ALLOGENEIC COMPOSITION FOR THE TREATMENT OF COVID-19

Abstract

The present disclosure relates to the use of allogeneic populations of mesenchymal stem/stromal cells and related compositions, which populations and compositions comprise cells pooled from multiple donors, in the treatment and/or prevention of COVID-19 infection or for use in the treatment and/or prevention of symptoms associated with COVID-19 infection. The present disclosure also relates to methods for obtaining said compositions.

Claims

1. A method for treatment and/or prevention of COVID-19 infection, or of symptoms associated with COVID-19 infection, comprising administering a therapeutically effective dose of isolated, pooled allogeneic MSC population comprises MSCs derived from at least 3 individual donors, wherein the number of cells derived from any one donor does not exceed 50% of the total cell number and wherein said MSCs have at most been subject to ten passages and wherein said isolated, pooled allogeneic MSC population is obtainable or is obtained by a method comprising the steps of: culturing or providing MSCs from more than said at least 3 individual donors to obtain more than at least 3 individual donor derived MSC populations; assaying each individual donor derived MSC population using at least 3 assays to obtain at least 3 assay results for said each individual donor derived MSC population; for each assay allocating an individual ranking score value to said each individual donor derived MSC population based on the assay result and thus obtaining at least 3 individual ranking score values for each individual donor derived MSC population, wherein a higher ranking score value is indicative of more desirable assay result; or wherein a lower ranking score value is indicative of more desirable assay result; allocating a total score value to each individual donor derived MSC population based on said at least 3 individual ranking score values, wherein in the case of a higher ranking score value being indicative of more desirable assay result, a higher total score value is indicative of more desirable population properties; or wherein in the case of a lower ranking score value being indicative of more desirable assay result, a lower total score value is indicative of more desirable population properties; selecting a subset of individual donor derived MSC populations with desirable population properties based on their total score values; and pooling said selected individual donor derived MSC populations to obtain an isolated, pooled allogeneic MSC population; wherein at least 2 of said at least 3 assays are selected from the group consisting of one assay measuring indoleamine-2,3-dioxygensase (IDO) activity; one assay measuring prostaglandin E2 secreted by said MSCs; and one assay measuring the effect of said MSCs on the proliferation of peripheral blood mononuclear cells (PBMCs); and wherein at least 1 of said at least 3 assays is selected from the group consisting of one assay measuring the effect of said MSCs on the capacity of T cells to suppress an immune response; one assay measuring the effect said MSCs on inducing tolerogenic dendritic cells, one assay measuring the effect of the said MSCs on monocytes; and one assay measuring the effect of the said MSCs on microglia cell and/or microglia-like cells: and wherein said isolated pooled allogeneic MSC population is not further cultured after the pooling step.

2. (canceled)

3. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, said method further comprising a step of exposing the isolated pooled allogeneic MSC population to the presence of proinflammatory factors.

4. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 3, wherein the exposure is for a period of up to about 1 hour before administration or for between about 1 to about 24 hours before administration.

5. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said MSCs are derived from a native MSC source.

6. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said MSCs are selected from the group consisting of umbilical cord derived MSCs and Wharton Jelly derived MSCs.

7. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said population comprises MSCs derived from at least four individual donors .

8. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said method comprises one assay measuring the effect of the said MSCs on microglia cells or microglia-like cells and said assay is selected from the group consisting of one assay measuring microglial proliferation; one assay measuring expression of markers characteristic of the M1 phenotype in microglia; one assay measuring expression of markers characteristic of the M2 phenotype in microglia; and an assay measuring the shift from the M1 microglia phenotype to the M2 microglia phenotype.

9. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1,wherein said pooled population exhibits enhanced immunosuppressive and/or immune-modulatory potential compared to individual donor derived MSC population .

10. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said immunosuppressive and/or immune-modulatory potential is measured as expression of IDO by unstimulated MSCs.

11. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 9, wherein said immunosuppressive and/or immune-modulatory potential is measured as expression of PGE2 by unstimulated MSCs.

12. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 9, wherein the enhancement of immunosuppressive and/or immune-modulatory potential is by at least approximately 5 % .

13. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said treatment and/or prevention of symptoms associated with COVID-19 infection is treatment and/or prevention of neurological symptoms associated with COVID-19 infection.

14. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said treatment and/or prevention of neurological symptoms associated with COVID-19 infection is treatment and/or prevention of inflammation and/or demyelination associated with COVID-19 infection.

15. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said treatment and/or prevention of symptoms associated with COVID-19 infection is treatment and/or prevention of symptoms associated with long COVID-19 infection .

16. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said use comprises exposing the isolated pooled allogeneic MSC population to the presence of proinflammatory factors prior to administration .

17. The method for treatment and/or prevention of COVID-19 infection or of symptoms associated with COVID-19 infection according to claim 1, wherein said use comprises administration by intravenous infusion or intravenous injection.

18. (canceled)

19. The method of claim 6, wherein the MSCs are Wharton Jelly derived MSCs.

20. The method of claim 7, wherein the population comprises MSCs derived from at least at least five individual donors, at least six individual donors, at least seven individual donors, at least eight individual donors, at nine individual donors, or at least ten individual donors.

21. The method of claim 9, wherein the individual donor derived MSC population comprises an individual donor derived MSC population assayed or an individual donor derived MSC population selected for pooling.

22. The method of claim 12, wherein the enhancement of immunosuppressive and/or immune-modulatory potential is by at least approximately 10 %, or at least by approximately 15 %, as compared to individual donor derived MSC populations.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0187] FIG. 1 is a flowchart illustrating the manufacturing process of isolated, pooled allogeneic MSC population according to the present disclosure.

[0188] FIG. 2 shows the results from FACS analysis of an apoptotic marker 7AAD in (A) undiluted drug substance and in (B) diluted drug substance as described in Example 6. Data from 3 separate experiments presented as absolute viability, error bars represent standard deviation.

[0189] FIG. 3A, shows overlay of CD200R expression at HMC3 which is treated with IFN.sub.Y for 48 hour and FIG. 3B, shows overlay of CD200R expression on HMC3 which is treated with IFN.sub.Y and MSC for 48 hours. In both overlay plots, the light grey histogram is from unstained cells and the dark grey histogram is from cell stained with anti-human CD200R.

[0190] FIG. 4, panel A, shows overlay of CD183 expression at HMC3 which is treated with IFN.sub.Y for 48 hours but panel B, shows overlay of CD183 expression on HMC3 which is treated with IFN.sub.Y and MSC for 48 hours. In both overlay plots, the light grey histogram is from unstained cells and the dark grey histogram is from cell stained with anti-human CD183.

[0191] FIG. 5, box and whiskers plots demonstrating no significant batch to batch variation with pooling of the WJ-MSC product in terms of relative suppression of PBMC proliferation, prostaglandin E2 secretion and IDO activity.

[0192] FIG. 6 shows bar graphs showing that the isolated, pooled allogeneic MSC population according to the present disclosure (TB1) obtained from WJ exhibits higher level of IDO-activity at baseline (unstimulated) compared to MSCs obtained from WJ from single donors (TST-503; TST-526), MSCs obtained from bone marrow (BM-MSC) and JEG-3 cell line (FIG. 6A) and compared to MSCs obtained from WJ from single donors (TST-475; TST-503; TST-526) and the JEG-3 cell line (FIG. 6B).

[0193] FIG. 7 is a bar graph showing that the isolated, pooled allogeneic MSC population according to the present disclosure (CB2) obtained from WJ secretes higher levels of PGE2 at baseline (unstimulated) compared to MSCs obtained from WJ from single donors (05-MSC2; 07-MSC3; 09-MSC4 and 11-MSC5).

[0194] FIG. 8 is a table showing that the isolated, pooled allogeneic MSC population according to the present disclosure (CB1, CB2 and TB1) do not express the SARS-CoV-2 viral entry receptor, ACE2 receptor or the spike protein priming serine protease TMPRSS2. The housekeeping gene RPL13A was used to confirm relative expression levels and 597 WJMSCs from a single donor are presented as a control.

EXAMPLES

[0195] The present non-limiting Examples describe the generation of the inventive pooled allogeneic MSC composition of in vitro expanded mesenchymal stromal cells, including characterization of cells, selection of appropriate donor derived populations of cells and pooling of said donor derived populations of cells to obtain said composition. Examples 1-5 describe the process of obtaining the inventive pooled allogeneic MSC composition. Examples 6-9 describe a clinical study using said pooled allogeneic MSC composition for treatment and/or prevention of COVID-19 and/or symptoms associated with COVID-19.

[0196] As used in the Example section the following terms have the meaning as explained below:

[0197] Master Cell Stock - Term used to define Drug Substance Intermediate at certain passage. In the example presented herein, Master Cell Stock is the Drug Substance Intermediate at passage 0. The skilled person will appreciate that the Master Cell Stock may be the Drug Substance Intermediate at passage 1 or 2.

[0198] Drug Substance Intermediate - Term used to define MSCs from a single donor that are in production, hence being expanded. Meeting in process quality criteria but has not yet been evaluated with the selection algorithm. Drug Substance Intermediate corresponds to individual donor derived MSC population as disclosed herein, which individual donor derived MSC population has not yet been selected for pooling.

[0199] Drug Substance - Term used to define MSCs from a single donor that meet in the manufacturing quality criteria and have been identified as having desired characteristics by the selection algorithm. Hence, not subject to further culturing or expansion. Drug Substance thus corresponds to individual donor derived MSC population as disclosed herein, which individual donor derived MSC population have been selected for pooling.

[0200] Drug Product - The term Drug Product refers to a cell suspension of ex vivo expanded Wharton’s jelly derived mesenchymal stem cells (WJMSCs) from multiple donors which have been identified as having desired characteristics by the selection algorithm. Drug Product corresponds to the isolated, pooled allogeneic MSC populations as disclosed herein.

[0201] Final Product - The term Final Product refers to a pharmaceutical composition comprising the Drug Product and at least one pharmaceutically acceptable excipient or carrier.

[0202] To clarify, the term “antigen X-antibody” and “anti-antigen X-antibody” as used herein both refer to an antibody with affinity for antigen X. Said terms are used interchangeably.

Example 1

[0203] The present Example describes the process of harvesting, transportation, ex vivo expansion, and cryopreservation of MSCs from Wharton’s Jelly. Additionally, maternal blood is tested for infections agents. Furthermore, culture conditions are described.

Materials and Methods

[0204] The manufacturing for the Master Cell Stock of Wharton’s Jelly-derived MSC is a continuous process from the donor qualification and subsequent ex vivo expansion in xeno-free culture system.

[0205] Umbilical cord (UC) samples are collected after natural delivery as well as caesarian sections after placenta expulsion and umbilical cord blood collection (for infectious agents screening). Maternal peripheral blood samples are also collected.

[0206] For minimizing the risk of contamination, disposable, sterile scissors and forceps are used and fragments of the umbilical cord are placed into sterile transportation containers filled with transportation liquid (99% Sodium Chloride (0.9% sol.) (Fresenius Cat.no: PK03XE050PL) supplemented with 1% Antibiotic/Antimycotic solution (Gibco Cat.no: 15240-062)). Samples are transported inside of protective boxes to the Manufacturer’s Laboratory. Transport conditions are monitored and UC tissue is processed within 72 hours of child delivery. Isolation of Wharton’s Jelly tissue and culture of explants for cell isolation are performed in GMP lab with use of xeno-free, serum-free media and compounds.

[0207] Qualification of UC tissue as a source material requires providing complete responses to a medical questionnaire and submission of maternal peripheral blood sample collected within 7 days of the UC collection for infectious agents testing. Donor sampling, testing and screening (medical health questionnaire) is in accordance with Annex II of Directive 2006/17/EC. All donor test kits are validated for intended use. Infectious agent tests performed before umbilical cord qualification are listed in Table 1. Approximately 10-25% of collected samples qualify for further production.

TABLE-US-00002 Infectious agent tests performed from maternal blood (MB) samples. Agent/Disease Test specification Results required HIV I, HIV II anti-HIV I/II (-) nonreactive HIV I HIV I Nucleic Acid Test (NAT) (-) negative HBV anti-HB core (-) nonreactive HBV HBs-Ag (-) nonreactive HBV HBV Nucleic Acid Test (NAT) (-) negative HCV anti-HCV (-) nonreactive HCV HCV Nucleic Acid Test (NAT) (-) negative CMV anti-CMV M (-) nonreactive CMV anti-CMV G (-) nonreactive Toxoplasmosis anti-Toxo M (-) nonreactive Toxoplasmosis anti-Toxo G (-) nonreactive Syphilis Specific treponemal antibody assay (-) nonreactive *In case of reactive results CMV IgG of maternal blood screening, additional test of Real Time PCR is performed from primary culture. Negative results of RT PCR CMV are required for product release.

[0208] Upon arrival at the Manufacturer’s Laboratory, UC fragments are removed from transportation container and washed in a sterile transportation liquid. UC is dissected and blood vessels are removed. Wharton Jelly tissue is minced into 1-2 mm.sup.3 scraps with a sterile lancet and placed in xeno-free, serum-free media into culture flask coated with Attachment Solution (1% MSC Attachment Solution Stock 99% D-PBS) for primary explants cultures. Flask are incubated at 37° C. in 5% CO.sub.2. After 1-2 weeks cultures are examined for the presence of adherent, fibroblast-like cells. All non-adherent cells presence in cultures are washed out. The cell culture medium comprises 94% NutriStem® XF (Biological Science, Cat no: 05-200-1A), 5% NutriStem® XF Supplement Mix (Biological Science, Cat no: 05-201-1U) and 1% Antibiotic/Antimycotic solution (Gibco Cat.no: 15240-062). Adherent cells from primary are passaged (controlled enzyme digestion of cultures) upon reaching 90% confluence, generating a master cell stock at P0, and (i) cryopreserved in the presence of cryoprotectant solution (70-80% Human Serum Albumin (5% sol.) (CSL Behring Cat.no: Alburex 5) and 20-30% Dimethyl Sulfoxide (WAK Chemie, Cat.no: WAK-DMSO-50)) for vapor phase of liquid nitrogen storage or (ii) immediately reseeded for further expansion.

[0209] When cells are thawed for expansion at passage 1, the Master Cell Stock exists only for a few hours. Regardless of this short lifespan of the Master Cell Stock, all tests mentioned in FIG. 1 are performed.

TABLE-US-00003 Solutions used in steps of manufacturing process according to the FIG. 1 Name of solution Composition Step of process Transportation Liquid 99% Sodium Chloride (0.9% sol.) 1% Antibiotic/Antimycotic solution 1 Culture Medium 94% NutriStem® XF 5% NutriStem® XF Supplement Mix 1% Antibiotic/Antimycotic solution 2-6 Attachment Solution 1% MSC Attachment Solution Stock 99% D-PBS 2-6 Cryoprotectant Solution* 70-80% Human Serum Albumin (5% sol.) 20-30% Dimethyl Sulfoxide 7 *when Master Cell Stock is intended to be cryopreserved.

[0210] There are no animal-origin raw materials used in the manufacturing process from umbilical cord tissue collection until Drug Product release.

[0211] During primary cultures of explants, and at the end of manufacturing of Master Cell Stock each cell passage, samples are taken to determine the presence of bacterial and fungal contamination, mycoplasma and endotoxins. The number and viability of cells is evaluated in the Master Cell Stock and Drug Product. Microbial culture, mycoplasma and endotoxins is evaluated from final product. Additionally, one reference sample of Drug Product is can be thawed and testing cell culture is established. This testing culture serve as a source of material for additional final confirmation of product safety purity (by microbial culture and mycoplasma and endotoxins test, karyotype etc.), potency (cell number, adherence efficiency and viability) and identity (cytometric immunophenotyping). Cultures fulfilling the approval criteria listed in Table 3 qualify for next steps of processing or cryopreservation and analytical procedures for evaluation of cultures are explained in Example 2. The quality criteria for impurities is totally less than 5 % of the cells may express any of the negative cell surface markers (analysed collectively) and at least 70 % of the cells have to be positive to for the positive cell surface markers (analyzed separately).

TABLE-US-00004 Tests and acceptance specification Test or Specification Goal Limits or range Appearance Identity Single cell suspension, clear to opalescent Sterility of in-process media safety, purity bacteria/fungi not detected Sterility of Master Cell Stock safety, purity bacteria/fungi not detected Mycoplasma safety, purity not detected Endotoxins safety, purity not detected (<0.25 IU/ml) Cell count potency ≥ 500 × 10.sup.6 Cell viability potency ≥ 80% Surface adherence potency, identity ≥ 90% of adherent cells Karyotype safety 46 and sex chromosomes CD45 antigen expression identity < 5% CD34 antigen expression identity < 5% CD14 antigen expression identity < 5% CD19 antigen expression identity < 5% CD3 antigen expression identity < 5% CD73 antigen expression identity ≥ 70% HLA-DR antigen expression identity < 5% CD90 antigen expression identity ≥ 70% CD105 antigen expression identity ≥ 70% Osteogenesis assay identity Detection of osteocytes Adipogenesis assay identity Detection of adipocytes Chondrogenesis assay identity Detection of chondrocytes Excipient 0.9 % sodium chloride Human Serum Albumin 5 % ± 0.5 volume DMSO 10 % ± 1% volume

Results

[0212] Manufacturer demonstrated the microbiological safety of WJMSC derived from umbilical cords obtained after natural deliveries. The addition of antibiotic/antimycotic solution to the transportation liquid and during next steps of manufacturing resulted in the absence of microorganism (bacteria and fungi) in Master Cell Stock as well as in Drug Product.

[0213] The retrospective analysis the characteristic of cells obtained from different donors allow to get criteria to be met by all MSCs for manufacturing comparable Drug Products as is referred in Table 4.

[0214] The present procedures provide highly uniform MSC populations which fulfill the required safety criteria.

TABLE-US-00005 Analysis of different batches of Master Cell Stock Batch # Test TST 626 TST 668 TST 664 TST 681 TST 642 Inf. agents neg neg neg neg neg Sterility neg neg neg neg neg Mycoplasma neg neg neg neg neg Endotoxins neg neg neg neg neg Viability (%) 98.82% 97.39% 99.06% 98.5% 98.8% CD45.sup.∗∗ 0.04% 0.33% 0.00% 0.02% 0.03% CD34.sup.∗∗ 0.04% 0.33% 0.00% 0.02% 0.03% CD14.sup.∗∗ 0.04% 0.33% 0.00% 0.02% 0.03% CD19.sup.∗∗ 0.04% 0.33% 0.00% 0.02% 0.03% HLA-DR.sup.∗∗ 0.04% 0.33% 0.00% 0.02% 0.03% CD73 85.19% 81.02% 86.66% 92.76% 93.9% CD90 95.82% 99.86% 99.48% 99.97% 98.39% CD105 95.56% 86.47% 98.79% 98.66% 96.72% .sup.∗Positive results of CMV IgG from maternal blood. Real time PCR test from primary culture has confirmed the lack of viral DNA in culture cells .sup.∗∗Tests performed in one antibody panel

Example 2

[0215] The present Example describes characterization of MSCs from donors based on morphology, proliferative capacity and expression of markers for MSC according to the criteria of the ISCT. Furthermore, the cells are screened for the presence of mycoplasma, endotoxins, bacterial contaminants, fungal contaminants, viral contaminants and/or endotoxins and karyotype testing is performed. The described characterization results in identification of MSC populations derived from Drug Substance Intermediates, which MSCs fulfill quality criteria for pooling.

Materials and Methods

[0216] First, MSCs must be plastic-adherent when maintained in standard culture conditions. Only plastic adherent cells are subject to the analytical procedures described below. Cultures are screened according to the analytical procedures given below.

Analytical Procedures

Infectious Agents

[0217] Sampling. The source material for WJ-MSC manufacturing (placental part of the umbilical cord) is obtained within several minutes after placenta expulsion. That is why the only way of infectious agent transmission is from maternal blood via placenta. Two samples of donor-mother’s peripheral blood are collected at the day of delivery and source tissue harvest.

[0218] Analysis. ABBOTT ARCHITECT 2000 for chemiluminescent immunoassay and Procleix PANTHER System for NAT assay are used according to manufacturer’s instructions. The following test using the Abbott ACHITECT for chemiluminescent immunoassay are performed HIV Ag/Ab Combo; HBsAg Qualitative II; Anti-HBc II; Anti-HCV; CMV IgM; CMV IgG; Toxo IgM; Toxo IgG; and Syphilis TP. Additionally, Proclex Utrio Plus Assay is used to qualitative screen in vitro nucleic acid amplification for HIV-1 RNA, hepatitis C virus (HCV) RNA and hepatitis B virus (HBV) DNA in plasma and serum specimens from human donors.

[0219] Acceptance criteria. Results of test must be “negative”, “non-reactive” or “not detected” for infectious agents (except CMV IgG: having positive results of this test Manufacturer performs confirm the lack of CMV DNA in the product by RealTime PCR test).

Sterility

[0220] Sampling. A sample (10 mL) of cells and supernatant from cultures after enzymatic harvest.

[0221] Analysis. Sample is seeded into two BACTEC bottles intended for growth of anaerobic and aerobic bacteria as well as for detection of fungal contamination. Bottles are placed in BACTEC FX400 microbial analyzer for 14 days.

[0222] Acceptance criteria. Results of test must be “negative” or “not detected” for aerobic anaerobic bacteria as well as for fungal microorganisms after 14 days incubation.

Mycoplasma.

[0223] Sampling. A sample (0.1 mL) of cells and supernatant from cultures after enzymatic harvest

[0224] Analysis. The Venor®GeM Classic Assay (Merck KGaA, cat no MP0025) is based on PCR amplification is uses according to the manufacturer’s instructions.

[0225] Acceptance criteria. Results of test must be “not detected” for amplification product in the gel slot.

Endotoxin.

[0226] Sampling. A sample (0.5 mL) of cells and supernatant from cultures after enzymatic harvest

[0227] Analysis. The Endosafe®-PTS™, (Charles River Laboratories, cat no PTS2005F) realtime endotoxin testing system, is used according to the manufacturer’s recommendations.

[0228] Acceptance criteria. Results of test must be “not detected”

Cell Count.

[0229] Sampling. A sample (0.5 mL) of cells from cultures after enzymatic harvest Analysis. Light microscopic analysis of cell number with use of Malassez’ chamber.

[0230] Acceptance criteria. Not less than 98% of required number of cells

Cell Viability.

[0231] Sampling. A sample (0.5 mL) of cells from cultures after enzymatic harvest

[0232] Analysis. Flow cytometric analysis of 7-AAD (Becton, Dickinson and Company, Cat.no. 559925) stained cell suspension is performed using a FACS Calibur flow cytometer. Acceptance criteria. More than 80% of viable cells.

Immunophenotyping.

[0233] Sampling. A sample (0.5 mL) of cells from cultures after enzymatic harvest

[0234] Analysis. Flow cytometric analysis of cells previously labelled with monoclonal antibodies is performed using a FACS Calibur flow cytometer Antigens tested a listed in Table 4.

[0235] Acceptance criteria- Expression of CD73, CD90 and CD105 on more than 70% of cells. Lack of expression of lineage antigens (CD45, CD34, CD14 or CD11b, CD79alpha or CD19 and HLA-DR surface molecules).

Karyology.

[0236] Sampling. Cell culture performed especially for this assay.

[0237] Analysis. Culture is blocked with Colcemid and stained with Giemsa. The number of chromosomes and structural aberrations are evaluated.

[0238] Acceptance criteria. 46 chromosomes, XY or XX; no visible aberrations.

Differentiation Assay

Cells Are Subject to Differentiation

[0239] Analysis. Differentiation assays are used according to manufacturer’s instructions. Human Mesenchymal Stem Cell Functional Identification Kit, Catalog Number SC006, R&D Systems, Inc. designed for the identification of human MSCs based on their ability to differentiate into multiple mesenchymal lineages. This kit contains specially formulated adipogenesis, chondrogenesis, and osteogenesis media supplements, which can be used to effectively differentiate MSCs into adipogenic, chondrogenic, or osteogenic lineages. A panel of antibodies, consisting of anti-mFABP4, anti-hAggrecan, and anti-hOsteocalcin, are included to define the mature phenotypes of adipocytes, chondrocytes, and osteocytes, respectively. StemPro® Chondrogenesis Differentiation Kit, Catalogue number: A1007101, Thermo Fisher Scientific Inc. developed for the chondrogenic differentiation of mesenchymal stem cells (MSCs) in tissue-culture vessels. The kit contains all reagents required for inducing MSCs to be committed to the chondrogenesis pathway and generate chondrocytes.

[0240] Acceptance criteria. Ability to differentiate to osteoblasts, adipocytes and chondroblasts in vitro.

Results

[0241] Obtained MSC populations are plastic-adherent when maintained in standard culture conditions. The MSC express CD105, CD73 and CD90, and lack expression of CD45, CD34, CD14 or CD11b, CD79alpha or CD19 and HLA-DR surface molecules as given in Example 3 and are able to differentiate to osteoblasts, adipocytes and chondroblasts in vitro. Thus, MSC populations eligible for pooling are identified.

[0242] While these criteria are currently employed, they may require modification as new knowledge unfolds leading to for example alteration of the definition of MSC according to the criteria of the ISCT), the present inventors believe the above minimal set of standard criteria will foster a more uniform characterization of MSC. As used herein, MSCs are defined according to criteria from ISCT.

Example 3

[0243] The present Example describes the screening assays used to characterize the said MSC populations derived from Drug Substance intermediates for morphological, proliferative and functional characteristics in order to select the MSC populations to be pooled.

Materials and Methods

[0244] Below follows the description of 6 assays used to characterize the MSC populations.

[0245] Assay 1 - IDO: IDO assay is used to analyze the immunosuppressive capacity of Drug Substance Intermediate or Drug Substance, i.e. mesenchymal stem/stromal cells (MSC).

[0246] The UC-MSC immunomodulatory potential is reported as a measure of indoleamine 2,3-dioxygenase (IDO) activity, determined by measuring tryptophan and kynurenine in the culture supernatant. Indoleamine-pyrrole 2, 3-dioxygenase (IDO or INDO EC 1.13.11.52) is a heme-containing enzyme that in humans is encoded by the IDO1 gene. The IDO enzyme converts L-tryptophan to N-formylkynurenine (or kynurenine), an immunosuppressive molecule that acts as an inhibitor of immune cell proliferation - including T cells, as well as exhibiting antibacterial and antiviral functions. The IDO activity is the ratio of kynurenine/tryptophan and can be determined by calculating the amount of tryptophan and kynurenine present in cell culture supernatants using an ELISA kit. When stimulated with interferon gamma (IFN.sub.Y) in the presence or absence of tumor necrosis factor alpha, mesenchymal stem/stromal cells (MSC) secrete more IDO than when they are unstimulated.

[0247] Inducible IDO activity indicates that the cells released have functional potency, related to immunomodulation.

[0248] MSC culturing: Seed 10 000 MSC / well in 48-well cell culture plates in 100 .Math.l assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)). Dilute IFN.sub.Y from stock, 1 mg/ml (ThermoFisher Scientific, cat no. PHC4033). The final concentration of IFN.sub.Y / well is 100 ng/ml. Add 100 .Math.l of 200 ng/ml IFN.sub.Y to the wells. Add 100 .Math.l assay medium to non-stimulated cells (no IFN.sub.Y). Incubate cell culture plate at 37° C., 5% CO.sub.2 for 72 hours. Remove the supernatant from each well and store in micro tubes at -20° C. until further processing for ELISA analysis.

[0249] Tryptophan and kynurenine measurements are done according to manuals provided by the ELISA-kit manufacturer (Immundiagnostik AG, cat no. K 3730 and K 3728). Both tryptophan and kynurenine ELISA are performed on the same day but at separate occasions. The two ELISAs are conducted according to manufacturer’s instructions; see the manuals for respective ELISA.

[0250] Absorption at 450 nm with background subtraction at 620 nm is measured in a Spectramax microplate reader (Molecular Devices, Spectramax 190).

[0251] Analyzing results: Amount of absorbance measured is inversely proportional to the amount of amino acid present in the sample; i.e. the lower the OD450, the more kynurenine or tryptophan there is. The 4PL-algorithm (Four Parameter Logistic Regression) is used to calculate results (software SoftMax Pro 7.0.2, Molecular Devices), as recommended by kit manufacturer. Concentrations are determined directly from the standard curve. The control samples provided with the kits should are evaluated for acceptability: if outside the acceptable range according to the manufacturer of the kit, the samples need to be re-assayed.

Results

[0252] Relative IDO bioactivity of IFNy treated cells from Drug Substance Intermediates are used for ranking of the samples according to the selection algorithm (Example 4). The donors with the highest increase in bioactivity get the highest ranking score. The ranking score (Table 5) is later used in the final selection of donor (see Example 4).

TABLE-US-00006 Illustrative example of ranking score based on IDO fold increase. Donor IDO fold increase Ranking score Donor IDO fold increase Ranking score D5 150 3 D3 112 2 D7 130 3 D2 100 1 D4 125 3 D8 90 1 D6 124 2 D10 85 0 D1 112 2 D9 80 0

Assay 2: Proliferation Assay

[0253] This method is used to quantitatively measure the immunosuppressing effect of the Drug Substance Intermediate and/or Drug Substance, i.e. umbilical cord derived MSCs have on the proliferation of peripheral blood mononuclear cells (PBMC). MSC have been shown to suppress T-lymphocyte proliferation. Mixed lymphocyte reactions with MSC are frequently used to demonstrate the immunosuppressive activity of MSC.

[0254] Phytohaemagglutinin (PHA) is used as a mitogen which activates proliferation of T-lymphocytes. The immunosuppressive activity of Drug Substance Intermediate and/or Drug Substance is quantified as the decrease in proliferation of PHA stimulated T-lymphocytes.

[0255] Culturing and CFSE priming: MSC (2× 10.sup.5 cells/well) in 500 .Math.l of working medium (RPMl1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in 12-well cell culture plates. The plates are incubated at 37° C., 5% CO.sub.2 for 2 hours for plastic adherence of cells. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC are suspended in RPMI 1640, 22 × 10.sup.6 cells/ml. CellTrace™ CFSE Cell Proliferation Kit (ThermoFisher Scientific, cat no. C34554) is used for analysing the proliferation according to manufacturer’s instruction. CFSE-primed PBMC (1×10.sup.6 cells /well) are seeded to the 12-well cell culture plate and PHA is added as a mitogen.

[0256] Analysis: CFSE positive cells are analyzed by Accuri C6 plus flow cytometer. CFSE histogram includes three or four peaks and the first top from the right represents undivided cells (G0). The following tops show different generations (G1-G4). Proliferation Index (PI) is calculated as the total number of cells of all generations divided by the number of parent cells that entered cell division.

TABLE-US-00007 Illustrative example of ranking score based on proliferation index Donor Proliferation Index Ranking score Donor Proliferation Index Ranking score D7 1.02 3 D1 1.14 2 D5 1.06 3 D8 1.16 1 D6 1.07 3 D2 1.17 1 D4 1.11 2 D9 1.22 0 D3 1.13 2 D10 1.28 0

Results

[0257] The average proliferation index for each Drug Substance Intermediates is used for relative comparison of the donors. The donors with the lowest PI get the highest ranking score. The ranking score (Table 6) is later used in the final selection of donor (see Example 4).

Assay 3: Prostaglandin E2

[0258] Prostaglandin E2 (PGE2) assay evaluates Drug Substance Intermediate and/or Drug Substance secretion of PGE2 when co-cultured with peripheral blood mononuclear cells (PBMCs) activated with Phytohemagglutinin (PHA).

[0259] Cell culturing: Cells are cultured in assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) for 3 days in co-culture cell ratio MSC-PBMC 1:5, in the presence and absence of PHA (Merck, cat no. 11082132001). 40 000 MSCs are seeded per well in 12-well cell culture plates. Cell culture plates are incubated at 37° C., 5% CO.sub.2 for 2 h to allow the cells to adhere.

[0260] Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC are suspended in assay medium, 0.5 × 10.sup.6 cells/ml, and 400 .Math.l is seeded into wells intended for PBMC. 500 .Math.l assay medium is added to wells without PBMC. 100 .Math.l/well of 100 .Math.g/ml is added to PHA to PBMC containing wells and the cell culture plate is incubated at 37° C., 5% CO.sub.2 for 72 hours. The supernatant is removed from each well and centrifuged for 5 min at 500 g to remove particulates. The supernatant is frozen and stored at -20° C. until further processing for ELISA analysis.

[0261] The Parameter™ Prostaglandin E2 Immunoassay kit is used for PGE2 expression detection according to manufacturer’s instruction (Bio-Techne, cat no. KGE004B) and is analyzed with Spectramax microplate reader (Molecular Devices, Spectramax 190). The 4PL-algorithm (Four Parameter Logistic Regression) is used to calculate results (software SoftMax Pro 7.0.2, Molecular Devices).

Results

[0262] The average expression of PGE2 in pg/ml for each Drug Substance Intermediate is used for relative comparison of the donors. The donors with the highest expression level get the highest ranking score. The ranking score (Table 7) is later used in the final selection of donors (see Example 4).

TABLE-US-00008 Illustrative example of ranking score based on PGE2 expression Donor PGE2 expression Ranking score Donor PGE2 expression Ranking score D5 14900 3 D3 12400 2 D7 13000 3 D2 12000 1 D4 12900 3 D8 11100 1 D6 12600 2 D10 10000 0 D1 12500 2 D9 9000 0

Assay 4: HLA-G

[0263] The HLA-G assay evaluates Drug Substance Intermediate and/or Drug Substance expression of soluble and/or intracellular HLA-G in response to IFNy, IL-10 and/or PHA.

[0264] Cell culture: 50 000 MSC and 25 000 JEG-3 cells (positive control cells, ATCC, cat no. ATCC.sup.® HTB-36.sup.TM ) are seeded per well in 12-well cell culture plates in 1 ml assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) with a final concentration of 10-50 ng/ml IL-10 (Miltenyi Biotec, cat no. 130-108-985) or 25-100 ng/ml IFN.sub.Y (ThermoFisher Scientific, cat no. PHC4033) or without stimulation. Cells are incubated at 37° C., 5% CO.sub.2 for 48 to 72 h. The supernatant is removed from each well and stored at -20° C. for ELISA analysis of soluble HLA-G.

[0265] Intracellular HLA-G: The adherent cells are washed twice with DPBS and detached with TrypLE Express (Thermo Scientific, cat no. 12604021). The BD Cytofix/Cytoperm™ is used for fixation and permeabilization of cells according to manufacturer’s instruction (Becton, Dickinson and Company, cat no. 554714). Cells are stained with HLA-G (PE) antibody (EXBIO Praha, cat no. 1P-431-C100) according to manufacturer’s instruction and analyzed by flow cytometry (Merck, Guava easyCyte 5HT).

[0266] Soluble HLA-G: The concentration of HLA-G in the supernatant is analyzed with sHLA-G ELISA kit (Enzo Life Sciences, cat no. ALX-850-309-KI01) according to manufacturer’s instruction.

Results

[0267] The Drug Substance Intermediates and/or Drug Substances are analyzed for both intracellular and soluble HLA-G expression and receive a score based on the relative expression compared to with the other samples analyzed. The total score from intracellular and soluble HLA-G expression is summarized and the Drug Substance Intermediates receive a ranking score (Table 8) that is used for the final selection of donors (see Example 4).

TABLE-US-00009 Illustrative example of ranking score based on sHLA-G and iHLA-G scores. Donor Soluble HLA-G sHLA-G score Intracellular HLA-G iHLA-G score HLA-G score Ranking score D5 1110 8 0% 9 17 3 D7 1100 7 1% 6 13 3 D4 990 4 0% 9 13 3 D6 1200 9 6% 1 10 2 D1 1002 6 1% 6 12 2 D3 980 3 0% 9 12 2 D2 1000 5 8% 0 5 1 D8 937 2 5% 3 5 1 D10 825 1 5% 3 4 0 D9 600 0 2% 4 4 0

Assay 5: Morphology

[0268] Cell morphology of the Drug Substance Intermediate and/or Drug Substance cultures are continuously surveilled. Cells are being visually inspected during expansion as well as before harvesting and evaluated based on:

TABLE-US-00010 • Size of cell normal/big • Size of nuclei normal/big • Shape of cell normal/abnormal • Ratio between cell and nuclei size normal/abnormal

Results

[0269] Drug Substance Intermediate cells are visually assessed based on the criteria above. Only samples with more than 90% normal cells are accepted. The frequency of abnormal cells is used for ranking (Table 9) the Drug Substance Intermediates (see Example 4).

TABLE-US-00011 Illustrative example of ranking score based on morphology. Donor Percentage abnormal cells Ranking score Donor Percentage abnormal cells Ranking score D5 0% 3 D4 2% 2 D6 0% 3 D3 5% 1 D7 0% 3 D8 5% 1 D1 1% 2 D9 6% 0 D2 1% 2 D10 8% 0

Assay 6: Fluorospot

[0270] Drug Substance Intermediate and/or Drug Substance are cultured in Fluorospot specific 96 well plates pre-coated with antibodies (service provided by MabTech). 1000 - 3000 cells are seeded per well in 100 .Math.l assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) and incubated for 48 hours in absence or presence of stimuli. Stimulations used are Poly I:C (Invivogen, cat no. tlrl-pic), r848 (Invivogen, cat no. tlrl-r848), GABA (Diamyd Medical) and IFNy (ThermoFisher Scientific, cat no. PHC4033). The expression of IL-2, IL-4, IL-6, IL-8, IL-12, IL-12/13, IL-17A IL-21, IL-22, IL-29, IL-31, TGFβ1, GM-CFS, IFNa, IFNɣ, apoE and TNFa is analyzed by Fluorospot (MabTech). Earlier batches of the pooled allogeneic MSC composition, i.e. Drug Product, are used as reference. The assay contains both proteins and cytokines considered desirable and undesirable. For example, it is considered positive if the cells are expressing IL-6 but negative if they express IFNy.

TABLE-US-00012 Antibodies used in said Fluorospot-assay. Fluorospot-assay Detection antibody Fluorospot-assay Detection antibody IL-2 human mAb MT8G10-biotin, 0.5 mg/ml IL-29 human mAb MT6G4-biotin, 0.5 mg/ml IL-4 human mAb IL-4 II-biotin, 1 mg/ml IL-31 human mAb MT158-biotin, 0.5 mg/ml IL-6 human mAb 39C3-biotin, 1 mg/ml IFNα (pan) human mAbs MT2/4/6-biotin, 1 mg/ml IL-8 human mAb MT8F19-biotin, 0.5 mg/ml IFNɣ human mAb 7-B6-1-biotin, 1 mg/ml IL-13 human mAb IL13-3-biotin, 0.5 mg/ml TNFα human mAb TNF5-biotin, 0.5 mg/ml IL-21 human mAb MT21.3 m-biotin, 0.5 mg/ml GM-CSF human mAb 23B6-biotin, 1 mg/ml IL-22 human mAb MT7B27-biotin, 0.5 mg/ml TGFβ1 (latent form) human mAb MT517-biotin, 0.5 mg/ml

Results

[0271] The results are analyzed with the software provided with the Fluorspot reader. The program generates both visual and numeric output (see FIG. 3).

[0272] The Drug Substance Intermediate samples are scored in relation to the reference sample (numeric value). A threshold value for positive vs. negative is predefined for each marker and the Drug Substance Intermediates are scored according to Table 12.

TABLE-US-00013 Marker translation to numeric scores Type of marker Result Numeric score Type of marker Result Numeric score Positive markers Negative 0 Negative markers Negative 0 Positive 1 Positive -2 Higher than reference 2

[0273] The final ranking of the Drug Substance Intermediates is based on the summarized score from all markers analyzed with and/or without stimuli (Table 12).

TABLE-US-00014 Illustrative example of ranking score for all markers analyzed. Donor M1 M1 S1 M2 M3 M4 S1 M4 S2 M4 S3 Summarized score D1 1 1 0 0 1 1 1 5 D2 1 1 0 0 1 1 1 5 D3 1 1 -1 0 1 1 1 4 D4 1 1 0 0 1 1 1 5 D5 2 1 0 0 2 1 1 7 D6 2 2 0 0 1 2 1 8 D7 1 2 0 0 2 1 1 7 D8 0 0 0 0 1 1 1 3 D9 0 0 0 0 0 0 1 1 D10 1 1 0 0 0 0 1 3 D1 = donor 1, D2 = donor 2 etc. M1 = marker 1, M2 = marker 2 etc. S1 = stimuli 1, S2 = stimuli 2 etc. M1 and M4 are positive markers. M2 and M3 are negative markers.

[0274] The ranking of the Drug Substance Intermediates is based on the score which generates are ranking score for the Fluorospot assay. The ranking score is later used for the overall selection of donors described in Example 4. The Drug Substance Intermediate sample with the highest score will also get the highest ranking score (see Table 13). Furthermore, it is also possible to use some or all of the Fluorospot results as input in the selection algorithm, i.e. data from each analyzed protein as a separate component in the selection algorithm.

TABLE-US-00015 Illustrative example of ranking score based on Summarized score from the Fluorospot assay Donor Score Ranking score Donor Score Ranking score D6 8 3 D4 5 2 D5 7 3 D3 4 1 D7 7 3 D8 3 1 D1 5 2 D9 3 0 D2 5 2 D10 1 0

Assay 7: Microglia Proliferation Assay

[0275] This method is used to quantitatively measure the immunosuppressing effect of the Drug Substance Intermediate and/or Drug Substance, i.e. MSCs as described herein, have on the proliferation of microglia cells. MSC have been shown to suppress microglia proliferation. Co-culture of microglia and MSC is used to demonstrate the immunosuppressive activity of MSC. Lipopolysaccharide (LPS) is used as a mitogen which activates proliferation of microglia. The immunosuppressive activity of Drug Substance Intermediate and/or Drug Substance is quantified as the decrease in proliferation of LPS stimulated microglia cells.

[0276] Co-culturing CFSE-primed microglia with MSC: Microglia cells (1 × 10.sup.6 cells/ml) are suspended in DPBS+2%FBS and stained with CellTrace ™ CFSE Cell Proliferation Kit (ThermoFisher Scientific, cat no. C34554) according to manufacturer’s instruction. MSC (5000 cells/well) in 100 .Math.l of working medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) are seeded in 48-well cell culture plates. 200 .Math.l of CFSE-primed microglia cells (25000 cells/well) in DMEM+10%FBS are seeded in 48-well cell culture plate simultaneously. After 24 hours at 37° C., 5%CO.sub.2, LPS (from E.coli, Sigma Aldrich Cat No;10900010L4391) with a final concentration of 1 pg/ml is added and the 48-well cell culture plates are incubated for a further 48 hours, then the medium is removed and the adherent cells are washed twice with DPBS and detached with 25 .Math.l TrypLE Express (Thermo Scientific, cat no. 12604021).1 ml working medium is added to the wells and cells are transferred to tubes and centrifuged at 300 g for 5 min. The supernatants are removed and cells are re-suspended in 200 .Math.l DPBS+2%FBS and run on Accuri C6 Plus Flow cytometer.

[0277] Analysis: Total cell amount of each sample is calculated by multiplying cells/.Math.l of CFSE stained cells x 200 .Math.l. Growth index is calculated by dividing the total cells after 72 hour to cell amount at starting of assay.

Results

[0278] The average growth index for each Drug Substance Intermediate is used for relative comparison of the donors. The donors with the lowest GI get the highest ranking score. The ranking score is later used in the final selection of donors (see Example 5).

TABLE-US-00016 Illustrative example of ranking score based on proliferation index. Donor Growth Index Ranking score Donor Growth index Ranking score D7 1.92 3 D1 2.35 2 D5 1.95 3 D8 2.36 1 D6 2.01 3 D2 2.44 1 D4 2.11 2 D9 2.48 0 D3 2.22 2 D10 2.70 0 RefTB1 2.25 Negative 3.50 0

Assay 8: Microglia CD183 Expression

[0279] Chemokine receptor CXCR3 is a receptor in the CXC chemokine receptor family. Other names for CXCR3 are G protein-coupled receptor 9 (GPR9) and CD183. CXCR3 is expressed primarily on activated T lymphocytes and NK cells and some epithelial cells as well as on microglia cells.

[0280] Co-culturing microglia cells with MSC: Microglia cells are re-suspended in serum-free media and seeded in CellBIND culture flasks (1 × 10.sup.6 cells/T75). After 2 hours at 37° C., 5% CO.sub.2, MSC (0.2 × 10.sup.6 cells/T75) and IFN.sub.Y (10 ng/ml) are added to the microglia cells. The ratio will be 5:1 microglia cells: MSC. The cells are incubated for 48 h before washing with DPBS and detaching the cells with 500 .Math.l TrypLE Express (Thermo Scientific, cat no. 12604021). Serum free medium is added and cells are transferred to tubes and centrifuged at 200 g for 5 min. The supernatant is removed and 3 ml working medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) is added. Cells are counted and divided equally to flow cytometry staining tubes. Cells are stained with 16 .Math.l Anti Human CD183 from BD Pharmingen (Product no; 557185; PE mouse Anti human CD183) for 30 min at RT protected from light. Staining is stopped by adding 2 ml DPBS+2%FBS to each tube. Cells are centrifuged at 200 g for 5 min, supernatants are discarded and cell pellets are re-suspended in 200 .Math.l DPBS+2%FBS. 150 .Math.l of each sample is used for running flow cytometry. A minimum of 30000 events is recorded.

Results

[0281] The FACS results are analyzed with Flow-Jo software. The inactivation of microglia is calculated as the decrease of CD183 positive microglia cells caused by the Drug Substance Intermediates (FIG. 4A), calculated as:

[00004] $S u p p r e s s i o n % = 1 - \frac{% C D 183 p o s i t i v e m i c r o g l i a c e l l s w i t h M S C}{% C D 183 p o s i t i v e m i c r o g l i a c e l l s}$

[0282] The donors with the highest suppression percent get the highest ranking score. The ranking score is later used in the final selection of donors.

TABLE-US-00017 Illustrative example of ranking score based on CD183 suppression. Donor Suppression Ranking score Donor Suppression Ranking score D5 92% 3 D8 80% 2 D6 89% 3 D3 75% 1 D7 88% 3 D4 55% 1 D1 84% 2 D9 32% 0 D2 82% 2 D10 28% 0 RefTB1 82% 2 Negative 0% 0

Assay 9: Microglia CD200R Expression

[0283] The CD200 transmembrane glycoprotein, mostly expressed in neurons, interacts with its receptor, CD200R which is expressed in the CNS almost exclusively in microglia as well as in other CNS macrophages, to inhibit microglial priming and holds microglia in a quiescent state. Fold increase of CD200R expression on microglia cells by MSC is analyzed to measure immunosuppression or the shift towards an M2 phenotype. Co-culturing microglia cells with MSC: Microglia cells are re-suspended in serum-free media and seeded in CellBIND culture flasks (0.6 × 10.sup.6 cells/T75). After 2 hours at 37° C., 5% CO.sub.2, MSC (0.6 × 10.sup.6 cells/T75) and IFN.sub.Y (10 ng/ml) are added to the microglia. The ratio will be 1:1 microglia cells: MSC. The cells are cultured for 48 h before washing with DPBS and detaching the cells with 500 .Math.l TrypLE Express (Thermo Scientific, cat no. 12604021). Serum free medium is added and cells are transferred to tubes and centrifuged at 200 g for 5 min. The supernatant is removed and 3 ml working medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) is added. Cells are counted and divided equally to flow cytometry staining tubes. Cells are stained with 10 .Math.l Anti Human CD200R from Abcam (Product no; ab33366; PE mouse Anti human CD200R) for 30 min at RT protected from light. Staining is stopped by adding 2 ml DPBS+2%FBS to each tube. Cells are centrifuged at 200 g for 5 min, supernatants are discarded and cell pellets are re-suspended in 200 .Math.l DPBS+2%FBS. 150 .Math.l of each sample is used for running flow cytometry. A minimum of 30000 events are recorded.

Results

[0284] The FACS results are analyzed with Flow-Jo software. The inactivation of microglia is calculated as the fold increase of CD200R positive microglia cells caused by the Drug Substance Intermediates (FIG. 3), calculated as:

[00005] $\begin{array}{l} F o l d i n c r e a s e = \\ \frac{% C D 200 R p o s i t i v e m i c r o g l i a c e l l s w i t h M S C}{% C D 200 R p o s i t i v e m i c r o g l i a c e l l s} - 1 \end{array}$

[0285] The donors with the highest CD200R fold increase get the highest ranking score. The ranking score is later used in the final selection of donors.

TABLE-US-00018 Illustrative example of ranking score based on CD200R fold increase. Donor Fold increase Ranking score Donor Fold increase Ranking score D5 3 3 D4 2.08 2 D1 2.96 3 D3 1.91 1 D6 2.45 3 D8 1.54 1 D2 2.38 2 D9 1.43 0 D7 2.32 2 D10 0.98 0 RefTB1 2.3 2 Negative 0 0

Assay 10: Shift From M1 to M2 Microglia Phenotype

[0286] Assay 8 and 9 are measuring the fraction of microglia cells losing their M1 phenotype and gaining an M2 phenotype respectively. This assay combines loss of markers for M1 phenotype and gaining of M2 phenotype markers to reflect a shift from M1 to M2. This is combined in the same assay and give synergistic value, for example CD200R increase CD183 reduction. In this example the same conditions are used as in assay 8 and 9 but with an HMC3 to MSC ratio of and for both CD200R and CD183.Result: The shift from M1 to M2 is calculated as:

[00006] $S h i f t s c o r e = \frac{C D 200 R f o l d i n c r e a s e}{1 - C D 183 s u p p r e s s i o n}$

[0287] The donors with the highest shift score get the highest ranking score. The ranking score is later used in the final selection of donors.

TABLE-US-00019 Illustrative example of shift score based on CD200R fold increase and CD183 suppression Donor CD183.sup.∗ CD200R Shift score Ranking score D5 76% 3 12.5 3 D6 74% 2.96 11.4 3 D7 71% 2.45 8.4 3 D1 69% 2.38 7.7 2 D2 58% 2.32 5.5 2 RefTB1 56% 2.3 5.2 2 D8 54% 2.08 4.5 2 D3 49% 1.91 3.7 1 D4 39% 1.54 2.5 1 D9 32% 1.43 2.1 0 D10 22% 0.98 1.3 0 Negative 0% 0 0 0 .sup.∗ Note: The CD183 suppression is analysed for co-culture at a 1:1 ratio of HMC3 and MSC in this assay.

[0288] Alternative markers are for phenotype shift from M1 to M2:

[0289] M1 markers which decrease: B7-2/CD86, Integrin alpha V beta 3, MFG-E8, NO, ROS, RNS, CCL2/MCP-1, CCL3/MIP-1 alpha, CCL4/MIP-1 beta, CCL5/RANTES, CCL8/MCP-2, CCL11/Eotaxin, CCL12/MCP-5, CCL15/MIP-1 delta, CCL19/MIP-3 beta, CCL20/MIP-3 alpha, CXCL1/GRO alpha/KC/CINC-1, CXCL9/MIG, CXCL10/IP-10, CXCL11/I-TAC, CXCL13/BLC/BCA-1, CX3CL1/Fractalkin, MMP-3, MMP-9, Glutamate, IL-1 beta/IL-1F2, IL-2, IL-6, IL-12, IL-15, IL-17/IL-17A, IL-18/IL-1F4, IL-23, IFN.sub.Y, TNF-alpha, Fc gamma RIII/CD16, Fc gamma RII/CD32, CD36/SR-B3, CD40, CD68/SR-D1, B7-1/CD80, MHC II, iNOS, COX-2.

[0290] M2 markers which increase: IL-1Ra/IL-1F3, IL-4, IL-10, IL-13, TGF-beta, CCL13/MCP-4, CCL14, CCL17/TARC, CCL18/PARC, CCL22/MDC, CCL23/MPIF-1, CCL24/Eotaxin-2/MPIF-2, CCL26/Eotaxin-3, FIZZ1/RELM alpha, YM1/Chitinase 3-like

[0291] 3, CLEC10A/CD301, MMR/CD206, SR-Al/MSR, CD163, Arginase 1/ARG1, Transglutaminase 2/TGM2, PPAR gamma/NR1C3.

Assay 11: Dendritic Cells

[0292] Fms-related tyrosine kinase 3-ligand (FLT3L) is a key regulator of DC commitment in hematopoiesis, which regulates the proliferation, differentiation and apoptosis of hematopoietic cells through the binding to FLT3. MSCs express FLT3L that binds to FLT3 on CD1 c+DCs to promote the proliferation and inhibit the apoptosis of tolerogenic CD1c+DCs. MSC expression of FLT3L measured by ELISA in co-culture with PBMC according to Assay 2, with or without stimulation with e.g. PHA or LPS. The fraction of cells being CD1c+ will increase as the Drug Substance Intermediate and/or Drug Substance, i.e. MSCs as described herein, induce tolerance which can be analyzed flow cytometry.

[0293] Co-culturing MSC with PBMC: MSC (2× 10.sup.5 cells/well) in 500 .Math.l of working medium (RPMl1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in 12-well cell culture plates. The plates are incubated at 37° C., 5% CO.sub.2 for 2 hours for plastic adherence of the cells. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC (1×10.sup.6 cells /well) +PHA or LPS added as mitogen, are seeded in the 12-well cell culture plate and the co-culture is incubated for 72 h at 37° C., 5% CO.sub.2

[0294] Analysis: The supernatant is labeled with anti-FLT3L antibody (MyBioSource, Inc. cat no MBS2035709) according to manufacturer’s instruction for ELISA and presence of soluble FLT3L is quantified with Spectramax microplate reader (Molecular Devices, Spectramax 190).

[0295] The CD1c+ fraction of dendritic cells is defined as CD11c+ and CD1c+ of the PBMCs, analyzed by flow cytometry (Becton, Dickinson and Company, Accuri C6 plus). The cells in suspension are labeled with anti-CD11c antibody and anti-CD1c antibody (ThermoFisher Scientific cat no 12-0116-42 and 12-0015-42 respectively) according to manufacturer’s instruction.

Results

[0296] The Drug Substance Intermediates and/or Drug Substances are analyzed for FLT3L expression and receive a score based on the relative expression compared to the other samples analyzed. The fraction of CD1c+ cells of the CD11c+ cells from the supernatant after co-culture with Drug Substance Intermediates and/or Drug Substances are analyzed and receive a score based on the relative expression compared to the other samples analyzed.

TABLE-US-00020 Illustrative example of relative FLT3L expression, CD1c+ positive cell fraction and the dendritic cell related score. The DC score is an average of the FLT3 and CD1c+ score Donor FLT3L CD1c+ FLT3L score CD1c+ score DC score D2 2.1 15% 3 3 3 D1 2.0 13% 3 2 2.5 D5 1.8 14% 3 3 3 D3 1.7 12% 2 2 2 D8 1.1 10% 2 1 1.5 RefTB1 1 12% 2 2 2 D7 0.9 15% 2 3 2.5 D6 0.9 13% 1 2 1.5 D10 0.8 8% 1 0 0.5 D9 0.4 7% 0 0 0 D4 0.2 9% 0 1 0.5 Negative 0 0 0 0 0

[0297] The score later used in the final selection of donors can be FLT3L and/or CD1c+ or the combined score presented as DC score.

Assay 11: FLT3L

[0298] Fms-related tyrosine kinase 3-ligand (FLT3L) is a key regulator of DC commitment in hematopoiesis, which regulates the proliferation, differentiation and apoptosis of hematopoietic cells through the binding to FLT3. MSCs express FLT3L that binds to FLT3 on CD1c+DCs to promote the proliferation and inhibit the apoptosis of tolerogenic CD1c+DCs. MSC expression of FLT3L measured by ELISA in co-culture with PBMC according to Assay 2, with or without stimulation with e.g. PHA or LPS.

[0299] Co-culturing MSC with PBMC: MSC (2× 10.sup.5 cells/well) in 500 .Math.l of working medium (RPMl1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in 12-well cell culture plates. The plates are incubated at 37° C., 5% CO.sub.2 for 2 hours for plastic adherence of the cells. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC (1×10.sup.6 cells /well) +PHA or LPS added as mitogen, are seeded in the 12-well cell culture plate and the co-culture is incubated for 72 h at 37° C., 5% CO.sub.2

[0300] Analysis: The supernatant is labeled with anti-FLT3L antibody (MyBioSource, Inc. cat no MBS2035709) according to manufacturer’s instruction for ELISA and presence of soluble FLT3L is quantified with Spectramax microplate reader (Molecular Devices, Spectramax 190).

Results

[0301] The Drug Substance Intermediates and/or Drug Substances are analyzed for FLT3L expression and receive a score based on the relative expression compared to the other samples analyzed. The score is later used in the final selection of donors.

TABLE-US-00021 Illustrative example of relative FLT3L expression. Donor FLT3L FLT3L score Donor FLT3L FLT3L score D2 2.1 3 D7 0.9 2 D1 2.0 3 D6 0.9 1 D5 1.8 3 D10 0.8 1 D3 1.7 2 D9 0.4 0 D8 1.1 2 D4 0.2 0 RefTB1 1 2 Negative 0 0

Assay 12: CD1c

[0302] MSC immunosuppressive effect on dendritic cells can be analyzed as a phenotypic shift towards CD1c positive cells as MSCs promote the proliferation and inhibit the apoptosis of tolerogenic CD1c+DCs.

[0303] The fraction of cells being CD1c+ will increase as the Drug Substance Intermediate and/or Drug Substance, i.e. umbilical cord derived MSCs, induce tolerance which can be analyzed flow cytometry.

[0304] Co-culturing MSC with PBMC: MSC (2× 10.sup.5 cells/well) in 500 .Math.l of working medium (RPMl1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in 12-well cell culture plates. The plates are incubated at 37° C., 5% CO.sub.2 for 2 hours for plastic adherence of the cells. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC (1×10.sup.6 cells /well) +PHA or LPS added as mitogen, are seeded in the 12-well cell culture plate and the co-culture is incubated for 48 h at 37° C., 5% CO.sub.2

Analysis

[0305] The CD1 c+ fraction of dendritic cells is defined as CD11c+ and CD1 c+ of the PBMCs, analyzed by flow cytometry (Becton, Dickinson and Company, Accuri C6 plus). The cells in suspension are labeled with anti-CD11c antibody and anti-CD1c antibody (ThermoFisher Scientific cat no 12-0116-42 and 12-0015-42 respectively) according to manufacturer’s instruction.

Results

[0306] The effect of Drug Substance Intermediates and/or Drug Substances on dendritic cells is quantified as the fraction of CD1c+ cells of the CD11c+ cells from the supernatant after co-culture. Dendritic cells cultured with Drug Substance Intermediates and/or Drug Substances are analyzed and receive a score based on the relative induction of CD1c+ expression compared to the other samples analyzed. The score later used in the final selection of donors can be FLT3L and/or CD1c+ or the combined score presented as DC score.

TABLE-US-00022 CD1c+ positive cell fraction of the dendritic cells related score. Donor CD1c+ CD1c+ score Donor CD1c+ CD1c+ score D2 15% 3 D7 15% 3 D1 13% 2 D6 13% 2 D5 14% 3 D10 8% 0 D3 12% 2 D9 7% 0 D8 10% 1 D4 9% 1 RefTB1 12% 2 Negative 0 0

Assay 13: Dendritic Cells

[0307] The combined result of Fms-related tyrosine kinase 3-ligand (FLT3L) expression of the Drug Substance Intermediate and/or Drug Substance (assay 13) and the fraction of CD1 c+ dendritic cells after coculture with the Drug Substance Intermediate and/or Drug Substance (assay 12) is combined to give a dendritic cell score.

Results

[0308] The Drug Substance Intermediates and/or Drug Substances are analyzed for FLT3L expression and receive a score based on the relative expression compared to the other samples analyzed. The fraction of CD1 c+ cells of the CD11c+ cells from the supernatant after co-culture with Drug Substance Intermediates and/or Drug Substances are analyzed and receive a score based on the relative expression compared to the other samples analyzed.

TABLE-US-00023 Illustrative example of relative FLT3L expression, CD1c+ positive cell fraction and the dendritic cell related score. The DC score is an average of the FLT3 and CD1c+ score Donor FLT3L CD1c+ FLT3L score CD1c+ score DC score D2 2.1 15% 3 3 3 D1 2.0 13% 3 2 2.5 D5 1.8 14% 3 3 3 D3 1.7 12% 2 2 2 D8 1.1 10% 2 1 1.5 RefTB1 1 12% 2 2 2 D7 0.9 15% 2 3 2.5 D6 0.9 13% 1 2 1.5 D10 0.8 8% 1 0 0.5 D9 0.4 7% 0 0 0 D4 0.2 9% 0 1 0.5 Negative 0 0 0 0 0

[0309] The score later used in the final selection of donors can be FLT3L and/or CD1 c+ or the combined score presented as DC score.

Assay 14: Regulatory T-Cells

[0310] T regulatory cells are identified as a subpopulation of the CD4+CD25+ T cell population with the capacity to suppress an immune response. This subpopulation may be further characterized by lack of expression of CD127 or positive expression of FoxP3. This fraction of cells will increase when exposed to the Drug Substance Intermediate and/or Drug Substance, i.e. umbilical cord derived MSCs, which can be analyzed by flow cytometry.

[0311] Co-culturing of MSC with PBMC: MSC (2 × 10.sup.5 cells/well) in 500 .Math.l of working medium (RPMI1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in 12-well cell culture plates. The plates are incubated at 37° C., 5% CO.sub.2 for 2 hours for plastic adherence of cells. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). PBMC (1× 10.sup.6 cells/well=500 .Math.l) are suspended in working medium and added to the 12-well plates and co-culture is continued for 24 hours at 37° C., 5% CO.sub.2.

Analysis

[0312] The cells in suspension are labeled with CD4 antibody and CD25 antibody (ThermoFisher Scientific cat no 15-0041-82 and 48-0259-42, respectively) according to manufacturer’s instruction. The cells may be further characterized by lack of expression of CD127 or positive expression of FoxP3.

Results

[0313] The fraction of CD25 positive (optionally CD127 negative or FoxP3 positive) CD4+ cells from the supernatant after co-culture with Drug Substance Intermediates and/or Drug Substances are analyzed and receive a relative score based on the fraction of CD25+ cells compared to the other samples analyzed. The score is later used in the final selection of donors.

TABLE-US-00024 Illustrative example of CD25+ positive cells. Donor CD25+ percentage CD25+ ranking score Donor CD25+ percentage CD25+ ranking score D7 8.1 3 D2 4.0 2 D6 6.0 3 D1 3.4 1 D5 5.8 3 D8 2.7 1 D4 4.7 2 D9 1.8 0 D3 4.4 2 D10 1.5 0 RefTB1 4.1 2 Negative 2.1 0

Assay 15: Changing Monocyte Phenotype

[0314] Monocytes originate from myeloid precursors in the bone marrow and they can enter CNS during inflammation. Classically, a monocyte is CD14++ CD16-. These classical monocytes are highly plastic and upon recruitment to inflamed tissues, they can change to macrophages or dendritic cells. Non classical monocytes are CD14+ CD16++ and involved in tissue homeostasis and local regeneration. MSC can change the monocyte phenotype from classical to non-classical.

[0315] Co-culturing MSC with PBMC: MSC (5× 10.sup.4 cells/ tube) in 500 .Math.l of working medium (RPMl1640 (ThermoFisher Scientific, cat no. 12633012) + 2 mM Glutamax (ThermoFisher Scientific, cat no. 35050061) + 100 U/ml Pest (ThermoFisher Scientific, cat no. 15140122) + 10% FBS (ThermoFisher Scientific, cat no. 16140071) are seeded in polypropylene culture tubes. Lymphoprep™ kit is used for isolation of mononuclear cells from donated peripheral blood, retrieved from the blood central, according to manufacturer’s instructions (Stem Cell Technologies, cat no. 07801). Monocytes from mononuclear cells, positively selected with magnetic beads coupled to monoclonal anti human CD14 antibodies from Miltenyi Biotec, (Germany # 130-050-201) are isolated according to manufacturer’s instructions. 2×10.sup.5 monocytes in 500 .Math.l of working medium, is seeded into the MSC-containing polypropylene tubes. The co-culture is incubated for 24 hours at 37° C., 5% CO.sub.2.

Analysis

[0316] Cells are collected and washed twice with DPBS+2%FBS+2 .Math.M EDTA and labelled with Anti CD14 PE (Thermofisher, Catalog # 12-0149-42) and anti-CD16 FITC (Thermofisher Catalog # 11-0168-42). The increasing expression of CD16 and the decreasing percentage of CD14++ CD16- in monocytes in co-culture with and without Drug Substance Intermediates and/or Drug Substances are compared. The donor which have highest fold induction of CD16 expression and highest suppression of CD14++CD16- will get the highest score at final donor selection.

TABLE-US-00025 Illustrative example of CD16 positive cells and suppression percentage of CD14++CD16- Donor CD16++ fold induction Ranking score CD16++ fold induction Donor CD14++CD16-Suppression percentage Ranking score CD14++ suppression percentage Monocyte ranking score D7 20 3 D7 28 2 2.5 D6 15 3 D6 33 3 3 D5 15 3 D5 22 2 2.5 D4 12 2 D4 18 2 2 D3 12 2 D3 36 3 2.5 RefTB1 10 2 RefTB1 21 2 2 D2 10 2 D2 14 1 1.5 D1 8 1 D1 20 1 1 D8 8 1 D8 31 3 2 D9 6 0 D9 13 0 0 D10 6 0 D10 11 0 0 Negative 5 0 Negative 5 0 0

[0317] The score later used in the final selection of donors can be CD16++ and/or CD14++ suppression percentage or the combined score presented as monocyte ranking score.

Assay 16: Expression of ACE2 Receptor and TMPRSS2 mRNA in WJMSCs and Pro Trans

[0318] ACE2 receptor is the entry point on the surface of target cells for infection by coronavirus spike proteins. Co-expression of the serine protease TMPRSS2 by the target cells allows for coronavirus spike protein priming.

[0319] Evaluating mRNA expression of ACE2 receptor and TMPRSS2: Total RNA was isolated from the control WJMSCs and ProTrans product (CB1, CB2 and TB1) using an RNeasy mini kit (QIAGEN). cDNA was generated from each sample using the high capacity cDNA reverse transcriptase kit. RT- samples were generated as controls for each experimental sample. Quantitative PCR (QPCR) was run using Fast SYBR Green Master Mix (Applied Biosystems) with primers designed to target the human ACE2 receptor (F 5′TTCTGTCACCCGATTTTCAA 3′ (SEQ ID NO:1; R 5′TCCCAACAATCGTGAGTGC 3′ (SEQ ID NO:2)), human TMPRSS2 (F 5′CGCTGGCCTACTCTGGAA 3′ (SEQ ID NO:3); R 5′CTGAGGAGTCGCACTCTATCC 3′ (SEQ ID NO:4)) and human RPL13A (housekeeping gene; F 5′CCTGGAGGAGAAGAGGAAAGAGA 3′ (SEQ ID NO:5); R 5′TTGAGGACCTCTGTGTATTTGTCAA 3′ (SEQ ID NO:6)). Cycling was performed as per the manufacturer’s instructions for Fast Sybr Green amplification. A total of 40 cycles were performed.

[0320] Analysis: Average Cq values from a technical repeat of three runs were compared with the average Cq value of the equivalent reverse transcriptase (RT) negative control. Where values were higher than the respective RT- sample, the gene was deemed to not be expressed. Where values were lower than the respective RT- samples, the gene was deemed to be expressed. All samples tested were negative for ACE2 receptor and TMPRSS2. All samples were positive for the house-keeping gene RPL 13A.

[0321] Results:FIG. 8 shows the results from analysis for mRNA expression of the ACE2 receptor, TMPRSS2 and house-keeping gene RPL13A in control WJ-MSC cells and ProTrans product (CB1, CB2 and TB1).

Example 4

[0322] The present Example describes the process of selection of the MSC populations derived from the donors based on the characteristics described in Example 4 resulting in a subset of cells populations for pooling to obtain the inventive pooled allogeneic composition.

Material and Methods

[0323] Analysis and ranking: The Drug Substance Intermediate samples are analyzed with the assays described above (IDO, proliferation, PGE2, HLA-G, Morphology and Fluorospot). Ranking of samples is performed as described below:

[0324] 1. The IDO assay described above is conducted two times with duplicate cell culture samples and each sample is analyzed in triplicates with ELISA. Earlier batches pooled allogeneic MSCs are used as reference samples. The IDO assay contains control samples, analyzed with each run and results generated from the analysis of control samples are evaluated for acceptability using appropriate statistical methods.

[0325] Acceptable range of the two controls are according to manufacturer’s specification. An example of acceptable ranges is: Kynurenine (.Math.mol/L) control 1: 0.53 -1,33 and control 2: 1.78-4.15; Tryptophan (.Math.mol/L) control 1: 15.0-35.0 and control 2: 31.2-72.8. Quality criteria employed for assay are: IDO controls are within the specified range and IDO activity (reference sample) > 60-fold, i.e. the fold induction of IDO activity between interferon gamma (IFN.sub.Y) reference sample compared to unstimulated reference sample.

[0326] The Drug Substance Intermediates are ranked based on their relative IDO expression.

[0327] 2. The Proliferation assay described above is conducted two times with duplicate cell culture samples and each sample is analyzed in triplicates with FACS. The samples impact on PBMC proliferation is presented as proliferation index, PI. Earlier batches pooled allogeneic MSCs are used as reference samples and PBMC stimulated with PHA in absence of MSC is used as positive control. Quality criteria employed for assay are: Proliferation Index (positive control) > 1.5 and Proliferation Index (reference) 0.9-1.3.

[0328] The Drug Substance Intermediates are ranked based on their relative Proliferation Index

[0329] 3. The PGE2 assay is conducted two times with duplicate cell culture samples and each sample is analyzed in triplicates with ELISA. The kit includes standards for establishing a standard curve for each experiment. Earlier batches pooled allogeneic MSCs are used as reference samples and the samples are compared based on the level of PGE2 expression in presence of PBMC activated by PHA. Quality criteria employed for assay are: PGE2 expression (reference) 5-15 ng/ml and Standard curves R2 > 0.95.

[0330] The Drug Substance Intermediates are ranked based on their relative PGE2 expression.

[0331] 4. The HLA-G assay is conducted two times with duplicate cell culture samples and each sample is analyzed in triplicates with ELISA or FACS. Earlier batches pooled allogeneic MSCs are used as reference samples and the samples are compared based on the level of HLA-G expression in presence of PBMC activated by PHA. The ELISA kit includes standards for establishing a standard curve for each experiment. Quality criteria employed for assay are: Soluble HLA-G expression (reference) >3 U/ml, Standard curves R2 > 0.95 and Intracellular HLA-G expression (reference) >5%, The Drug Substance Intermediates are ranked based on their relative intracellular and/or soluble expression of HLA-G.

[0332] 5. The morphology assessment is conducted by laboratory personnel with long experience in MSC culturing. Earlier batches pooled allogeneic MSCs are used as reference samples and the samples assessed based on: size of cell (normal or big); size of nuclei (normal or big); shape of cell (normal or abnormal); and ration between cell and nuclei size (normal or abnormal). Quality criteria employed for assay are:

[0333] >90% normal cells according to all four criteria. Reference sample has > 90% normal cells. The Drug Substance Intermediates that have more than 10% abnormal cells are disqualified. The Drug Substance Intermediates are ranked based on the frequency of abnormal cells.

[0334] 6. The Fluorospot assay is conducted two times with triplicate cell culture samples. Earlier batches pooled allogeneic MSCs are used as reference samples. The Drug Substance Intermediates are ranked based on their relative expression or suppression of specific proteins.

[0335] 7. Microglia proliferation assay is conducted two times with at least duplicate cell culture samples. Earlier batches pooled allogeneic MSCs are used as reference samples and microglia proliferation in presence of mitogen and absence of MSC is used as negative control. The Drug Substance Intermediates are ranked based on their relative ability to suppress microglia proliferation as measured by growth index, proliferation index or proliferation percentage.

[0336] 8.-10. Microglia expression assays are conducted two times with at least duplicate cell culture samples. Earlier batches pooled allogeneic MSCs are used as reference samples. Mitogen stimulated microglia, cultured without MSC is used as negative control. The Drug Substance Intermediates are ranked based on their relative increase of M2 markers and/or decrease in expression of M1 markers and/or a combinatorial shift from M1 to M2 phenotype.

[0337] 11. Dendritic cell assays is conducted two times with at least duplicate cell culture samples. Earlier batches pooled allogeneic MSCs are used as reference samples.

[0338] Outliers and disqualification of samples: ELISA and FACS are analyzed in triplicates from each cell culture well. Only one of the three triplicates can be regarded as an outlier. Measurements from a cell culture well are analyzed for outliers if the coefficient of variance (CV) is > 10%. The replicate which is deviating most from the average is considered an outlier if the exclusion of the replicate will decrease CV with > 3% when removed from the analysis. Such outliers are excluded from the analysis without further justifications.

[0339] The analysis of a single cell culture well is disqualified if the CV > 20% after outlier analysis has been conducted. Three or more disqualified cell culture wells in the same experiment will disqualify the experiment.

[0340] Overall assessment: The selection of Drug Substance Intermediates is an overall assessment of the assays according to a point system presented in Table 21 below. Each assay generates a ranking score and in this final selection, the ranking score of all the assays is summarized by addition.

[0341] Selecting 5 donors from the 10 donors can be accomplished by conducting at least 2 of IDO, PGE2 and Proliferation assay with at least 1 of the assays microglia proliferation, microglia M1 suppression, microglia M2 fold increase, Dendritic cell tolerogenicity or Regulatory T cell described in Example 3. Illustrative minimal selection algorithms with added value selection is presented in Table 21 and 22. Here ranking values are added for each assay to obtain an additive total score.

TABLE-US-00026 Example of selection based on additive total score Donor (DX) IDO PI Microglia Growth Index Total score Selected D1 2 2 2 6 yes D2 1 1 0 2 no D3 2 2 1 5 no D4 3 2 2 7 yes D5 3 3 3 9 yes D6 2 3 3 8 yes D7 3 3 3 9 yes D8 1 1 2 4 no D9 0 0 0 0 no D10 0 0 0 0 no

TABLE-US-00027 Example of selection based on additive total score Donor (DX) IDO PGE2 Monocyte assay Total score Selected D1 2 2 1 5 no D2 1 1 1.5 3.5 no D3 2 2 2.5 6.5 yes D4 3 3 2 8 yes D5 3 3 2.5 8.5 yes D6 2 2 3 7 yes D7 3 3 2.5 8.5 yes D8 1 1 2 4 no D9 0 0 0 0 no D10 0 0 0 0 no

[0342] Alternatively selecting 5 of the 10 donors is done by assigning a weight the assays, thus allowing an analysis to influence the selection of more or less donors. An example would be to put a factor two on microglia assay in Table 21 and decrease the importance of proliferation of peripheral blood lymphocytes to half. Weighed ranking scores are added to obtain a weighed total score. The results from Table 21 based on weighed total score are shown in Table 23:

TABLE-US-00028 Example of selection based on additive total score Donor (DX) IDO PI (x0.5) Microglia GI (x2) Total score Selected D1 2 1 4 7 yes D2 1 0.5 0 1.5 no D3 2 1 2 5 no D4 3 1 4 8 yes D5 3 1.5 6 10.5 yes D6 2 1.5 6 9.5 yes D7 3 1.5 6 10.5 yes D8 1 0.5 4 5.5 no D9 0 0 0 0 no D10 0 0 0 0 no

[0343] Alternatively selecting 5 of the 10 donors is done by assigning a weight the assays, thus allowing an analysis to influence the selection of more or less donors. An example would be to put a factor three on IDO assay in Table 15 and increase the importance of the monocyte assay by factor 2. Weighed ranking scores are added to obtain a weighed total score. The results from Table 22 based on weighed total score are shown in Table 24:

TABLE-US-00029 Example of selection based on additive total score of 3 assays with different weight Donor (DX) IDO (x3) PG E2 Monocyte assay (x2) Total score Selected 5 D1 6 2 2 10 no D2 5 1 3 9 no D3 6 2 5 13 yes D4 9 3 4 16 yes D5 9 3 5 17 yes D6 6 2 6 14 yes D7 9 3 5 17 yes D8 3 1 4 8 no D9 0 0 0 0 no D10 0 0 0 0 no

[0344] An example of a selection algorithm based on 11 assays is presented in Table 25.

TABLE-US-00030 Example of selection based on additive total score of 11 assays with the same weight Assay 1 2 3 4 5 6 7 10 13 14 15 Total Score Selecte d D1 2 2 2 2 2 2 2 2 3 1 1 21 Yes D2 1 1 1 1 2 2 0 2 2, 5 2 1,5 16 No D3 2 2 2 2 1 1 1 1 2 2 2,5 18,5 No D4 3 2 3 3 2 2 2 1 0, 5 2 2 22,5 Yes D5 3 3 3 3 3 3 3 3 3 3 2,5 32,5 Yes D6 2 3 2 2 3 3 3 3 1, 5 3 3 28,5 Yes D7 3 3 3 3 3 3 3 3 2, 5 3 2,5 32 Yes D8 1 1 1 1 1 1 2 2 1, 5 1 2 14,5 No D9 0 0 0 0 0 0 0 0 0 0 0 0 No D10 0 0 0 0 0 0 1 0 0, 5 0 0 1,5 No

Results

[0345] The 5 Drug Substance Intermediates (DX) with the highest total score (additive/simple or weighed) are selected for manufacturing of the isolated pooled allogeneic MSC population, i.e. the Drug Product, as disclosed herein. Thus, the isolated, pooled allogeneic population comprises MSCs derived from 5 different donors, which MSCs fulfil the functional, morphological and safety criteria as disclosed herein.

Example 5

[0346] The present Example describes the process of manufacturing the Final Product, which is a single cell suspension comprising excipients as described below. Said Final Product is filled in transfer bags suitable for cryopreservation and frozen according to predefined temperature curves as described below.

TABLE-US-00031 Composition packaging of Final Product″ Alburex 5 (CSL Behring), 50 G/L; human serum albumin 50 g/L; purity of protein > 96%, sodium N- acetyltryptophanate, sodium caprylate, sodium chloride CELL SUSPENSION COMPONENTS Component Function Quantity Quality Allogeneic WJMSCs Active Substance 100×10.sup.6 cells In-house 5% Human Serum Albumin.sup.∗ Component of Cryoprotectant 90% vol/vol (4.5 mL) Ph.Eur Dimethyl Sulfoxide (DMSO).sup.∗∗ Component of Cryoprotectant 10% vol/vol (0.5 mL) Ph.Eur PACKAGING COMPONENTS Component Description Function Quality Cryobags Bag; ethylene vinyl acetate Primary container Ph.Eur Cassette Container; aluminum alloy Protective container In-house Label Cryo label Information In-house .sup.∗∗ WAK Chemie, Cat.no. WAK-DMSO-50.

Materials and Methods

Pooling of Donors

[0347] Only donor samples that pass all acceptance criteria are considered for pooling. The Drug Substances used are selected according to Example 4 and 5. The pooling of Drug Substance in passage 2 or 3 is directly followed by cryopreservation. The Drug Product is thus obtained. Importantly, the Drug Product is not subjected to any further culturing or expansion.

Formulation and Packaging of Drug Product

[0348] The Final Product is a 5 mL of cell suspension and is presented in cryobags. The composition of cryopreserved Final Product, comprising the Drug product, is shown in Table 26.

Results

[0349] Thus, a resulting Final Product is obtained as disclosed herein.

Example 6

[0350] The present Example describes evaluation of the stability of the Final Product after cryopreservation. It shows that the Final Product is stable for at least 2 hours post thawing.

Materials and Methods

[0351] The inventive composition is shipped on liquid nitrogen or on dry ice in cryo bags containing 5 ml of cell suspension with 30, 50, 60 or 100 million cells per bag (the Final Product). The cryo bag is thawed in water bath (37° C.) and directly diluted with autologous spinal fluid or lactated Ringer’s solution, usually 10 ml. The injection solution of 15 ml is then ready for infusion. The viability of the cells is analyzed by taking a sample from the infusion bag at different time points.

[0352] Stability of the Drug product is investigated by flow cytometry analysis to the apoptotic marker 7AAD. The Drug Product is stable for more than 2 hours post thaw undiluted (FIG. 2a). The Drug Product is diluted in sodium chloride infusion solution by transferring the drug product from the cryo bag to a saline infusion bag (Baxter). Aliquots are taken at different time points while kept at room temperature (FIG. 2b).

Results

[0353] Viability: The Drug Product is regarded stable until the time point when the viability has decreased to 80 % of the viability measured instantly after thawing. The Drug Product has been tested for MSC specific cell surface markers and culturing potency at the stability time limit of 2 hours. The Drug Product has shown sustained characteristics after 2 hours and acceptable viability for both diluted and undiluted.

[0354] Conclusion: The analyzed batch the inventive composition fulfills quality criteria with cell viability.

Example 7

[0355] The present Example provides a summary of the clinical study design of intravenous administration of the inventive pooled allogeneic MSC composition into patients diagnosed with COVID-19. Safety and tolerance of intravenous infusion of inventive pooled allogeneic MSC composition in adult patients diagnosed with COVID-19 over 24 months. Any adverse events will be reported and potential causal relationship with the Final product will be investigated.

[0356] Study Objectives: The primary objective of the study is to investigate the safety and tolerance of intravenous infusion of the inventive pooled allogeneic MSC composition in adult patients with COVID-19. Secondary objectives include to assess the effect of the Final Product on patient clinical status including mortality to day 7, 15 and 30 as assessed on the 9-point ordinal scale (0. No clinical or virological evidence of infection. 1. No limitations of activities. 2. Ambulatory, limitation of activities. 3. Hospitalized, not requiring supplemental oxygen. 4. Hospitalized, requiring supplemental oxygen. 5. Hospitalized, on non-invasive ventilation or high flow oxygen devices. 6. Hospitalized, intubated and on mechanical ventilation. 7. Hospitalized, ventilation + additional organ support - pressors, RRT, ECMO, 8. Death); time to clinical improvement of one category from admission on the 9 point ordinal scale; effect of the Final Product on lung damage using imaging techniques; duration of hospitalisation and intensive care unit stay; kinetics of COVID-19 viral load after infusion with the Final Product; evolution of biological markers of liver, myocardium and inflammation after infusion with the Final Product; tolerance of the Final Product for severe COVID-19 respiratory conditions.

[0357] Study design: This is a an open, dose escalating Phase IB Clinical Trial.

[0358] First cohort of three patients will receive the dose of 25 Million MSCs per patients. In case of no toxicity among the first cohort, the second cohort of three patients will receive the dose of 100 Million MSCs per patients. If the first patient experiences one toxicity grade 3 or 4 related to the study drug, the DSMB of the study will provide the sponsor with a recommendation on how to proceed. The sponsor will then take a decision on stopping the trial. If no AE grade 3 or 4 is observed post dosing of the first patient the next patient will be dosed as planned. A total of 3 patients will be treated with a dose of 25 Million MSCs. If there are no severe AEs observed in the first cohort the trial will proceed and dosing of the second cohort of three patients at the dose of 100 Million MSCs per patients will be continued. Rules for the third cohort will be the same. In case of no toxicity grade 3 or 4 related to the study drug among the first and the second cohorts and individuals within each cohort, the third cohort of three patients will receive the dose of 200 Million MSCs per patients.

[0359] Screening and informed consent: After signature of the informed consent, the following assessments will be performed to determine eligibility requirements as specified in the inclusion and exclusion criteria, and will be scheduled before the inclusion of the patient in the study: [0360] Demography, medical history (treatments, co-morbidities and allergies) [0361] Confirm the positive SARS-CoV-2 test result by PCR in any specimen before inclusion [0362] Classification of the pneumonia assessed by SpO.sub.2 measurement and need of supplemental oxygen [0363] Blood test for screening laboratory evaluations, if last results >72 h from day of inclusion: [0364] ✓ Haematology (WBC, haemoglobin, platelet count) [0365] ✓ Biochemistry (AST, ALT total bilirubin, serum creatinine, blood electrolytes (including kaliemia), CPK, NT-proBNP, CK-Mb, haptoglobin, Troponin I, procalcitonin, LDH, ferritinaemia, CRP) [0366] ✓ Hemostasis markers (D-dimer levels, INR, fibrinogen, anti-thrombin and antiXa activity) [0367] ✓ Serological profile of HIV, syphilis, HEP B, HEP C [0368] Investigate tuberculosis infection or prior exposure [0369] Urinary test for cytobacterium evaluation, if last results >72 h from day of inclusion [0370] Urine or serum pregnancy test (in women of childbearing potential) Treatment - Intravenous administration of WJMSCs and acute monitoring: Post- screening and study inclusion study subjects will receive an intravenous injection of the WJMSCs.

[0371] The inventive pooled allogeneic MSC composition will be delivered to the study clinic in liquid nitrogen. The drug product is thawed in water bath for 3-5 minutes. The Final Product is diluted in 100 ml of saline prior to administration.

[0372] During the hospitalization the subject will be observed by research nurses for any Adverse Events during and immediately following the intravenous injection of the inventive pooled allogeneic MSC composition.

[0373] Follow-up: Patients will be evaluated post-treatment according to Table 27.

[0374] Final Follow-up Visit: All study subjects, will have a final follow-up visit 24 months after MSC composition treatment. At this visit patients will undergo the following procedures as illustrated in Table 27.

TABLE-US-00032 Summary table of evaluation post treatment Eligibi -lity inclusion Day 0 Before MSC infusion (Baseline) Day 0 3 hours after MSC infusion 1 Day 1 post-MSC Day 3 post-MSC Day 5 post-MSC Day 8.sup.2 post-MSC Day 15.sup.2 post-MSC Day of discharge OR Day 30.sup.2 Follow up: Months 2, 3, 4, 5, 6 (+/- 2 weeks) post- MSC Long term follow up: Month 12, 18, 24 (+/-2 weeks) post-MSC Informed Consent.sup.1 x Medical history (treatments and comorbidities) and demography x Clinical status (7 point ordinal scale) Everyday Serological status (HIV, syphilis, HEP B, HEP C) x Urinary test (for bacterial infection) x β-HCG (urine) x SARS-CoV-2 RT-PCR in any specimen x SARS-CoV-2 RT-PCR in throat swab x x x x x O.sub.2 Saturation (twice a day).sup.3 x Everyday O.sub.2 requirement (twice a day).sup.3 x Everyday Haematology (WBC, haemoglobin, platelets count) x x x x x x x x x x Biochemistry (AST, ALT total bilirubin, serum reatinine,Na+ K), CPK, NT-proBNP, CP-Mb, haptoglobin, Troponin 1, procalcitonin, LDH, ferritinaemia, CRP) x x x x x x x x x x Hemostasis markers (D-dimer levels, INR, fibrinogen, anti-thrombin and antiXa activity ) x x x x x x x x x Chest X ray, CT scan, or doppler ultrasound (optional.sup.4) Prior to MSC infusi on After MSC infusion, prior to hospital discharge Adverse events Everyday if applicable (or at each visit) Plasma Biobanking x.sup.5 x x x x x 1 : Informed consent should be signed before any study procedure 2: All procedures need to be conducted according to the table up to D8. This protocol is designed to follow patients until Day 30. However, if the patient is discharged prior to D30, examinations, with the exception of adverse events, related to Day 30 follow- up visit will be performed on discharge. This means that patients will be followed-up to D15 OR the point of discharge (if discharge take place after D15). Adverse events will be followed up to Day 30 in the form of a telephone call once a week to the patient if they have been discharged from care prior to this timepoint. 3: worst values/requirements are kept among the 2 daily measurements 4: These examinations are not required by the trial but can be exploited if done before and after MSC infusion for clinical need. 5: Immediately prior to MSC infusion

[0375] End of trial: The end of study is defined as the last patient’s last follow-up. The Principle Investigator has the right to at any time terminate the study for clinical or administrative reasons. The study may be prematurely terminated due to a high number of serious adverse events related to the ATMP or if the enrolment process cannot be completed within a reasonable time frame.

[0376] Decision on premature study termination will be made by sponsor/principal investigator. Study termination will be reported to the MPA within 90 days, or within 15 days if the study is terminated prematurely. The Investigators will inform participants and ensure that the appropriate follow-up is arranged for all involved. A summary report of the study will be submitted to the Medical Products Agency, MPA, within one year after study termination. All patients will be followed-up for two years post study treatment. Patients will be followed-up regarding safety aspects assessed by a study investigator at all follow-up visits.

[0377] Alternatively, intrathecal delivery is used in the clinical study. The clinical study design is the same as for the study comprising intrathecal administration, with the following exception: the Final Product will be delivered in a volume of 10-15 ml..

[0378] Alternatively the intravenous infusion of the Final Product may constitute a Phase II randomized, double-blinded study using a 1:1 randomisation strategy for Final Product to Placebo as defined below:.

[0379] Study objectives: To evaluate the efficacy of a single infusion of a fixed dose of Final Product (100 Million MSCs per patient) in the treatment of “severe” COVID-19 pneumonia defined as patients who cannot saturate > 96% on 4 L/min of O.sub.2 and who are neither on ‘non-invasive’ ventilation, NOR invasive mechanical ventilation NOR ECMO. The primary composite end point is the rate of use of mechanical ventilation (i.e., need for intubation) or death at 15 days after inclusion. The secondary endpoints for the study are: [0380] Clinical status evolution at day 7, 15 and 30 as assessed by the 9-point ordinal scale [0381] Survival at day 7, 15 and 30 [0382] Time to clinical improvement, defined as time from randomization to either an improvement of 1 point on the 9-point ordinal scale or discharge from hospital [0383] Duration of hospitalization and ICU stay

[0384] Explorative (research) endpoints: [0385] Quantitative PCR SARS-CoV-2 virus in nasopharyngeal samples (time frame: before MSC infusion on Day 0 and after MSC infusion as per clinical indication). [0386] White blood cells, hemoglobin, platelets count and standard hemostasis markers (D-dimer levels, prothrombin time, International Normalized Ratio (INR), fibrinogen and antiXa activity), assessed in peripheral blood (time frame: before MSC infusion on Day 0 and after MSC infusion on Days 1, 3, 5, 8, 15, and on Day 30 or Day of hospital discharge if earlier). [0387] Standard biological markers of inflammation and myocardial damage: glutamic oxaloacetic and alanine aminotransferase, total bilirubin, serum creatinine, blood electrolytes, creatine phosphokinase, NT-proBNP, myoglobin, haptoglobin, Troponin T, procalcitonin, LDH, ferritin, CRP, assessed in peripheral blood (time frame: before MSC infusion on Day 0 and after MSC infusion on Days 1, 3, 5, 8, 15, and on Day 30 or Day of hospital discharge if earlier). [0388] Lung damage assessed by imaging techniques (Chest X ray/CT scan /or on doppler ultrasound) when clinically indicated [0389] Research biomarkers including Angiopoietin 2, IL-1β, IL-6, IL-8, IL-10, TNFα, VEGF, RAGE and antiSARS-CoV2 IgG and IgA; evaluated using multiplex electrochemiluminescence based techniques. Change from Baseline (time frame: immediately before MSC infusion on Day 0, and after MSC infusion at 3 hours, and on days 1, 8, 15, and on Day 30 or Day of hospital discharge if earlier). [0390] Peripheral blood mononuclear cells for single cell RNA Sequencing and/or flow cytometry (time frame: immediately before MSC infusion on Day 0, and after MSC infusion at 3 hours, and on days 1, 8, and on Day 30 or Day of hospital discharge if earlier).

[0391] Study design: This is a randomised, double-blinded placebo controlled Phase II Clinical Trial. A total of 48 patients will be enrolled, with a 1:1 randomisation of Final Product to Placebo used. Stratification of the study population to each treatment arm will be based on age and gender. Each patient enrolled will receive an intravenous infusion of Final Product or Placebo and evaluated for 12 months post-treatment.

[0392] Screening and Informed Consent: After signature of the informed consent, the following assessments will be performed to determine eligibility requirements as specified in the inclusion and exclusion criteria, and will be scheduled before the inclusion of the patient in the study: [0393] Demography, medical history (treatments, co-morbidities and allergies) [0394] Confirm the positive SARS-CoV-2 test result by PCR in any specimen before randomization [0395] Classification of the pneumonia, assessed by SpO.sub.2 measurement and need of supplemental oxygen [0396] Blood tests for screening laboratory evaluations, if last results <72 h from day of randomization: [0397] Absolute neutrophil count [0398] Platelets [0399] ALT or AST [0400] Creatinine [0401] Serological profile of VIH, syphilis, VHB, VHC [0402] Investigate ongoing tuberculosis infection [0403] Urinary test if last results <72 h from day of randomization [0404] Urine or serum pregnancy test (in women of childbearing potential)

[0405] The following assessments will be performed as needed for baseline data, in addition to already-obtained screening measures: [0406] At Day 0, prior to MSC infusion: [0407] Clinical status as assessed on the 9-point ordinal scale (0. No clinical or virological evidence of infection. 1. No limitations of activities. 2. Ambulatory, limitation of activities. 3. Hospitalized, not requiring supplemental oxygen. 4. Hospitalized, requiring supplemental oxygen. 5. Hospitalized, on non-invasive ventilation or high flow oxygen devices. 6. Hospitalized, intubated and on mechanical ventilation. 7. Hospitalized, ventilation + additional organ support - pressors, RRT, ECMO, 8. Death) [0408] Quantitative PCR SARS-CoV-2 virus in nasopharyngeal swabs [0409] O.sub.2 saturation and O.sub.2 requirement [0410] White blood cell, hemoglobin, platelets count and standard hemostasis markers (D-dimer levels, prothrombin time, INR, fibrinogen, and antiXa activity) in peripheral blood [0411] Standard biological markers for inflammation and myocardial damage within the peripheral blood: ALT, AST, total bilirubin, serum creatinine, blood electrolytes, creatine phosphokinase, NT-proBNP, myoglobin, haptoglobin, Troponin T, procalcitonin, LDH, ferritin, CRP [0412] Plasma and Peripheral blood mononuclear cell (PBMC) biobanking

[0413] Any time prior to MSC infusion, for COVID-19 evaluation Chest X ray/CT scan /or on doppler ultrasound if done for clinical purposes

[0414] MSC Infusion: Cryobags are thawed at bedside and diluted in 100 ml of saline prior to administration. Cells will be delivered at a rate of 5 million cells per minute over a total of 20 minutes. The product will be evaluated visually to ensure no visible clumps or cell debris prior to, or during, the infusion process.

[0415] Experimental treatment group: single dose of 100×10.sup.6 WJ-MSC/patient administered by slow intravenous infusion at a rate of 5 million cells per minute over a total of 20 minutes. Placebo group: sodium chloride buffer supplemented with 5 % human serum albumin (HSA) and 10 % dimethyl sulphoxide (DMSO) same volume and mode of administration than the experimental treatment group.

[0416] Follow-up visits: The following assessments will be performed daily after the intervention [0417] Clinical status as assessed on the 9-point ordinal scale [0418] O.sub.2 saturation and O.sub.2 requirement evaluation twice a day. Worst value will be taken [0419] Evaluation of the safety according to the criteria of the Common Terminology Criteria for Adverse Events (CTCAE) Version 5 [0420] The following evaluations will be performed at Day 1, 3, 5, 8, 15 and 30 (or day of hospital discharge if earlier). If they are done as part of clinical care the data will be included in the study, otherwise samples will be obtained, stored and tested as part of ‘exploratory outcomes: [0421] Biological examinations including: [0422] Hematology: White Blood Cells, hemoglobin, platelet count [0423] Biochemistry: ALT, AST, total bilirubin, serum creatinine, blood electrolytes, CPK, NT-proBNP, myoglobin, haptoglobin, Troponin T, procalcitonin, LDH, ferritin, CRP [0424] Hemostasis markers: D-dimer levels, prothrombin time, INR, fibrinogen, and [0425] antiXa activity [0426] Plasma and PBMC biobanking will be performed at Day 0, 3 hours after MSC infusion, and days 1, 8, and Day 30 (or day of hospital discharge if earlier) [0427] Evaluation of survival will be assessed at Day 7, 15 and 30 [0428] Chest X ray/CT scan or doppler ultrasound if clinically indicated

[0429] Final study visit: The End of the study is when all inclusions and all patients have completed their follow-ups. The last visit of this study is Day 30. If patient is discharged from the hospital before day 30, he/she will undergo last biological evaluations at day of discharge but clinical status since hospital discharge and adverse events will be assessed by phone call to the patient at weekly intervals.

Example 8

[0430] The present Example describes the selection criteria for the study population. Each patient enrolled in the study has to fulfill all inclusion criteria and none of the exclusion criteria.

[0431] Inclusion and Exclusion criteria: Subjects will be recruited from the population of diagnosed with COVID-19.

[0432] Inclusion criteria are as follows: [0433] Male or female, ≥18 years old [0434] Has laboratory-confirmed SARS-CoV-2 infection as determined by reverse-transcription polymerase chain reaction (RT-PCR) in any specimen prior to inclusion. [0435] Hospitalized patients [0436] Patients classified as severe pneumonia, as defined by the need for continuous supplemental oxygen 5 L/min O.sub.2 OR high flow oxygen, 35% FiO.sub.2 > 301 /min and cannot saturate > 96% NOT under “non-invasive” ventilation NOR invasive mechanical ventilation NOR ECMO [0437] Women of childbearing potential must agree to use contraception or acceptable birth control for the duration of the study.

[0438] Exclusion criteria are as follows: [0439] Inability to provide informed consent [0440] Patients not expected to survive for 24 hours or mechanically ventilated at inclusion or previously during present hospitalization [0441] Pregnant or nursing (lactating) women, where pregnancy is defined as the state of a female after conception and until the termination of gestation, confirmed by a positive human chorionic gonadotrophin (hCG) laboratory test [0442] Patients with BMI ≥30 [0443] Patients with known, or previous, malignancy [0444] Patients with other serious systemic diseases deemed of contra-indication by the physician [0445] Patient with any of following laboratory results out of the ranges detailed below at screening: Absolute neutrophil count (ANC) ≤ 1.0 × 10.sup.9/L, Platelets (PLT) < 50 10.sup.9 /L, ASAT or ALAT > 5N, eGFR < 30 mL/min [0446] Current documented bacterial infection [0447] Serological evidence of infection with human immunodeficiency virus, Treponema pallidum, hepatitis B antigen (serology consistent with previous vaccination and a history of vaccination is acceptable) or hepatitis C [0448] Latent or previous as well as on-going therapy against tuberculosis, or exposed to tuberculosis or have travelled in areas with high risk of tuberculosis or mycosis within the last 3 months [0449] Patients with known allergies to a component of the ProTrans® product [0450] Ongoing treatment with Remdesivir [0451] Pre-existing chronic respiratory diseases requiring long- term oxygen therapy [0452] Pre-existing cirrhosis with basal Child and Pugh of C [0453] Patients with history of increased risk for thrombo- embolic and/or co-morbidity for thrombo- embolism [0454] Patients with a history of myocardium infarction [0455] A history of cardiac dysfunction.sup.1

Results

[0456] Study population of 9 individuals is selected based on the criteria described above. A subject may withdraw consent for study participation either before or after administration of the trial intervention. The reason for subject discontinuation will be documented in the Case Report Form (CRF). If a subject is discontinued due to an AE, the nature of the event and its clinical course must be fully documented

Example 9

[0457] The present Example describes how the clinical study is performed. Herein the inventive pooled allogeneic MSC composition is referred to as Drug Product and the pharmaceutical composition as Final Product. Thus, the Final Product comprises the Drug Product.

Material and Methods

[0458] The Drug Product is defined as an allogeneic cell suspension of from multiple donors. MSC are isolated through explant from Wharton Jelly, expanded until passage 2 or 3. The Drug Product contains pooled ex vivo expanded cells from 5 donors. The production of each batch starts with explant culture of tissue from approximately 20 qualified donors from which 5 donors are finally selected as Drug Product donors as described herein.. In addition to the MSC characterization, cells are selected based on morphology, proliferative capacity and functional assays related to immunosuppression and immunomodulatory capacity.

[0459] The cells are frozen in cryo bags at concentrations of 30, 60 or 100 × 10.sup.6 cells in 5 ml 5% HSA and 10% DMSO, one cryo bag contains one dose. The bags are frozen in a controlled rate freezer and directly transferred to -190° C. for storage until it is time for infusion. The cryopreserved bags are transported by the Manufacturer on liquid Nitrogen to the investigator’s site, where it is thawed bed-side and diluted in autologous spinal fluid which is aspirated through lumbar puncture for immediate dilution of drug product and intrathecal injection. Alternatively, where intravenous or intraarterial infusion will be utilized the Drug Product will be diluted in 100 ml of saline prior to administration. Minimum 24 hours before injection, the investigator will send a requisition to the Manufacturer for delivery of the IP. On the day of infusion, the applicable Final product is transported by the Manufacturer to the investigator site.

[0460] The Final Product is considered delivered when the Manufacturer has handed over the cryobag in liquid nitrogen transportation canister. When the patient is ready for infusion, the cells are thawed bed-side in a water bath. The thawed Final Product is diluted in 10 ml spinal fluid which gives a total of 15 ml infusion volume for intrathecal delivery or 100 ml of saline for intravenous or intraarterial delivery. The Final Product should be administered to the patient within 30 minutes after preparation, however not later than 2 hours after preparation..

[0461] Cells are administered intravenously in a dose of 100 ml of saline. The placebo will be an equivalent volume DMSO for intravenous or intraarterial studies. For phase II studies this will be a double-blinded study where both the study subjects and study personnel performing post-injection assessments of safety and efficacy will be blinded to whether subjects received WJMSC or placebo.

[0462] Subjects will be randomised to receive either Drug Product or Placebo treatment.

[0463] All patients will receive standard COVID-19 treatment. Study patient receiving concomitant medication which may interfere with study treatment will be withdrawn from the study. The investigator will instruct the patient to notify the study site about any new medications he/she is taking when study treatment has started. All medications and significant non-drug therapies (including physical therapy and blood transfusions) administered after the patient starts treatment with study drug must be listed in the CRF and medical records.

[0464] The study is completed at the 2 year follow-up after infusion of Drug Product/Final Product.

Results

[0465] The above described approach assures the proper application of the product and allows the study of the safety and efficacy of the product.

[0466] Number and frequency of adverse events will be recorded from the time of enrolment until the end of the follow-up period or, in the case of early withdrawal, to the time of study withdrawal. Adverse Events (AEs and SAEs) are noted in the patient’s medical record and a separate AE/SAE report is completed for each AE/SAE. Patients will be asked to report any adverse events at each visit following the screening visit. Vital signs, physical examination, neurological examination (by investigator), blood and urine samples will be analysed at specified times throughout the study for safety.

[0467] Two patients have received an infusion with 25 million cells formulated as investigational medicinal product IMP (in other words Final Product) in the clinical trial EudraCT number: 2020-002078-29 (Treatment of Respiratory Complications Associated with COVID-19 Infection Using Wharton’s Jelly (WJ)-Umbilical Cord (UC) Mesenchymal Stromal Cells (ProTrans®): open Phase IB Clinical Trial). No servere adverse reactions has been registered and the patients were discharged 1 and 5 days after infusion, respectively. One patient has received an infusion with either 100 million cells formulated as IMP or placebo in the Canadian clinical trial Project code number: 2021-6954 (Treatment of Respiratory Complications Associated with COVID-19 Infection Using Wharton’s Jelly (WJ)-Umbilical Cord (UC) Mesenchymal Stromal Cells (ProTrans®): a Randomized Phase II Controlled Clinical Trial). No severe adverse reactions has been registered.

[0468] It is expected that the present example will show that treatment with Drug Product as disclosed herein will show one or more of the following results: decrease in hospitalization time, decreased need for supplemental oxygen or high flow supplemental oxygen, decreased need for medical ventilation (such as need for mechanical ventilation for example ECMO), decreased need for organ support, and increase survival.

[0469] Additionally, it is expected that the present treatment will not lead to any clinically relevant induction of anti-HLA antibodies in the patients

Example 10

[0470] The present Example shows that the isolated, pooled allogeneic MSC population according to the present disclosure exhibit higher baseline secretion of immunomodulatory molecules, without the need for culture post-pooling, compared to MSCs derived from single donors or other sources of MSCs such as bone marrow MSCs.

Material and Methods

[0471] Assay 1: IDO assay. IDO assay is used to analyze the immunosuppressive capacity of Drug Substance Intermediate or Drug Substance, i.e. mesenchymal stem/stromal cells (MSC).

[0472] The WJ-MSC immunomodulatory potential is reported as a measure of indoleamine 2,3-dioxygenase (IDO) activity, determined by measuring tryptophan and kynurenine in the culture supernatant. The IDO activity is the ratio of kynurenine/tryptophan and can be determined by calculating the amount of tryptophan and kynurenine present in cell culture supernatants using an ELISA kit. The inventors present data demonstrating that pooling of WJ-MSCs results in higher baseline (unstimulated) levels of IDO activity compared to single WJ-MSC donors or bone marrow derived MSCs.

[0473] MSC culturing: Seed 10 000 MSC / well in 48-well cell culture plates in 100 .Math.l assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)). Add 100 .Math.l assay medium to the cells.

[0474] Incubate cell culture plate at 37° C., 5% CO.sub.2 for 72 hours. Remove the supernatant from each well and store in micro tubes at -20° C. until further processing for ELISA analysis. Tryptophan and kynurenine measurements are done according to manuals provided by the ELISA-kit manufacturer (Immundiagnostik AG, cat no. K 3730 and K 3728). Both tryptophan and kynurenine ELISA are performed on the same day but at separate occasions. The two ELISAs are conducted according to manufacturer’s instructions; see the manuals for respective ELISA.

[0475] Absorption at 450 nm with background subtraction at 620 nm is measured in a Spectramax microplate reader (Molecular Devices, Spectramax 190).

[0476] Analyzing results: Amount of absorbance measured is inversely proportional to the amount of amino acid present in the sample; i.e. the lower the OD450, the more kynurenine or tryptophan there is. The 4PL-algorithm (Four Parameter Logistic Regression) is used to calculate results (software SoftMax Pro 7.0.2, Molecular Devices), as recommended by kit manufacturer. Concentrations are determined directly from the standard curve. The control samples provided with the kits should are evaluated for acceptability: if outside the acceptable range according to the manufacturer of the kit, the samples need to be re-assayed.

Results

[0477] The ratio of kynurenine/tryptophan was evaluated in pooled WJ-MSCs (TB1) compared to single cell WJ-MSC donors, bone marrow derived MSCs and a JEG-3 control cell line derived from human placenta choriocarcinoma. Higher baseline IDO activity was seen in TB1 pooled WJ-MSCs compared to all other cell sources evaluated (FIG. 6).

Material and Methods

[0478] Assay 2: Prostaglandin E2 (PGE2) assay evaluates Drug Substance Intermediate and/or Drug Substance secretion of PGE2 in culture medium supernatant.

[0479] Cell culturing: Cells are cultured in assay medium (DMEM, low glucose, GlutaMAX™ Supplement, pyruvate (ThermoFisher Scientific, cat no. 21885025) + 10% Fetal Bovine Serum, qualified, heat inactivated (ThermoFisher Scientific, cat no. 16140071)) for 3 days. 40 000 MSCs are seeded per well in 12-well cell culture plates. Cell culture plates are incubated at 37° C., 5% CO.sub.2.500 .Math.l assay medium. The cell culture plate is incubated at 37° C., 5% CO.sub.2 for 72 hours. The supernatant is removed from each well and centrifuged for 5 min at 500 g to remove particulates. The supernatant is frozen and stored at -20° C. until further processing for ELISA analysis.

[0480] The Parameter™ Prostaglandin E2 Immunoassay kit is used for PGE2 expression detection according to manufacturer’s instruction (Bio-Techne, cat no. KGE004B) and is analyzed with Spectramax microplate reader (Molecular Devices, Spectramax 190). The 4PL-algorithm (Four Parameter Logistic Regression) is used to calculate results (software SoftMax Pro 7.0.2, Molecular Devices).

Results

[0481] Levels of PGE2 secretion by pooled WJ-MSCs (TB1) and single donors was evaluated over 72 hours. Baseline levels of secretion of PGE2 were higher in pooled cells compared to the single donors (FIG. 7).

ITEMIZED LIST OF EMBODIMENTS

[0482] 1. Isolated, pooled allogeneic mesenchymal stem cell (MSC) population for use in the treatment and/or prevention of COVID-19 infection or for use in the treatment and/or prevention of symptoms associated with COVID-19 infection, wherein said isolated, pooled allogeneic MSC population comprises MSCs derived from at least 3 individual donors, wherein the number of cells derived from any one donor does not exceed 50% of the total cell number and wherein said MSCs have at most been subject to ten passages and wherein said isolated, pooled allogeneic MSC population is obtainable by a method comprising the steps of: [0483] culturing or providing MSCs from more than said at least 3 individual donors to obtain more than at least 3 individual donor derived MSC populations; [0484] assaying each individual donor derived MSC population using at least 3 assays to obtain at least 3 assay results for said each individual donor derived MSC population; [0485] for each assay allocating an individual ranking score value to said each individual donor derived MSC population based on the assay result and thus obtaining at least 3 individual ranking score values for each individual donor derived MSC population, wherein a higher ranking score value is indicative of more desirable assay result; or wherein a lower ranking score value is indicative of more desirable assay result; [0486] allocating a total score value to each individual donor derived MSC population based on said at least 3 individual ranking score values, wherein in the case of a higher ranking score value being indicative of more desirable assay result, a higher total score value is indicative of more desirable population properties; or wherein in the case of a lower ranking score value being indicative of more desirable assay result, a lower total score value is indicative of more desirable population properties; [0487] selecting a subset of individual donor derived MSC populations with desirable population properties based on their total score values; and [0488] pooling said selected individual donor derived MSC populations to obtain an isolated, pooled allogeneic MSC population;wherein at least 2 of said at least 3 assays are selected from the group consisting of one assay measuring indoleamine-2,3-dioxygensase (IDO) activity; one assay measuring prostaglandin E2 secreted by said MSCs; and [0489] one assay measuring the effect of said MSCs on the proliferation of peripheral blood mononuclear cells (PBMCs) and [0490] wherein at least 1 of said at least 3 assays is selected from the group consisting of one assay measuring the effect of said MSCs on the capacity of T cells to suppress an immune response; one assay measuring the effect said MCSs on the proliferation and/or apoptosis of dendritic cells, one assay measuring the effect of the said MSCS on monocytes; and one assay measuring the effect of the said MSCs on microglia cell and/or microglia-like cells.

[0491] 2. Isolated, pooled allogeneic MSC population for use according to item 1, wherein said pooled allogeneic MSC population is not further cultured after the pooling step.

[0492] 3. Isolated, pooled allogeneic MSC population for use according to item 1 or 2, wherein the individual ranking score value for at least one assay is allocated to said each individual donor derived MSC population based on a comparison of the assay result for said each individual donor derived MSC population to the results for the remaining individual donor derived MSC populations.

[0493] 4. Isolated, pooled allogeneic MSC population for use according to any one of items 1-3, wherein the individual ranking score value for at least one assay is allocated to said each individual donor derived MSC population based on absolute assay result obtained for said individual donor derived MSC population.

[0494] 5. Isolated, pooled allogeneic MSC population for use according to item 4, wherein the assay result is deemed desirable and an individual ranking score value that reflects the obtained desirable assay result is allocated, when said absolute result corresponds to at least a predetermined value or at most a predetermined value.

[0495] 6. Isolated, pooled allogeneic MSC population for use according to any one of items 1-5, wherein the step of selecting a subset of individual donor derived MSC populations with desirable population properties comprises selecting the individual donor derived MSC populations with total score value which corresponds to at least a predetermined value in the case wherein a higher total score value is indicative of more desirable population properties; or to at most a predetermined value in the case wherein a lower total score value is indicative of more desirable population properties.

[0496] 7. Isolated, pooled allogeneic MSC population for use according to any one of items 1-5, wherein the step of selecting a subset of individual donor derived MSC populations with desirable population properties comprises selecting a predetermined number of the individual donor derived MSC populations, which populations exhibit a higher total score value relative the remaining individual donor derived MSC populations in the case wherein a higher total score value is indicative of more desirable population properties; or which populations exhibit a lower total score value relative the remaining individual donor derived MSC populations in the case wherein a lower total score value is indicative of more desirable population properties.

[0497] 8. Isolated, pooled allogeneic MSC population for use according to any one of item 1-7, wherein said MSCs have at most been subject to seven passages, such as at most six passages, such as at most five passages, such as at most four passages, such as at most three passages, such as one, two or three passages, such as two or three passages.

[0498] 9. Isolated, pooled allogeneic MSC population for use according to any one of items 1-8, wherein said MSCs are derived from native MSC source.

[0499] 10. Isolated, pooled allogeneic MSC population for use according to any one of items 1-9, wherein said MSCs are selected from the group consisting of bone marrow derived MSCs, peripheral blood derived MSCs, adipose tissue derived MSCs, dental tissue derived MSCs, oral mucosal derived MSCs, placenta derived MSCs, umbilical cord derived MSCs, amniotic fluid derived MSC, cord blood derived MSCs, Wharton Jelly derived MSCs, decidua derived MSCs, chondrion membrane derived MSCs and amnion membrane derived MSCs; such as the group consisting of placenta derived MSCs, umbilical cord derived MSCs, amniotic fluid derived MSC, cord blood derived MSCs, Wharton Jelly derived MSCs, decidua derived MSCs, chondroid membrane derived MSCs, dental pulp derived MSCs and amnion membrane derived MSCs.

[0500] 11. Isolated, pooled allogeneic MSC population for use according to item 10, wherein said MSCs are selected from the group consisting of umbilical cord derived MSCs and Wharton Jelly derived MSCs, such as wherein said MSCs are Wharton Jelly derived MSCs.

[0501] 12. Isolated, pooled allogeneic MSC population for use according to any one of items 1-11, wherein said population comprises MSCs derived from at least four individual donors, such as at least five individual donors, such as at least six individual donors, such as at least seven individual donors, such as at least eight individual donors, such as at nine individual donors, such as at least ten individual donors.

[0502] 13. Isolated, pooled allogeneic MSC population for use according to any one of items 1-12, wherein said population comprises MSCs derived from 3-20 individual donors, such as 3-15 individual donors, such as 3-10 individual donors, such as 4-8 individual donors, such as 5-7 individual donors, such as 5, 6 or 7 individual donors.

[0503] 14. Isolated, pooled allogeneic MSC population for use according to any one of items 1-13, wherein the step of assaying each individual donor derived MSC population comprises assaying at least 1-4 times, such as 2-4 times, such as 2-3 or 3-4 times, as many individual donor derived MSC population as the number of individual donor derived MSC populations pooled in the pooling step.

[0504] 15. Isolated, pooled allogeneic MSC population for use according to any one of items 1-14, wherein the step of assaying each individual donor derived MSC population comprises assaying at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8, such as at least 9, such as at least 10, such as at least 11, such as at least 12, such as at least 13, such as at least 14, such as at least 15, such as at least 16, such as at least 17, such as at least 18, such as at least 19, such as at least 20 individual donor derived MSC populations.

[0505] 16. Isolated, pooled allogeneic MSC population for use according to any one of items 1-14, wherein the step of assaying each individual donor derived MSC population comprises assaying 3-50 individual donor derived MSC populations, such as 4-50, such as 5-50, such as 6-50, such as 6-30, such as 6-20, such as 6-15, such as 8-12 individual donor derived MSC population.

[0506] 17. Isolated, pooled allogeneic MSC population for use according to any one of items 1-16, the step assaying each individual donor derived MSC population using at least 3 assays comprises using as least one functional assay, such as at least two functional assays, such as at least three functional assays, such at least four functional assays, such least five functional assays.

[0507] 18. Isolated, pooled allogeneic MSC population for use according to any one of items 1-17, wherein said at least one assay measuring IDO activity comprises of the step of measuring IDO activity within the culture supernatant of MSCs co-cultured with stimulated PBMCs or purified T cells or activated monocytes/macrophages or microglia.

[0508] 19. Isolated, pooled allogeneic MSC population for use according to any one of items 1-18, wherein said at least one assay measuring prostaglandin E2 secreted by said MSCs comprises measuring prostaglandin E2 secreted by said MSCs when co-cultured with PBMCs, such as phytohaemagglutinin (PHA) stimulated PBMCs, such as PHA stimulated T-lymphocytes or co-cultured with interferon γ and/or tumor necrosis factor alpha.

[0509] 20. Isolated, pooled allogeneic MSC population for use according to any one of item 1-19, wherein said proliferation of PBMCs is the proliferation of T-lymphocytes, such as proliferation of phytohaemagglutinin (PHA) stimulated T-lymphocytes.

[0510] 21. Isolated, pooled allogeneic MSC population for use according to any one of item 1-20, wherein said at least 1 of said at least 3 assays isone assay measuring the effect of said MCSs on the capacity of T cells to suppress an immune response.

[0511] 22. Isolated, pooled allogeneic MSC population for use according to any one of item 1-21, wherein said at least 1 of said at least 3 assays is one assay measuring the effect said MSCs on the proliferation and/or apoptosis of dendritic cells or one assay measuring the effect said MSCs on inducing tolerogenic dendritic cells.

[0512] 23. Isolated, pooled allogeneic MSC population for use according to any one of item 1-22, wherein said at least 1 of said at least 3 assays is one assay measuring the effect of the said MSCs on microglia cells or microglia-like cells is selected from the group consisting of one assay measuring microglial proliferation; one assay measuring expression of markers characteristic of the M1 phenotype in microglia; one assay measuring expression of markers characteristic of the M2 phenotype in microglia; and an assay measuring the shift from the M1 microglia phenotype to the M2 microglia phenotype.

[0513] 24. Isolated, pooled allogeneic MSC population for use according to item 23, wherein said one assay measuring microglial proliferation comprises cocultivation of said individual donor derived MSC population(s) with microglia cells and/or microglia-like cells.

[0514] 25. Isolated, pooled allogeneic MSC population for use according to item 23 or 24, wherein said microglia cells or microglia-like cells are selected from the group consisting of immortalized cell lines, such as the human microglial HMC3 cell line or the CHME-5 cell line; primary microglia obtained from biopsies; primary microglia-like cells cultured from cord blood; and immortalized microglia-like cells from cord blood, such as the DUOC-01 cell line; such as selected from the group consisting of the consisting of immortalized cell lines, for example selected from the group consisting of HMC3 cell line, CHME-5 cell line and the DUOC-01 cell line.

[0515] 26. Isolated, pooled allogeneic MSC population for use according to any one of items 23-25, wherein said one assay measuring microglial proliferation comprises assaying if a decrease in the proliferation microglia cells occurs upon mitogen stimulation, such as lipopolysaccharide stimulation, or quantifying a decrease in the proliferation microglia cells upon lipopolysaccharide stimulation.

[0516] 27. Isolated, pooled allogeneic MSC population for use according to any one of items 23-26, wherein said proliferation is measured as a proliferation percentage, is measured as a proliferation index or is measured as a growth index, such as is measured as a growth index.

[0517] 28. Isolated, pooled allogeneic MSC population for use according to any one of items 23-27, wherein said one assay measuring expression of markers characteristic of the M1 phenotype in microglia and/or microglia-like cells comprises measuring the expression of at least one marker selected from the group consisting of CD183, CD11b, CD14, B7-2/CD86, Integrin alpha V beta 3, MFG-E8, NO, ROS, RNS, CCL2/MCP-1, CCL3/MIP-1 alpha, CCL4/MIP-1 beta, CCL5/RANTES, CCL8/MCP-2, CCL11/Eotaxin, CCL12/MCP-5, CCL15/MIP-1 delta, CCL19/MIP-3 beta, CCL20/MIP-3 alpha, CXCL1/GRO alpha/KC/CINC-1, CXCL9/MIG, CXCL10/IP-10, CXCL11/I-TAC, CXCL13/BLC/BCA-1, CX3CL1/Fractalkine, MMP-3, MMP-9, Glutamate, IL-1 beta/IL-1F2, IL-2, IL-6, IL-12, IL-15, IL-17/IL-17A, IL-18/IL-1F4, IL-23, IFNγ, TNF-alpha, Fc gamma RIII/CD16, Fc gamma RII/CD32, CD36/SR-B3, CD40, CD68/SR-D1, B7-1/CD80, MHC II, iNOS and COX-2; such as at least one marker selected from the group consisting of CD183, CD11b and CD14.

[0518] 29. Isolated, pooled allogeneic MSC population for use according to item 28, wherein said one assay measuring expression of markers characteristic of the M1 phenotype in microglia and/or microglia-like cells comprises measuring the expression of at least CD183.

[0519] 30. Isolated, pooled allogeneic MSC population for use according to any one of items 28-29, wherein a decrease in expression of at least one of the markers whose expression in measured by said one assay measuring expression of markers characteristic of the M1 phenotype in microglia and/or microglia-like cells is indicative of a desirable result.

[0520] 31. Isolated, pooled allogeneic MSC population for use according to item 23-27, wherein said one assay measuring expression of markers characteristic of the M2 phenotype in microglia and/or microglia-like cells comprises measuring the expression of at least one marker selected from the group consisting of CX3CR1, CD200R, CD206, IL-1ra/IL-1F3, IL-4, IL-10, IL-13, TGF-beta, CCL13/MCP-4, CCL14, CCL17/TARC, CCL18/PARC, CCL22/MDC, CCL23/MPIF-1, CCL24/Eotaxin-2/MPIF-2, CCL26/Eotaxin-3, FlZZ1/RELM alpha, YM1/Chitinase 3-like 3, CLEC10A/CD301, MMR/CD206, SR-Al/MSR, CD163, Arginase 1/ARG1, Transglutaminase 2/TGM2, PPAR and gamma/NR1C3; such as at least one marker selected from the group consisting of CX3CR1, CD200R and CD206.

[0521] 32. Isolated, pooled allogeneic MSC population for use according to item 31, wherein said one assay measuring expression of markers characteristic of the M2 phenotype in microglia and/or microglia-like cells comprises measuring the expression of at least CD200R.

[0522] 33. Isolated, pooled allogeneic MSC population for use according to any one of items 31-32, wherein an increase in expression of at least one of the markers whose expression in measured by said one assay measuring expression of markers characteristic of the M2 phenotype in microglia and/or microglia-like cells is indicative of a desirable result.

[0523] 34. Isolated, pooled allogeneic MSC population for use according to any one of items 28-33, wherein said shift from the M1 microglia phenotype to the M2 microglia phenotype is measured as a decrease in the expression of any one or more of the markers defined in any one of items 28-29 and an increase in the expression of any one or more of the markers defined in any one of items 31-32.

[0524] 35. Isolated, pooled allogeneic MSC population for use according to item 34, wherein said shift from the M1 microglia phenotype to the M2 microglia phenotype is measured as a decrease in the expression of any one or more of the markers selected from CD183, CD11b and CD14 and an increase in the expression of any one or more of the markers selected from CX3CR1, CD200R and CD206, such as wherein said shift from the M1 microglia phenotype to the M2 microglia phenotype is measured as a decrease in the expression of CD183 and an increase in the expression of CD200R.

[0525] 36. Isolated, pooled allogeneic MSC population for use according to any one of items 34-35, wherein said shift from the M1 microglia phenotype to the M2 microglia phenotype is indicative of a desirable result.

[0526] 37. Isolated, pooled allogeneic MSC population for use according to any one of items 1-36, wherein said one assay measuring the effect of the said MSCs on monocytes comprises measuring the shift from classical to non-classical monocyte phenotype in response to said MSCs, such as measures the effect of said MSC on monocyte shift towards regenerative phenotype.

[0527] 38. Isolated, pooled allogeneic MSC population for use according to any one of items 1-37, wherein said at least 3 assays further comprise at least one assay measuring HLA-G expression in said MSCs in response to IFNγ, tumor necrosis factor alpha, alum, IL-10, PHA and/or GABA, such as in response to IFNγ, IL-10 and/or PHA.

[0528] 39. Isolated, pooled allogeneic MSC population for use according to any one of items 1-38, wherein said at least 3 assay further comprise at least one assay measuring the protein expression and/or cytokine expression.

[0529] 40. Isolated, pooled allogeneic MSC population for use according to item 39, wherein said at least one assay measuring the protein expression and/or cytokine expression measures the expression of one or several proteins or cytokines selected from the group consisting of IL-2, IL-4, IL-6, IL-8, IL-12, IL-12/13, IL17A, IL-21, IL-22, IL-29, IL-31, TGFβ, VEGF, FGF, GM-CSF, IFNα, IFNγ, apo E and TNFα, such as the group consisting of IL-6, IL-8, GM-CSF and TGFβ, such as the group consisting of at least IL-6 or wherein said at least one assay measuring the protein expression and/or cytokine expression measures one or several proteins or cytokines selected from the group consisting of IL-2, IL-4, IL-6, IL-8, IL-12, IL- 12/13, IL17A, IL-21, IL-22, IL-29, IL-31, TGFβ, VEGF, FGF, GM-CSF, IFNα, IFNγ, apo E and TNFα and ACE2 receptor and TMPRSS2, such as the group consisting of IL-6, IL-8, GM-CSF,TGFβ, ACE2 receptor and TMPRSS2, such as the group consisting of at least ACE2 receptor and TMPRSS2.

[0530] 41. Isolated, pooled allogeneic MSC population for use according to item 40, wherein the expression of at least 2, such as at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8, such as at least 9, such as at least 10, such as at least 11, such as at least 12, such as at least 13, such as at least 14, such as at least 15, such as at least 16, such as at least 17, such as at least 18, such as all 19 of said proteins and/or cytokines are measured.

[0531] 42. Isolated, pooled allogeneic MSC population for use according to any one of items 39-41, wherein said expression is measured in absence and/or presence of at least one stimuli.

[0532] 43. Isolated, pooled allogeneic MSC population for use according to item 42, wherein said stimuli is an immune response modifying stimuli.

[0533] 44. Isolated, pooled allogeneic MSC population for use according to item 43, wherein said immune response modifying stimuli is selected from the group consisting of PBMCs; stimulated PBMCs, such as PBMCs stimulated with PHA, IL10, gamma-aminobutyric acid (GABA), anti-CD2, anti-CD3, anti-CD28, alum and/or interferon gamma (IFNγ).

[0534] 45. Isolated, pooled allogeneic MSC population for use according to item 43 or 44, wherein said immune response modifying stimuli is gamma-aminobutyric acid (GABA) or wherein said immune response modifying stimuli is PBMCs stimulated with gamma-aminobutyric acid (GABA).

[0535] 46. Isolated, pooled allogeneic MSC population for use according to item 42-44, wherein said stimuli is a cytokine, such as interferon gamma (IFNγ).

[0536] 47. Isolated, pooled allogeneic MSC population for use according to item any one of items 42-46, wherein stimuli is selected from the group consisting of polyinosinic:polycytidylic acid (Poly I:C), resiquimod (r848), gamma-aminobutyric acid (GABA) and IFNγ, such as the group consisting of Poly I:C and IFNγ.

[0537] 48. Isolated, pooled allogeneic MSC population for use according to item any one of items 42-44, wherein stimuli is PBMCs, such as stimulated or unstimulated PBMCs, such as PHA stimulated PBMCs, such as PHA stimulated T-lymphocytes.

[0538] 49. Isolated, pooled allogeneic MSC population for use according to any one of items 1-48, wherein said at least 3 assays comprises at least one morphological assay.

[0539] 50. Isolated, pooled allogeneic MSC population for use according to item 49, wherein said morphological assay assays morphological features of cells and/or cells nuclei.

[0540] 51. Isolated, pooled allogeneic MSC population for use according to item 50, wherein said morphological features of cells and/or cells nuclei are one or more features selected from the group consisting of the size of the cell, the size of the nuclei, the shape of the cell and the ratio between cell and nuclei size.

[0541] 52. Isolated, pooled allogeneic MSC population for use according to any one of items 49-51, wherein an individual donor derived MSC population is only eligible for pooling if it exhibits more than or equal to 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such at least 99% normal cells and/or nuclei.

[0542] 53. Isolated, pooled allogeneic MSC population for use according to any one of items 1-52, wherein the step of assaying each individual donor derived MSC population using at least 3 assays is performed when the MSC population is in passage 0 (p0) - passage 8 (p8), such as in p1 - p 5, such as in p1 - p4, such as in p2 - p4 or in p1 - p4, such as in p1, p2 and/or p3, such as in p2 and/or p3.

[0543] 54. Isolated, pooled allogeneic MSC population for use according to any one of items 1-53, at least one assay, such as at least two assays, such as at least three assays, such as all assays, is/are performed when the cells are in the same passage as when they are pooled.

[0544] 55. Isolated, pooled allogeneic MSC population for use according to any one of items 1-53, wherein at least two assays are performed at different passages.

[0545] 56. Isolated, pooled allogeneic MSC population for use according to any one of items 1-55, wherein said total score value allocated to said each individual donor derived MSC population is an additive total score value obtained by addition of ranking score values for each individual donor derived MSC population.

[0546] 57. Isolated, pooled allogeneic MSC population for use according to any one of items 1-55, wherein said total score value allocated to said each individual donor derived MSC population is a weighed total score value obtained by 1) assigning a weight to the ranking score value for each assay and 2) adding the weighed ranking score values for individual donor derived MSC population.

[0547] 58. Isolated, pooled allogeneic MSC population for use according to any one of items 1-57, wherein the step of selecting a subset of individual donor derived MSC populations with desirable population properties comprises selecting at least 3, such as at least 4, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8, such as at least 9, such as at least 10 individual donor derived MSC populations.

[0548] 59. Isolated, pooled allogeneic MSC population for use according to any one of items 1-58, in which population the number of cells derived from any one donor does not exceed 45%, such as does not exceed 40%, such as does not exceed 35%, of the total cell number and wherein said population comprises MSCs derived from at least 3 donors; such as in which population the number of cells derived from any one donor does not exceed 40%, such as does not exceed 35%, such as does not exceed 30%, of the total cell number and wherein said population comprises MSCs derived from at least 4 donors; such as in which population the number of cells derived from any one donor does not exceed 35%, such as does not exceed 30%, such as does not exceed 25%, of the total cell number and wherein said population comprises MSCs derived from at least 5 donors; such as in which population the number of cells derived from any one donor does not exceed 30%, such as does not exceed 25%, such as does not exceed 20%, of the total cell number and wherein said population comprises MSCs derived from at least 6 donors; such as in which population the number of cells derived from any one donor does not exceed 25%, as does not exceed 22 %, such as does not exceed 20 %, of the total cell number and wherein said population comprises MSCs derived from at least 7 donors.

[0549] 60. Isolated, pooled allogeneic MSC population for use according to any one of items 1-59 in which population the number of MSC derived from any one donor does not exceed four times, such as three times, such as two times the number of the cells derived any other donor.

[0550] 61. Isolated, pooled allogeneic MSC population for use according to item any one of items 1-60, said method further comprising the step of discarding an individual donor derived MSC population from the pooling step if the assay results for said individual donor derived MSC population are less desirable than the corresponding assay results for a pooled allogeneic MSC population previously obtained by the method as defined in any one of items 1-60.

[0551] 62. Isolated, pooled allogeneic MSC population for use according to item any one of items 1-61, wherein said MSCs are obtained from a native MSC source.

[0552] 63. Isolated, pooled allogeneic MSC population for use according to item any one of items 1-62,, wherein said pooled population exhibits enhanced immunosuppressive and/or immune-modulatory potential compared to individual donor derived MSC populations, such as each individual donor derived MSC population assayed, such as each individual donor derived MSC population selected for pooling.

[0553] 64. Isolated, pooled allogeneic MSC population for use according to item 63,, wherein said enhanced immunosuppressive and/or immune-modulatory potential is measured as expression of IDO by unstimulated MSCs.

[0554] 65. Isolated, pooled allogeneic MSC population for use according to item 63 or 64, wherein said enhanced immunosuppressive and/or immune-modulatory potential is measured as expression of PGE2 by unstimulated MSCs.

[0555] 66. Isolated, pooled allogeneic MSC population for use according to any one of items 1 or 65,wherein said population exhibits no statistically significant batch-to-batch variability.

[0556] 67. Isolated, pooled allogeneic MSC population for use according to any one of items 1-66, wherein said treatment and/or prevention of symptoms associated with COVID-19 infection is treatment and/or prevention the neurological symptoms associated with COVID-19 infection.

[0557] 68. Isolated, pooled allogeneic MSC population for use according to any one of items 1-66, wherein said treatment and/or prevention of symptoms associated with long COVID-19 infection is treatment and/or prevention the neurological symptoms associated with long COVID-19 infection, such as treatment and/or prevention of inflammation and/or demyelination associated with long COVID-19 infection.

[0558] 69. Isolated, pooled allogeneic MSC population for use according to any one of items 1-67, wherein said treatment and/or prevention of neurological symptoms associated with COVID-19 infection is treatment and/or prevention of inflammation and/or demyelination associated with COVID-19 infection.

[0559] 70. Isolated, pooled allogeneic MSC population for use according to any one of items 1-69, wherein said use comprises administration of said MSC population as an infusion or injection to patient in need thereof.

[0560] 71. Isolated, pooled allogeneic MSC population for use according to item 70, wherein said infusion or injection is administered intravenously, intraperitoneally, intralymphatically, intravenously, intrathecally, intracerebrally, intraarterially, subcutaneously or through the ommaya reservoir; such as intravenously, intraperitoneally or intralymphatically, such as intravenously.

[0561] 72. Isolated, pooled allogeneic MSC population for use according to item 70 or 71, wherein said infusion or injection is administered intrathecally or intracerebrally or intravenously.

[0562] 73. Isolated, pooled allogeneic MSC population for use according to any one of items 70-72, wherein said infusion is performed repeatedly.

[0563] 74. Isolated, pooled allogeneic MSC population according for use according to any one of items 70-72, wherein said infusion performed one time only.

[0564] 75. Isolated, pooled allogeneic MSC population for use according to any one of items 1-74, wherein said population after pooling has been exposed to a proinflammatory compound, such as IFNγ, tumor necrosis factor alpha and/or alum, for up to about 1 hour before administration or for between about 1 to about 24 hours before administration.

[0565] 76. Isolated, pooled allogeneic MSC population for use according to any one of item 1-75, wherein administration of said MSC population induces no or low anti-HLA antibody titers in the patient.

[0566] 77. Isolated, pooled allogeneic MSC population according for use according to any one of items 1-76, wherein said use comprises administration to said patient a dose of approximately at least 3 × 10.sup.6 cells, such as approximately at least 5 × 10.sup.6 cells, such as approximately at least 10 × 10.sup.6 cells, such as approximately at least 15 × 10.sup.6 cells, such as approximately at least 20 × 10.sup.6 cells, such as approximately at least 25 × 10.sup.6 cells, such as approximately at least 30 × 10.sup.6 cells, such as approximately at least 50 × 10.sup.6 cells, such as approximately at least about 60 × 10.sup.6 cells, such as approximately at least about 75 × 10.sup.6 cells, such as approximately at least about 100 × 10.sup.6 cells, such as approximately at least about 150 × 10.sup.6 cells, such as approximately at least about 200 × 10.sup.6 cells.

[0567] 78. Isolated, pooled allogeneic MSC population according for use according to any one of items 1-77, wherein said uses comprises administration to said patient a dose of approximately at least 0.1 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,3 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,5 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,75 × 10.sup.6 cells/kg bodyweight, such as approximately at least 1 × 10.sup.6 cells/kg bodyweight, such as approximately at least 1,2 × 10.sup.6 cells/kg bodyweight.

[0568] 79. Isolated, pooled allogeneic MSC population according for use according to any one of items 1-78, wherein said use comprises administering to said patient a dose from approximately 0.1 × 10.sup.6 cells/kg bodyweight to approximately 10 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.15 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.20 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.3 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as for example from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 3 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 2 × 10.sup.6 cells/kg bodyweight or from approximately 0.3 × 10.sup.6 cells/kg bodyweight to approximately 1.2 × 10.sup.6 cells/kg bodyweight .

[0569] 80. Pharmaceutical composition comprising an or an isolated, pooled allogeneic MSC population for use according to any one of items 1-79, and at least one pharmaceutically acceptable excipient or carrier.

[0570] 81. Pharmaceutical composition according to item 80, comprising approximately at least 3 × 10.sup.6 cells, such as approximately at least 5 × 10.sup.6 cells, such as approximately at least 10 × 10.sup.6 cells, such as approximately at least 15 × 10.sup.6 cells, such as approximately at least 20 × 10.sup.6 cells, such as approximately at least 25 × 10.sup.6 cells, such as approximately at least 30 × 10.sup.6 cells, such as approximately at least 50 × 10.sup.6 cells, such as approximately at least about 60 × 10.sup.6 cells, such as approximately at least about 75 × 10.sup.6 cells, such as approximately at least about 100 × 10.sup.6 cells, such as approximately at least about 150 × 10.sup.6 cells, such as approximately at least about 200 × 10.sup.6 cells.

[0571] 82. Pharmaceutical composition according to any one of items 7980, formulated for infusion; such for intravenous infusion, intraperitoneal infusion, intralymphatical infusion, intravenous infusion, intracerebral infusion, intrathecal infusion, intracerebral infusion, intraarterial infusion, subcutaneous infusion or infusion through the ommaya reservoir; such as for intracerebral or intrathecal infusion or such as for intravenous infusion.

[0572] 83. Method for treatment and/or prevention of a disease or condition, which disease or condition is COVID-19 infection or is associated with COVID-19 infection, comprising administering a therapeutically effective dose of an isolated, pooled allogeneic MSC population according to any one of items 1-79 or a pharmaceutical composition according to any one of items 80-82, to a patient in need thereof.

[0573] 84. Method for treatment and/or prevention of a disease or condition according to item 83 o wherein said disease or condition is neurological symptoms associated with COVID-19 infection.

[0574] 85. Method for treatment and/or prevention of a disease or condition according to any one of items 83-84, wherein said disease or condition is inflammation and/or demyelination associated with COVID-19 infection.

[0575] 86. Method for treatment and/or prevention according to any one of items 83-85, wherein said administration of said MSC population is by infusion; such as by intravenous infusion, intraperitoneal infusion, intralymphatical infusion, intravenous infusion, intrathecal infusion, intracerebral infusion, intraarterial infusion, subcutaneous infusion or infusion through the ommaya reservoir; such as by intrathecal infusion or intracerebral infusion or such as for intravenous infusion.

[0576] 87. Method for treatment and/or prevention according to item 86, wherein said infusion is performed repeatedly.

[0577] 88. Method for treatment and/or prevention according to item 86, wherein said infusion is performed one time only.

[0578] 89. Method for treatment and/or prevention according to any one of items 83-88, wherein said population after pooling has been exposed to a proinflammatory compound, such as IFNγ, tumor necrosis factor alpha and/or alum, for between up to about 1 hour before administration or about 1 to about 24 hours before administration.

[0579] 90. Method for treatment and/or prevention according to any one of items 83-89, wherein said administration induces no or low anti-HLA antibody titers in the patient.

[0580] 91. Method for treatment and/or prevention according to any one of items 83-90, wherein said method comprises administering to said patient a dose of approximately at least 3 × 10.sup.6 cells, such as approximately at least 5 × 10.sup.6 cells, such as approximately at least 10 × 10.sup.6 cells, such as approximately at least 15 × 10.sup.6 cells, such as approximately at least 20 × 10.sup.6 cells, such as approximately at least 25 × 10.sup.6 cells, such as approximately at least 30 × 10.sup.6 cells, such as approximately at least 50 × 10.sup.6 cells, such as approximately at least about 60 × 10.sup.6 cells, such as approximately at least about 75 × 10.sup.6 cells, such as approximately at least about 100 × 10.sup.6 cells such as approximately at least about 150 × 10.sup.6 cells, such as approximately at least about 200 × 10.sup.6 cells.

[0581] 92. Method for treatment and/or prevention according to any one of items 83-91, wherein said method comprises administering to said patient a dose of approximately at least 0.1 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,3 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,5 × 10.sup.6 cells/kg bodyweight, such as approximately at least 0,75 × 10.sup.6 cells/kg bodyweight, such as approximately at least 1 × 10.sup.6 cells/kg bodyweight, such as approximately at least 1,2 × 10.sup.6 cells/kg bodyweight.

[0582] 93. Method for treatment and/or prevention according to any one of items 83-92, wherein said method comprises administering to said patient a dose from approximately 0.1 × 10.sup.6 cells/kg bodyweight to approximately 10 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.15 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.20 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.3 × 10.sup.6 cells/kg bodyweight to approximately 4 × 10.sup.6 cells/kg bodyweight, such as for example from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 3 × 10.sup.6 cells/kg bodyweight, such as from approximately 0.25 × 10.sup.6 cells/kg bodyweight to approximately 2 × 10.sup.6 cells/kg bodyweight or from approximately 0.3 × 10.sup.6 cells/kg bodyweight to approximately 1.2 × 10.sup.6 cells/kg bodyweight.

[0583] 94. Use of an isolated, pooled allogeneic MSC population as defined in any one of items 1-79, in the manufacture of a medicament for the treatment of a disease or conditions selected from the group consisting COVID-19 infection and conditions associated with COVID-19 infection, such as neurological symptoms associated with COVID-19 infection, inflammation associated with COVID-19 infection and/or demyelination associated with COVID-19 infection.

[0584] 95. Method for treatment and/or prevention of a disease or condition selected from the group consisting of COVID-19 infection and conditions associated with COVID-19 infection, such as neurological symptoms associated with COVID-19 infection, inflammation associated with COVID-19 infection and/or demyelination associated with COVID-19 infection, comprising the steps of [0585] -obtaining an isolated, pooled allogeneic MSC population using the method as defined herein; and [0586] -administering a therapeutically effective dose of said isolated, pooled allogeneic MSC population or of a pharmaceutical composition comprising said isolated, pooled allogeneic MSC population to a patient in need thereof.

ALLOGENEIC COMPOSITION FOR THE TREATMENT OF COVID-19

Inventors

Cpc classification

Classification Explorer

G01N33/5008

PHYSICS

Classification Explorer

G01N33/68

PHYSICS

Classification Explorer

G01N2333/90241

PHYSICS

Classification Explorer

A61P31/14

HUMAN NECESSITIES

Classification Explorer

G01N33/5073

PHYSICS

Classification Explorer

G01N33/5023

PHYSICS

Classification Explorer

C12N5/0605

CHEMISTRY; METALLURGY

Classification Explorer

A61K35/28

HUMAN NECESSITIES

Classification Explorer

C12N5/0668

CHEMISTRY; METALLURGY

Classification Explorer

A61P37/02

HUMAN NECESSITIES

Classification Explorer

G01N33/92

PHYSICS

International classification

Classification Explorer

A61K35/28

HUMAN NECESSITIES

Classification Explorer

C12N5/0775

CHEMISTRY; METALLURGY

Classification Explorer

G01N33/50

PHYSICS

Classification Explorer

A61P37/02

HUMAN NECESSITIES

Classification Explorer

A61P31/14

HUMAN NECESSITIES

Abstract

Claims

Description