CORN EVENT 2A-7 AND IDENTIFICATION METHOD THEREFOR

20230304105 · 2023-09-28

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a transgenic corn event 2A-7, and corn plants or parts, seeds, cells, or progenies thereof containing nucleic acid molecules for diagnosing the corn event. The event shows resistance to lepidopteran insect infestation. Further provided are a method for detecting the presence of nucleic acid molecules unique to the corn event in a sample, and a probe and a primer for detecting the presence of the corn event in the sample. Further provided is a method for producing corn plants and seeds containing the nucleic acid molecules for the corn event.

    Claims

    1.-35. (canceled)

    36. A corn plant or part, seed, cell or progeny thereof, which has an exogenous nucleic acid molecule inserted into its genome, and the exogenous nucleic acid molecule comprises Cry1Ab and Cry2Ab genes, wherein the exogenous nucleic acid molecule is flanked by a 5′-flanking region and a 3′-flanking region, a sequence comprising the 5′-flanking region and a part of the exogenous nucleic acid molecule adjacent thereto is shown in SEQ ID NO: 1, and a sequence comprising the 3′-flanking region and a part of the exogenous nucleic acid molecule adjacent thereto is shown in SEQ ID NO: 2; wherein the exogenous nucleic acid molecule comprises 35S polyA terminator, Bar gene, CAMV 35S promoter, nos polyA terminator, Cry1Ab gene, Gly promoter, CAMV 35S promoter, adhl enhancer, Cry2Ab gene and nos polyA terminator.

    37. The corn plant or part, seed, cell or progeny thereof according to claim 36, wherein the position of the exogenous nucleic acid molecule in the genome corresponds to that between Chr3:179141694bp-179141724bp of the B73 V4 version reference genome sequence; and/or, the exogenous nucleic acid molecule comprises a nucleotide sequence of positions 483-8524 of SEQ ID NO: 5 or the complement thereof.

    38. The corn plant or part, seed, cell or progeny thereof according to claim 36, the genome of which comprising a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof.

    39. The corn plant or part, seed, cell or progeny thereof according to claim 36, wherein a corn seed that produce the corn plant or part, seed, cell or progeny thereof is deposited in the China General Microbiological Culture Collection Center (CGMCC), with the deposit number CGMCC NO. 17848.

    40. A corn seed, which is deposited at the China General Microbiological Culture Collection Center (CGMCC), with the deposit number CGMCC NO. 17848.

    41. A product comprising the corn plant or part, seed, cell or progeny thereof according to claim 36, or a corn seed that is deposited at the China General Microbiological Culture Collection Center (CGMCC) with the deposit number CGMCC NO. 17848.

    42. The product according to claim 41, wherein the product comprises a sequence selected from any one of SEQ ID NOs: 1-5 or a complementary sequence thereof.

    43. The product according to claim 41, wherein the product is selected from the group consisting of corn ear, corn with husk removed, corn silk, corn pollen, corn grit, corn meal, crushed corn, corn flour, corn oil, corn starch, corn pulp, malted corn, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and/or liquor produced from corn, distillers dried grains with solubles (DDGS) produced from corn fermentation, and animal feed, cosmetic and filler derived from corn.

    44. The corn plant or part, seed, cell or progeny thereof according to claim 36, wherein the part of the corn plant is selected from the group consisting of kernel, pollen, ovule, flower, shoot, root, stalk, silk, tassel, ear and leaf.

    45. A primer pair, which comprises a first primer and a second primer, wherein the first primer comprises a nucleotide sequence composed of at least 15 consecutive nucleotides of the sequence of positions 1-432 of SEQ ID NO: 5 or the complement thereof, or a sequence having a sequence identity of at least 80% as compared with the nucleotide sequence, and the second primer comprises a nucleotide sequence composed of at least 15 consecutive nucleotides of the sequence of positions 483-8524 of SEQ ID NO: 5 or the complement thereof, or a sequence having a sequence identity of at least 80% as compared with the nucleotide sequence.

    46. The primer pair according to claim 45, wherein the first primer comprises a sequence shown in SEQ ID NO: 6 or a sequence having a sequence identity of at least 80% as compared therewith, and the second primer comprises a sequence shown in SEQ ID NO: 7 or a sequence having a sequence identity of at least 80% as compared therewith.

    47. A primer pair, which comprises a first primer and a second primer, wherein the first primer comprises a nucleotide sequence composed of at least 15 consecutive nucleotides of the sequence of positions 483-8524 of SEQ ID NO: 5 or the complement thereof, or a sequence having a sequence identity of at least 80% as compared with the nucleotide sequence, and the second primer comprises a nucleotide sequence composed of at least 15 consecutive nucleotides of the sequence of positions 8532-9031 of SEQ ID NO: 5 or the complement thereof, or a sequence having a sequence identity of at least 80% as compared with the nucleotide sequence.

    48. The primer pair according to claim 47, wherein the first primer comprises a nucleotide sequence shown in SEQ ID NO: 8 or a sequence having a sequence identity of at least 80% as compared therewith, and the second primer comprises a nucleotide sequence shown in SEQ ID NO: 9 or a sequence having a sequence identity of at least 80% as compared therewith.

    49. A method for detecting a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting the primer pair according to claim 45 with the sample; (2) performing a nucleic acid amplification reaction; and (3) detecting a product of step (2) by gel electrophoresis; wherein the corn event 2A-7 comprises a sequence as shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof in its genome.

    50. A method for detecting a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting the primer pair according to claim 46 with the sample; (2) performing a nucleic acid amplification reaction; and (3) detecting a product of step (2) by gel electrophoresis; wherein, when an amplicon with a length of about 250-260 bp is detected, it indicates the presence of the nucleic acid molecule unique to the corn event 2A-7 in the sample; wherein the corn event 2A-7 comprises a sequence as shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof in its genome.

    51. A method for detecting a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting the primer pair according to claim 48 with the sample; (2) performing a nucleic acid amplification reaction; and (3) detecting a product of step (2) by gel electrophoresis; wherein, when an amplicon with a length of about 305-315 bp is detected, it indicates the presence of the nucleic acid molecule unique to corn event 2A-7 in the sample; wherein the corn event 2A-7 comprises a sequence as shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof in its genome.

    52. A method for detecting a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting a primer pair with the sample; wherein, when the primer pair is used to amplify a nucleic acid from a genomic DNA of the corn event 2A-7, an amplicon comprising a nucleotide sequence selected from the following is generated: a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof; (2) performing a nucleic acid amplification reaction, thereby producing the amplicon; and (3) detecting the amplicon; wherein, the corn event 2A-7 is the corn plant or part, seed, cell or progeny thereof according to claim 36.

    53. A method for detecting the presence of a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting a nucleic acid probe specific to a target sequence with the sample, wherein the target sequence comprises a nucleotide sequence selected from the following: a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof; (2) subjecting the sample and the nucleic acid probe to a stringent hybridization condition; and (3) detecting the hybridization between the nucleic acid probe and the sample; when the hybridization is detected, it indicates the presence of the nucleic acid molecule unique to the corn event 2A-7 in the sample; wherein, the corn event 2A-7 is the corn plant or part, seed, cell or progeny thereof according to claim 36.

    54. An isolated nucleic acid molecule, which comprises a nucleotide sequence selected from the following: a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof.

    55. A method for producing an insect-resistant corn plant, which comprises: (1) crossing a first parental corn plant with a second parental corn plant; wherein the first or second parental corn plant is as defined according to claim 36; (2) obtaining first generation progeny plants from the cross of (1); and (3) selecting a progeny plant having an insect resistance from these first generation progeny plants, wherein, the progeny plant is an insect-resistant corn plant when the progeny plant satisfies at least one of the following items (3a) to (3d): (3a) the progeny plant comprises a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof in its genome; (3b) when SEQ ID NO: 6 and SEQ ID NO: 7 are used as forward primer and reverse primer respectively to amplify a genomic DNA of the progeny plant, an amplicon with a length of about 200-300 bp is generated; and/or, (3c) when SEQ ID NO: 8 and SEQ ID NO: 9 are used as forward primer and reverse primer respectively to amplify a genomic DNA of the progeny plant, an amplicon with a length of about 250-350 bp is generated; or, (3d) when a nucleic acid probe specific to a sequence shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof is used to detect a genomic DNA of the progeny plant, hybridization is detected; optionally the method further comprises the following steps: (4) selfing of the progeny plant obtained in step (3) to produce a plurality of second generation progeny plants; (5) selecting a plant having an insect resistance from these second generation progeny plants, wherein the plant is an insect-resistant corn plant when the plant satisfies at least one of items (3a) to (3d); wherein the insect is selected from Lepidopteran insects.

    56. A method for producing a hybrid corn seed that can grow into an insect-resistant corn plant, which comprises: crossing a first parental corn plant with a second parental corn plant and harvesting the resulting hybrid seed, wherein the first parental corn plant and/or the second parental corn plant are as defined in claim 36; wherein the insect is selected from Lepidopteran insects.

    57. A method for producing a hybrid corn seed that can grow into an insect-resistant corn plant, which comprises: (1) planting seeds of a first inbred corn line, in which the first inbred corn line is a corn plant as defined in claim 36; and planting seeds of a second inbred line with a different genotype; (2) cultivating corn plants resulting from said planting until time of flowering; (3) emasculating flowers of plants of one of the corn inbred lines; (4) sexually crossing the two different inbred lines with each other; and (5) harvesting the hybrid seed produced thereby; wherein the insect is selected from Lepidopteran insects.

    58. The corn plant or part, seed, cell or progeny thereof according to claim 36, wherein the exogenous nucleic acid molecule is flanked by a 5′-flanking region, and the 5′-flanking region has a nucleotide sequence of positions 1-432 or 300-432 of SEQ ID NO: 5; and the exogenous nucleic acid molecule is flanked by a 3′-flanking region, and the 3′-flanking region has a nucleotide sequence of positions 8532-9031 or 8532-8800 of SEQ ID NO: 5.

    59. A method for detecting a nucleic acid molecule unique to corn event 2A-7 in a sample comprising a corn nucleic acid, which comprises: (1) contacting the primer pair according to claim 47 with the sample; (2) performing a nucleic acid amplification reaction; and (3) detecting a product of step (2) by gel electrophoresis; wherein the corn event 2A-7 comprises a sequence as shown in any one of SEQ ID NOs: 1-5 or a complementary sequence thereof in its genome.

    60. The method according to claim 55, wherein the insect is selected from armyworm, corn borer, cotton bollworm, peach borer, and Spodoptera frugiperda.

    61. The method according to claim 56, wherein the insect is selected from armyworm, corn borer, cotton bollworm, peach borer, and Spodoptera frugiperda.

    62. The method according to claim 57, wherein the insect is selected from armyworm, corn borer, cotton bollworm, peach borer, and Spodoptera frugiperda.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0156] FIG. 1 shows the vector map of pCAMBIA3301+mCry1Ab+mCry2Ab.

    [0157] FIG. 2 shows the electrophoresis results of the PCR product of internal reference gene in Example 2. Among them, lane 1: industrial transgenic corn; lane 2: industrial transgenic soybean; lane 3: industrial transgenic rape; lane 4: industrial transgenic cotton; lane 5: industrial transgenic rice; lane 6: transgenic corn 2A-5; lane 7: transgenic corn 2A-7; lane 8: transgenic corn 2A-7; lane 9: transgenic corn 2A-7; lane 10: transgenic corn 2A-7; lane 11: non-transgenic recipient control; lane 12: blank control; lane 13: positive control T+zSSIIb (Zm00001d052263) plasmid (10 pg); lane M: molecular weight marker DL2000 plus.

    [0158] FIG. 3 shows the electrophoresis results of the PCR product of specific reaction system of 5′-flanking region in Example 2. Among them, lane 1: industrial transgenic corn; lane 2: industrial transgenic soybean; lane 3: industrial transgenic rape; lane 4: industrial transgenic cotton; lane 5: industrial transgenic rice; lane 6: transgenic corn 2A-5; lane 7: transgenic corn 2A-7; lane 8: transgenic corn 2A-7; lane 9: transgenic corn 2A-7; lane 10: transgenic corn 2A-7; lane 11: non-transgenic recipient control; lane 12: blank control; lane 13: T+2A-7 5′-plasmid (10 pg) containing the 5′-flanking sequence and insert sequence cloned previously; lane M: molecular weight marker DL2000 plus.

    [0159] FIG. 4 shows the electrophoresis results of the PCR product of specific reaction system of 3′-flanking region in Example 2. lane 1: industrial transgenic corn; lane 2: industrial transgenic soybean; lane 3: industrial transgenic rape; lane 4: industrial transgenic cotton; lane 5: industrial transgenic rice; lane 6: transgenic corn 2A-5; lane 7: transgenic corn 2A-7; lane 8: transgenic corn 2A-7; lane 9: transgenic corn 2A-7; lane 10: transgenic corn 2A-7; lane 11: non-transgenic recipient control; lane 12: blank control; lane 13: T+2A-7 3′-plasmid plasmid (10 pg) containing the 3′-flanking sequence and insert sequence; lane M: molecular weight marker DL2000 plus.

    [0160] FIG. 5 shows the identification results of the resistance of 2A-7 to Mythimna separata in Example 3.

    [0161] FIG. 6A shows the identification results of the resistance of the ear of 2A-7 to corn borer in Example 3. From top to bottom: 2A-7, Zheng 58, and Zheng Dan 958.

    [0162] FIG. 6B shows the identification results of the resistance of the stalk of 2A-7 to corn borer in Example 3. From top to bottom: 2A-7, Zheng 58, and Zheng Dan 958.

    [0163] FIG. 7 shows the identification results of the resistance of the ear of 2A-7 to cotton bollworm in Example 3. From top to bottom: 2A-7, Zheng 58, and Zheng Dan 958.

    [0164] FIG. 8 shows the results of indoor bioassay of the leaf of 2A-7 against Spodoptera frugiperda in Example 3. Upper panel: the leaf of control Zheng 58; Lower panel: the leaf of 2A-7.

    [0165] FIG. 9 shows the results of indoor bioassay of the silk of 2A-7 against Spodoptera frugiperda in Example 3. Upper panel: the silk of control Zheng 58; Lower panel: the silk of 2A-7.

    [0166] FIG. 10 shows the results of field bioassay of 2A-7 against Spodoptera frugiperda in Example 3. Left column: 2A-7; right column: the control Zheng 58.

    SEQUENCE INFORMATION

    [0167] Information on partial sequences involved in the present invention is provided in Table 1 below.

    TABLE-US-00001 TABLE 1 Description of sequence SEQ ID NO: Description 1 5′-junction sequence (a sequence comprising the 5′-flanking region of genome and a part of the exogenous nucleic acid molecule adjacent thereto) 2 3′-junction sequence (a sequence comprising the 3′-flanking region of genome and a part of the exogenous nucleic acid molecule adjacent thereto) 3 5′-junction sequence + 5′-flanking sequence 4 3′-junction sequence + 3′-flanking sequence 5 Exogenous nucleic acid molecule + flanking sequences at both ends 6 5′-forward primer 7 5′-reverse primer 8 3′-forward primer 9 3′-reverse primer 10 zSSIIb-F 11 zSSIIb-R 12 mcry1Ab gene 13 mcry2Ab gene 14 Bar gene 15-25 TAIL-PCR primer

    Deposit of Biological Materials

    [0168] The present invention relates to the following biological materials that have been deposited in China Common Microbial Culture Collection Center (CGMCC) (No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing):

    [0169] The Seed of Corn (Zea mays) 2A-7, which has the deposit number CGMCC NO. 17848, and the date of deposit is Oct. 28, 2019.

    EXAMPLES

    [0170] The present invention will now be described with reference to the following examples which are intended to illustrate the present invention rather than limit the present invention.

    [0171] Unless otherwise specified, the experiments and methods described in the examples are basically performed according to conventional methods well known in the art and described in various references. In addition, if the specific conditions are not specified in the examples, it shall be carried out in accordance with the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without the manufacturer's indication are all conventional products that can be purchased commercially. Those skilled in the art know that the present invention is described by way of examples, and are not intended to limit the scope of protection claimed by the present invention. All publications and other references mentioned in this article are incorporated into this article by reference in their entirety.

    Example 1. Transformation and Selection of Corn Event 2A-7

    [0172] The selective marker gene bar (SEQ ID NO: 14), the target genes mCry1Ab (SEQ ID NO: 12) and mCry2Ab (SEQ ID NO: 13) and their related regulatory elements were inserted into T-DNA of pCAMBIA3301 (purchased from Hunan Fenghui Biotechnology Co., Ltd.) to construct a plant expression vector according to conventional molecular biology methods, which was named as pCAMBIA3301+mCry1Ab+mCry2Ab. The related regulatory elements of each inserted gene were shown in the following table. The map was shown in FIG. 1, wherein the promoter Gly can be seen in Chinese patent application CN201710702435.4. Positive clones were identified by restriction digestion and two-way sequencing, and used for corn transformation.

    TABLE-US-00002 TABLE 2 Regulatory elements in transformation vector Regulatory element Function Source Gly Promoter of target gene mcry1Ab Corn nos Terminator of target gene mcry1Ab Agrobacterium tumefaciens CaMV35s Promoter of target gene mcry2Ab Cauliflower mosaic virus adh1 To enhance the expression of mCry2Ab Corn nos Terminator of target gene mcry2Ab Agrobacterium tumefaciens CaMV35s Promoter of selective marker gene bar Cauliflower mosaic virus 35S ploy A Terminator of selective marker gene bar Cauliflower mosaic virus

    [0173] Agrobacterium EHA105 (purchased from Beijing Huayueyang Biotechnology Co., Ltd.) was transformed with the above vector, and then immature embryos of corn were infected with the Agrobacterium containing the target gene. The specific transgenic method was as follows:

    [0174] The recipient used in the transgenic process was the hybrid F1 generation of inbred lines HiIIA and HiIIB (which can be obtained from the “Corn Genetic Resources Center” (Maize GDB, 2010)). Firstly, the inbred lines HiIIA and HiIIB were planted in the field, and then they were separately covered with bags when the inbred lines shed pollen. Then pollination was prepared by two pollination methods: HiIIA as female parent and HiIIB as male parent; or HiIIA as male parent and HiIIB as female parent. After 9-11 days of pollination, the immature embryo was taken from the kernel of the pollinated ear, and then infected with Agrobacterium indoors. The immature embryo infected with Agrobacterium was placed on a selection medium for multiple screenings to obtain resistant callus, the resistant callus was regenerated into seedlings, thereby obtaining T0 generation transgenic plant. After the TO generation transgenic plant was obtained, the pollen of the T0 generation transgenic plant was used to cross some seed-bearing female parents, such as Zheng 58. The insertion sequence was introduced into the immature embryo of the recipient plant by the Agrobacterium infection method, and the transgenic plant was obtained after screening with herbicide bialaphos. A total of more than 2,000 T0 generation transformants were obtained through multiple transformations, followed by detecting the amount of proteins mcry1Ab and mcry2Ab, screening the copy number of inserts, testing the stability of successive generations and identifying the agronomic traits in different locations. The corn transformant 2A-7 with high expression of both mcry1Ab and mcry2Ab, single copy, and genetic stability was thereby obtained.

    [0175] Further, the integration of exogenous DNA in the genome of corn transformant 2A-7 was identified, and the method was as follows: fresh corn leaves were taken to extract corn genomic DNA. TAIL-PCR was performed by using 5 kinds of degenerate primers: LAD1-1, LAD1-2, LAD1-3, LAD1-4, AC1, and 6 kinds of specific primers: RB-0a, RB-1a, RB-2a, LB-0a, LB-1a, LB-2a, and their sequences were shown in the table below.

    TABLE-US-00003 TABLE 3 Primers used in TAIL-PCR SEQ ID Primer Sequence NO: LAD1-1 ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA 15 LAD1-2 ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT 16 LAD1-3 ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA 17 LAD1-4 ACGATGGACTCCAGAGCGGCCGCBDNBNNNCGGT 18 AC1 ACGATGGACTCCAGAG 19 RB-0a CTGTTGCCGGTCTTGCGATGATTAT 20 RB-1a TTCTGTTGAATTACGTTAAGCATGT 21 RB-2a GGTTTTTATGATTAGAGTCCCGCAA 22 LB-0a CTGCCCGTCACCGAGATTTG 23 LB-1a TCCTATAGGGTTTCGCTCATGTGTT 24 LB-2a GTACTAAAATCCAGATCCCCCGAAT 25 Note: N = A/T/C/G, B = G/T/C, V = A/G/C, D = A/G

    [0176] The PCR product was ligated into B vector (Beijing Quanshijin Biotechnology Co., Ltd. CB101-01), and the ligation product was transformed into E. coli competent cells. Single clones were selected for PCR identification, and the amplified product was sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the T-border sequence and the corn genome, and the integration of exogenous fragments was analyzed.

    [0177] It was determined that the integration of exogenous DNA resulted in the deletion of part of the sequence in the recipient genome, the deleted sequence was Chr3: 179141695 bp-179141723 bp (B73 reference genome V4 version), with a total of 29 bp. The deletion region was the endogenous corn gene Zm00001d042767, the function of which was predicted to be Glucan endo-13-beta-glucosidase 14. The insertion of the target fragment and the deletion of the sequence of Chr3: 179141695bp-179141723bp would inactivate the function of the gene. Corn has two copies of this gene, and the gene identifier of the other homologous gene is Zm00001d012292. The 2A-7 transformant was inserted between Chr3:179141694bp and 179141724bp (B73 reference genome V4 version), and the sequence of T-border which was integrated into the genome was as shown in the nucleotides 483-8524 of SEQ ID NO: 5, the composition of SEQ ID NO: 5 was shown in the following table. In the 2A-7 genome, the exogenous sequence was flanked by a 5′-flanking region and a 3′-flanking region, the 5′-flanking region had the sequence of nucleotide positions 1-432 of SEQ ID NO: 5, and the 3′-flanking region had the sequence of nucleotide positions 8532-9031 of SEQ ID NO: 5. The 5′ junction sequence covering part of the 5′-flanking region and part of the non-genomic sequence is shown in SEQ ID NO: 1 (corresponding to positions 423-442 of SEQ ID NO: 5), the 3′ junction sequence covering part of the non-genomic sequence and part of the 3′-flanking region is shown in SEQ ID NO: 2 (corresponding to positions 8522-8541 of SEQ ID NO: 5).

    TABLE-US-00004 TABLE 4 Sequence information of corn transformant 2A-7 integrated into the genome Positions (bp) SEQ Length, in NO ID: 5 Description of sequence bp  1-432 5′-flanking region genome sequence: 1-160 bp 432 referring to the specific genome sequence for recipient corn, 161-432 bp corresponding to corn genome Chr3: 179141995-179141724 bp sequence (B73 genome V4 version) 433-482 Unexpected integration fragment 50 563-737 35S poly A terminator for bar gene 175  744-1295 frame coding for bar gene 552 1340-2016 CAMV 35S promoter (enhanced) for bar gene 677 2337-2590 nos poly A terminator for mCry1Ab gene 254 2598-4472 frame coding for mCry1Ab gene 1875 4473-5055 Gly promoter for mCry1Ab gene 583 5458-5803 promoter for mcry2Ab gene 346 5804-6386 adh1 enhancer 583 6393-8294 expression element for mCry2Ab gene 1902 8317-8524 part sequence of nos polyA terminator for 208 mCry2Ab gene 8525-8531 unexpected integration fragment 7 8532-9031 3′-flanking region genome sequence: corn 500 genome Chr3 179141694-179141195 sequence (B73 genome V4 version) Note: (1) Unexpected integration sequence was neither genomic sequence nor T-border sequence, and could be a sequence generated by genome repair when the insert was integrated; (2) the positions not mentioned in the table are the intergenic sequence of T-border region.

    Preparation of 2A-7 Seed

    [0178] Through genetic transformation of 3301+mCry1Ab+mCry2Ab vector, TO generation plants of 2A-7 were obtained. After 2 consecutive generations of selfing, homozygous 2A-7 seeds were obtained, which were deposited in China Common Microbial Culture Collection Center (CGMCC), with the deposit number of CGMCC NO. 17848, and the deposit date of Oct. 28, 2019.

    Example 2. Identification of Corn Event 2A-7

    1. Materials and Methods

    1.1 Extraction of Corn Genomic DNA

    [0179] (1) CTAB solution was taken and subjected to 65° C. water bath in advance; [0180] (2) about 0.1 g of fresh corn leaves was cut into pieces, placed in a pre-cooled mortar, and then quickly ground into powder in liquid nitrogen, and immediately transferred to a pre-cooled 2 mL EP tube (generally no more than ½ tube volume); [0181] (3) 0.8 mL of CTAB buffer incubated at 65° C. was quickly added into the EP tube, gently shaken well, and subjected to water bath at 65° C. for 30 minutes with occasional shaking; [0182] (4) it was placed in a fume hood for about 15 minutes and cooled to room temperature; [0183] (5) an equal volume of mixture of chloroform and isoamyl alcohol (24:1) was added, mixed well, and shaken slightly for 15 min; [0184] (6) centrifugation was performed at 12000 rpm for 8 min at room temperature; [0185] (7) the supernatant was pipetted and transferred to a new 1.5 mL EP tube; [0186] (8) an equal volume of pre-cooled isopropanol (pre-cooled at 4° C.) was added; [0187] (9) centrifugation at 12000 rpm for 8 minutes was performed at room temperature; [0188] (10) the supernatant was discarded, added with 1 mL of 75% ethanol, mixed well, and the supernatant was discarded (i.e., ethanol precipitation); [0189] (11) it was placed in a fume hood until the ethanol was completely volatilized (1-2 h); [0190] (12) the DNA was dissolved with 300 μL of TE Buffer, and stored overnight at 4° C. for later use.

    1.2. PCR Method Specific for Transformation Event

    [0191] The 5′- and 3′-flanking sequences of event 2A-7 were shown as the sequence of nucleotide positions 1-432 and nucleotide positions 8532-9031 of SEQ ID NO: 5, respectively. Forward and reverse primers (Table 5-6) were designed for the 5′-end and 3′-end insertion site sequences of corn transformant 2A-7, to perform PCR reaction. The reaction conditions and reaction system were shown in Table 7-8 below.

    TABLE-US-00005 TABLE 5 5′-End primer information Primer Primer Ampli- Primer sequence position length con (5′ - 3′) (bp) (bp) (bp) Forward CGATCGATGAACGTGAACA 281-301 21 258 primer AG (SEQ ID NO: 6) 2A-7 5F Reverse CAGTACATTAAAAACGTCC 515-538 24 primer GCAAT (SEQ ID NO: 7) 2A-7 5R

    TABLE-US-00006 TABLE 6 3′-End primer information Primer Primer Ampli- Primer sequence position length con (5′ - 3′) (bp) (bp) (bp) Forward GTTTTTATGATTAGAGTCC 8458-8482 25 310 primer CGCAAT (SEQ ID NO: 2A-7 3F 8) Reverse CAGGATGGGCTTCATGTAC 8746-8767 22 primer TCC (SEQ ID NO: 9) 2A-7 3R

    TABLE-US-00007 TABLE 7 PCR reaction conditions Stage Temperature Time Cycle Pre-denaturation 95° C. 5 min — Denaturation 95° C. 45 s 35 Annealing 58° C. 45 s Extension 72° C. 30 s Extension 72° C. 10 min — Preservation 10° C. — —

    TABLE-US-00008 TABLE 8 PCR reaction conditions Final Volume of each Components of reaction system concentration reaction (μL) 1. Nuclease-free water 12.6 2. Reaction buffer 1× 2 3. dNTP′s 0.25 mM 2 4. Forward primer 0.25 μmol/L 0.5 5. Reverse primer 0.25 μmol/L 0.5 6. DNA polymerase (5 U/μL) 0.1 U/μL 0.4 DNA sample (50 ng, 25 ng/μL) 2.5 ng/μL 2 Total volume 20

    [0192] The endogenous corn gene zSSIIb (Zm00001d052263) was used as the internal reference gene, its forward primer zSSIIb-F was shown in SEQ ID NO: 10, and its reverse primer zSSIIb-R was shown in SEQ ID NO: 11.

    [0193] Electrophoresis of agarose gel (3%) stained with ethidium bromide was used to detect PCR amplification product. Appropriate molecular weight standards were added during electrophoresis to determine the size of the amplification product, and a gel imaging system was used to make the PCR amplification product visible.

    2. Verification Results of the Method

    [0194] About 1000 ng of genomic DNA extracted from the following samples was used as a template for the PCR amplification of the corn transformant 2A-7 specific system for 5′-end and 3′-end and the internal standard system to determine the specificity of the method: 4 different corn single plants containing transformant 2A-7, corn transformant 2A-5, industrial transgenic corn, industrial transgenic soybean, industrial transgenic cotton, and industrial transgenic rice, wherein: [0195] 1) industrial transgenic corns (Bt-11, Bt-176, MON863, MON810, GA21, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, MON87460, mixed as one sample, each with a content of 1%) [0196] 2) industrial transgenic soybeans (MON87769, 356043, 305423, CV127, MON89788, A5547-127, A2704-12, mixed as one sample, each with a content of 1%) [0197] 3) industrial transgenic rapes (MS1, MS8, RF1, RF2, RF3, T45, Oxy235, Topas19/2, mixed as one sample, each with a content of 1%) [0198] 4) industrial transgenic cottons (MON1445, MON531, MON15985, LLCOTTON25, MON88913, mixed as one sample, each with a content of 1%) [0199] 5) industrial transgenic rices (KF-6, KMD-1, M12, KF-2, KF-8, mixed as one sample, each with a content of 1%).

    [0200] The test results of the internal reference gene were shown in FIG. 2. The results showed that all corn samples showed expected amplification products, and all non-corn samples did not show any amplification product.

    [0201] The detection results of amplification using the 5′-end primer pairs shown in Table 5 were shown in FIG. 3. The results showed that for all samples containing transformant 2A-7, a clear single band with expected size was observed without non-specific amplification; for all other corn and non-corn samples, no expected amplification product was observed.

    [0202] The detection results of amplification using the 3′-end primer pairs shown in Table 6 were shown in FIG. 4. The results showed that for all samples containing transformant 2A-7, a clear single band with expected size was observed without non-specific amplification; for all other corn and non-corn samples, no expected amplification product was observed.

    [0203] Because the two primers of specific PCR bound to specific regions of T-DNA and recipient genome respectively, the PCR amplification could be completed only when the two binding regions were adjacent. In the transgenic process, the integration of T-DNA was random, so that except for 2A-7 transformant, the binding regions of other transformants were almost impossible to be adjacent, and even if they were adjacent, the product would not match the expected size. Therefore, the above 5′-end primer pairs and 3′-end primers could be used to detect corn transformant 2A-7.

    [0204] In addition, in view of the uniqueness of the 5′ junction sequence and the 3′ junction sequence, a DNA probe that specifically hybridized therewith could also be used to detect the presence of the 5′-junction sequence or 3′ junction sequence so as to identify 2A-7 corn event.

    Example 3. Identification of Insect Resistance of Corn Event 2A-7 in Field

    1. Experimental Basis

    [0205] The reference basis for this experiment is: “Announcement No. 953 of the Ministry of Agriculture-10.1-2007”.

    2. Experimental Materials

    2.1 Test Corns

    [0206] (1) T5 generation of transgenic insect-resistant corn 2A-7: its selection process comprises infecting the immature embryo of F1 generation of the cross of HiIIA and HilIB by using Agrobacterium containing a target vector; after obtaining a TO generation of transgenic plant, performing crossing and backcrossing by using Zheng as recurrent parent; after obtaining a T3 generation, performing continuous selfing for 2 generations to obtain homozygous 2A-7 with Zheng 58 background; [0207] (2) Zheng 58 as recipient control; and [0208] (3) Zhengdan 958, a conventional corn variety for local production and application.

    [0209] The quality of the above-mentioned materials met the requirements of GB4404.1 not lower than the second grade corn seed.

    2.2 Test Insects

    [0210] Mythimna separata: newly hatched larvae of Mythimna separata (hatch time 12-24 h) were the population of Mythimna separata fed with artificial diet or corn seedlings indoors;

    [0211] Ostrinia furnacalis: newly hatched larvae of Ostrinia furnacalis (hatch time 2-12 h) were the population of Ostrinia furnacalis artificially bred indoors;

    [0212] Helicoverpa armigera: newly hatched larvae of Helicoverpa armigera (hatch time 12-24 h) were the population of Helicoverpa armigera artificially bred indoors;

    [0213] Spodoptera frugiperda: newly hatched larvae of Spodoptera frugiperda (hatch time 12-24 h) were the population of Spodoptercl frugiperda artificially bred indoors.

    3. Isolation Measures

    [0214] The isolation of the test plot was carried out in the following way: flowering period should differ by more than 25 days within 300 meters.

    4. Experimental Method

    [0215] Identification of resistance by artificial inoculation with insects: in accordance with the standards of “Announcement No. 953 of the Ministry of Agriculture-10.1-2007”.

    [0216] The field trial design adopted a randomized block design, with 3 replications. The area of each plot was 30 m.sup.2 (5 m×6 m), the row spacing was 60 cm, the plant spacing was 25 cm. The soil fertility level and tillage management were the same as those in the field production, and no insecticide was sprayed during the whole growth period. There was an interval of 2 m between test plots inoculated with different pests to avoid the spread of pests between different plots. Before and after the inoculation with insects, the field should maintain a certain humidity, and in case of drought, watering should be performed in time.

    4.1 Mythimna separata

    [0217] Inoculation with insect: The identification of resistance against Mythimna separata was carried out at the leaf stage. When the corn plants developed to the 4-leaf to 6-leaf stage, at least 40 plants were artificially inoculated with insects in each plot. 30-40 newly hatched larvae which were artificially bred were inoculated in corn leaf for each plant. Three days after inoculation, the second inoculation was carried out, the amount of insects and method of inoculation were the same as those in the first inoculation. The inoculation was carried out in the evening.

    [0218] Investigation record: 14 days after inoculation, the damage of Mythimna separata to corn leaves and the number of surviving larvae were surveyed.

    [0219] Expression of results: According to the damage level of Mythimna separata to corn leaves, the average value of damage level (leaf-chewing level) of Mythimna separata to corn leaves in each plot was calculated, and its judgment criteria were shown in Table 9. And then the resistance level of transgenic insect-resistant corn to Mythimna separata was determined according to the standards set forth in Table 10.

    TABLE-US-00009 TABLE 9 Grading standards for damage level of Mythimna separata to corn leaves Leaf- chewing level Description of symptoms 1 No leaf was damaged, or only leaves had pinprick holes (≤1 mm) 2 Only few leaves had a few holes in size of bullet hole (≤5 mm) 3 A few leaves had holes in size of bullet hole (≤5 mm) 4 Only few leaves had notches (≤10 mm) 5 A few leaves had notches (≤10 mm) 6 Several leaves had notches (≤10 mm) 7 Only few leaves were partially-eaten, and a few leaves had large notches (≤10 mm) 8 A few leaves were eaten, and several leaves had large notches (≤10 mm) 9 Most leaves were eaten

    TABLE-US-00010 TABLE 10 Evaluation criteria of corn resistance to Mythimna separata Average value of leaf- chewing level at leaf stage Resistance grade 1.0~2.0 Highly resistant, HR 2.1~4.0 Resistant, R 4.1~6.0 Moderately resistant, MR 6.1~8.0 Sensitive, S 8.1~9.0 Highly sensitive, HS

    4.2 Ostrinia furnacalis

    [0220] Inoculation with insect: The identification of resistance to the target pest Ostrinia furnacalis was performed in the leaf stage generation and the silking stage generation, in which the artificial inoculation was performed at the leaf stage (small bell-mouth stage, in which corn plant developed to the 8-leaf to 10-leaf stages) and the silking stage respectively. The inoculation was performed twice in each stage. At least 40 plants were artificially inoculated with insects at each plot in each stage, and 60 to 80 newly hatched larvae of Ostrinia furnacalis were inoculated for each plant. The insect inoculation was carried out in the evening, and if the weather was worse than moderate rain after insect inoculation, the insect inoculation was carried out again once.

    [0221] Survey records at the leaf stage: Two to three weeks after the insect inoculation at the leaf stage, the status of middle and upper leaves eaten by Ostrinia furnacalis was surveyed plant-by-plant. For each material for identification, 15 to 20 plants/row were randomly selected, and the leaf-chewing level of Ostrinia furnacalis was recorded plant-by-plant according to the description in Table 11 (the leaf-chewing level was determined according to the diameter and number of holes on leaves that were formed after the leaves were eaten by Ostrinia furnacalis larvae).

    TABLE-US-00011 TABLE 11 Grading standards for damage level of Ostrinia furnacalis to leaves Leaf- chewing level Description of symptoms 1 Only few leaves had 1~2 holes with a diameter of ≤1 mm 2 Only few leaves had 3~6 holes with a diameter of ≤1 mm 3 A few leaves had more than 7 holes with a diameter of ≤1 mm 4 Few leaves had 1~2 holes with a diameter of ≤2 mm 5 A few leaves had 3~6 holes with a diameter of ≤2 mm 6 Several leaves had more than 7 holes with a diameter of ≤2 mm 7 A few leaves had 1~2 holes with a diameter of >2 mm 8 Several leaves had 3~6 holes with a diameter of >2 mm 9 Most leaves had more than 7 holes with a diameter of >2 mm

    [0222] The average value of damage level of Ostrinia furnacalis to the leaves of the population in the material for identification (leaf-chewing level) was calculated by the following calculation method:


    Average leaf-chewing level=Σ(leaf-chewing level×number of plants at this level)/total number of surveyed plants

    [0223] Expression of results of the leaf stage: According to the average value of leaf-chewing level, the damage level of each material for identification was given and shown in Table 12.

    TABLE-US-00012 TABLE 12 Evaluation criteria of resistance of corn to Ostrinia furnacalis Average leaf- chewing Damage level level at leaf stage Resistance 1 1.0~2.9 Highly resistant, HR 3 3.0~4.9 Resistant, R 5 5.0~6.9 Moderately resistant, MR 7 7.0~8.9 Sensitive, S 9 9.0 Highly sensitive, HS

    [0224] Survey records at the silking stage: The damage of corn ears, the number of holes, the length of the tunnel bored by the insect (cm), and the instar and number of surviving larvae were surveyed to evaluate the damage degree of ears and the damage of plants.

    [0225] Expression of results of the silking stage: The evaluation of insect resistance of corn at the silking stage was performed according to the ear damage, the number of holes, the length of the tunnel bored by the insect (cm), the instar and number of surviving larvae; the average value of damage level of Ostrinia furnacalis to ears at the silking stage in each plot was calculated, in which the judgment standards were shown in Table 13, and the resistance level of corn at the silking stage to Ostrinia furnacalis was determined according to the standards set forth in Table 14.

    TABLE-US-00013 TABLE 13 Grading standards for damage level of Ostrinia furnacalis at the silking stage of corn Damage level of ears Description of symptoms 1 Ears were not damaged 2 Less than 50% of the silk was damaged 3 Most plants had more than 50% of the silk damaged; there were larvae that survived, instar ≤2 4 Damaged ear tip was ≤1 cm, there were larvae that survived, instar ≤3 5 Damaged ear tip was ≤2 cm; or there were larvae that survived, instar ≤4; tunnel length ≤2 cm 6 Damaged ear tip was ≤3 cm; or there were larvae that survived, instar ≥4; tunnel length ≤4 cm 7 Damaged ear tip was ≤4 cm, tunnel length ≤6 cm 8 Damaged ear tip was ≤5 cm, tunnel length ≤8 cm 9 Damaged ear tip was >5 cm, tunnel length >8 cm

    TABLE-US-00014 TABLE 14 Evaluation criteria for resistance of corn ears to Ostrinia furnacalis Average damage level of ears Resistance grade 1.0~2.0 Highly resistant, HR 2.1~3.0 Resistant, R 3.1~5.0 Moderately resistant, MR 5.1~7.0 Sensitive, S ≥7.1 Highly sensitive, HS

    4.3 Helicoverpa armigera

    [0226] Inoculation with insect: The identification of resistance to Helicoverpa armigera was carried out during the silking and pollen-shedding stage, and each plant was inoculated with 20 to 30 newly hatched larvae. No less than 40 plants were artificially inoculated in each plot, and the inoculation was performed on corn silk. Three days after the inoculation, the second insect inoculation was performed and the number of insects were the same as the first inoculation. The insect inoculation was carried out in the evening, and if the weather was worse than moderate rain after insect inoculation, the insect inoculation was carried out again once.

    [0227] Investigation of damage degree: The damage rate of ear, the number of surviving larvae per ear, and the damage length of ear were surveyed plant-by-plant on the 14.sup.th to 21.sup.st days after artificial inoculation.

    [0228] Expression of results: The evaluation of insect resistance at the silking stage of corn was carried out according to the damage rate of ear, the number of surviving larvae, and the ear damage length (cm) of ear, and the average value of damage level of Helicoverpa armigera to ears at the silking stage of corn in each plot was calculated, in which the judgment criteria were shown in Table 15, and the resistance grade of corn to Helicoverpa armigera at the silking stage was determined according to the standards set forth in Table 16.

    TABLE-US-00015 TABLE 15 Grading standards for damage level of Helicoverpa armigera at the silking stage of corn Damage level of ears Description of symptoms 0 No ear was damaged 1 Only silk was damaged 2 Damaged ear tip was 1cm  3+ For every increase of 1cm in the length of damage under the ear tip, the corresponding damage level increases by 1 level . . . N

    TABLE-US-00016 TABLE 16 Evaluation criteria for resistance of corn ears to Helicoverpa armigera Average value of damage level of ears Resistance grade   0~1.0 Highly resistant, HR 1.1~3.0 Resistant, R 3.1~5.0 Moderately resistant, MR 5.1~7.0 Sensitive, S ≥7.1 Highly sensitive, HS

    4.4 Spodoptera frugiperda

    [0229] Inoculation with insect: The identification of resistance to the target pest Spodoptera frugiperda was performed in the leaf stage generation and the silking stage generation, in which the artificial inoculation was carried out at the leaf stage (small bell-mouth stage, the corn plant developed to 8-leaf to 10-leaf stages) and the silking stage respectively. The inoculation was carried out twice in each stage, no less than 40 plants was inoculated in each plot in each stage, and 20 to 30 newly hatched larvae of Spodoptera frugiperda were inoculated for each plant. The insect inoculation was carried out in the evening, and if the weather was worse than moderate rain after insect inoculation, the insect inoculation was carried out again once.

    [0230] Survey records: 14 days after the insect inoculation, the damage level of Spodoptera frugiperda to corn leaves was surveyed.

    [0231] Expression of results: According to the damage level of Spodoptera frugiperda to corn leaves, the average value of damage level (leaf-chewing level) of Spodoptera frugiperda to corn leaves in each plot was calculated, in which the judgment criteria were shown in the following table, and then the resistance grade of transgenic insect-resistant corn to Spodoptera frugiperda was determined according to the standards set forth in Table 17 and Table 18.

    TABLE-US-00017 TABLE 17 Grading standards for damage level of Spodoptera frugiperda to corn leaves Leaf-chewing level Description of symptoms 1 No leaf was damaged, or only leaves had pinprick wormholes (≤1 mm) 2 Only few leaves had a few worm holes in size of bullet hole (≤5 mm) 3 A few leaves had worm holes in size of bullet hole (≤5 mm) 4 Only few leaves had notches (≤10 mm) 5 A few leaves had notches (≤10 mm) 6 Several leaves had notches (≤10 mm) 7 Only few leaves were partially-eaten, and a few leaves had large notches (≤10 mm) 8 A few leaves were eaten, and several leaves had large notches (≤10 mm) 9 Most leaves were eaten

    TABLE-US-00018 TABLE 18 Evaluation criteria for resistance of corn to Spodoptera frugiperda Average value of leaf-chewing level at the leaf stage Resistance grade 1.0~2.0 Highly resistant, HR 2.1~4.0 Resistant, R 4.1~6.0 Moderately resistant, MR 6.1~8.0 Sensitive, S 8.1~9.0 Highly sensitive, HS

    [0232] Survey records at the silking stage: the ear damage, the number of holes, the length of the tunnel bored by the insect (cm), and the instar and number of surviving larvae were surveyed to evaluate the damage degree of ears and the damage of plants.

    [0233] Expression of results of the silking stage: The evaluation of insect resistance of corn at the silking stage was performed according to the ear damage, the number of holes, the length of the tunnel bored by the insect (cm), and the instar and number of surviving larvae; the average value of damage level of Spodoptera frugiperda to ears at the silking stage in each plot was calculated, in which the judgment standards were shown in Table 19, and the resistance level of corn at the ear stage to Spodoptera frugiperda was determined according to the standards set forth in Table 20.

    TABLE-US-00019 TABLE 19 Grading standards for damage level of Spodoptera frugiperda at the silking stage of corn Damage level of ears Description of symptoms 1 Ears were not damaged 2 Less than 50% of the silk was damaged 3 Most plants had more than 50% of the silk damaged; there were larvae that survived, instar ≤2 4 Damaged ear tip was ≤1 cm, there were larvae that survived, instar ≤3 5 Damaged ear tip was ≤2 cm; or there were larvae that survived, instar ≤4; tunnel length ≤2 cm 6 Damaged ear tip was ≤3 cm; or there were larvae that survived, instar ≥4; tunnel length ≤4 cm 7 Damaged ear tip was ≤4 cm, tunnel length ≤6 cm 8 Damaged ear tip was ≤5 cm, tunnel length ≤8 cm 9 Damaged ear tip was >5 cm, tunnel length >8 cm

    TABLE-US-00020 TABLE 20 Evaluation criteria for resistance of corn ears to Spodoptera frugiperda Average damage level of ears Resistance grade 1.0~2.0 Highly resistant, HR 2.1~3.0 Resistant, R 3.1~5.0 Moderately resistant, MR 5.1~7.0 Sensitive, S ≥7.1 Highly sensitive, HS

    5. Result Analysis

    5.1 Analysis of Identification Results of Resistance to Mythimna separata

    [0234] The identification results of insect inoculation were surveyed 2 to 3 weeks after inoculation. The results were shown in FIG. 5 and Table 21. The analysis of leaf damage rate, the size of hole or notch and other parameters showed that, the leaf damage rate and the size of hole or notch of the transgenic corn 2A-7 were all significantly lower than those of the corresponding non-transgenic corn variety and the local common cultivated corn variety, with a significance level of 5%, and the difference reached a significant level. The experimental results showed that the transgenic corn 2A-7 had a better control effect on the target pest Mythimna separata.

    TABLE-US-00021 TABLE 21 Survey results of damage level of Mythimna separata to leaves Corn variety Average leaf-chewing level 2A-7 1.32a Zheng 58 8.03b Zhengdan 958 8.52b

    5.2 Analysis of Identification Results of Resistance to Ostrinia furnacalis

    5.2.1 Survey of Damage Level of Leaves

    [0235] For the insect inoculation at the leaf stage (V6-V8), the leaf-chewing level was surveyed plant-by-plant 14 days after the inoculation. The survey results of leaf damage level showed that the transgenic corn 2A-7 had a good control effect on the target pest Ostrinia furnacalis; the leaf damage level of 2A-7 was significantly lower than that of the corresponding non-transgenic corn variety and the local common cultivated corn variety with a significance level of 5%, and the difference reached a significant level (Table 22). The results showed that the resistance of transgenic corn 2A-7 to Ostrinia furnacalis was better than the corresponding non-transgenic corn variety and the local common cultivated corn variety.

    TABLE-US-00022 TABLE 22 Survey results of damage level of Ostrinia furnacalis to leaves at the leaf stage Damage level at the leaf stage Variety I II III 5% significant level 2A-7 1 1 1 1.0 ± 0.00 a Zheng 58 8.5 8.6 8.4 8.5 ± 0.08 b Zhengdan 958 7.9 8.3 8.1 8.1 ± 0.16 b

    5.2.2 Survey of Damage Level of Ears

    [0236] For the insect inoculation at the silking stage, the identification results of inoculation were surveyed before harvest. The results were shown in FIGS. 6A to 6B and Tables 23-24. The analysis of five parameters including ear damage rate, number of holes per plant, tunnel length per plant, number of surviving insects per plant, and instar of surviving larvae showed that: the ear damage rate, the number of holes per plant, the tunnel length per plant, the number of surviving insects per plant and the instar of surviving larvae of the transgenic corn 2A-7 were all significantly lower than those of the corresponding non-transgenic corn variety and the local common cultivated corn variety with 5% significant level, and the difference reached a significant level. The experimental results showed that the transgenic corn 2A-7 had a better control effect on the target pest Ostrinia furnacalis.

    TABLE-US-00023 TABLE 23 Effects of resistance to Ostrinia furnacalis at silking stage Total number of Length of Number Length of Number of surviving larvae in each instar/heads surviving damaged Variety of holes tunnel/cm 1 instar 2 instar 3 instar 4 instar 5 instar larvae/heads ear tip/cm 2A-7   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00 Zheng 58 3.20 ± 0.62 6.36 ± 1.31 0.00 ± 0.00 0.00 ± 0.00 0.42 ± 0.10 1.54 ± 0.31 1.79 ± 0.42 2.38 ± 0.36 4.72 ± 0.91 Zhengdan 2.92 ± 0.50 6.98 ± 1.20 0.00 ± 0.00 0.00 ± 0.00 0.48 ± 0.09 1.80 ± 0.23 2.93 ± 0.51 2.46 ± 0.40 4.90 ± 0.86 958

    TABLE-US-00024 TABLE 24 Survey results of damage level of Ostrinia furnacalis to ears Damage level of ears 5% significant Variety I II III level Resistance grade 2A-7 1 1 1 1.00 ± 0.00 Highly resistant Zheng 58 7.7 7.7 7.3 7.57 ± 0.19 Highly sensitive Zhengdan 958 7.2 7.1 7.9 7.40 ± 0.36 Highly sensitive

    [0237] From the above results, it could be seen that the average ear damage levels of the 2A-7, the control and the main cultivated variety Zhengdan 958 were 1.00, 7.57 and 7.40, respectively. Based on the above data, there were significant differences in the resistance effects of the insect-resistant corn 2A-7 and the two control corns to Ostrinia furnacalis, showing a high level of resistance.

    5.2.3 Survey of Damage Level of Ear Shank

    [0238] As the only channel for nutrient transportation in grain fill stage of corn, the ear shank played an important role in the development of kernel. Meanwhile, the ear shank supported the ear during the harvest stage and provided an important guarantee for mechanized harvesting. To this end, we surveyed the parameters including ear shank damage rate, number of surviving larvae on ear shank, length of damaged ear shank (cm). The analysis showed that, the ear shank damage rate, the number of surviving larvae on ear shank and the length of damaged ear shank (cm) of the transgenic corn 2A-7 were all significantly lower than those of the corresponding non-transgenic corn variety and the local common cultivated corn variety with a significant level of 5%, and the difference reached a significant level (Table 25). The experimental results showed that the transgenic corn 2A-7 had a better control effect on the target pest Ostrinia furnacalis.

    TABLE-US-00025 TABLE 25 Insect resistance effect of ear shank on Ostrinia furnacalis Ear shank Number of Length of damage surviving damaged ear Variety rate, % larvae (heads) shank/cm 2A-7  0 ± 0.00   0 ± 0.00   0 ± 0.00 Zheng 58 61 ± 5.8 2.01 ± 0.15 4.21 ± 0.32 Zhengdan 958 59 ± 6.2 2.23 ± 0.21 2.57 ± 0.42

    5.3 Analysis of Identification Results of Resistance to Helicoverpa armigera

    [0239] For the insect inoculation in the silking stage, the identification results of insect inoculation were surveyed 2-3 weeks after the insect inoculation. The results were shown in FIG. 7 and Table 26. Analysis of the parameters including ear damage rate, number of surviving larvae, and length of damaged ear (cm) showed that, the ear damage rate, the number of surviving larvae and the length of damaged ear (cm) of the transgenic corn 2A-7 were all significantly lower than those of the corresponding non-transgenic corn variety and the local common cultivated corn variety with a significant level of 5%, and the difference reached a significant level. The experimental results showed that the transgenic corn 2A-7 had a better control effect on the target pest Helicoverpa armigera.

    TABLE-US-00026 TABLE 26 Effects of resistance to Helicoverpa armigera at silking stage Ear Number of Length of damage surviving damaged Variety rate, % larvae (heads) ear/cm 2A-7  0 ± 0.00   0 ± 0.00   0 ± 0.00 Zheng 58 86 ± 6.5 1.31 ± 0.31 6.42 ± 0.98 Zhengdan 958 82 ± 7.2 1.36 ± 0.42 7.06 ± 0.89

    [0240] The above results fully indicated that 2A-7 had significant resistance to the attack of lepidopteran pests including Ostrinia furnacalis, Mythimna separata, Helicoverpa armigera and the like.

    5.4 Identification Results of Resistance to Spodoptera frugiperda

    5.4.1 Survey of Damage Level of Leaves

    [0241] The insect inoculation was performed at the leaf stage (small bell-mouth stage, corn plants developed to 8-leaf to 10-leaf stages), the inoculation identification results were surveyed 2-3 weeks after the inoculation. The results were shown in Table 27. The analysis of parameters including leaf damage rate, and size of hole or notch showed that, the leaf damage rate and the size of hole or notch of the transformant 2A-7 were all significantly lower than those of the corresponding non-transgenic corn control varieties with 5% significant level, and the difference reached a significant level. The experimental results showed that leaves of the transformant had a good control effect on the target pest Spodoptera frugiperda, reaching a high level of resistance.

    TABLE-US-00027 TABLE 27 Survey results of damage level of Spodoptera frugiperda to leaves at leaf stage Damage level at leaf stage 5% significant Variety I II III level 2A-7 1 1 1 1.0 ± 0.00 a Zheng 58 8.3 8.4 8.8 8.5 ± 0.26 b Zhengdan 958 8.4 8.5 8.2 8.4 ± 0.15 b

    5.4.2 Survey of Ear Damage Level

    [0242] For the insect inoculation at the silking stage, the identification results of inoculation were surveyed before harvest. The results were shown in Tables 28 to 29. The analysis of five parameters including ear damage rate, number of holes per plant, tunnel length per plant, number of surviving insects per plant, and instar of surviving larvae showed that, the ear damage rate, the number of holes per plant, the tunnel length per plant, the number of surviving insects per plant and the instar of surviving larvae of the transgenic corn 2A-7 were all significantly lower than those of the corresponding non-transgenic corn variety and the local common cultivated corn variety with a significant level of 5%, and the difference reached a significant level. The experimental results showed that the transgenic corn 2A-7 had a better control effect on the target pest Spodoptera frugiperda.

    TABLE-US-00028 TABLE 28 Effects of resistance to Spodoptera frugiperda at silking stage Total number of Length of Number Length of Number of surviving larvae in each instar/heads surviving damaged Variety of holes tunnel/cm 1 instar 2 instar 3 instar 4 instar 5 instar larvae/heads ear tip/cm 2A-7   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00   0 ± 0.00 Zheng 58 1.25 ± 0.31 8.22 ± 2.21 0.00 ± 0.00 0.00 ± 0.00 0.18 ± 0.04 0.34 ± 0.11 0.42 ± 0.12 0.94 ± 0.16 4.96 ± 1.12 Zhengdan 1.42 ± 0.28 8.48 ± 2.11 0.00 ± 0.00 0.00 ± 0.00 0.22 ± 0.09 0.29 ± 0.08 0.33 ± 0.07 0.84 ± 0.13 5.21 ± 1.27 958

    TABLE-US-00029 TABLE 29 Survey results of damage level of Spodoptera frugiperda to ears Damage level of ears 5% significant Variety I II III level Resistance grade 2A-7 1 1 1 1.00 ± 0.00 Highly resistant Zheng 58 7.8 7.9 7.5 7.73 ± 0.21 Highly sensitive Zhengdan 958 8.1 8.1 7.9 8.03 ± 0.12 Highly sensitive

    [0243] In addition, FIGS. 8-9 showed the results of indoor bioassays on the resistance of leaves or silks of 2A-7 to Spodoptera frugiperda. FIG. 10 showed the results of field bioassays on the resistance of 2A-7 to Spodoptera frugiperda.

    [0244] The above results indicated that the transgenic corn 2A-7 had good resistance to Spodoptera frugiperda.

    Example 4. Identification of Glufosinate-Ammonium Resistance of Corn Event 2A-7

    1. Experimental Scheme

    1.1 Experimental Materials

    [0245] Basta (18% glufosinate-ammonium soluble solution), produced by Bayer. [0246] 2A-7: T5 generation of the transformant, same as Example 3.

    1.2 Experimental Design

    [0247] (1) Experimental Design

    [0248] Randomized block design, with 3 to 4 repetitions, was used. An isolation zone with a width of 1.0 m was set between plots, the plot area was not less than 24 m.sup.2. And the treatment comprised: no herbicide sprayed on transgenic corn; target herbicide sprayed on transgenic corn; no herbicide sprayed on the corresponding non-transgenic corn; target herbicide sprayed on the corresponding non-transgenic corn. [0249] (2) Application Dose of Glufosinate-Ammonium

    [0250] The application doses of the herbicide used comprised: the medium dose in the pesticide registration label (600 g of active ingredient/ha), 2 times the medium dose (1200 g of active ingredient/ha), and 4 times the medium dose (2400 g of active ingredient/ha). The volume of the added water was 450 L/ha.

    1.3 Application Period

    [0251] The recommended time for glufosinate-tolerant corn was applied.

    [0252] The postemergence treatment with glufosinate-ammonium on stems and leaves was performed. In general, the resistance identification was performed at the 3-5 leaf stage of corn.

    1.4 Requirements for Spray Equipment

    [0253] (1) Selection of Sprayer

    [0254] A manual knapsack sprayer with constant pressure, wide range of spray and stable flow rate, or a CO.sub.2 compression sprayer, should be chosen. Spraying should be evenly. [0255] (2) Nozzle

    [0256] Fan-shaped nozzles were selected. [0257] (3) Spraying Method

    [0258] For each treatment, the spraying should be completed at one time. The dosage should be calculated according to the actual area of the sprayed plot. If it rained within 12 hours after the application, the experiment should be performed again.

    1.5 Survey of Resistance Identification

    [0259] The corn seedling rate, plant height, and phytotoxicity symptoms were surveyed and recorded at 1 week, 2 weeks and 4 weeks after the application. 15 corn plants were taken from each plot.

    [0260] After the corn was harvested, two rows of corn in the middle of each plot were taken to test the yield.

    1.6 Analysis and Expression of Results

    [0261] The damage rate for the herbicide was calculated by the following formula.

    [00001] X = Σ ( N × S ) T × M × 100 [0262] wherein: [0263] X: damage rate, with unit of percentage (%); [0264] N: number of damaged plants at same level; [0265] S: level number; [0266] T: total number of plants; [0267] M: the highest level.

    [0268] The grading of phytotoxicity symptoms was based on GB/T 17980.42-2000. [0269] Level 1: corn grew normally without any damage symptoms; [0270] Level 2: corn was slightly damaged, and the damage rate was less than 10%; [0271] Level 3: corn was moderately damaged, which could be recovered in the future without affecting the yield; [0272] Level 4: corn was relatively severely damaged, which could be difficult to recover, resulting in a reduced yield; [0273] Level 5: corn was severely damaged, which could not be recovered, resulting in a significantly reduced yield or no yield.

    2. Experimental Results

    2.1 Damage Rate

    [0274] The damage rate of the transformant was surveyed at 1 week, 2 weeks and 4 weeks after spraying, and the results were shown in the table below.

    TABLE-US-00030 TABLE 30 Damage rate for glufosinate-ammonium treatment Treatment 1 week (%) 2 weeks (%) 4 weeks (%) Zheng 58 Spraying the medium dose 100.00 ± 0.00  100.00 ± 0.00  100.00 ± 0.00  Zheng 58 No spraying 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 2A-7 No spraying 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 2A-7 Spraying the medium dose 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 2A-7 Spraying 2 times the medium dose 2.75 ± 0.42 0.75 ± 0.06 0.00 ± 0.00 2A-7 Spraying 4 times the medium dose 15.77 ± 1.55  11.65 ± 2.83  0.00 ± 0.00

    [0275] It could be seen from the above table that there was slightly damaged after spraying 2 times the medium dose of glufosinate-ammonium, and the damage rate was less than 10%. After spraying 4 times the medium dose of glufosinate-ammonium, the transgenic corn 2A-7 was moderately damaged, and the damage rate was greater than 10%.

    2.2 Survey of 2A-7 Plant Height

    [0276] The plant height of the transformant was surveyed at 1 week, 2 weeks and 4 weeks after spraying, and the results were shown in the table below.

    TABLE-US-00031 TABLE 31 Effect of glufosinate-ammonium treatment on plant height Treatment 1 week (cm) 2 weeks (cm) 4 weeks (cm) Zheng 58 Spraying the medium dose — — — Zheng 58 No spraying 55.50 ± 2.70a 90.39 ± 3.20b 171.40 ± 5.92c  2A-7 No spraying 56.69 ± 1.19a 89.27 ± 2.33b 170.5 ± 6.21c 2A-7 Spraying the medium dose 55.76 ± 1.91a 87.25 ± 2.34b 165.4 ± 3.95c 2A-7 Spraying 2 times the medium dose 52.46 ± 2.93a 81.17 ± 0.71b 162.3 ± 7.27c 2A-7 Spraying 4 times the medium dose 49.35 ± 0.49a 77.35 ± 2.53b 160.1 ± 4.14c

    [0277] It can be seen from the above table that the plant height of transgenic corn 2A-7 after spraying with different concentrations of glufosinate ammonium has a small decrease compared with the no spraying control, but there is no significant difference.

    2.3 Survey of 2A-7 Yield

    [0278] The yield and moisture content of kernels of single ear were surveyed at harvest, and the yield per mu (containing 14% moisture) was calculated, and the results were shown in the following table.

    TABLE-US-00032 TABLE 32 Effect of glufosinate-ammonium treatment on yield Equivalent to yield per mu Kernels of Moisture (containing 14% Treatment single ear (g) content (%) moisture) (kg) Zheng 58 Spraying the medium — — dose Zheng 58 No spraying 70.34 ± 3.87a 16.20 ± 0.32b 308.42 ± 16.9c 2A-7 No spraying 73.10 ± 4.50a 16.67 ± 1.25b 318.75 ± 19.6c 2A-7 Spraying the medium 72.24 ± 4.25a 16.29 ± 1.40b 316.42 ± 18.6c dose 2A-7 Spraying 2 times the 70.62 ± 4.31a 16.33 ± 0.93b 309.18 ± 18.9c medium dose 2A-7 Spraying 4 times the 68.56 ± 3.75a 16.15 ± 0.94b 300.79 ± 16.4c medium dose

    [0279] It could be seen from the above table that the yields of the transgenic corn 2A-7 after spraying with different concentrations of glufosinate-ammonium were lower than that of the control without spraying, but there was no significant difference.

    [0280] Based on the above results, the results of the phytotoxicity symptoms grading according to GB/T 17980.42-2000 were shown in the following table. The transgenic corn 2A-7 grew normally without any damage symptoms after spraying the medium dose of glufosinate-ammonium, and the resistance grade was level 1; after spraying 2 times the medium dose of glufosinate-ammonium, the corn was slightly damaged with a damage rate of less 10%, and the resistance grade was level 2; after spraying 4 times the medium dose of glufosinate-ammonium, the corn was moderately damaged, the plant height could be restored, the yield was lower than that of the treatment group with less dose of spraying, and the resistance grade was level 4. The above results indicated that the 2A-7 had excellent resistance to herbicides such as glufosinate-ammonium.

    TABLE-US-00033 TABLE 33 Grading of resistance to glufosinate-ammonium Resistance Resistance Resistance grade (T3 grade (T4 grade (T5 genera- genera- genera- Material Treatment tion) tion) tion) Zheng 58 Spraying the medium 5 5 5 dose Zheng 58 No spraying — — — 2A-7 No spraying — — — 2A-7 Spraying the medium 1 1 1 dose 2A-7 Spraying 2 times the 2 2 2 medium dose 2A-7 Spraying 4 times the 4 4 4 medium dose

    [0281] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that according to all the teachings that have been disclosed, various modifications and substitutions can be made to those details, and these changes are all within the protection scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.