DMSO 0.2%).

[0305] FIG. 8: SARS-CoV-2 pseudoviral entry is blocked by up to 45% in ACE2+TMPRSS2 enhanced A549 cells at both 100 and 200 micromolar concentrations of AAT. (Respikam 100 uM in PBS 5x, Sigma 100 uM in PBS 5x, Sigma 200 uM in PBS 2.5x, Portland 100 uM in PBS 5x, Genfaxon in PBS 5x, Camostat 10 uM and 100 uM in DMSO 0.2%, Bromhexine 10 uM and 100 uM in DMSO 0.2%, Benzenesulfonyl 10 uM and 100 uM in DMSO 0.2%).

[0306] FIG. 9 ACE-2 is the host cell receptor responsible for mediating infection by SARS-CoV-2, the novel coronavirus responsible for coronavirus disease 2019 (COVID-19). Treatment with a drug compound (AAT) disrupts the interaction between virus and receptor. (Adapted from https://www.rndsystems.com/resources/articles/ace-2-sars-receptor-identified).

[0307] FIG. 10: SARS-CoV-2 pseudoviral entry assay protocol.

[0308] FIG. 11 a) b) Effect of plasma derived and recombinant AAT on SARS-CoV-2 pseudovirus entry in ACE2 overexpressing A549 human lung alveolar basal epithelium cells. Most pronounced inhibitory effect (93.4%) is observed at 200 uM for Recombinant AAT 1 produced in CHO cells using vector pXC17.4 (Lonza Biologics Plc) c) Effect of other serine protease inhibitors on SARS-CoV-2 pseudovirus entry in ACE2 overexpressing A549 human lung alveolar basal epithelium cells d) IFN-beta-1a at 10 ng/mL in combination with 25 uM plasma-derived AAT and recombinant AAT produced in CHO cells (Recombinant AAT 1, Recombinant AAT 2) show an additive inhibitory effect in a SARS-CoV-2 pseudoviral entry assay.

[0309] FIG. 12 a) b) Effect of plasma derived and recombinant AAT on SARS-CoV-2 pseudovirus entry in ACE2 overexpressing HeLa human cervical cancer cells c) Effect of other serine protease inhibitors on SARS-CoV-2 pseudovirus entry in ACE2 overexpressing HeLa human cervical cancer cells.

[0310] FIG. 13 Schematic illustration of the SARS-CoV-2 spike fusion assay.

[0311] FIG. 14 SARS-CoV-2 spike fusion assay in HeLa human cervical cancer cells overexpressing either ACE2 and small bit luciferase or SARS-CoV-2 spike and large bit luciferase. Recombinant AAT (rhAAT) produced in CHO cells (Recombinant AAT 1 and Recombinant AAT 2) shows a better inhibitory effect on SARS-CoV-2 spike mediated cell fusion compared to plasma derived AAT.

[0312] FIG. 15 a) qPCR analysis of spike protein priming protease gene expression in human lung cell line b) qPCR analysis of ACE2 gene expression in human lung cell line (Calu 3 and A549), shows no endogenous expression of ACE2 in the A549 cell line c) qPCR analysis of TMPRSS2 gene expression in human lung cell line (A549) versus a coloreactal cell line (Caco2), shows no endogenous expression of TMPRSS2 in the A549 cell line d) e) Relative quantative qPCR analysis of spike protein priming protease gene expression in various human cell lines (tissues). Evidently, cells originating from the lungs display the highest copy number for Trypsin and Cathepsin B, in Calu3 and A549 cells, respectively. Notably, cells derived from neural tissue (SH-SY5Y) also display a realtively high copy number for both Trypsin and Cathepsin B.

[0313] FIG. 16 a) AAT and rhAAT inhibits cathepsin B protease activity b) AAT and rhAAT inhibits cathepsin L protease activity, with the most pronounced inhibitory effect observed for recombinant AAT produced in HEK293 cells with vector pcDNA3.1(+) (Recombinant AAT 4) c) AAT and rhAAT inhibits trypsin protease activity, with the most pronounced inhibitory effect observed for recombinant AAT produced in HEK293 cells with vector pcDNA3.1(+) (Recombinant AAT 4) d) AAT and rhAAT inhibits furin protease activity, with the most pronounced inhibitory effect observed for recombinant AAT produced in HEK293 cells with vector pcDNA3.1(+) (Recombinant AAT 4) e) AAT and rhAAT inhibits PC1 protease activity f) AAT and rhAAT inhibits matriptase protease activity g) AAT and rhAAT inhibits TMPRSS2 protease activity h) AAT and rhAAT inhibits elastase protease activity, with the most pronounced inhibitory effect observed for recombinant AAT produced in CHO cells with vector pXC17.4 (Recombinant AAT 1) i) AAT and rhAAT inhibits neutrophil elastase protease activity, with the most pronounced inhibitory effect observed for recombinant AAT produced in HEK293 cells with vector pcDNA3.1(+) (Recombinant AAT 4).

[0314] FIG. 17 Standard curve for binding of a) plasma derived AAT and b) recombinant AAT measured using Octet method. Different binding affinity is observed between the plasma derived AAT and the recombinant AAT produced in CHO cells with vectors PL136 and 137.

[0315] FIG. 18 a) Schematic illustration of the experimental timeline b) IFNy-mediated microglial activation (inflammation).

[0316] FIG. 19 a) Schematic illustration of the experimental timeline b) AAT decreases IFNy-mediated microglial activation (inflammation). Effect is observed for plasma derived AAT, recombinant AAT (rhAA) and for cells transduced with a gene expressing AAT (gene therapy). FIG. 20 a) Schematic illustration of the experimental timeline b) IFNβ improves the anti-inflammatory effect obtained with AAT.

[0317] FIG. 21 a) b) Effect of plasma derived and recombinant AAT on MERS-CoV pseudovirus entry in Caco2 human colorectal adenocarcinoma cells c) Effect of other serine protease inhibitors on MERS-CoV pseudovirus entry in Caco2 human colorectal adenocarcinoma cells.

[0318] FIG. 22 a) b) Effect of plasma derived and recombinant AAT on SARS-CoV pseudovirus entry in ACE2 overexpressing A549 human lung alveolar basal epithelium cells c) Effect of other protease inhibitors on SARS-CoV pseudovirus entry in ACE2 overexpressing A549 human lung alveolar basal epithelium cells.

[0319] FIG. 23 a) impact of AAT on ADAM17 activation and protein shedding b) impact of AAT on activation of monocyte/macrophages by spike protein/IgG immune complexes.

[0320] FIG. 24 Differences in molecular weight of AAT from different sources.

[0321] FIG. 25 a) Vector map for pXC-17.4 (Lonza Biologics) b) Vector map for pJ201_AAT_native_SP (Merck) c) Vector map for pJ201_AAT_SP5 (Merck) d) Vector map for PL136 (Merck) e) Vector map for PL137 (Merck) f) Vector map for empty pCGS3 vector g) Vector map for pcDNA3.1(+) (GenScript).

[0322] FIG. 26 Octet method developed for the detection of AAT affinity.

[0323] All Figures: “Respikam” refers to Plasma derived AAT (clinical-grade); “Sigma” refers to Plasma derived AAT; “Recombinant AAT 1” refers to AAT produced in CHO by pXC-17.4 (GS System, Lonza), “Recombinant AAT 2” refers to AAT produced in CHO by PL136/PL137 (Merck), “Recombinant AAT 3” refers to AAT produced in HEK293T; “Recombinant AAT 4” refers to AAT produced in HEK293 by pcDNA3.1(+) (GenScript).

EXAMPLES

Materials & Methods

Treatment of SARS-CoV-2 Infection by Alpha1-Antitrypsin (AAT)

[0324] The impact of AAT on SARS-CoV-2 infection is shown on two levels: [0325] 1. First, the protease-dependent entry of SARS-CoV-2 into cells [0326] 2. Second the overshooting inflammation in severe SARS-CoV-2 disease

[0327] Importantly, this represents three stages of the COVID-19 (i.e. the disease caused by SARS-CoV-2):

[0328] 1. First stage COVID-19 (disease caused by SARS-CoV-2, flue-like symptoms, usually disappearing within one week) does not require treatment.

[0329] 2. Second stage disease, typically characterized by viral pneumonia, requires hospital and an antiviral treatment (i.e. inhibition of SARS-CoV-2 entry into cells) is of major interest at this stage to prevent further progression.

[0330] 3. Third stage COVID disease is characterized by acute respiratory distress syndrome (ARDS) and severe systemic inflammation; this stage requires an anti-inflammatory and antiviral treatment.

[0331] According to our analysis, AAT is useful for the treatment of stage II and stage III COVID-19 whereas prophylactic administration of AAT is envisaged in order to prevent the development of stage I into stage II and III.

Example 1 - Entry of SARS-CoV-2 Into Cells

[0332] The entry of SARS-CoV-2 is mediated by the binding of the viral spike protein with the host cell Angiotensin converting enzyme 2 (ACE2) receptor. To recapitulate in-vitro this biological event, lentivectors coding for a reporter (GFP or luciferase) and expressing the spike protein on its surface are generated. The cellular entry of the lentivector is mediated by the SARS-CoV-2 mechanism, the efficiency of which is measured by the expression of the reporter (GFP or luciferase) in the target cells (Ou, X., Liu, Y., Lei, X. et al. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620, 2020). AAT is added to quantify inhibition on viral entry by reading out the GFP and/or luciferase signals.

[0333] The transmembrane Serine Protease TMPRSS2 is crucial for SARS-CoV-2 infection (Toshio Hirano, Masaaki Murakami COVID-19: A New Virus, but a Familiar Receptor and Cytokine Release Syndrome Immunity, 22 April 2020) and for Hepatitis C infection (Esumi M, Ishibashi M, Yamaguchi H, Nakajima S, Tai Y, Kikuta S, Sugitani M, Takayama T, Tahara M, Takeda M, WakitaT- Trans-membrane serine protease TMPRSS2 activates hepatitis C virus infection. Hepatology. 2015 Feb; 61 (2):437-46). The hepatitis C infection can be blocked by AAT (presumably through TMPRSS2 inhibition - Esumi et al., 2020), SARS-CoV-2 (as well as some highly pathogenic forms of influenza virus) has a sequence that allows cleavage by the protease furin. This cleavage site is not present in the SARS and the MERS coronaviruses, suggesting that it is important for pathogenicity of SARS-CoV-2 (B. Coutard, C. Valle, X. de Lamballerie, B. Canard, N.G. Seidah, E. Decroly, The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade, Antiviral Research, Volume 176, 2020). Alpha1-antitrypsin Portland has a strong and selective activity on furin (Jean F, Stella K, Thomas L, et al. alpha1-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent. Proc Natl Acad Sci USA. 1998;95(13):7293-7298. doi:10.1073/pnas.95.13.7293). It is, therefore, envisaged that wild type AAT (plasma derived) as well as recombinant (produced in mammalian cells, e.g. CHO and/or HEK cells) would display furin activity.

Experiments

1.1. Impact of AAT on Cellular Cleavage of Recombinant Spike Protein

[0334] Recombinant spike protein is added to relevant cell types (any ACE2 expressing cells and known in the art) and proteolytic cleavage is assessed by Western blotting. Any ACE2 expressing cell-lines can be used. Multiple target cell lines express various amount of the ACE2 receptor, include but are not limited to; Calu-3, SH-SY5Y, HEK, HT1080, A549, MRC 5, Huh7, Vero81, VeroE6, Hela, RS and LLCMK2.

1.2. Impact of AAT on Entry of Pseudoviruses

[0335] Pseudoviruses (i.e. pseudotyped viral vectors) that use the SARS-CoV-2 spike protein as viral attachment/fusion protein correctly depict the mechanisms of SARS-CoV-2 into cells. This entry is dependent on two proteolytic steps which are inhibited by the protease inhibitor AAT. Therefore, the entry of pseudo-viruses in a variety of different cell lines, preferably ACE2 expressing cell-lines are investigated.

1.3. Impact of AAT on Cellular Infection by Active SARS-CoV-2 (Live Virus Tests):

[0336] AAT is tested on live SARS-CoV-2 virus manipulated under biosecurity level 3 in accordance with OFSP recommendations. The virus is inoculated in-vitro on cells treated with AAT, or any fragment, variant and isoform thereof as multiple parameters are measured to assess efficiency including reduced cytotoxicity and viral titer. More specifically, cellular infection with SARS-CoV-2 is assessed by immunofluorescence with viral proteins as well as quantification of cell death. Since SARS-CoV-2 infect neural tissue (Helms J, Kremer S, Merdji H, et al. Neurologic Features in Severe SARS-CoV-2 Infection [published online ahead of print, 2020 Apr 15]. N Engl J Med. 2020; Pleasure SJ, Green AJ, Josephson SA. The Spectrum of Neurologic Disease in the Severe Acute Respiratory Syndrome Coronavirus 2 Pandemic Infection: Neurologists Move to the Frontlines. JAMA Neurol. Published online April 10, 2020), infection of neural tissue (e.g. Minibrain™) as well as neuroblastoma cells (SH-SY5Y) will be performed as co-treatment with AAT and is expected to modify viral cytotoxicity or tropism.

Example 2 - Overshooting Inflammation in Severe SARS-CoV-2 Disease Also Known As “Cytokine Storm”, Fu Y, Cheng Y, Wu Y. Understanding SARS-CoV-2-Mediated Inflammatory Responses: From Mechanisms to Potential Therapeutic Tools [Published Online Ahead of Print, 2020 Mar 3]. Virol Sin. 2020;1-6. Doi:10.1007/s12250-020-00207-4):

[0337] TABLE-US-00004 Mechanism of SARS-CoV-2 induced inflammation.sup.9 Activity of AAT Inflammation Caused by Rapid Viral Replication and Cellular Damage inhibition of viral entry Inflammation Caused by Virus-Induced ACE2 Downregulation and Shedding inhibition of ADAM 17 Inflammatory Responses Induced by Anti-Spike IgG (Anti-S-IgG) Proteolysis was shown to enhance also monocyte FcyRJI-mediated functions, such as antibody-dependent cellular cytotoxicity and induction of TNF-cu release.

Experiments

[0338] 2.1. SARS-CoV-2 activation of ADAM17 (TACE): ADAM17 activation part of SARS-CoV-2 pathology (see, e.g. Vanesa Palau, Marta Riera, María José Soler, ADAM17 inhibition may exert a protective effect on COVID-19, Nephrology Dialysis Transplantation,, gfaa093, https://doi.org/10.1093/ndt/gfaa093; https://clinicalaffairs.umn.edu/umn-research/regulation-sars-cov-2-receptor-ace2-adam17; Haga S, Yamamoto N, Nakai-Murakami C, et al. Modulation of TNF-alpha-converting enzyme by the spike protein of SARS-CoV and ACE2 induces TNF-alpha production and facilitates viral entry. Proc Natl Acad Sci USA. 2008;105(22):7809-7814. doi:10.1073/pnas.0711241105). AAT inhibits ADAM17 (see, e.g. Bergin DA, Reeves EP, Meleady P, et al. α-1 Antitrypsin regulates human neutrophil chemotaxis induced by soluble immune complexes and IL-8. J Clin Invest. 2010;120(12):4236-4250. doi:10.1172/JCI41196; Serban KA, Petrusca DN, Mikosz A, et al. Alpha-1 antitrypsin supplementation improves alveolar macrophages efferocytosis and phagocytosis following cigarette smoke exposure. PLoS One. 2017;12(4):e0176073. Published 2017 Apr 27. doi:10.1371/journal.pone.0176073).

[0339] Investigate the impact of AAT on ADAM17 activation and protein shedding (in particular ACE2) after exposure of cells to (FIG. 23a): [0340] i) spike protein [0341] ii) pseudovirus [0342] iii) SARS-CoV-2 (live virus).Most relevant cells to be used are any ACE2 expressing cells (as listed above).

[0343] 2.2. Activation of Fc receptors by SARS-CoV-2/IgG immune complexes (antibody-dependent enhancement see e.g. F. Negro, Swiss Med Wkly. 2020;150:w20249 “Is antibody-dependent enhancement playing a role in COVID-19 pathogenesis?”). Proteolysis through trypsin-like proteases enhances monocyte FcyRJI-mediated functions, such induction of TNF release (J M Debets, J G Van de Winkel, J L Ceuppens, I E Dieteren, W A Buurman in The Journal of Immunology Feb. 15, 1990, 144 (4) 1304-1310).

[0344] Investigate impact of AAT on activation of monocyte/macrophages by spike protein/IgG immune complexes (FIG. 23b).

Example 3 - Additional Experiments in Support of AAT Efficacy in Decreasing Viral Proliferation

3. Viral Polymerase Assay

[0345] The SARS-CoV-2 viral polymerase is a key element in the replication of the viral genetic material. A cell-line cell line expressing the multi-subunit viral polymerase (constituted of at least the 3 core subunits NSP7, NSP8 and NSP12) is transfected to also overexpress a luciferase reporter which can only be activated by the viral polymerase activity.

[0346] The luciferase reporter signal is proportional to the viral polymerase activity. AAT is tested to assess viral polymerase inhibition activity.

[0347] Upon entry in the host cell, SARS-CoV-2 will use the host cell machinery to enhance its own replication. This will induce a toxic response on the host cell, essentially mediated by the NSP1 viral protein.

[0348] To mimic this biological event a cell-line expressing the viral NSP1 protein controlled by a tetracycline-inducible promoter is generated. Following the cells’ treatment with tetracycline the toxic NSP1 protein will be expressed. Addition of AAT is presumed to inhibit this toxic effect mediated by the viral protein.

Experiment 4

Introduction

[0349] The recent pandemic caused by the newly emerged SARS-CoV-2 Coronavirus took the world by surprise. As opposed to previous Coronavirus outbreaks such as SARS and MERS, the new virus is not characterized by a particularly high case-fatality rate, but rather by an unprecedented epidemiological success. And indeed, the virus has so far largely resisted to all attempts of eradication, despite stringent measures taken in many countries around the globe.

[0350] SARS-CoV-2 is an RNA virus, but Coronaviruses differ from other RNA viruses in several respects. They have a large genome and a sophisticated life cycle which is still poorly understood. Also, coronaviruses have a proof-reading machinery, which confers a relatively stable genome, as compared to other types of RNA viruses. And indeed, given the size of the pandemic, so far relatively few mutations leading to amino acid changes have been reported. The coronavirus S protein, also known as spike, is the dominant protein of the viral envelop. It mediates the attachment of the virus to the host cell surface receptors and subsequent fusion between the viral and host cell membranes to facilitate viral entry into the host cell. It is a trimeric class I fusion protein which exists in a metastable pre-fusion conformation divided in two main subunits, namely S1 and S2. In order to attach to the host cell surface receptors, the receptor binding domain (RBD) contained within the S1 domain undertakes a hinge-like conformational change, defining two different states [1]. This conformational change is required for proteolytic processing and/or fusion of the S2 domain with the host cell membrane. It is now thought that a variety of proteases including PC family of proteases, trypsin-like proteases, and cathepsins are able to cleave the spike protein [2].

[0351] The spike protein D614G mutation has received attention as it could potentially alter viral attachment, fusogenicity, and/or immunogenicity. The D614G mutation has been suggested to increase infectivity (ref), transmissibility [3] and/or case fatality rate [4]. More recent studies directly demonstrate that the G614 variant indeed enhances viral entry into cells [5, 6].

[0352] SARS-CoV-2 employs a multi-subunit replication/transcription machinery [7]. A set of non-structural proteins (nsp) produced as cleavage products of the ORF1a and ORFlb viral polyproteins assemble to facilitate viral replication and transcription, making this machinery a potential target for therapeutic intervention against COVID-19 viral infections [8]. RNA-dependent RNA polymerase (RdRp, also known as nsp12) is a key player in the synthesis of viral RNA. Recently resolved crystal structure of SARS-CoV-2 nsp12 in complex with its nsp7 and nsp8 co-factors underlines the central role these non-structural proteins have in the replication and transcription cycle of the COVID-19 virus [8, 9]. The P314L mutation of the RdRp has received less attention, however it has been suggested that this mutation might alter viral proof reading and thereby lead to an increased down-stream mutation rate [10].

[0353] In this study, we investigate the emergence of a SARS-CoV-2 variant with concomitant mutations in the S protein and the RdR-polymerase. Both mutations are in strategically relevant sites of the respective proteins and hence candidates to alter the biology of the virus. The G624/L323 variant, but not the individual G624 or L323 mutants, is epidemiologically highly successful and over the last months has largely replaced the original D624/P323 variant.

Methods

Cell Lines and Culture

[0354] Human cell lines used in the study were HEK 293T/17 (human kidney, ATC C#CRL-11268), A549, HeLa and HMC3-MHCII.sup.Luc cells. HMC3-MHCII.sup.Luc cell line coding for luciferase reporter under major histocompatibility complex II promoter (MHCII) has been described as a valuable tool to study human microglial activation by and was obtained from Prof. Karl-Heinz Krause at the University of Geneva. HMC3-MHCII.sup.Luc cells were transduced with a lentiviral vector to obtain an AAT-producing HMC3-MHCII.sup.Luc;Ubi.sup.AAT cell line (See Lentivirus production). Cells were maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS), 100 .Math.g/ml of penicillin and streptomycin, 2 mM 1-glutamine, 1 mM sodium pyruvate and 1% non-essential amino acids. HMC3 cell lines were not added non-essential amino acids. Cultureds were maintained at 37° C. in a 5% CO2 atmosphere.

Spike Fusion Assay

[0355] Suited concentration of treatments was pre-diluted in culture media. On the top of this mix was added the HeLa cell line stably overexpressing the human ACE2 receptor and the Smallbit split-luciferase fragment together with the HeLa cell line stably overexpressing the SARS-CoV-2 spike protein and the Largebit split-luciferase fragment, and incubated at 27° C. for 24 h. Interaction between ACE2 and SARS-CoV-2 spike mediates the fusion of both cell line, thus interactions between the largebit and smallbit split luciferase fragments which leads to a functional luciferase. Light emission was measured with the Nanoglo kit (Promega) according to manufacturer instructions.

Generation of Cell Lines Expressing ACE2 and TMPRSS2

[0356] Hela and A549 cells were plated at a density of 2E05 cells per well in a 12 well plate. The day after cells were co-transduced either with ACE2/puromycin and/or TMPRSS2/blasticidin lentiviruses. Four day after transduction, cells were selected with blasticidin amd puromycin at 5 .Math.g/ml. Cells were maintained as polyclonal population.

Plasmids

[0357] ACE2 and TMPRSS2 cDNA ORFs were purchased from GenSript and were cloned into pCDH-CMV-MCS-EF1α-Puro (SEQ ID NO: 13) and pCDH-CMV-MCS-EF1α-Blast (SEQ ID NO: 14) lentivectors respectively using standard cloning methods. pCG1_SCoV2-S plasmid (SEQ ID NO: 15) encoding SARS-CoV-2-Spike protein was provided by Prof. Dr. Stefan Pöhlmann (University Göttingen, Göttingen, Germany). G614 Spike was cloned using site-directed mutagenesis with the following primers: 5′-GCGTGAACTGTACCGAAGTG-3′ (SEQ ID NO: 16) and 5′-CCTGGTACAGCACTGCC-3′ (SEQ ID NO: 17). C-terminal 19 amino acids truncated version of the SARS-CoV-2-Spike was generated by PCR amplification using primers 5′-AGCGAATTCGGATCCGCC-3′ (SEQ ID NO: 18) and 5′-ACAGTCGACTCTAGATTAGCAGCAGCTGCCACAG-3′ (SEQ ID NO: 19) followed by cloning into pCG1 plasmid.

AAT Purification Produced in HEK293T Cells

[0358] Supernatant from HEK293T cells overexpressing human AAT-His tagged was sampled and incubated overnight at 4° C. under shaking with Ni Sepharose excel histidine-tagged protein purification resin (Cytiva). Volume ratio supernatant:resine is 200:1. Then supernatant was discarded, and beads were washed once with phosphate-buffered saline (PBS). Beads were washed once times with PBS supplemented by 10% (v/v) elution buffer (PBS supplemented with 500 mM imidazole, pH 7.5), and once with PBS supplemented with 20% elution buffer. Finally purified AAT-His-tagged was eluted in 100% elution buffer. Imidazole was removed by dialysis to obtain AAT-His in PBS buffer.

Lentivirus Production

[0359] For recombinant-lentivirus production, plasmids were transfected in HEK293T cells using the calcium phosphate method. Briefly, 4.5×10.sup.6 cells were plated in a 10-cm dish and transfected 16 h later with 15 .Math.g of either ACE2, TMPRSS2, AAT or empty-expressing lentiviral vectors, 10 .Math.g of packaging plasmid (psPAX2, gift from Didier Trono [Addgene plasmid 12260]) and 5 .Math.g of envelope (pMD2G, gift from Didier Trono [Addgene plasmid 12259]). The medium was changed 8h post-transfection. After 48 h, the viral supernatants were collected and filtered using 45 .Math.m PVDF filters and stored at -80° C.

Coronavirus Spike Pseudotyped Lentiviral Production

[0360] Spike-pseudotyped lentivirus were produced by co-transfection 293T cells with psPAX2, pCDH-CMV-Gluc-EF1α- GFP, and plasmids encoding either SARS-CoV-2 Spike D614 Full length (FL) (SEQ ID NO: 15), Spike G614 Full length (FL) (SEQ ID NO: 20), Spike D614 DeltaCter (SEQ ID NO: 21), Spike G614 DeltaCter (SEQ ID NO: 22), SARS-CoV spike (Sino Biological Europe GmbH, Catalog Number: VG40150-G-N), MERS-CoV spike (Sino Biological Europe GmbH, Catalog Number: VG40069-G-N) or empty vector (SEQ ID NO: 23) by using the calcium phosphate method as described above.

Coronavirus Spike Pseudotyped Lentiviral Infectivity Assays

[0361] HeLa stably overexpressing the human ACE2 receptor, A549 cells stably overexpressing the human ACE2 receptor or Caco2 cells were seeded into 96-well plates. 3 hours after plating, compound treatment was performed, or omitted depending on the experimental setup. 24 h later cells were transduced with coronavirus pseudovirus for 6 h. Then culture media was changed and cells were kept at 37° C. After three-day incubation, Gaussia luciferase activity was measured by the addition of 10 uL cell supernatant to 50 uL of phosphate-buffered saline [PBS] supplemented with 4 .Math.M coelenterazine and immediately measuring luminescence in a luminometer (Glomax; Promega). In parallel the cells were trypsinized and resuspended in PBS supplemented with 10% FBS and were analysed by flow cytometry using Attune NxT Flow Cytometer(thermofisher Scientific). Data was analysed using FlowJo 11 (FlowJo, LLC, Ashland, OR).

Cell Free Assay (Spike Protein Priming Protease Inhibition)

[0362] The reaction was performed in 100 ul for trypsin (Sigma-Aldrich), 75 ul for cathepsin B (R&D Systems) and 50 ul for PC1 (R&D Systems), matriptase (R&D Systems), furin (NEB), cathepsin L (R&D Systems) and TMPRSS2 (creative biomart). Buffer is composed of PBS pH 7.4 for trypsin (diluted to 6.4 nM) ; 25 mM MES, pH 5 for cathepsin B (diluted to 1.76 ng/ul) ; 25 mM MES, 5 mM CaCl2, 1% Brij-35, pH 6 for PCl (diluted to 1.76 ng/ul); 50 mM Tris, 50 mM NaCl, 0.01% Tween 20, pH 9 for matriptase (diluted to 1.76 ng/ul); 100 mM HEPES, 1 mM CaCl2, 0.5% Triton X100, 1 mM 2-Mercaptoethanol, pH 7.5 for furin ( diluted to 10U/ml) ; 0.005% Brij-35, 1 mM EDTA, 5 mM DTT, 50 mM MES, pH 6 for cathepsin L (diluted to 1.76 ng/ul); 50 mM TrisHCl, 150 mM NaCl, 0.01% tween 20, pH 8 for TMPRSS2 (diluted to 0.5uM). Unless specified all reagents were provided by Sigma Aldrich. For trypsin, cathepsin B, PC1, matriptase, furin, cathepsin L assays, SARS-CoV-2 peptide composed of the sequence TNSPRRARSVA (SEQ ID NO: 12) with modification MCA/Lys (DNP) FRET pair (Biomatik) was used. For TMPRSS2 assay, peptide composed of the sequence Boc-QAR-AMC (R&D Systems) was used. For elastase ELA1 from pig pancreas, assay kit (E-12056) was purchased from molecular probes (Sigma-Aldrich) and for neutrophil elastase ELA2, assay kit (BML-AK497) was purchased from Enzo, tests were performed according to manufacturer instructions. Fluorescence or absorbance was measured every minute for 45 minutes in plate reader. Vmax was determined for each condition as fluorescence unit per minute and enzymatic activity is expressed in percentage of untreated condition.

Gene Expression Analysis

[0363] Total RNA was isolated using RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions. 500 ng of total RNA from each sample were reverse transcripted with Primescript kit from Takara in a total volume of 10 .Math.l, at 37° C. for 15 min. The relative mRNA levels were evaluated by quantitative RT-qPCR using SYBR Green PCR kit (Applied Biosystems) by 2 delta Ct method. GAPDH was used as internal control.

Gene Copy Number Estimation

[0364] For copy number, linearization of each specific plasmid was performed using restriction enzyme digestion. The product of digestion was cleaned using PCR clean up kit (GeneJET) according to manufacturer instructions.Then optical density was measured and copy number determined. A serial dilution of ⅒ from digested plasmid was used for qPCR.

[0365] Plasmids for furin, cathepsinL, matriptase (stl4), trypsin (PRSS 1), PC1 (PCSK1) were provided by GenScript and plasmid for cathepsin B was provided from Sino Biological.

Primers

[0366] TABLE-US-00005 Gene Oligo sequence (5′ to 3′) Furin Forward GGAACATGACAGCTGCAACT (SEQ ID NO: 32) Furin Reverse TCGTCACGATCTGCTTCTCA (SEQ ID NO: 33) Cathepsin L Forward TAGAGGCACAGTGGACCAAG (SEQ ID NO: 34) Cathepsin L Reverse ATGGCCATTGTGAAGCTGTG (SEQ ID NO: 35) Cathepsin B Forward TCTCTGACCGGATCTGCATC (SEQ ID NO: 36) Cathepsin B Reverse TCACAGGGAGGGATGGAGTA (SEQ ID NO: 37) PC1 Forward GCGTGCCTGAGAAGAAAGAG (SEQ ID NO: 38) PC1 Reverse ATCCCGTTCTCTTTCAGCCA (SEQ ID NO: 39) Trypsin Forward AAGTGTGAAGCCTCCTACCC (SEQ ID NO: 40) Trypsin Reverse GGTGTAGACTCCAGGCTTGT (SEQ ID NO: 41) Matriptase Forward CCCAACAACCAGCATGTGAA (SEQ ID NO: 42) Matriptase Reverse ACTGGAGTCGTAGGAGAGGT (SEQ ID NO: 43) Matriptase Forward AGAACGTCCTGCTCATCACA (SEQ ID NO: 44) Matriptase Reverse TGTGCAGTCAATGTTGGGTG (SEQ ID NO: 45)

Results: Impact of the S Protein D614G Mutation on Cell Transduction With Pseudotype Lentivectors

[0367] Our aim was to establish cell lines that consistently express the viral receptor ACE2, as well as relevant proteases able cleave the spike protein. As seen in FIGS. 3A and B, neither Hela cells, nor A549 cells expressed relevant amounts of ACE2 mRNA. Similarly, mRNA levels of TMPRSS2 were almost undetectable. Both cell types show a low to intermediate gene expression of furin, but relatively high level gene expression of cathepsin L (a protease able to cleave spike protein from both, SARS-CoV-1 and SARS-CoV-2). In order to establish cell lines permissive for spike protein pseudotyped lentivectors, we therefore transduced both Hela cells and A549 cells either individually, or combined with ACE2 (SEQ ID NO: 24) and TMPRSS2(SEQ ID NO: 25).

[0368] As expected, exposure of wild type (mock-transduced) Hela cells or A549 cells to the above described lentivectors did not lead to GFP or luciferase expression (FIGS. 3c-f). Similarly, overexpression of TMPRSS2 by itself did not lead to significant transduction rate. Using the D614 pseudotype lentivector, there was a small, yet clearly detectable transduction of the ACE2 and ACE2/TMPRSS2-expressing Hela cells, but only a very small transduction of A549 cells. This changed markedly when the G614 pseudotype vector was used. There was a much stronger transduction of both ACE2-expressing lines. Note however that transduction of ACE2-expressing HeLa cells was much stronger than the one of ACE2-expressing A549 cells. Conversely, the overexpression of TMRPSS2 in addition to ACE2, lead to strong additional enhancement of transduction, which was not the case for Hela cells. Thus, most likely Hela cells already strongly express a spike cleaving protease, and the overexpression of TMRPSS2 is not required for efficient transduction. In contrast, in A549 cells, proteolytic cleavage appears to be a rate-limiting step, and overexpression of TMRPSS2 therefore enhances transduction.

Discussion (HeLa Versus A549 Cell-Line Susceptibility to Viral Infection)

[0369] The increased susceptibility of one cell-line (HeLa, cervical, female, Afro-american origin) to SARS-CoV-2 pseudoviral infection is a particularly interesting observation versus another cell-line (A549, lungs, male, Caucasian origin) as it underlies the concept that characterization of patient populations is key to determining a therapeutic strategy tailored towards achieving maximal impact for patients either diagnosed with COVID-19 or otherwise for prophylactic purposes. Although race in itself might present a secondary role for consideration, genetic predisposition for either low endogenous AAT or higher levels of chronic inflammation (higher IFN-γ and/or cathepsin L) for instance require higher doses and/or more regular administration of the active therapeutic substance (AAT).

Experiment 4

[0370] The aim was to detect the endogenous levels of ACE2 and TMPRSS2 gene expression in different cell lines.

[0371] Method: Total RNA was extracted from Calu3, CaCo2, VeroE6, HepG2, A549, SH-SY5Y, HEK293-117T, HeLa, cell lines using RNeasy Micro Kit (Qiagen). Complementary DNA was synthesized from total RNA using PrimeScript™ RT Reagent kit (Takara). The real-time PCR measurement of cDNAs was performed using PowerUp SYBR™ Green Master Mix (Applied Biosystems) and normalized to the expression of GAPDH as control housekeeping gene. The primers are listed below: [0372] ACE2 forward: cattggagcaagtgttggatctt (SEQ ID NO: 26) [0373] ACE2 reverse: gagctaatgcatgccattctca (SEQ ID NO: 27) [0374] TMPRSS2 forward: cacggactggatttatcgacaa (SEQ ID NO: 28) [0375] TMPRSS2 reverse: cgtcaaggacgaagaccatgt (SEQ ID NO: 29) [0376] GAPDH forward: gcacaagaggaagagagagacc (SEQ ID NO: 30) [0377] GAPDH reverse: aggggagattcagtgtggtg (SEQ ID NO: 31) [0378] The results are shown in FIG. 3.

Experiment 5

[0379] The aim was to determine whether Interferon gamma treatment induces ACE2 expression in A549 cell line.

[0380] Protocol: A549 cells were seeded in 12 well plate and the addition of interferon gamma was performed 24 hours post cell splitting. The treatment lasted for 48 hours and we performed RNA extraction, reverse transcriptase reaction and qPCR as previously described (cf. method section of Experiment 4).

[0381] The results are shown in FIG. 4.

Experiment 6

[0382] The aim was to determine whether interferon gamma treatment induces ACE2 expression in HeLa cells expressing the SARS-CoV-2 fusion protein.

[0383] Protocol: HeLa Spike cells were seeded in 12 well plate and the addition of interferon gamma was performed 24 hours post cell splitting. The treatment lasted for 48 hours and we performed RNA extraction, reverse transcriptase reaction and qPCR as previously described (cf. method section of Experiment 4).

[0384] The results are shown in FIG. 5.

Experiment 7: SARS-CoV-2 Viral Entry Assay

[0385] The results are shown in FIGS. 7 and 8. Done with pseudolentivector expressing the surface protein SARS-CoV-2 spike harboring the D614G mutation, coding for a luciferase reporter (FIGS. 7 and 8).

[0386] The pseudolentivector is added on A549 cells overexpressing constitutively the ACE2 receptor (FIG. 7) or both ACE2 and TMPRSS2 (FIG. 8 ). Compound treatment is either performed 24 h (panels A&B) or 1 h (panels C&D) prior to addition of the pseudolentivector. Further schematic information on the pseudoviral assay protocol is provided in FIGS. 9 and 10.

Example 4

[0387] Viral entry inhibition test with A549 human lung alveolar basal epithelium cells overexpressing ACE2 (FIGS. 11 and 22) or Caco2 human colorectal adenocarcinoma (FIG. 21) were treated for 24h with AAT from multiple sources (FIGS. 11a,11b, 21a, 21b, 22a, 22b) or with inhibitor compounds (FIGS. 11c, 21c, 22c). Then the lentivector coding for the luciferase reporter and expressing the SARS-CoV-2 spike protein with the D614G mutation (FIG. 11), the SARS-CoV spike protein (FIG. 22) or the MERS-CoV spike protein (FIG. 21) was added for 6h. Finally, the culture media was changed, and cells were incubated for 3 additional days prior to measurements. Viral entry was measured by the lentivirus-mediated luciferase signal (FIGS. 11, 21, 22 dark grey) and normalized with WST8-cell viability displayed as light grey. For all conditions the concentrations of DMSO / PBS have been normalized (buffer). All conditions were performed in triplicate, error bars represent standard deviation. Please refer to material and method section for technical information.

Example 5

[0388] Viral entry inhibition test with HeLa human cervical cancer cells overexpressing ACE2 were treated for 24 h with AAT from multiple sources (FIGS. 12a, 12b) or with inhibitor compounds (FIG. 12c). Then the lentivector coding for the luciferase reporter and expressing the SARS-CoV-2 spike protein with the D614G mutation was added for 6 h. Finally, the culture media was changed, and cells were incubated for 3 additional days prior to measurements. Viral entry was measured by the lentivirus-mediated luciferase signal (dark grey) and normalized with WST8-cell viability displayed as light grey. For all conditions the concentrations of DMSO/PBS have been normalized (buffer). All conditions were performed in triplicate, error bars represent standard deviation. Please refer to material and method section for technical information.

Example 6

[0389] SARS-CoV-2 spike fusion assay. The principle of the test is depicted in FIG. 13. HeLa human cervical cancer cells overexpressing either ACE2 and small bit luciferase or SARS-CoV-2 spike and large bit luciferase were mixed at equal number with the suited concentration of treatment. 24 h later the cell fusion was measured by the amount of luciferase reporter signal. Luciferase signal are observed in function of the buffer control. Sera was diluted at final concentration of 1/16. For all conditions the concentrations of Sera / PBS have been normalized (buffer). All conditions were performed in triplicate, error bars represent standard deviation (FIG. 14). Please refer to material and method section for technical information.

Example 7

[0390] Quantitative PCR analysis was performed to determine gene copy number of proteases in A549 cell. Copy number was calculated using linear plasmid for each gene as a control (FIG. 15 a). Please refer to material and method section for technical information.

Example 8

[0391] Quantitative PCR analysis was performed to determine relative gene expression of proteases ACE2 (FIG. 15 b) and TMPRSS2 (FIG. 15 c) in A549 cells. Calu3 and Caco2 cell lines were used as reference for respectively ACE2 and TMPRSS2 expression. Gapdh gene was used to normalize. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 9

[0392] SARS-CoV-2 peptide 50 uM, cathepsin B recombinant protein 1.76 ng/ul and AAT at luM were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm) (FIG. 16 a). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 10

[0393] SARS-CoV-2 peptide 50 uM, cathepsin L recombinant protein 1.76 ng/ul and AAT at 10 uM, were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm) (FIG. 16 b). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 11

[0394] SARS-CoV-2 peptide 50 uM, trypsin recombinant protein 6.4 nM and two concentrations of AAT (0.1 uM and 1 uM) were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm)(FIG. 16 c). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 12

[0395] SARS-CoV-2 peptide 50 uM, furin recombinant protein 10U/ml and AAT at 1 uM were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm) (FIG. 16 d). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 13

[0396] SARS-CoV-2 peptide 50 uM, PCI recombinant protein 1.76 ng/ul and several concentrations of AAT (1 uM, 10 uM, 40 uM and 100 uM) were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm) (FIG. 16 e). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 14

[0397] SARS-CoV-2 peptide 50 uM, matriptase recombinant protein 1.76 ng/ul and several concentrations of AAT (1 uM, 10 uM, 40 uM and 100 uM) were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm and emission detection at 390 nm) (FIG. 16 f). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 15

[0398] AAT inhibits TMPRSS2 protease activity. Boc-QAR-AMC peptide 30 uM, TMPRSS2 recombinant protein 0.5 uM and AAT at 5 uM were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 380 nm and emission detection at 460 nm) (FIG. 16 g). Vmax value was determined with the slope of the trendline. Experiment has been performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 16

[0399] DQ™ elastin substrate 25 ug/mL, elastase (ELA1) from pig pancreas 0.25U/mL and several concentrations of AAT (10 nM, 50 nM and 100 nM) were incubated together for 45 min. Fluorescence was measured every minute in a fluorescence reader (excitation at 485 nm and emission detection at 530 nm) (FIG. 16 h). Vmax value was determined with the slope of the trendline. It was performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 17

[0400] Substrate MeOSuc-AAPV-pNA 100 uM, purified human neutrophil elastase (ELA2) 2.2uU/ul and several concentrations of AAT (1 nM and 10 nM) were incubated together for 45 min. Absorbance was measured every minute in a spectrophotometer reader (A405 nm) (FIG. 16 i). Vmax value was determined with the slope of the trendline during 20 min. It was performed in duplicate. Error bars indicate the standard deviation. Please refer to material and method section for technical information.

Example 18

[0401] Titer measurement was done using an Octet RED (Sartorius, Octet RED96) method, Protein A biosensors (Sartorius, Ref 18-5010; 18-5012), Mouse Mc anti hAAT IgG2A (abcam, ab116604), neutralization buffer (MBD; 0.02% Tween 20, 150 mM, NaCl, 1 mg/mL BSA, PBS1X) and regeneration buffer (MBD; 10 mM Glycine- HCL (pH2)) binding as illustrated in FIG. 26. Comparison between plasma derived AAT (Sigma-Aldrich, SRP6312) and recombinant AAT produced in CHO by PL136/PL137 pool (FIG. 17).

TABLE-US-00006 Acquisition parameters Step Matrix Duration (sec) Shaking speed (rpm) Sensor pre-conditioning Regeneration buffer 5 *3 cycles 1000 Neutralization buffer 5 *3 cycles 1000 Baseline pre-loading Neutralization buffer 30 400 mAb loading mAb at 10 pg/mL in neutralization buffer 300 400 Baseline post-loading Neutralization buffer 300 1000 Protein standard association Range from 1.56 to 100 pg/mL in neutralization buffer 600 1000 Sensor regeneration Regeneration buffer 5 *3 cycles 1000 Neutralization buffer 5 *3 cycles 1000 Analysis parameters Standard curve equation Dose Response - 5-PL unweighted Binding rate equation R Equilibrium

Example 19

[0402] Human microglial cells HMC3-MHCII.sup.Luc cells were plated at day 0, activated with IFNy at day1 until day 2 and measurement of the luciferase activity and cell viability were done at day 4 (FIG. 18 a). Activation was measured by the activity of MHCII-driven luciferase and normalized to cell viability. Luciferase activity for all conditions is represented as fold of the untreated cells control (FIG. 18 b). All conditions were performed in triplicate, error bars represent standard deviation

Example 20

[0403] Human microglial HMC3-MHCII.sup.Luc and HMC3-MHCII.sup.Luc;Ubi.sup.AAT cells were plated at day 0, activated with IFNγ at day1 until day 2 and measurement of the luciferase activity and cell viability were measured at day 4. Plasma-derived AAT was applied from day 0 to day 4 on HMC3-MHCII.sup.Luc cells (FIG. 19 a). Activation was measured by the activity of MHCII-driven luciferase and normalized to cell viability. Luciferase activity for all conditions is represented as percentage of IFNy-activation control (FIG. 19 b). All conditions were performed in triplicate, error bars represent standard deviation

Example 21

[0404] Human microglial HMC3-MHCII.sup.Luc cells were plated at day 0, exposed to IFNγ and/or IFNβ at day 1 until day 2 and measurement of the luciferase activity and cell viability were done at day 4. Plasma-derived AAT was applied from day 0 to day 4 (FIG. 20 a). Activation was measured by the activity of MHCII-driven luciferase and normalized to cell viability. Luciferase activity for all conditions is represented as percentage of IFNy-activation control (FIG. 20 b). Bars for plasma-derived AAT (1, 10, 25 .Math.M) are repetition of Example 20 for comparison purpose. All conditions were performed in triplicate, error bars represent standard deviation.

Example 22

[0405] Coomassie Figure legend: SDS-PAGE coomassie-stained with AAT from multiple sources.educed samples were prepared for analysis by mixing with NuPage 4x LDS sample buffer (Life Technologies) and NuPage 10x sample reducing agent (Life Technologies), and incubated at 70° C., 10 min. For non-reduced samples, the reducing agent and heat incubation were omitted. 5 ug of protein was loaded per lane. Samples were electrophoresed on 4-20% Mini- PROTEAN® Precast Gels (BioRad) with TGS buffer. Then gels were fixed for 30 minutes at room temperature in fixation buffer (50% Methanol + 10% acetic acid + 40% H2O). Coomassie blue (Sigma Aldrich) was added at final concentration of 0.25% and incubated for additional 15 minutes. Finally gels were destained overnight in multiple washes of fixation buffer, and imaged on a G:Box imager (Syngene)(FIG. 24).

Example 23

[0406] Expression of recombinant human AAT in HEK 293 cells. Based on the SEQ ID NO: 46 for HEK293 or SEQ ID NO: 47 for HEK293T. For HEK293 an rhAAT expression clone containing SERPINA1_OHu22141C_pcDNA3.1(+) plasmid was generated from the vector in FIG. 25g. The plasmid-containing clone was sequence verified and a sufficient amount of plasmid for transfection of HEK 293 cells (ATCC, Catalog# CRL-1573) was prepared. HEK293 cells were transfected with the plasmid and rhAAT expression and secretion into the culture broth in 3 sets of 6-well plates was confirmed using a commercially available ELISA kit (Thermo Fischer Scientific, Catalog# EH411RBX5). Mock transfected cells as well as cells transfected with pCMV-Td Tomato and EGFP fluorescent markers was used as a control.

TABLE-US-00007 Critical Materials and Reagents Used for Generating rhAAT HEK 293 Cells Materials and Reagents Supplier Catalog # Amount Purpose pcDNA™3.1 (+) Thermo Fischer Scientific V79020 - Expression vector HEK-293 ATCC CRL-1573 - Host cells HyClone™ Dulbecco’s Modified Eagles Medium Thermo Fischer Scientific SH3024301 500 mL Growth medium Gibco™ Fetal Bovine Serum, certified, US Thermo Fischer Scientific 16-000-044 500 mL Nutrient supplement Gibco™ Penicillin-Streptomycin (10,000 U/mL) Thermo Fischer Scientific 15-140-122 100 mL Antibiotic supplement Gibco™ Versene Solution Thermo Fischer Scientific 15-040-066 100 mL Cell dissociation reagent Materials and Reagents Supplier Catalog # Amount Purpose Gibco™ DPBS, no calcium, no magnesium Thermo Fischer Scientific 14-190-250 500 mL Cell wash/dilution buffer Gibco™ Geneticin™ Selective Antibiotic (G418 Sulfate) (50 mg/mL) Thermo Fischer Scientific 10-131-035 20 mL Antibiotic solution (selection agent) Lipofectamine™ LTX Reagent with PLUS™ Reagent Thermo Fischer Scientific 15338100 1.0 mL Transfection facilitating agent Human Serpin A3/Alpha- 1-Antichymotrypsin ELISA Kit Thermo Fischer Scientific EH411RBX5 1 A1AT identity/quantitation rhAAT Select Resin 50 mL Pellicon 10 kDa membrane Millipore Pellicon 10 kDa membrane Millipore

Procedure

[0407] Production of rhAAT in HEK 293 cells was executed in two stages: [0408] 1. Preparation of rhAAT expressing cells. [0409] 2. Production of rhAAT.

Preparation of rhAAT Expressing Cells

[0410] Preparation of rhAAT expressing cells included the following activities: [0411] Construction and validation of expression-ready plasmid [0412] Transfection of the host cells [0413] Generation of rhAAT-expressing (stable) pools [0414] Clone selection

Construction and Validation of Expression-Ready Plasmid

[0415] Based on the sequence presented in SEQ ID NO: 46, a rhAAT expression clone containing SERPINAl_OHu22141C_pcDNA3.1(+) plasmid was prepared by Genscript Biotech Corporation (Piscataway, NJ).

[0416] The plasmid-containing clone was shipped to RTI International (Research Triangle Park, NC) for sequence verification and preparation of a sufficient amount of plasmid for transfection of HEK 293 cells.

Transient Transfection of the Host Cells

[0417] HEK293 cells were transfected with SERPINA1_OHu22141C_pcDNA3.1(+) plasmid and rhAAT expression and secretion into the culture broth in 3 sets of 6-well plates was confirmed using a commercially available ELISA kit. Mock transfected cells as well as cells transfected with pCMV-Td Tomato and EGFP fluorescent markers was used as a control.

TABLE-US-00008 Amounts of reagents and plasmid DNA per experiment per well Plasmids Plasmid (ng/.Math.L) Plasmid (.Math.L) Volume/ well (.Math.L) # of wells Total volume (.Math.L) Opti-Mem (.Math.L) Plasmid (.Math.L) PLUS (.Math.L) LTX (.Math.L) pcDNA3.1 SERPINA 1 1000 2.5 500 8 4000 3900 20.0 20.0 60 Mock 0 0 500 4 2000 1960 0.0 10.0 30 EGFP 308 8.1 500 2 1000 964 16.2 5.0 15 pCMV-Td Tomato 500 5.0 500 1 500 485 5.0 2.5 7.5

Generation of rhAAT-Expressing (Stable) Pools

[0418] Upon confirmation of successful transient transfection, generation of stable pools was performed in T-150 by antibiotic selection. The cells were maintained for up to 2 weeks under antibiotic selection to eliminate cells without plasmid. Following which, the culture supernatant was tested for protein expression using ELISA.

[0419] Pooled cells were frozen at 80° C. prior to the transfer for further cell expansion and rhAAT production in shake flasks.

Clone Selection

[0420] Cells were harvested diluted and transferred to 10-cm2 dishes for isolating single clones. 3-6 clones from 50-96 colonies, depending on the behavior of the transgene, were identified for subsequent confirmation rhAAT expression by ELISA.

Production of rhAAT

[0421] Production of rhAAT includes cell expansion and rhAAT production in cell stacks, purification of rhAAT by affinity chromatography, product concentration and formulation (buffer exchange) utilizing Amicon Ultra 15, 10 kDa tubes.

Cell Expansion and rhAAT Production in Cell Stacks

[0422] Recombinant anchorage dependent HEK-293 cells were grown in culture treated T-flasks and Cell Staks bottles in Dulbecco’s Modified Eagles Medium (DMEM, HyClone) and supplemented with 10% fetal bovine serum (FBS, Gibco), Penicillin-Streptomycin (Gibco), and Geneticin Selective antibiotic G418 Sulfate (Gibco). The cultures were incubated in a humidified incubator at 37.0° C. and 5% CO.sub.2 and rotating at 2.5 rpm when grown in roller bottles and subsequently harvested.

Purification of rhAAT by Affinity Chromatography

[0423] Clarified culture supernatant was tested for pH and Conductivity and titrated to 7.4 ± 0.1 using 1 M Tris, pH 7.4 and ±5 mS/cm of the equilibration buffer with 1 M NaCl, respectively, as required. Following the pH and conductivity adjustment, the clarified supernatant was filterd through 0.2 .Math.m filter prior to purification.

Affinity Chromatography

[0424] The affinity chromatography column packed with rhAAT Select Resin was rinsed with 3CV of Purified Water and sanitized with 3CV 0.5 M NaOH (with a 30 min hold after 2CV), followed by another rinse with 3CV of Purified Water and equilibration with 10CV of 20 mM Tris, 150 mM NaCl pH 7.4 buffer. The rhAAT Select column was loaded with the maximum volume of the clarified supernatant calculated based on rhAAT titer at the end of shake flask culture, volume of the clarified supernatant and the maximum column load capacity of 10 mg/mL resin. If required, in order to avoid overloading the resin, the clarified supernatant was processed through the rhAAT Select column in multiple cycles. Loaded protein was washed with 4 CV of 20 mM Tris, 150 mM NaCl pH 7.4 buffer and rhAAT eluted with 4 CV of 20 mM Tris, 2 M MgCl pH 7.4 buffer into PETG collection bottles. The column was stripped with 4 CV of PBS, pH 2.0 buffer and if required, equilibrated with 3 CV of 20 mM Tris, 150 mM NaCl pH 7.4 buffer prior to performing additional cycles.

Example 24

[0425] Construction of the vectors PL136 (pCGS3_AAT_native_SP; FIG. 25d) (original signal peptide into HindIII/XhoI restriction sites (LC MCS)) and PL137 (pCGS3_AAT_SP5, FIG. 25e) (The singal peptide of SEQ ID NO:1 was optimized by replacing amino acids 1-24 with an ATUM℠ (Newark, California) optimized signal peptide).

[0426] Coding sequences were codon optimized for expression in Chinese Hamster Ovary cells, using DNA2.0 proprietary algorithm (GeneGPS® Expression OptimizationTechnology, https://www.dna20.com/services/genegps). A canonical kozak sequence (GCCGCCACC) was added in front of the start codon. HindIII and XhoI restriction sites were added 5′ and 3′ of the synthetized coding sequences.

[0427] The resulting DNA fragments were cloned into vector pJ201. The complete plasmid map and sequence of clone pJ201_AAT_native_SP (FIG. 25b) and pJ201_AAT_SP5 (FIG. 25c) are provided.

[0428] pCGS3_AAT_native_SP and pCGS3_AAT_SP5 were obtained according to the following cloning scheme (empty pCGS3 vector FIG. 25f):

TABLE-US-00009 Vector Insert Construct name pCGS3/ HindIII-Xhol pJ201_AAT_native_SP/ HindIII-Xhol pCGS3_AAT_native_SP pCGS3/ HindIII-Xhol pJ201_AAT_SP5/ HindIII-Xhol pCGS3_AAT_SP5

[0429] Fragments preparation:

TABLE-US-00010 pCGS3/ HindIII-Xhol MQ-H20 33 .Math.l pCGS3 (1 .Math.g/ ul) 1 .Math.l 10X CutSmart buffer 4 .Math.l HindIII-HF 1 .Math.l XhoI 1 .Math.l total 40 .Math.l

TABLE-US-00011 pJ201_AAT_native_SP/HindIII-Xhol MQ-H20 9 .Math.l pJ201_AAT_native_SP (50 ng/ .Math.l) 25 .Math.l 10X CutSmart buffer 4 .Math.l HindIII-HF 1 .Math.l XhoI 1 .Math.l total 40 .Math.l

TABLE-US-00012 pJ201_AAT_SP5/ HindIII-Xhol MQ-H20 9 .Math.l pJ201_AAT_SP5 (50 ng/ .Math.l) 25 .Math.l 10X CutSmart buffer 4 .Math.l HindIII-HF 1 .Math.l XhoI 1 .Math.l total 40 .Math.l

[0430] All digestions were incubated for 2 hour at 37° C. Fragments of interest were isolated by agarose gel electrophoresis (1.2% agarose gel). Fragments of expected size were excised, gel purified and used for the following ligations:

Ligations

[0431] TABLE-US-00013 pCGS3_AAT_native_SP_A MQ-H20 4 .Math.l pCGS3/HindIII-Xhol (10 ng/.Math.l) 2 .Math.l pJ201_AAT_native_SP/ HindIII-Xhol (10 ng/.Math.l) 2 .Math.l 10X ligase buffer 1 .Math.l T4 DNA ligase 1 .Math.l total 10 .Math.l

TABLE-US-00014 pCGS3_AAT_SP5_A MQ-H20 4 .Math.l pCGS3/ HindIII-Xhol (10 ng/.Math.l) 2 .Math.l pJ201_AAT_SP5/ HindIII-Xhol (10 ng/.Math.l) 2 .Math.l 10X ligase buffer 1 .Math.l T4 DNA ligase 1 .Math.l total 10 .Math.l

[0432] The ligation mixtures (1 .Math.l) were transformed into E. coli Stabl2 cells from Invitrogen. The transformed E. coli cells were cultivated on LB Agar Lennox, Animal Free containing 50 mg/l Carbenicillin. E. coli colonies were transferred into 4 ml LB Broth Lennox, Animal Free containing 50 mg/l Ampicillin and incubated over night at 33° C. in a shaker incubator at 300 rpm. Plasmid DNA was isolated from the E. coli cultures using a Qiagen BioRobot 9600 and the Nucleo Spin Robot-8 Plasmid kit from Macherey-Nagel. DNA was then sequenced using chains specific sequencing primers covering the cloning sites.

[0433] The sequences of the following clones were confirmed to be identical to the expected ones PL136 (pCGS3_AAT_native_SP; FIG. 25d) and PL137 (pCGS3_AAT_SP5, FIG. 25e). AAT obtained from the PL136 in CHO and PL137 in CHO were pooled.

Example 25

Gene Synthesis and Single Gene Construction

[0434] The rhAAT single gene vector was constructed by sub-cloning the product gene into the vector pXC-17.4 (Lonza) (FIG. 25a).

DNA Amplification

[0435] 1 .Math.L of vector DNA was used to transform One Shot® Stbl3 Chemically Competent E. coli cells (Life Technologies, C7373-03) using the heat-shock method according to manufacturer’s instructions. Cells were spread onto ampicillin-containing (50 .Math.g/ml) LB agar plates (LB Broth Base, Select APS™ and Bacto-Agar, both Becton Dickinson, 292438 and 214010 respectively) and incubated overnight at 37° C. until bacterial colonies were evident.

[0436] For Giga preps, single bacterial cultures were used to inoculate a starter culture which was subsequently used to inoculate 1.0 L Plasmid Plus Medium (Thomson, 446300) containing 50 .Math.g ampicillin and incubated at 37° C. overnight with shaking. Vector DNA was isolated using the QIAGEN Gigaprep system (Qiagen, 12291). In all instances, DNA concentration was measured using a Nanodrop 1000 spectrophotometer (Thermo-Scientific) and adjusted to 1 mg/mL. DNA quality was assessed by measuring the absorbance ratio at 260 and 280 nm.

Routine Culture of CHOK1SV GS-KO Cells

[0437] CHOK1SV GS-KO cells were cultured in CD-CHO media (Life Technologies, 10743-029) supplemented with 6 mM L-glutamine (Life Technologies, 25030-123). Cells were incubated in a shaking incubator at 36.5° C., 5% CO2, 85% humidity, 140 rpm. Cells were routinely sub-cultured every 3-4 days, seeding at 0.2×106 cells/ml and were propagated in order to have sufficient cells available for transfection. Cells were discarded by passage 20.

[0438] Stable recombinant CHOK1SV GS-KO cells were cultured in CD-CHO media supplemented with 50 .Math.M MSX (L-Methionine Sulfoximine, Sigma-Aldrich, M5379) and SP4. Cells were incubated in a shaking incubator at 36.5° C., 5% CO2, 85% humidity, 140 rpm. Cells were routinely sub-cultured every 3-4 days, seeding at 0.2× 106 cells/ml and were propagated in order to have sufficient cells available for the large scale fed-batch overgrowth.

Stable Pooled Transfection of CHOK1SV GS-KO Cells

[0439] Single gene vector DNA plasmid was prepared for transfection by linearising with PvuI followed by ethanol precipitation and resuspension in EB buffer to a final concentration of 400 .Math.g/ml. Transfection was carried out via electroporation using the Gene Pulse XCell. For each transfection, viable cells were resuspended in pre-warmed CD-CHO media to 1.43× 107 cells/ml. 100 .Math.l linearised DNA at a concentration of 400 .Math.g/ml was aliquotted into a 0.4 cm gap electroporation cuvette and 700 .Math.l cell suspension added. Three cuvettes of cells and DNA were electroporated at 300 V, 900 .Math.F and immediately recovered to 30 ml pre-warmed CD-CHO supplemented with 10 ml/L SP4 (Lonza, BESP1076E) to generate a stable pool. The transfectants were incubated in a shaking incubator at 36.5° C., 5% CO2, 85% humidity, 140 rpm.

[0440] A total of 3 stable pool transfectants were established. 24 h post-transfection the cultures were centrifuged and resuspended into pre-warmed CD-CHO supplemented with 50 .Math.M MSX and 10 ml/L SP4. Cell growth and viability were periodically checked post- transfection.

[0441] When the viable cell density was >0.6×106 cells/ml, the transfectant cultures were suitable to progress. Cells were seeded at 0.2×106 cells/ml in a final volume of 100 ml in CD-CHO medium supplemented with 50 .Math.M MSX/ 10 ml/L SP4, in a 500 ml vented Erlenmeyer flask (Fisher Scientific (Corning), 10352742) and incubated in a shaking incubator at 36.5° C., 5% CO2, 85% humidity, 140 rpm. Cell cultures were monitored and expanded once cultures had adapted to exponential growth. Cultures were expanded to 200 ml culture volume in 500 ml vented Erlenmeyer flasks at a concentration of 0.2×106 cells/ml in CD- CHO supplemented with 50 .Math.M MSX/10 ml/L SP4 and incubated under the conditions described above (see Section 0). Cultures were then expanded to the appropriate production volume.

Abridged Fed-Batch Overgrow

[0442] Cells were propagated to production volume of 2 L per product by seeding the appropriate culture volume at 0.2×106 cells/mL in Lonza’s CM42 base media supplemented with 4 mL/L SPE from the established stable pools. The production volumes were established in 5 L (Generon, 931116) shake flasks and incubated in a shaking incubator at 36.5° C., 5% CO2, 85% humidity, and 140 rpm. Cell count and viability were monitored on day 4, before feeding was initiated and periodically until the culture was harvested on day 11. The bolus feeds were administered on day 4 and 8 consisting of a mixture of Lonza’s proprietary feeds.

Harvesting and Concentrating of Production Culture

[0443] The culture was harvested by centrifugation at 3000 rpm for 10 min and filtered using a 0.22 .Math.m PES membrane to obtain clarified supernatant.

Alpha-1 Anti-Trypsin Affinity Chromatography

[0444] The clarified cell supernatant was purified using an in-house packed 50 ml Alpha-1 anti- trypsin Select column (GE Healthcare). The column was equilibrated pre- and post- product application with 20 mM Tris, 150 mM NaCl, pH 7.4 and elution was carried out with 20 mM Tris, 2 M MgCl2, pH 7.4. The procedure was carried out on an AKTA Purifier at 10 ml/min. Product-containing fractions from the affinity chromatography eluate were pooled and buffer exchanged into 50 mM Tris, 75 mM NaCl, pH 8.0 by Tangential Flow Filtration (TFF) using Spectrum’s KrosFlo TFF system with a 10 kDa MWCO (D02-E010-05-N).

Anion Exchange Chromatography

[0445] The pooled and buffer exchanged fractions were further purified using 25 ml CaptoQ column (5×5 ml columns connected in tandem) (GE Healthcare) on an AKTA purifier at 10 ml/min. The column was equilibrated pre- and post- product application with 50 mM Tris, 75 mM NaCl, pH 8.0. The product was eluted over a 10 CV linear gradient to 50 mM Tris, 1 M NaCl, pH 8.0. Product-containing fractions from the anion exchange chromatography eluate were pooled, diluted 1 mg/ml and quality analysed.

SE-HPLC

[0446] Duplicate samples were analysed by SE-HPLC on an Agilent 1200 series HPLC system, using a Zorbax GF-250 9.4 mM ID × 25 cm column (Agilent). 80 .Math.L aliquots of 1 mg/mL samples (or stock concentration if samples are < 1 mg/mL) were injected and run in 50 mM sodium phosphate, 150 mM sodium chloride, 500 mM arginine, pH 6.0 at 1 mL/min for 15 minutes. Soluble aggregate levels were analysed using Empower software. Signals arising from buffer constituents were analysed by blank buffer injection and are omitted in the data analysis unless indicated otherwise.

Product Concentration

[0447] The purified product was concentrated to a target of 25 mg/mL using Vivaspin Turbo-15 Centrifugal Filter Units 30 KDa Molecular Weight Cut-Off (Sartorius, VS15T02).

REFERENCES

[0448] 1. Wrapp, D., et al., Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science, 2020. 367(6483): p. 1260-1263.

[0449] 2. Jaimes, J.A., J.K. Millet, and G.R. Whittaker, Proteolytic Cleavage of the SARS-CoV-2 Spike Protein and the Role of the Novel S1/S2 Site. iScience, 2020. 23(6): p. 101212.

[0450] 3. Korber, B., et al., Spike mutation pipeline reveals the emergence of a more transmissible form of SARS-CoV-2. bioRxiv, 2020: p. 2020.04.29.069054.

[0451] 4. Becerra-Flores, M. and T. Cardozo, SARS-CoV-2 viral spike G614 mutation exhibits higher case fatality rate. Int J Clin Pract, 2020.

[0452] 5. Li, Q., et al., The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity. Cell, 2020.

[0453] 6. Ogawa, J., et al., The D614G mutation in the SARS-CoV-2 Spike protein increases infectivity in an ACE2 receptor dependent manner. bioRxiv, 2020.

[0454] 7. Goodfellow, I. Goodfellow, and S.I. Taube, Calicivirus Replication and Reverse Genetics Viral Gastroenteritis : Molecular Epidemiology and Pathogenesis. 2016: p. 355-378.

[0455] 8. Yin, W., et al., Structural basis for inhibition of the RNA-dependent RNA polymerase from SARS-CoV-2 by remdesivir. Science, 2020.

[0456] 9. Gao, Y., et al., Structure of the RNA-dependent RNA polymerase from COVID-19 virus. Science, 2020. 368(6492): p. 779-782.

[0457] 10. Pachetti, M., et al., Emerging SARS-CoV-2 mutation hot spots include a novel RNA-dependent-RNA polymerase variant. J Transl Med, 2020. 18(1): p. 179.