Preventive and therapeutic approach for aberrant cell differentiation and ISR-associated diseases
11759437 · 2023-09-19
Assignee
Inventors
- Song Eng Kathryn Cheah (Hong Kong, CN)
- Danny Chan (Hong Kong, CN)
- Cheng Wang (Hong Kong, CN)
- Cheuk Wing Wilson Chan (Hong Kong, CN)
Cpc classification
A61K31/165
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
C07C235/14
CHEMISTRY; METALLURGY
C07C211/29
CHEMISTRY; METALLURGY
A61P19/08
HUMAN NECESSITIES
C07C235/20
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/136
HUMAN NECESSITIES
A61K31/165
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
A61P19/08
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07C211/29
CHEMISTRY; METALLURGY
C07C235/14
CHEMISTRY; METALLURGY
Abstract
The present invention describes a method of preventing, ameliorating and/or treating disorders or diseases associated with the integrated stress response (ISR) involving the p-eIF2α pathway arising from various cellular stresses such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio-mechanical stress. In one embodiment, the present invention provides a method which prevents or alleviates aberrant cell differentiation that is caused by the activation of the integrated stress response and thereby prevents or alleviates conditions, disorders or diseases resulting therefrom. In one embodiment, ISR-associated diseases subject to the present invention include but are not limited to skeletal disorders including disc degeneration, MCDS and other skeletal dysplasias, cancers, inflammatory diseases, diabetes, fibrosis, obesity and neurodegenerative diseases. In another embodiment, the present invention provides a method of using a p-eIF2α-modulator for the prevention or treatment of conditions, disorders or diseases described herein.
Claims
1. A method for the amelioration and/or treatment of a disease caused by the activation of the integrated stress response (ISR) involving the p-eIF2α pathway in a subject, comprising: administering to the subject a modulator of a phosphorylated eukaryotic initiation factor 2α (p-eIF2α), wherein the modulator is represented by Formula I: ##STR00015## wherein each of R1, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, —OCH.sub.3, —OCH.sub.2Ph, —C(O)Ph, —CH.sub.3, —CF.sub.3, —CCl.sub.3, —CN, —S(O)CH.sub.3, —OH, —NH.sub.2, —COOH, —CONH.sub.2, —NO.sub.2, —C(O)CH.sub.3, —CH(CH.sub.3).sub.2, —CCSi(CH.sub.3).sub.3, —CCH, —CH.sub.2CCH, —SH, —SO.sub.3H, —SO.sub.4H, —SO.sub.2NH.sub.2, —NHNH.sub.2, —ONH.sub.2, —NHC═(O)NHNH.sub.2, —NHC═(O)NH.sub.2, —NHSO.sub.2H, —NHC═(O)H, —NHOH, —OCF.sub.3, —OCHF.sub.2, —N.sub.3, substituted or substituted or alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
2. The method of claim 1, wherein an effective amount of the modulator is capable of one or more of the following: a) inhibiting the phosphorylation of eIF2α; b) promoting the de-phosphorylation of eIF2α; c) inhibiting the effect of phosphorylated-eIF2α; d) inhibiting the transcription or expression of Sox9/SOX9; e) inhibiting the transcription or expression, by translation control, of ATF4; and promoting the assembly of GADD34-Pp1c.
3. The method of claim 1, wherein the modulator is selected from the following: ##STR00016##
4. The method of claim 1, wherein the effective amount of the modulator is 0.1 mg/kg to 50 mg/kg per day.
5. A method of treating intervertebral disc degeneration (IDD), comprising a step of contacting a population of nucleus pulposus (NP) cells in an intervertebral disc with an effective amount of a molecule represented by Formula I: ##STR00017## wherein each of R1, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, —OCH.sub.3, —OCH.sub.2Ph, —C(O)Ph, —CH.sub.3, —CF.sub.3, —CCl.sub.3, —CN, —S(O)CH.sub.3, —OH, —NH.sub.2, —COOH, —CONH.sub.2, —NO.sub.2, —C(O)CH.sub.3, —CH(CH.sub.3).sub.2, —CCSi(CH.sub.3).sub.3, —CCH, —CH.sub.2CCH, —SH, —SO.sub.3H, —SO.sub.4H, —SO.sub.2NH.sub.2, —NHNH.sub.2, —ONH.sub.2, —NHC═(O)NHNH.sub.2, —NHC═(O)NH.sub.2, —NHSO.sub.2H, —NHC═(O)H, —NHOH, —OCF.sub.3, —OCHF.sub.2, —N.sub.3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
6. The method of claim 5, wherein each of R1, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, —OCH.sub.3, —OCH.sub.2Ph, —C(O)Ph, —CH.sub.3, —CF.sub.3, —CCl.sub.3, —CN, —COOH, —CONH.sub.2, —NO.sub.2, —C(O)CH.sub.3, —CH(CH.sub.3).sub.2, —CCH, —CH.sub.2CCH, —SH, —SO.sub.2NH.sub.2, —OCF.sub.3, —OCHF.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
7. The method of claim 5, wherein each of R1, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, —OCH.sub.3, —OCH.sub.2Ph, —C(O)Ph, —CH.sub.3, —CF.sub.3, —CCl.sub.3, —CN, —COOH, —CONH.sub.2, —NO.sub.2, —C(O)CH.sub.3, —CH(CH.sub.3).sub.2, —CCH, —CH.sub.2CCH, —SH, —SO.sub.2NH.sub.2, —OCF.sub.3, —OCHF.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, and substituted or unsubstituted heterocycloalkyl.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF THE INVENTION
(14) The present invention provides a method of preventing, ameliorating and/or treating conditions, disorders or diseases associated with the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2α (p-eIF2α) pathway arising from various cellular stresses. As described herein, phosphorylated eukaryotic initiation factor 2α pathways or p-eIF2α pathways include signaling pathways where de-phosphorylated eIF2α or phosphorylated eIF2α is involved, and include signaling pathways which are directly or indirectly affected by the de-phosphorylation or phosphorylation of eIF2α.
(15) ISR-Associated Skeletal Diseases
(16) The first aspect of this invention is to provide a method of preventing, ameliorating and/or treating a skeletal disorder associated with or caused by the activation of the integrated stress response in a subject. Skeletal disorders subject to the present invention can be arising from cellular stresses such as oxidative stress, hypoxia and ER stress, or caused by chronic or prolonged biomechanical stress.
(17) The integrated stress response (ISR) is an adaptive cell-survival pathway that can be activated when misfolded proteins trigger endoplasmic reticulum (ER) stress. It is implicated in development and diseases, with many human genetic skeletal deformities being caused by mutations that trigger the ISR.
(18) In an MCDS transgenic mouse model (13del) which carries a 13 bp deletion in Col10a1 equivalent to the human mutation, misfolded mutant collagen X induces ER stress. Although the chondrocytes survive, their differentiation is reversed by an unknown mechanism to a more juvenile state characterized by the re-expression of prehypertrophic chondrocyte markers (Ppr, Sox9 and Col2a), disrupting endochondral ossification, and skeletal dysplasia ensues. A similar effect on hypertrophic chondrocyte differentiation has been described in other mouse models of dwarfism (70). The skeletal defects caused by mutations that induce stress or inactivate key transducers of the stress response in humans and mouse models implicate components of pathways involved in chondrocyte and osteoblast differentiation. However, the relationship between skeletal dysplasia and the ISR remains unclear.
(19) The present invention represents the first mechanistic study in a model of human chondrodysplasia associated with ER stress that demonstrates causality and a direct link between the ISR and reprogrammed chondrocyte differentiation. Disclosed herein, ISR signalling reverses hypertrophic chondrocyte differentiation via ATF4-directed transactivation of the transcription factor gene Sox9. By genetic and molecular analyses, the present invention established that the major effect of the ISR is the preferential expression of ATF4 which activates the transcription of a potent transcription factor gene Sox9 (a key regulator of chondrocyte differentiation and proliferation) (
(20) The present invention further demonstrates that treatment of mutant 13del mice with a small molecule inhibitor of the ISR pathway, ISRIB (trans-N,N′-(Cyclohexane-1,4-diyl)bis(2-(4-chlorophenoxy)acetamide) which targets the interaction between eukaryotic initiation factor 2 (eIF2) and eukaryotic initiation factor 2B (eIF2B) and thereby suppresses ATF4 induction, prevents the differentiation defects and ameliorates chondrodysplasia in the 13del mice (
(21) In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating a skeletal disorder (including disc degeneration, MCDS and other skeletal dysplasias) associated with integrated stress response involving the p-eIF2α pathway in a subject using a molecule that targets the underlying p-eIF2α-pathway. In one embodiment, molecules to be used in the present invention are modulators which directly or indirectly suppress the translational or transcriptional expression of ATF4 or SOX9. Without limiting the generality of the foregoing, the following illustrates a few embodiments of the present invention.
(22) Chondrodysplasia and Congenital Dwarfism
(23) There has been no example whereby the impact on cell fate in a congenital disorder such as dwarfism can be prevented or ameliorated by targeting the ISR in vivo. Therefore, the present invention provides for the first time a feasible approach for the prevention and improvement of congenital dwarfism caused by the activation of ISR.
(24) In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating a skeletal disorder associated with integrated stress response involving the p-eIF2α pathway in a subject. In one embodiment of the present invention, skeletal disorders include but are not limited to osteogenesis imperfecta (OI), metaphyseal chondrodysplasia, type Schmid (MCDS), pseudoachondroplasia (PSACH), and multiple epiphyseal dysplasia. In another embodiment, skeletal disorders subject to the present method are caused by mutation(s) of extracellular matrix (ECM) proteins accumulating in the endoplasmic reticulum, and mutation(s) of key signaling transducer of ISR. In one embodiment, said skeletal disorders are arising from cellular stresses such as oxidative stress, hypoxia, and ER stress. In another embodiment, said skeletal disorders are caused by chronic or prolonged biomechanical stress.
(25) In one embodiment, the present invention provides a method of alleviating and/or reversing aberrant differentiation in a chondrocyte through the inhibition of ectopic expression of Sox9/SOX9 (mouse/human). In another embodiment, the present method prevents and/or alleviates conditions, disorders or diseases resulting from an aberrant chondrocyte differentiation. In one embodiment, the present method includes the use of a molecule which inhibits the ectopic expression of Sox9/SOX9. In another embodiment, the present method includes a use of a molecule which inhibits the ectopic expression of ATF4 which subsequently enhances the ectopic expression of Sox9. In one embodiment, the molecule is a modulator that is capable of directly or indirectly inhibiting the transcriptional or translational expression of ATF4.
(26) In one embodiment, the modulator in the present invention is represented by Formula I:
(27) ##STR00001##
wherein each of R1, R2, R3 and R4 is independently hydrogen, halogen, —OCH3, —OCH.sub.2Ph, —C(O)Ph, —CH.sub.3, —CF.sub.3, —CCl.sub.3, —CN, —S(O)CH.sub.3, —OH, —NH.sub.2, —COOH, —CONH.sub.2, —NO.sub.2, —C(O)CH.sub.3, —CH(CH.sub.3).sub.2, —CCSi(CH.sub.3).sub.3, —CCH, —CH.sub.2CCH, —SH, —SO.sub.3H, —SO.sub.4H, —SO.sub.2NH.sub.2, —NHNH.sub.2, —ONH.sub.2, —NHC═(O)NHNH.sub.2, —NHC═(O)NH.sub.2, —NHSO.sub.2H, —NHC═(O)H, —NHOH, —OCH.sub.3, —OCF.sub.3, —OCHF.sub.2, —N.sub.3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
(28) In one embodiment, the modulator represented by Formula I is ISRIB having the formula
(29) ##STR00002##
In one embodiment, the modulator represented by Formula I includes molecules that are described in WO 2014/144952, the entire contents of which are incorporated herein by reference into this application.
(30) In another embodiment, the modulator represented by Formula I is selected from the following molecules:
(31) ##STR00003## ##STR00004## ##STR00005##
(32) In one embodiment, the modulator subject to the present invention is represented by Formula II:
(33) ##STR00006##
wherein R.sup.1 is bicycloheteroaryl, including but not limited to pyrrolopyrimidine, which may be unsubstituted or substituted with groups such as amino and alkyl; R.sup.2 is heteroaryl, including but not limited to pyridyl, pyrrolyl and pyrazolyl, which may be unsubstituted or substituted with groups such as halogen, alkyl and trihaloalkyl, and R.sup.3 is hydrogen or halogen. In one embodiment, the modulator is represented by Formula II which includes molecules described in WO2011/119663, the entire contents of which are incorporated herein by reference into this application.
(34) In one embodiment, the modulator represented by Formula II is GSK2656157 having the formula of
(35) ##STR00007##
In various embodiments, the modulator represented by Formula II is selected from the following molecules:
(36) ##STR00008## ##STR00009## ##STR00010##
(37) In one embodiment, the present method reduces the number of mature hypertrophic chondrocytes reversing to pre-mature chondrocytes as indicated by the decreased transcriptional or translational expression of immature chondrogenic markers such as Sox9, Col2a1, Ppr and Ihh.
(38) In one embodiment, the present invention provides a method of ameliorating one or more conditions of MCDS or congenial dwarfism by modulating the p-eIF2α-pathway. In one embodiment, the method includes the use of a molecule which inhibits the effects of p-eIF2 on translation regulation or a molecule which inhibits the ectopic translational or transcriptional expression of Sox9 or ATF4 in the defective cells. In one embodiment, the conditions to be ameliorated by the present method include but are not limited to disproportionate dwarfism, short stature or limbs, flaring of metaphyses, genu varum (bowing legs), coxa vara, hip deformation, platyspondyly (flat vertebral bodies), abnormal vertebral endplates, widened growth plate and consequent disc degeneration.
(39) Intervertebral Disc Degeneration (IDD)
(40) In one embodiment, the present invention provides a method of preventing or ameliorating, intervertebral disc degeneration (IDD) caused by the activation of the integrated stress response pathway, which might induced by oxidative stress (23), hypoxia (24), ER stress (19), nutrition deprivation (25), accumulation of toxic metabolites (26) and/or excessive mechanical loading (27). In one embodiment, the present method of preventing or ameliorating, intervertebral disc degeneration (IDD) involves the use of one or more modulators or molecules described in the present invention. In 13del mice, the malformed spinal growth plates and endplates causes decreased volume of vascular canals in subchondral region between growth plates and endplates, consequently lowers the oxygen/nutrition importation and toxic metabolites exportation in nucleus pulpous, triggers oxidative stress (indicating by upregulation of ATF5), and changes cell differentiation indicating by ectopic expressing Sox9, Osteopontin (Opn) and α-SMA. Moreover, the ectopic expressing of matrix protein Opn alter the matrix deposition and induced ER stress, indicating by ectopic expression of ER stress sensor Bip and ATF4, and caused cell death at later stage. On the other hand, caged mouse normally used its tail to help its stand up for food and water, which might cause excessive mechanical loading to the tail of 13del with short stature. Consistently, the early onset of disc degeneration in 13del mice was always first observed in tail IVD (level 6-8), indicating the pathogenesis role of mechanical loading in IDD development. In one embodiment, the present invention uses a molecule that is capable of modulating the activation of ISR or its underlying stresses or causes in intervertebral disc cells for the prevention or treatment of IDD.
(41) ISR-Associated Diseases Involving p-eIF2α Pathway
(42) The second aspect of the present invention is to provide a method of preventing and/or ameliorating aberrant cell differentiation, or modulating cell fate determination through the modulation of ectopic expression of ATF4 and its potential downstream factors, such as Sox9/SOX9, in a cell. The present invention further provides a method of modulating ISR-associated diseases where aberrant cell differentiation is at least part of the underlying mechanism through the modulation of ectopic expression of ATF4 and its potential downstream factors, such as Sox9/SOX9, in a subject. In one embodiment, the present method of preventing and/or ameliorating aberrant cell differentiation, or modulating cell fate determination involves the use of one or more modulators or molecules described in the present invention.
(43) The present invention highlights the potential of manipulating levels of the ISR for the treatment of ISR-associated human diseases resulted from various forms of cellular stress. As discussed above, ISR has a central role in many forms of cellular stress such as oxidative stress, hypoxia, ER stress and its induction is associated with diverse common diseases, such as cancer, inflammatory diseases, diabetes, fibrosis, obesity, neurodegeneration and skeletal disorders. The p-eIF2α signaling pathway, being a part of the ISR, could be a target for the prevention or treatment of these ISR-associated diseases. However, while stress responses commonly result in apoptosis, understanding how cells adapt, survive and a molecular understanding on the consequences of inducing the ISR on cell fate and differentiation in vivo is lacking. The majority of molecular mechanistic insights of the impact of the ISR are based on cell based assays not in vivo. The present invention exploited an in vivo model of a congenital developmental disorder (MCDS) in order to provide mechanistic insight into the question of impacts of the ISR on cell fate and importantly also addressed the possibility of preventive therapy.
(44) As reported herein, over-expression of ATF4 as part of the ISR has far reaching consequences in vivo, it directly activates the expression of Sox9 and thereby reverses the differentiation of a mature chondrocyte to a more immature state. SOX9 is a potent transcription factor with key roles in cell fate determination, not only in chondrocyte differentiation, but also in many other cell types, notably stem cells (e.g. dermal papilla, gonads, intestinal, and neural) and its overexpression or dysfunction results in many diseases including fibrosis and cancer (83). By preventing aberrant cell differentiation, titrated inhibition of the ISR emerges as a rationale therapeutic strategy for treating skeletal disorders or other disorders caused by ISR. The present invention revealed that given the importance of ATF4 to normal development, simply preventing its expression globally may not work therapeutically (
(45) In one embodiment, the present invention provides a method of modulating cell differentiation or cell fate using a molecule that modulates the ectopic expression of ATF4 and its potential downstream factors, such as Sox9/SOX9. In another embodiment, the present invention provides a method of preventing, ameliorating and/or treating an ISR-associated disease where cell differentiation or development is impacted in a subject, the method comprises a step of administering to said subject an effective amount of a molecule that modulates the ectopic expression of ATF4 and its potential downstream factors, such as Sox9/SOX9. In one embodiment, the present invention is used to prevent, ameliorate and/or treat diseases which are associated with or caused by an impacted cell differentiation or development, which include but are not limited to cancer, fibrosis, neurodegeneration and skeletal diseases. Firstly, it has been implied that cancer cells are selected to resist mild and prolonged ER stress by activating pro-survival UPR and PERK signaling pathway induces resistance to cell death elicited by endoplasmic reticulum stress and chemotherapy (28). Notably, gemcitabine resistance in pancreatic ductal adenocarcinoma is enhanced by activating multiple ISR-dependent pathways, including eIF2, Nrf2, Nupr1, BEX2, and Bcl2A1 (29). Moreover, increased phosphorylation of eIF2α in chronic myeloid leukemia cells contribute to the disruption of bone marrow niche components by cancer cells and in this way support CML progression (30). Secondly, the persistent presence of ER stress can increase cell death in injured tissues, induction of epithelial-mesenchymal transition (EMT) and promote fibrotic remodeling instead of the restoration of normal tissue architecture (31), and increased oxidative stress is a common pathological feature of fibrosis in a variety of organs, including lung (32), liver (33) and heart (34). Thirdly, both ER stress and oxidative stress have suggested to play important roles in neurodegeneration, such as Parkinson's disease, Alzheimer's and prion disease (35, 36). Finally, as discussed above, ER stress is associated with chondrodysplasias caused by mutations in ECM protein and mutations in key factors in ISR signaling pathway (37).
(46) p-eIF2α Modulators
(47) Without limiting the generality of the foregoing, the present invention provides a method of preventing, ameliorating and/or treating the conditions, disorders or diseases discussed herein using a molecule which targets the p-eIF2α pathway (a “p-eIF2α modulator”). In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating a condition, a disorder or a disease associated with integrated stress response involving the p-eIF2α pathway in a subject, comprising the step of administering to said subject an effective amount of a p-eIF2α modulator. In another embodiment, the present invention provides a use of a p-eIF2α modulator for the preparation of a medicament for preventing, ameliorating and/or treating a condition, a disorder or a diseases associated with integrated stress response involving the p-eIF2α pathway. In another embodiment, the present invention provides molecules that are capable of modulating the p-eIF2α pathway for use in the treatment of diseases or modulation of conditions described herein.
(48) In one embodiment, the subject is a human including an adult and a child, or an animal.
(49) In one embodiment, “effective amount” means the amount of a molecule necessary to achieve a desired physiological effect.
(50) In one embodiment, the present invention provides a method of modulating the p-eIF2α pathway in a cell or a population of cells, the method comprising contacting the cell(s) with an effective amount of a p-eIF2α modulator.
(51) In one embodiment, p-eIF2α modulators are small molecules, nucleic acids, proteins or other biomolecules. In one embodiment, p-eIF2α modulators are small molecules which are represented by Formula I or II described above. In one embodiment, p-eIF2α modulators are p-eIF2α inhibitors that inhibit one or more downstream molecules or signaling events under the p-eIF2α pathway such as ISRIB and GSK2656157 and their analogs. In another embodiment, p-eIF2α modulators are molecules that activate one or more downstream molecules or signaling events under the p-eIF2α pathway such as Sulubrinal and Guanzbenz and their analogs. In yet another embodiment, p-eIF2α modulators are molecules that alter one or more downstream molecules or signaling events under the p-eIF2α pathway (for example, those illustrated in
(52) In one embodiment, said p-eIF2α modulators are capable of targeting eIF2α phosphorylation such as ISRIB and its analogs. In another embodiment, p-eIF2α modulators are molecules which are capable of targeting GADD34-Pp1c or promoting the assembly of GADD34-Pp1c. In yet another embodiment, p-eIF2α modulators are molecules which are capable of modulating the expression of ATF4 and its potential downstream factors, such as Sox9.
(53) In one embodiment of the present invention, the effective amount of p-eIF2α modulator such as ISRIB to be given to a subject is 2.5 mg/kg to 20 mg/kg per day. In various embodiments, the effective amount of p-eIF2α modulator is 0.05-0.1, 0.1-1, 1-5, 5-10, 10-20, 20-25, 25-50 or 50-100 mg/kg per day. In one embodiment, the subject is treated for 1 day or up to 365 days. In various embodiments, the subject is treated for 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325 or 350 days.
(54) In one embodiment, two or more p-eIF2α pathway modulators are administered concurrently. In another embodiment where two or more p-eIF2α pathway modulators are to be administered, the second or subsequent p-eIF2α pathway modulators are administered immediately or a certain period after the administration of the previous p-eIF2α pathway modulator.
(55) ATF4-Binding Site on Sox9 Locus and Binding Enhancers
(56) In one embodiment, the present invention provides a method of inhibiting the ATF4/ISR mediated activation of transcription of murine Sox9/human SOX9, thereby preventing, alleviating and/or treating conditions resulting from the overexpression of SOX9; the method comprises a step of contacting the cells with, or administering to a subject, a molecule that is capable of blocking the ATF4-binding site on the Sox9/SOX9 locus, or by interfering with molecules that modulate the ATF4-mediated transcription of Sox9//SOX9 (such as a molecule that enhances the binding between ATF4 and Sox9/SOX9 locus, i.e., an ATF4-binding enhancer).
(57) Sox9 was found to be located within the boundary between two sub-TADs (topologically associated domains) within chromosome 11 (chr11: 110760000-114800000), represented by chr11: 111520000-12200000 and chr11: 113160000-114160000 respectively (99, 100) (
(58) The present invention has identified the putative binding site for ATF4 on the Sox9 locus in hypertrophic chondrocytes of mice—a region in chromosome 11 (loci: 112642927-112643074) which covers the promoter region of Sox9 (
(59) In one embodiment, the present invention provides a method of inhibiting the transcription of murine Sox9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the murine Sox9 locus. In one embodiment, said ATF4 binding site is located within mouse chromosome 11 (loci: 112642927-112643074) having the sequence TGTTGCAA (SEQ ID NO: 1). In another embodiment, said ATF4 binding site is located within the binding sites for ATF4 as reported in Han: GTCACCCAAACATTTGCTTCCAAAAGACCATTTCTAAGCACTTTTTTTGGAAGCCGGC AGACTCCAGGCGCAGAAGCCCAGCTCCGCTTTGACGAGCAGCTGTTGCAATTTCCA TTGCTGTAAACGCCAGCGAAGTCCCGGGTACCAC) (SEQ ID NO.: 2), the entire contents of which are incorporated herein by reference into this application (44).
(60) In one embodiment, the present invention further provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the human SOX9 locus. In various embodiments, said ATF4 binding site is located within human chromosome 17 (chr17:68609000-71514000). In one embodiment, said ATF4 binding site is TGTTGCAA (SEQ ID NO.: 3) (38) which is the consensus sequence of ATF4 binding site on human SOX9 locus.
(61) In various embodiments, various approaches including those described in Han (44) are used to identify the functional binding sites of ATF4 on Sox9/SOX9 or other related ATF4 potential downstream factors. In one embodiment, ATF4-binding sites on Sox9/SOX9 or other related ATF4 potential downstream factors are mapped by the core Amino Acid Response Element (AARE) sequence TTgCaTCA (SEQ ID: 4), which is the complementary strand of SEQ ID NO.1.
(62) In one embodiment, open chromatin regions in cells expressing Sox9/SOX9 upon induction of the ISR and/or ATF4 over-expression is identified via ATAC-seq (39). This method applies hyperactive Tn5 transposase, which inserts sequencing adapters into accessible regions of chromatin, to mark accessible regions of DNA which are then sequenced. GFP (or other reporter) are inserted into 3′ untranslated region of mouse or human locus and targeted so as to provide a readout of SOX9 activity, alternatively the cells derived from Sox9.sup.EGFP/+ mice are adopted (40). Cells are subjected to ER stress, hypoxia or other stresses to induce the ISR, or over-expression of ATF4 is induced.
(63) Three biological replicates for ATAC-seq are generated to identify enhancers that are active and distinct to the So9.sup.+ve/SOX9.sup.+ve population. Approximately 10,000 FACS sorted EGFP.sup.+ve and EGFP.sup.−ve cells are isolated from Sox9.sup.EGFP/+ mice and library are prepared via NEBNext High Fidelity 2×PCR Master Mix. The amplified libraries are purified by AMPure beads, quantitated (KAPA biosystems) and sequenced at 10-15 million reads.
(64) Filtered reads are aligned to the mouse and human reference genomes using BWA and subjected to peak calling using MACS2. The regions with enrichment of transposition events indicating for open chromatin are identified. By comparing Sox9.sup.+ve/SOX9.sup.+ve specific enhancer profiles, we are able to distinguish and capture putative ISR induced and/or ATF4-associated enhancers: a) those for driving Sox9/SOX9 expression under normal non-stressed conditions; and b) those active when the ISR is induced and/or ATF4 is overexpressed. This approach allows us to prioritize amongst the putative enhancers, not only for functional validation but also for generation of a regulatory map of ISR- and/or ATF4-associated Sox9/SOX9 enhancers.
(65) To overcome variability in expression due to position effects, regions in the mouse genome or human genome that are constitutively open and therefore not subject to position effects are used for assaying the enhancer activity (e.g. the TIGRE locus (41, 105)). Reporter locus are targeted in cell lines and transgenic mice with a vector comprising a minimal promoter (such as hsp68 or the minimal SOX9 promoter which has no activity in cells/transgenic mice) linked by a 2A peptide sequence (42) to a fluorescence reporter (e.g. GFP, RFP, YFP etc.) or other factors (e.g. luciferase).
(66) In one embodiment, the enhancer interference assay is used for functional validation of enhancer elements by epigenome inhibition in vivo and in vivo, using a nuclease-deficient Cas9 (dCas9)-histone demethylase (43) fusion to inhibit the activity of candidate enhancer(s) by selectively altering the chromatin state of the target enhancer(s). Removal of H3K4meI/me2 modifications from specific active enhancer(s) using targeted catalytically inactive dead-Cas9 (dCas9) fused to the lysine-specific demethylase 1 (KDM1A/LSD1) results in ‘inactivation’ of enhancer elements and down-regulation of gene expression from the associated loci. The transgene containing dCas9-LSD1 is targeted via using CRISPR-Cas9 (44), in which a guide RNA (gRNA) is specifically designed to direct LSD1 to the putative Sox9/SOX9 enhancer(s). In this way, the expression of LSD1 on targeting specific enhancer(s) silences the candidate enhancer(s) by demethylation of histone H3K4me2 and destruction of K27 acetylation (H3K27ac).
(67) The targeted enhancer(s), resulting in loss of SOX9 driven EGFP expression when the ISR is activated and/or when ATF4 is over expressed, are first identified in vitro. In vivo, the activities of identified ISR- and or ATF4-inducible SOX9 enhancer(s) are assessed by: a) mutating the enhancer(s) in mice using CRISPR-Cas9; and b) targeting the enhancer(s) to the ISR reporter vector described above comprising a minimal hsp68 promoter and testing for its ability to be activated upon ATF4 or ISR induction in double transgenics where ISR is triggered and/or ATF4 is over-expressed.
(68) On the other hand, a total of 25 putative ATF4 binding enhancer regions were identified in the mouse Sox9-TAD domain (Table 1) by published ATF4 ChIP-seq (45), and
(69) In one embodiment, the present invention provides a method of inhibiting the transcription of Sox9/SOX9 (such as murine Sox9/Human SOX9) by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulates the transcription of murine Sox9, said ATF4 binding enhancer comprises a sequence selected from the group consisting of SEQ ID NOs.: 5-29.
(70) In another embodiment, the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9. To identify the putative ATF4 binding enhancer regions in the human SOX9-TAD domain, ATF4 ChIP-seq is applied in human fibroblasts, cancer cell lines, and chondrocytes (or any other cell lines where stress induces SOX9*) differentiated from human iPS. The cells are treated with an ER stress-inducer such as tunicamycin (46) to activate the preferential translation of ATF4, and three biological replicates for each cell type are generated. In one embodiment, said ATF4 binding enhancers are located within human chromosome 17 (chr17:68609000-71514000).
(71) In various embodiments, the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9, said ATF4 binding enhancer comprises a sequence that could be similar/homologous to the murine sequence selected from the group consisting of SEQ ID Nos.: 5-29. In one embodiment, said ATF4 binding enhancer comprises a sequence corresponding to a sequence which is at least 70%, 75%, 80%, 85%, 90% or 95% homologous to the sequence selected from the group consisting of SEQ ID Nos.: 5-29. In another embodiment, said ATF4 binding enhancer in human comprises a sequence corresponding to and showing high consensus to the murine sequence selected from the group consisting of SEQ ID Nos.: 5-29. It is also possible that there will be human specific ATF4 binding enhancers not present in mouse. These will be detected by the ATAC-seq and ATF4 ChIP-seq approaches described above. Functional validation of the human enhancer activity will be tested by linking putative enhancer(s) to reporter (e.g. Luciferase/fluorescent proteins) constructs and testing for their activation upon inducing the ISR in vitro (mouse or human cell-lines) and in vivo, using transgenic mice in which the ISR is induced, such as in 13del.
(72) TABLE-US-00001 TABLE 1 Putative ATF4 binding sites on murine Sox9 locus within Chromosome 11 in mice. Start End SEQ ID ID position position Sequences NO. 1 111688769 111688869 GAGTTGCCACAGCTTCCCTGGTGGTAGCACAGATGTTGTC 5 TGGCAGACAGAGACAGAGGCTTACAGGACAGTCTCAAGA ACGACCAGAGTCAACCTGAACA 2 111762751 111762851 TACCCCCCAAAAATATAAAATAAAATCCCTTAGTCTAAA 6 ATTCCATGCAATTAACATTGTTTACTTAAGGAGGAAGCTC TCCAGGACAATGTTCACATCTA 3 111792806 111792906 CAGTTCTTTCAGGAAGAAAAACAAACATTCCACTCAAAG 7 TTAAAACTGAATTGTTTCCCATTTGAACAAATTATGACTT TTGATATATAATAGAGAAGACT 4 111857540 111857640 GGAAGTGGGGGTGGTGACAAAGGAGGTGGTAAGGGAGG 8 GGAAATTGTGATCAGGATGTAACATAGGCGAGAATAAAT TCATAATGTTAACTAACAAAAAAA 5 112003191 112003291 CATCCAGAAGGACAATGTCAACATCTAGCCTCAGCATGT 9 GGTCACTGAGACTTCCCACAAGGATTTGATATTTTTAACA TTACCAAAGCACGGTACACAAC 6 112063301 112063401 TTCAACCTTGTACAACTCCAGACTCGGTGACTCTAGACAC 10 AGTAGGAGAGAAGGAAACTAAAGAAGAGTOTGGGAAGC TTACATGCTCACATTCTGACCCA 7 112472513 112472613 ACAGCCATTTCCTCCTTAGCTGCCTCCTACAAAACATCAC 11 ACCCTGGCCTCCATCCTCAGCCCAGTGCCAGGCCCATCAT TGGGGAAGACACCGCACTTCC 8 112546494 112546594 AGTGACAGAGAGTGTCAGGATGTGATGGGGCCTCCAGTG 12 ACCACCTCGCTCACCCGGGAACTTTCCAAATGTCACACAT AAACCCTCTCACTAATTAGCTG 9 112608916 112609016 GAAGAATGCAGGCAAGAAACATAGGAGAGAAGCACTCC 13 TGAATGGAGCCTTCCCGCTCAGAGAGCAATTGTTGCTGCT CACTCTTTTGGAGCTCAACAAAC 10 112613540 112613640 ATTAAATAAAGTTGTAATGATGGCGTTTTGATCCAACAGG 14 CCTCTTTTTTTTTAAATATTTTTATTATTATGTATTTTCCTC AATTACATTTAGAATGCTA 11 112638971 112639071 CCTGAGAGCTTTTCAGACTCAATTATCCCTAAAGCCATAA 15 TGAGAACTGCATCATGGAAAGGAGACTTGGACCCTATGA CATGCAGTAACAAAGAGTCTGC 12 112662091 112662191 CCTTTGCAGATGAAGTAATACACAATCCTGGAAGGTGCA 16 CTAAAAATCCTAGGAAGAAGACAGAGTGATTCAGCCTGA ATATTGAGAAGAGAATCCAGGGA 13 112782311 112782411 AAGAGAGACGAGGTGCAAGTGGCCCCGGTTTCGTTCTCT 17 GTTTTCCCTCCCTCCTCCTCCGCTCCGACTCGCCTTCCCCG GGTTTAGAOCCGGCAGCTGAG 14 112805430 112805530 GTCCTTCTTTCTTATTATGGCTGAGGGCTCCAGCCCATCTC 18 TACTTAGAACCACATCCAGCGCATCTCTCATTCCACTCCT CCCCTGTTCTCTCAGTCTCC 15 112837797 112837897 TACACACAAACATATACATACATACACATACATCTTTACA 19 CACATATGTACAAACACACACCAAACACATCCACCACAA TAAATATTTTAAGTTGAAAAGT 16 112849357 112849457 GGGTTTTCTATAAGAGCACTGCATGCTTTAAACCAGAGA 20 GTCCTCTTTCTGTTTCTTCTTTCGTTTTCTAAGAATGAATC TCATGTACCCCAGGCTGACTT 17 112925650 112925750 GTAATTCTTTGACTCTTGACTTCTTGGGATAGCATGCTTG 21 ATAATGATCAAAGCAGCAAACAGACCTGGTTAGGAAAAT GGCCGTTCTCCCTTCCACTGCT 18 112958017 112958117 CTCACATGGTGTTCCCCGGTAGGAGGAATGGCATGGCTG 22 CCTCTACATAAATGCAGGGGGOTTGGGAGGGTGCAAGGG CATCTCCTGAAGGAGGACCTGCT 19 113297871 113297971 TCCCAAAGGATGGGATTATAGGTCTATGCCACCACATGC 23 CCCCTGGGCGCTGATTTTTGATCCCTGCCACTGATCCAGT AGGACACTGAGGTGCAGTAGCA 20 113538311 113538411 GCTTCTACTCAGTTGCAATAAGACCTTTAGGCTGATTTTA 24 ATAGAGGGCAATACAAATAAAGTCGCAATTAATATTCCT ATTCAGTTTCTTAAAAGAAATA 21 113568366 113568466 TCTCAGCTCCTCCTGCGCCATGCCTGCCTGGATACTGCCA 25 TGCTCCCACCTTGATGATAATGGACTGAACCTCTGAATCT GTAAGCCAGCCCCAATTAAAT 22 113609981 113610081 AAAAAAAAATAGAGAGAGAGGTGCCTGTGCGCCATTTAC 26 AACACATTTAAGTAAATCAATAGGAAAAAAATAGCAGAA ATAATTAGAATTGCCTGTCCTTG 23 113671192 113671292 TCAGTGCTCTTACCCGCTGAGCCATCTCGCCAGCCCTCAA 27 CATTTTTAAAATTATGCCCAACTTGGAGCTGGAGAGATGG CTCAACAGTTAAGAGCACTGG 24 113910532 113910632 TGGGTGGCTTGTGTGAAGCCTGCCCTGAGCCTTTTAAAAA 28 TTATACTTTGTATTCATTTCTTTGTGTACGTGTGCACGTGT GTGAGGTCAGAGGACAAGTC 25 113926715 113926815 TACTTTTGTGTGTGTGTGTGTGCGTGTACATGTGTGCACA 29 TGCATGCTCACTTAATTGACTTTCATTATGCTTGTGAGGG GTTGTTTATCAGCTCATTGAT
Drug Screening Platform Using 113Del and 13Del-KI Transgenic Mice
(73) The third aspect of this invention is to provide a method of screening a candidate molecule for the ability to modulate a skeletal disorder or its phenotypes associated with ISR involving the p-eIF2α pathway using transgenic mice disclosed in the present invention.
(74) In one embodiment, the present invention provides a method of screening a candidate molecule for the ability to modulate a skeletal disorder or skeletal abnormalities associated with ISR involving the p-eIF2α pathway, comprising the steps of administering said candidate molecule to a transgenic mouse carrying a Col10a1 transgene or having a DNA sequence encoding the mutated collagen protein Col 10-13del, and expressing a phenotype lacking hyperostosis. In one embodiment, the transgenic mouse represents a direct equivalent model of human 13del MCDS mutation. In one embodiment, the transgenic mouse is 13del mice or 13del-KI mice.
(75) In one embodiment, the present screening method further comprises a step of detecting any changes in the mouse that indicate improvement of said skeletal disorders or skeletal abnormalities including but are not limited to disproportionate dwarfism, short stature or limbs, flaring of metaphyses, genu varum (bowing legs), coxa vara, hip deformation, platyspondyly (flat vertebral bodies), abnormal vertebral endplates, widen growth plate and disc degeneration.
(76) In one embodiment, the present screening method comprising the step determining one or more of the following parameters in the mouse treated with said candidate molecule and comparing the results with those from a positive control such as ISRIB and a negative control: a) the growth curve, including body trunk length and whole body length, during whole period of treatment; b) limb length, including individual limb bones, after treatment; c) the spine length and curvature after treatment; d) the angle between proximal head and distal head of tibia after treatment; e) pelvic bone orientation (the angle between ilium and pubis) after treatment; f) the angle between the proximal head and the shaft of the femur after treatment; g) the heights of growth plates from limb bone and spine; h) the onset time point of disc degeneration after preventive treatment (administration before IDD observed); i) the X-ray examination and MicroCT examination of IDD development during the preventive treatment (administration before IDD observed); j) the X-ray examination and MicroCT examination of IDD development during the therapeutic treatment (administration after IDD observed); k) the disc histological morphology after or during the preventive (administration before IDD observed) and therapeutic treatment (administration after IDD observed), including the heights of growth plates, the irregularities of endplates, the volume of vascular canals in subchondral region between spinal growth plate and endplate, the disc distance and the calcification of nucleus pulpous (NP); l) the expression and transcription level of ectopic expressing factors, such as Sox9 in the affected disc after treatment; m) the cell number of ectopic expressing factors, such as Sox9 in the affected disc after treatment; n) the expression and transcriptional level of affected factors, such as Col10a1 in the affected disc after treatment; o) the number of affected factors expressing cell, such as Col10a1 in the affected disc after treatment; and p) the number of apoptotic cells in the affected disc after treatment.
Discussion
(77) In a transgenic mouse model displaying phenotypes reminiscent of congenital dwarfism [Metaphyseal chondrodysplasia, type Schimd (MCDS), MIM156500] and intervertebral disc changes consistent with early stages of human intervertebral disc degeneration (IDD), it has been shown that synthesis of misfolded collagen X in hypertrophic chondrocytes causes abnormal intracellular retention of secreted proteins and triggers the unfolded protein response (10). Specifically, it has been found that the PERK pathway, which controls protein translation via eIF2α phosphorylation and induction of the transcription factor ATF4, causes the hypertrophic chondrocyte differentiation defect in the growing long bones and spine. In one embodiment of the present invention, ISRIB, a selective modulator of phosphorylated-eukaryotic initiation factor (p-eIF2α) and eIF2B complex, is used to prevent and/or ameliorate the dwarfism and intervertebral disc degeneration caused by induction of the integrated stress response pathway.
(78) As shown in
(79) It is observed in the present model that UPR plays a critical role in the pathogenesis of MCDS. The present invention identifies the mechanism(s) underlying the ER stress-associated skeletal defects in the MCDS model. The present invention further discloses a novel approach in preventing or treating ISR-associated diseases, in particular to diseases where aberrant cell differentiation is the underlying cause.
(80) This invention will be better understood by reference to the examples which follow. However, one skilled in the art will readily appreciate that the examples provided are merely for illustrative purposes and are not meant to limit the scope of the invention which is defined by the claims following thereafter.
(81) Throughout this application, it is to be noted that the transitional term “comprising”, which is synonymous with “including”, “containing” or “characterized by”, is inclusive or open-ended, and does not exclude additional, un-recited elements or method steps.
(82) UPR Disrupts Transcriptome Patterns in the Chondrodysplastic Growth Plate
(83) The mammalian growth plate comprises four major sub-populations of chondrocytes organized into zones: resting, proliferating (PZ), prehypertrophic (PHZ) and hypertrophic (HZ). These chondrocytes have distinct morphologies and gene expression profiles governed by a precisely tuned gene regulatory network (48). To investigate the effect of the UPR on transcription, chondrocytes in the proximal tibia growth plates of postnatal day 10 (p10) from wild-type and MCDS 13del mice were fractionated into sub-populations representing proliferating, prehypertrophic and hypertrophic chondrocytes (HC) (
(84) k-means clustering was used to categorize the gene expression patterns across different zones in wild-type and 13del growth plates into four clusters. Genes (453) in Cluster I increased expression from PHZ to lower HZ specifically in 13del HC (
(85) PERK Signaling is the Major Contributor to Chondrocyte Adaptation to ER Stress
(86) The UPR employs three arms of sensors in the ER to mediate cell adaptation and survival under ER stress: PERK, IRE1α, and ATF6 family (49-51). Upon ER stress, ATF6 family factors move from the ER to the Golgi, are processed by S1 and S2 proteases, and translocate to the nucleus to activate ER quality control genes such as Hspa5 (encodes BiP) and Xbp1 (X-box binding protein 1). IRE1α has kinase and endoribonuclease (RNase) activities. It catalyses the splicing of Xbp1 mRNA, generating the UPR transcription factor XBP1.sup.s that upregulates genes encoding chaperones and proteins involved in ER-associated protein degradation (ERAD).
(87) PERK phosphorylates serine 51 in eIF2α, promoting the formation of a p-eIF2α and eIF2B complex, consequently inhibiting the guanine nucleotide exchange activity of eIF2B (52). Inactivation of the eIF2 complex leads to shut down of protein synthesis except for certain proteins, including ATF4, CHOP and other factors with both pro-survival and pro-death functions (47). eIF2α phosphorylation is transient and is reversed by GADD34, the regulatory subunit of eIF2α phosphatase, acting in a negative feedback loop, allowing protein synthesis to restart. When the stress is intense or prolonged, cells fail to adapt and apoptotic cell death is triggered. This PERK-p-eIF2α/ATF4/CHOP modulation of mRNA translation is a central part of the more general ISR (18).
(88) Contributions of PERK, IRE1 and ATF6 to the HC response to ER stress were investigated. By ontology and pathway analysis of Cluster I, enrichment of genes in the PERK pathway and IRE1-XBP1.sup.s regulated ERAD was found, but not for ATF6 signaling (
(89) Together, these data suggest a prominent contribution of the PERK signaling pathway. To test this notion, Xbp1.sup.s was ectopically expressed in HC in transgenic mice (
(90) ATF4 Expression in Hypertrophic Chondrocytes Reprograms Differentiation
(91) Apart from its role in the UPR, ATF4 also regulates chondrocyte differentiation through activating Ihh (54). ATF4 is normally expressed in fetal growth plate chondrocytes, but not in HC by p10 (
(92) To dissect apart the contribution of ATF4 to aberrant HC differentiation in the absence of ER stress, a transgenic mouse model carrying a Col10-Bac-ATF4-IRES-EGFP transgene was generated (hereafter referred to as C10-ATF4) (
(93) ATF4 Reprograms Chondrocyte Hypertrophy by Directly Activating Sox9
(94) In C10-ATF4 HC, constitutive ATF4 activation down-regulated expression of Col10a1, and led to expression of prehypertrophic chondrocyte marker genes Sox9, Col2a, Ppr and Ihh in the lower portion of the HZ (
(95) SOX9 is highly expressed in immature chondrocytes, transactivates critical cartilaginous matrix genes and regulates chondrocyte proliferation, differentiation and hypertrophy (55, 60-63). It is required for the expression of SOX5 and SOX6, which cooperate with SOX9 to transactivate Col2a1 (61). Two putative C/EBP-ATF4 motifs, named A1 and A2, were identified in the Sox9 promoter region covering the ATF4 binding peak. By transfection assays in ATDC5 chondrocytic cells, it was found that ATF4 could transactivate luciferase reporters controlled by motif-containing Sox9 promoter (
(96) The contribution of ATF4 activation of Sox9 in reverting HC differentiation by conditionally inactivating Sox9 in C10-ATF4 HC was then assessed using HC-specific Col10a1-Cre (56) (
(97) CHOP Plays an Adaptive and Pro-Survival Role in 13Del HC
(98) How do the ER-stressed HC survive? CHOP is another prominent transcription factor activated in the PERK, downstream of p-eIF2α, that regulates protein synthesis via the GADD34 negative feedback loop, which restores protein synthesis and induces oxidative stress via Ero1l (45, 64). Although CHOP is widely considered as a proapoptotic factor (45), it has context- and cell-type specific roles as an adaptive and pro-survival factor in several diseases (65-68). Therefore, the contribution of CHOP in the adaptation of 13del HC was assessed.
(99) It is found that ablating Chop in 13del mice exacerbated the skeletal defects and growth plate phenotype. The 13del;Chop.sup.−/− mice displayed further tibial shortening (
(100) These results are in contrast to the pro-apoptotic role reported for CHOP in a mouse model of Pseudoachondroplasia caused by expression of misfolded cartilage oligomeric matrix protein in proliferating and hypertrophic chondrocytes, where deleting CHOP reduced apoptosis but exacerbated growth plate chondrocyte disorganization (69, 70). These differences may be due to variation in the responses of proliferating versus hypertrophic chondrocytes and/or the acuteness and duration of the ER stress. The present transcriptome analyses of fractionated 13del;Chop.sup.−/− growth plates revealed up-regulation of molecular chaperones (Bip, Dnajb9, Dnajb11 and Calnexin) and ER stress sensors Xbp1 and Atf4 in the middle and lower HZ (
(101) On the other hand, ablation of GADD34, the modulator of translation recovery and downstream target of CHOP, from 13del HCs lead to a HZ reduction on day 10 (89% of 13del, n=5) (
(102) ATF4 and CHOP Mediate Chondrocyte Survival by Activating Fgf21
(103) CHOP acts not only downstream of ATF4, but also as its interacting partner in modulating ER stress targets (45). To elucidate the pro-survival role of the PERK signaling pathway in 13del HC, target genes of CHOP and ATF4 in Cluster I were searched. Fgf21, a reported target of ATF4 (72), was found to be the most up-regulated gene in 13del HC (
(104) FGF21 is a hormone with roles in glucose and lipid metabolism (74) and plays an survival role in the response to diverse stressful conditions, such as amino acid deprivation, mitochondrial stress and ER stress associated with diseases such as diabetes, cardiovascular disease (75-77). Fgf21 expression was found to be greatly increased (>100 fold) in response to treatment with the ER stress inducer tunicamycin in fibroblasts (NIH3T3 and MEF cells) and ATDC5 cells (
(105) The present invention assessed whether FGF21 had a survival role in 13del HC by genetically ablating the gene (
(106) The present invention next tested the functional relevance of a reported C/EBP-ATF4 binding motif in the Fgf21 promoter (78) that coincided with an ATF4 peak. By transactivation assays (
(107) ISRIB Inhibition of the PERK Signaling can Ameliorate 13Del Skeletal Deformities
(108) In the UPR, PERK phosphorylation of serine 51 in eIF2α is the critical upstream controlling point that triggers the p-eIF2α/ATF4/CHOP signaling pathway (18). The present data show that genetically ablating the key transcription factors in the PERK signaling as a strategy for rescuing the aberrant chondrocyte differentiation is imperfect, because of effects on cell survival. In addition, addressing the effects of transcription factor over-expression and cell-type specificity is required because ATF4 is essential for normal development. Therefore, it is necessary to identify a suitable entry point in the pathway which can be manipulated for protection or rescue from the effects of ER stress, without interfering with normal developmental function.
(109) As summarized in Table 2, small molecules targeting PERK signaling pathway have been reported in neurodegenerative disorders and cancer therapy (14). Recently, a small molecule, Integrated Stress Response InhiBitor (ISRIB) has been reported to render cells insensitive to eIF2α phosphorylation by targeting the interaction between eIF2 and eIF2B, and its activity is independent of eIF2α phosphorylation (79, 80). ISRIB shows acceptable pharmacokinetic properties and no overall toxicity in mice, and has been reported to show significant neurotrophic effects in mice (79, 81).
(110) TABLE-US-00002 TABLE 2 Pharmaceutically Targeting PERK Signaling Pathway in Disease Molecules Target (Effects) Disease Phase
(111) The potential of ISRIB to modify the chondrodysplasia phenotype was tested by treating 13del and wild-type littermates with ISRIB or vehicle twice daily by intraperitoneal injection from E13.5 (onset of expression of 13del transgene) to postnatal day 20 (p20) (
(112) Moreover, it was found that the HZ expansion in the limb growth plates of ISRIB-treated 13del mice was greatly reduced and the number of SOX9.sup.+, Col2a1.sup.+ and Ppr.sup.+ cells in the HZ at p10 and p20 was diminished (
(113) The 13 Del-Knockin MCDS Mice
(114) These mice are similar to the transgenic 13del mice in terms of the Col10a1 13del mutation except that in these mice the 13del deletion was introduced into the endogenous Col10a1 allele by homologous recombination in mouse embryonic stem (ES) cells. This mouse, referred to here as 13del-KI, therefore represents a direct equivalent model of the human 13del MCDS mutation and is another mouse model for the UPR triggered by expression of 13del-collagen X (
(115) Comparison Between 13Del and 13Del-MCDS Mice
(116) The 13del and 13del-KI mice express the same collagen X mutation. The gross phenotype of dwarfism of the 13del-MCDS was similar to that of 13del except for the absence of hyperostosis and the degree of expansion of the 13del-KI HZ was not as severe as for 13del. The 13del-KI mice recapitulated all the skeletal phenotypes of MCDS, including disproportionate dwarfism, and skeletal abnormalities including flaring of the metaphysis, coxa vara, deformities in the pelvic bones, in heterozygotes and homozygotes with the latter being more affected. Both mouse models display expanded HZ and accumulation of premature HCs (
(117) Intervertebral Disc Degeneration (IDD) in MCDS Mice
(118) It is noted that some cases of MCDS display spinal abnormalities including in vertebral bodies and end plate irregularities (82). S. Ikegawa at Center for Integrative Medical Sciences, RIKEN, Tokyo, has examined the MRI of the spine of a 20-year-old male MCDS patient and found evidence for signal intensity loss (“dark disc”) and irregularities in the end plate (
(119) The expanded and irregular endplates can be observed in 13del mice at early p10 and p20 stage (
(120) Interestingly, the elevated stress response in 13del NP is accompanied by significant cell fate change, implied by the ectopic expression of Sox9 (
(121) Spinal changes were also observed in 13del-KI mice, including shortened vertebral bodies throughout the spine, disc space narrowing and similar irregularities of iAF (4-weeks-old mice) (
(122) These findings suggest 13del and 13del-MCDS mice could be used to model changes in the IVD from activation of ER stress in hypertrophic chondrocytes of the cartilage endplate.
(123) ISRIB Prevents the Molecular Changes in the 13Del IVD
(124) As abovementioned, ISRIB treatment in 13del mice reduced the deformities in growth plates of axial skeleton, with reduced HZ expansion and decreased number of Sox9.sup.+ and Col2a1.sup.+ premature cells in tail intervertebral disc growth plates (
(125) Disrupted matrix deposition in NP could be an important characteristic of degenerative changes. In 13del lumbar NP, the ectopic upregulation of Opn was observed at p10, p20 and 16-month stages (
(126) Multiple stresses can activate the integrated stress response, in which ATF4 directly transactivates another important transcription factor ATF3. In 13del lumbar IVD, ATF3 is significantly activated not only in HCs in the growth plate and endplate, but also in the NP. Notably, the activation of ATF3 can only be observed in L3-L6, the region mostly affected by spine bending caused by lumbar lordosis. This finding strongly suggests the correlation between spine alignment and the onset of IDD. After the ISRIB treatment, no Atf3.sup.+ cell can be detected in L3-L6 NP, nor growth plates or endplates (
(127) Hypoxia Stress in 13Del MCDS Mice
(128) The ISR is activated by many cellular stresses including oxidative, nutritional and hypoxic. HIF pathway activation can be a consequence of UPR, and PERK pathway is also at the heart of hypoxia stress signaling pathway (18). In 13del HCs, HIF1α and its associated or downstream factors were upregulated (Table 3).
(129) TABLE-US-00003 TABLE 3 Hypoxia stress is triggered in 13del HCs. Aars Bcat1 Cth Gdf15 Mafk Plaur Serpine1 Adm Bnip3 Dsp Gja1 Malat1 Ppp1r13l Slc2a1 Ak3l1 Cdk2ap2 Egln1 Gpt2 Mgea5 Psph Slc7a5 Aldoc Cebpb Eif4a1 Grpel1 Mthfd11 Riok3 Stc2 Asns Cebpd Fn1 Herpud1 Ndrg1 Rlf Tmem158 Atf3 Cited2 Gadd45a Ier3 Nfil3 Sars Tmepai Atf5 Creb3l2 Gadd45b Junb Pfkp Sdc4 Trib3
(130) In 13del-KI mice, HIF1α and HIF2α immunohistochemistry staining showed a strong accumulation of HIFs proteins in hypertrophic chondrocytes when compared with wild-type. In postnatal 10-day-old growth plate, HIF1α is detected in proliferating chondrocytes and resting chondrocytes, but not in hypertrophic chondrocytes. In the 13del-KI littermates, HIF1α is not only accumulated in proliferating chondrocytes, but also in the hypertrophic chondrocytes from the upper to lower hypertrophic zones (
(131) EF5 assay, which detects hypoxic cells in vivo system, was then performed in P10 littermates of WT and 13del-KI mice. The 13del immunofluorescence staining shows that almost all the hypertrophic chondrocytes are expressing mutant collagen type X in 13del-KI growth plate (
(132) To assess the relative contribution of intrinsic and extrinsic response in the activation of the hypoxia response, EF5 was administrated by intraperitoneal injection into a P9 GFP/13del-KI chimera mice and sacrificed 4 h later. In the distal tibia growth plate, columns of 13del positive hypertrophic chondrocytes can be detected with the 13del antibody indicating these are derived from clonal expansion of MCDS proliferating chondrocytes that are differentiated to hypertrophic chondrocytes. EF5 positive cells are highly correlated with the cells expressing 13del protein (
(133) As abovementioned, ATF4 is regulated at the translational level in ISR under anoxic and hypoxic conditions, mediates in part by the unfolded protein response and is an important regulator of cell fate. Therefore, ATF4 could be the essential link between ER stress and hypoxic stress. In C10-ATF4 mice, HIF1α can be detected in proliferating chondrocytes as well as the hypertrophic chondrocytes in the expanded hypertrophic zone in C10-ATF4 transgenic mice, while HIF1α can be only detected in proliferating chondrocytes but not in hypertrophic chondrocytes in wild-type mice as previously shown (
(134) Identified Putative ATF4 Binding Region on Sox9 Topologically Associated Domains (TAD)
(135) Chromosome conformation capture methods (capture Hi-C and 4C-seq methods) have been used to identify SOX9 subchromosomal structures of higher-order chromatin interactions called topologically associated domains (TADs) (85), which are separated by boundary regions that have comparatively high levels of transcriptional repressor CCCTC-binding factor (CTCF) (86). The TADs subdivide the SOX9 genome into discrete regulatory units, to which the majority of observed interactions between promoters and enhancers are restricted (87, 88).
(136) Both human SOX9 (hSOX9) and mouse Sox9 (mSox9) are located within the boundary region between 2 sub-TAD domains in human and mouse genome respectively, and share a highly conserved TAD pattern (
(137) Methods
(138) Mice Breeding
(139) The 13del transgenic mice were maintained in F1 (C57BL/6×CBA) background. The 13del-KI mice were maintained in C57BL/6 background. The Chop-null mice and Fgf21-null mice were reported previously (13, 89). The Sox9-flox mice was a gift from Prof. Andreas Schedl' lab (Institute of Biology Valrose, France) (60). The C10-ATF4 transgenic mice were generated by injecting a BAC vector (Col10a1-ATF4-IRES-EGFP) into the F1 zygotes and maintained in F1. Mice were genotyped by PCR using primers (5′-CAGATCAGTGATGGGCTATG-3′ (SEQ ID NO: 30) and 5′-GAACCACCTOGAGAAGGCAGATT-3′ (SEQ ID NO: 31). Animal care and experiments performed were in accordance with the protocols approved by the Committee on the Use of Live Animals in Teaching and Research of the University of Hong Kong.
(140) Generation of wtGFP/13Del-KI Chimeric Mice
(141) GFP (homozygous) and 13del-KI homozygous (M/M) morula-stage embryos (2.5 dpc) were collected, zona pellucida was then removed by acid tyrode and the embryos were washed and aggregated in 1:1 ratio at 37° C. overnight in an aggregation plate. Successful aggregated embryos were transferred to a pseudopregnant ICR foster mother.
(142) EF5 Distribution Analysis
(143) To study EF-5 distribution, P10 mice were injected with 10 mM EF5 at 1% of body weight and staining was performed as described previously (90, 91).
(144) RNA Preparation and Microarray Analysis
(145) The proximal part of tibia was embedded in O.C.T. compound (ebsciences, USA) for cryosection. Transverse sections (5 μm thick) were cut and pooled into fractions consisting of 10 sections per fraction to ensure separation of each cell type in the growth plates before lysed in Trizol® reagent (Invitrogen). Total RNA were extracted and hybridized to Mouse Genome 430 2.0 Gene Chip (Affymetrix). Gene expression data for each sample in triplicate were normalized using Robust Multi-chip Average (RMA) algorithm in R Bioconductor package. The k-Means Clustering algorithm (92, 93) was used to identify the distinct expression patterns of genes in WT and 13del growth plates. The Gene Ontology analysis was performed for each cluster of genes by using the Gene Ontology database (94) and the David Web Tools (95).
(146) HOMER Motif Discovery
(147) The DNA binding motif enrichment analysis was performed by using HOMER software package (96). The DNA sequences flanking the genes' transcription start sites 2 kb up- and downstream were extracted from the mouse reference genome assembly (mm9). The HOMER, the TRANSFAC (97) and the ISMARA (98) transcription factor databases were integrated to create the TF binding motif library for screening. The DNA sequences of the interrogated gene sets were compared with those extracted from the remainder gene sets to identify the differentially enriched DNA binding motifs and the TFs.
(148) ChIP-Sequencing Data Analysis
(149) The ATF4 and CHOP ChIP-sequencing datasets (45) were downloaded from the GEO database (GSE35681). The DNA sequences were aligned to the mm9 mouse reference genome assembly with Bowtie program (99). The analysis of coverage signal intensity and peak detection were performed by using Picard toolkit of Broad Institute (MIT) (https://tldrlegal.com/license/mit-license). The binding peaks located within 10 kb up or downstream of the TSS in each target gene were identified for statistical analysis in each cluster.
(150) Histological and Immunofluorescence Analyses
(151) Limbs were fixed in 4% PFA, followed by demineralization in 0.5M EDTA (pH 8.0) prior to embedding in paraffin. Slides were stained with Alcian Blue for cartilage matrix and Fast Red for nuclei. Immunofluorescence was performed using antibodies against ATF4 (sc-200, Santa Cruz), ATF3 (HPA001562, Sigma), CHOP (sc-575, Santa Cruz), GADD34 (sc-825, Santa Cruz), FGF21 (42189, AIS) and Sox9 (AB5535, Millipore).
(152) FAST Staining
(153) FAST staining refers to a multidye staining procedure using fast green, Alcian blue, Safranin-O, and tartrazine and was performed as described previously (100).
(154) In-Situ Hybridization
(155) In-situ hybridization was performed as previously described (101), using [.sup.35S]UTP-labeled ribopobes for Col10a1, Col2a1, Bip, 13del(10), Ihh (from A. McMahon), Sox9 (102) and the PTHrP receptor (Ppr) (from H. Kronenberg). The probes for Atf4, Atf3, Chop, Ero1l and Fgf21 were mouse cDNA fragments, generated by RT-PCR from growth plate total RNA. The primers used are as follows: Atf4, 5′-GAGGTGGCCAAGCACTTGAAA (SEQ ID NO: 32) and 5′-GAACCACCTGGAGAAGGCAGATT (SEQ ID NO: 33); Atf3, 5′-GCTTCCCCAGTGGAGCCAAT (SEQ ID NO: 34) and 5′-CCACCTCTGCTTAGCTCTGCAAT (SEQ ID NO: 35); Chop, 5′-ATGAGGATCTGCAGGAGGTCCTGTC (SEQ ID NO: 36) and 5′-GATGCCCACTGTTCATGCTTGGT (SEQ ID NO: 37); Ero1l, 5′-AAGACTACAAAAGCTTCTTG (SEQ ID NO: 38) and 5′-AAGAATTCTCATCGAAGTGCAA (SEQ ID NO: 39); and Fgf21, 5′-CAGGGTCATTCAAATCCTG (SEQ ID NO: 40) and 5′-AGGAATCCTGCTTGGTCTTG (SEQ ID NO: 41).
(156) TUNEL Assay
(157) Apoptotic cells in the growth plate of examined animals were detected by in situ terminal deoxynucleotidyltransferase deoxyuridine triphosphate nick end labeling (TUNEL) assay using the In Situ Cell Death Detection Kit (Roche) following the manufacturer's instructions.
(158) Chromatin Immunoprecipitation (ChIP) Assay
(159) The protocol used for ChIP was adapted from the instructions of ChIP Assay Kit (Millipore). Culture cells or limbs dissected from E15.5 WT and C10-ATF4 embryos were homogenized and crosslinked. DNA was sonicated and immunoprecipitated with rabbit anti-ATF4 (sc-200, Santa Cruz Biotechnology) or rabbit anti-CHOP (s-575, Santa Cruz Biotechnology) antibody. The pull-down DNA was purified and analyzed by PCR.
(160) Protein Extraction and Immunoblot Analysis
(161) Cartilages isolated from the mice were pulverized in liquid nitrogen and then lysed with RIPA buffer. The lysate was subjected to SDS-PAGE under reducing conditions and probed with FGF21 and beta-actin antibody.
(162) Dual Luciferase Reporter Assay
(163) Luciferase assays were conducted using a dual luciferase reporter assay kit (Promega), according to the manufacturer's protocol. Different promoter fragments of Sox9 or Fgf21 were cloned into pGL3-basic vector (Promega) to drive the expression of firefly luciferase. ATDC5 or NIH3T3 cells were plated at 2×10.sup.4 cells/well in 24-well plates. After 18-hours incubation, the cells were transfected with tested constructs with Renilla luciferase vector, which served as an internal control. Data presented are ratios of Luc/Renilla activity from at least three different experiments and each experiment was performed in triplicate for each DNA sample.
(164) Quantitative PCR
(165) Quantitative PCR was performed using SYBR-Green master mixture according to the manufacturer's instruction (Takara). Appropriate amounts of cDNA (or DNA) and primers were mixed with distilled water up to 10 μl and combined with equal amount of SYBR-Green master mixture. The reaction was run on the StepOne Real Time PCR system (Applied Biosystems, A&B). The Ct (cycle threshold) is defined as the cycle number required for the fluorescent signal to cross the threshold. The relative expression levels of target genes are calculated by normalizing to the expression level of GAPDH using delta-delta-Ct (Relative expression level=2{circumflex over ( )}−(Ct.sub.target−Ct.sub.Gapdh)). Melting curve was also measured to detect the specificity of the primers.
(166) ISRIB Treatments
(167) ISRIB (SML0843, Sigma) was dissolved in DMSO to make a 5 mg/ml stock and stored at 4-degree. Animals were intraperitoneally injected with ISRIB ((103, 104) (2.5 mg/kg, diluted in 0.9% saline) or vehicle (5% DMSO in saline) from E13.5 till p20 stage. The animals were collected at p10 and p20 stages for further analysis.
(168) Radiography of Mouse Skeleton
(169) Mice were anesthetized before radiography using digital Faxitron system (UltraFocus) at 20 kVA for 5 second exposure.
(170) Statistical Analyses
(171) No statistical methods were used to predetermine sample size. Statistical analyses used are detailed in the figure legends. Unpaired two tailed Student's t-test was used to establish statistical significance. For growth analysis, two tailed Mann-Whitney U-test was used. P<0.05 was considered statistically significant.
(172) Data Availability
(173) All primary microarray data are deposited into Gene Expression Omnibus (GEO) website (Accession Number GSE99306).
REFERENCES
(174) 1. P. T. Siegel, R. Clopper, B. Stabler, Psychological impact of significantly short stature. Acta paediatrica Scandinavica. Supplement 377, 14-18; discussion 19 (1991). 2. S. Thompson, T. Shakespeare, M. J. Wright, Medical and social aspects of the life course for adults with a skeletal dysplasia: a review of current knowledge. Disability and rehabilitation 30, 1-12 (2008). 3. C. W. Lie, W. Chow, Limb lengthening in short-stature patients using monolateral and circular external fixators. Hong Kong medical journal=Xianggang yi xue za zhi/Hong Kong Academy of Medicine 15, 280-284 (2009). 4. T. S. Lisse et al., ER stress-mediated apoptosis in a new mouse model of osteogenesis imperfecta. PLoS genetics 4, e7 (2008). 5. B. R. Olsen, Mutations in collagen genes resulting in metaphyseal and epiphyseal dysplasias. Bone 17, S45-S49 (1995). 6. F. Suleman et al., A novel form of chondrocyte stress is triggered by a COMP mutation causing pseudoachondroplasia. Hum Mutat 33, 218-231 (2012). 7. K. A. Pirog, Y. Katakura, A. Mironov, M. D. Briggs, Mild myopathy is associated with COMP but not MATN3 mutations in mouse models of genetic skeletal diseases. PloS one 8, e82412 (2013). 8. M. D. Briggs, K. L. Chapman, Pseudoachondroplasia and multiple epiphyseal dysplasia: Mutation review, molecular interactions, and genotype to phenotype correlations. Human Mutation 19, 465-478 (2002). 9. K. Y. Tsang, D. Chan, J. F. Bateman, K. S. Cheah, In vivo cellular adaptation to ER stress: survival strategies with double-edged consequences. Journal of cell science 123, 2145-2154 (2010). 10. K. Y. Tsang et al., Surviving endoplasmic reticulum stress is coupled to altered chondrocyte differentiation and function. PLoS Biol 5, e44 (2007). 11. O. Makitie et al., Schmid type of metaphyseal chondrodysplasia and COL10A1 mutations-findings in 10 patients. Am J Med Genet A 137A, 241-248 (2005). 12. M. Ridanpää et al., Genetic changes in the RNA components of RNase MRP and RNase P in Schmid metaphyseal chondrodysplasia. Journal of Medical Genetics 40, 741-746 (2003). 13. H. Zinszner et al., CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes & development 12, 982-995 (1998). 14. C. Hetz, E. Chevet, H. P. Harding, Targeting the unfolded protein response in disease. Nat Rev Drug Discov 12, 703-719 (2013). 15. S. Nundlall et al., An unfolded protein response is the initial cellular response to the expression of mutant matrilin-3 in a mouse model of multiple epiphyseal dysplasia. Cell Stress & Chaperones 15, 835-849 (2010). 16. K. L. Posey et al., Chondrocyte-specific pathology during skeletal growth and therapeutics in a murine model of pseudoachondroplasia. (2014). 17. D. T. Rutkowski, R. S. Hegde, Regulation of basal cellular physiology by the homeostatic unfolded protein response. (2010). 18. K. Pakos-Zebrucka et al., The integrated stress response. EMBO reports 17, 1374-1395 (2016). 19. C.-Q. Zhao, Y.-H. Zhang, S.-D. Jiang, L.-S. Jiang, L.-Y. Dai, Both endoplasmic reticulum and mitochondria are involved in disc cell apoptosis and intervertebral disc degeneration in rats. Age 32, 161-177 (2010). 20. D. Xu et al., Hydrogen sulfide protects against endoplasmic reticulum stress and mitochondrial injury in nucleus pulposus cells and ameliorates intervertebral disc degeneration. Pharmacological Research 117, 357-369 (2017). 21. T. Oosterhuis et al., Early rehabilitation after lumbar disc surgery is not effective or cost-effective compared to no referral: a randomised trial and economic evaluation. Journal of Physiotherapy 63, 144-153. 22. H. Kanazawa et al., Efficacy of growth hormone therapy for patients with skeletal dysplasia. Journal of Bone and Mineral Metabolism 21, 307-310 (2003). 23. S. Suzuki et al., Excessive reactive oxygen species are therapeutic targets for intervertebral disc degeneration. Arthritis Research & Therapy 17, 316 (2015). 24. A. Hiyama et al., Hypoxia Activates the Notch Signaling Pathway in Cells of the Intervertebral Disc: Implications in Degenerative Disc Disease. Arthritis and rheumatism 63, 1355-1364 (2011). 25. L. J. Smith, N. L. Nerurkar, K.-S. Choi, B. D. Harfe, D. M. Elliott, Degeneration and regeneration of the intervertebral disc: lessons from development. Disease Models & Mechanisms 4, 31-41 (2011). 26. A. G. Hadjipavlou, M. N. Tzermiadianos, N. Bogduk, M. R. Zindrick, The pathophysiology of disc degeneration. Journal of Bone &amp; Joint Surgery, British Volume 90-B, 1261 (2008). 27. H. S. An, K. Masuda, N. Inoue, Intervertebral disc degeneration: biological and biomechanical factors. Journal of Orthopaedic Science 11, 541-552 (2006). 28. I. C. Salaroglio et al., PERK induces resistance to cell death elicited by endoplasmic reticulum stress and chemotherapy. Molecular Cancer 16, 91 (2017). 29. L. R. Palam, J. Gore, K. E. Craven, J. L. Wilson, M. Korc, Integrated stress response is critical for gemcitabine resistance in pancreatic ductal adenocarcinoma. Cell Death & Disease 6, e1913 (2015). 30. P. Podszywalow-Bartnicka et al., Increased phosphorylation of eIF2α in chronic myeloid leukemia cells stimulates secretion of matrix modifying enzymes. Oncotarget 7, 79706-79721 (2016). 31. Y. Y. Ho, D. Lagares, A. M. Tager, M. Kapoor, Fibrosis[mdash]a lethal component of systemic sclerosis. Nat Rev Rheumatol 10, 390-402 (2014). 32. P. Cheresh, S.-J. Kim, S. Tulasiram, D. W. Kamp, Oxidative Stress and Pulmonary Fibrosis. Biochimica et biophysica acta 1832, 1028-1040 (2013). 33. R. M. Liu, K. A. Gaston Pravia, Oxidative stress and glutathione in TGF-β-mediated fibrogenesis. Free Radical Biology and Medicine 48, 1-15 (2010). 34. I. Cucoranu et al., NAD(P)H Oxidase 4 Mediates Transforming Growth Factor-β1-Induced Differentiation of Cardiac Fibroblasts Into Myofibroblasts. Circulation Research 97, 900 (2005). 35. G. H. Kim, J. E. Kim, S. J. Rhie, S. Yoon, The Role of Oxidative Stress in Neurodegenerative Diseases. Experimental Neurobiology 24, 325-340 (2015). 36. D. Lindholm, H. Wootz, L. Korhonen, ER stress and neurodegenerative diseases. Cell Death Differ 13, 385-392 (2006). 37. S. E. Patterson, C. N. Dealy, Mechanisms and models of endoplasmic reticulum stress in chondrodysplasia. Developmental Dynamics 243, 875-893 (2014). 38. Stela S. Palii, Michelle M. Thiaville, Y.-X. Pan, C. Zhong, Michael S. Kilberg, Characterization of the amino acid response element within the human sodium-coupled neutral amino acid transporter 2 (SNAT2) System A transporter gene. Biochemical Journal 395, 517-527 (2006). 39. J. Buenrostro, B. Wu, H. Chang, W. Greenleaf, ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide. Current protocols in molecular biology/edited by Frederick M. Ausubel . . . [et al.] 109, 21.29.21-21.29.29 (2015). 40. L. Nel-Themaat et al., Morphometric analysis of testis cord formation in Sox9-EGFP mice. Developmental Dynamics 238, 1100-1110 (2009). 41. L. Madisen et al., Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron 85, 942-958 (2015). 42. E. Provost, J. Rhee, S. D. Leach, Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos. genesis 45, 625-629 (2007). 43. N. A. Kearns et al., Functional annotation of native enhancers with a Cas9-histone demethylase fusion. Nat Meth 12, 401-403 (2015). 44. L. Cong et al., Multiplex Genome Engineering Using CRISPR/Cas Systems. Science (New York, N. Y) 339, 819-823 (2013). 45. J. Han et al., ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat Cell Biol 15, 481-490 (2013). 46. C. M. Oslowski, F. Urano, Measuring ER stress and the unfolded protein response using mammalian tissue culture system. Methods in enzymology 490, 71-92 (2011). 47. H. P. Harding et al., Regulated translation initiation controls stress-induced gene expression in mammalian cells. Molecular cell 6, 1099-1108 (2000). 48. H. Hojo, A. P. McMahon, S. Ohba, An Emerging Regulatory Landscape for Skeletal Development. Trends Genet 32, 774-787 (2016). 49. G. S. Hotamisligil, R. J. Davis, Cell Signaling and Stress Responses. Cold Spring Harb Perspect Biol 8, (2016). 50. P. Walter, D. Ron, The Unfolded Protein Response: From Stress Pathway to Homeostatic Regulation. Science 334, 1081 (2011). 51. K. Horiuchi, T. Tohmonda, H. Morioka, The unfolded protein response in skeletal development and homeostasis. Cell Mol Life Sci 73, 2851-2869 (2016). 52. A. Sudhakar et al., Phosphorylation of Serine 51 in Initiation Factor 2α (eIF2α) Promotes Complex Formation between eIF2α(P) and eIF2B and Causes Inhibition in the Guanine Nucleotide Exchange Activity of eIF2B. Biochemistry 39, 12929-12938 (2000). 53. T. L. Cameron et al., XBP1-Independent UPR Pathways Suppress C/EBP-beta Mediated Chondrocyte Differentiation in ER-Stress Related Skeletal Disease. PLoS genetics 11, e1005505 (2015). 54. W. Wang et al., Atf4 regulates chondrocyte proliferation and differentiation during endochondral ossification by activating Ihh transcription. Development (Cambridge, England) 136, 4143-4153 (2009). 55. V. Y. L. Leung et al., SOX9 Governs Differentiation Stage-Specific Gene Expression in Growth Plate Chondrocytes via Direct Concomitant Transactivation and Repression. PLoS genetics 7, e1002356 (2011). 56. L. Yang, K. Y. Tsang, H. C. Tang, D. Chan, K. S. Cheah, Hypertrophic chondrocytes can become osteoblasts and osteocytes in endochondral bone formation. Proc Natl Acad Sci USA 111, 12097-12102 (2014). 57. S. Stricker, R. Fundele, A. Vortkamp, S. Mundlos, Role of Runx Genes in Chondrocyte Differentiation. Developmental Biology 245, 95-108 (2002). 58. L. Koziel, M. Wuelling, S. Schneider, A. Vortkamp, Gli3 acts as a repressor downstream of Ihh in regulating two distinct steps of chondrocyte differentiation. Development (Cambridge, England) 132, 5249 (2005). 59. A. Ionescu et al., FoxA family members are crucial regulators of the hypertrophic chondrocyte differentiation program. Developmental Cell 22, 927-939 (2012). 60. H. Akiyama, M.-C. Chaboissier, J. F. Martin, A. Schedl, B. de Crombrugghe, The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes & development 16, 2813-2828 (2002). 61. C. F. Liu, W. E. Samsa, G. Zhou, V. Lefebvre, Transcriptional control of chondrocyte specification and differentiation. Semin Cell Dev Biol 62, 34-49 (2017). 62. D. M. Bell et al., SOX9 directly regulates the type-II collagen gene. Nat Genet 16, 174-178 (1997). 63. P. Dy et al., Sox9 directs hypertrophic maturation and blocks osteoblast differentiation of growth plate chondrocytes. Dev Cell 22, 597-609 (2012). 64. S. J. Marciniak et al., CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum. Genes & development 18, 3066-3077 (2004). 65. M. Pennuto et al., ABLATION OF THE UPR-MEDIATOR CHOP RESTORES MOTOR FUNCTION AND REDUCES DEMYELINATION IN CHARCOT MARIE TOOTH 1B MICE. Neuron 57, 393-405 (2008). 66. C. M. Southwood, J. Garbern, W. Jiang, A. Gow, The Unfolded Protein Response Modulates Disease Severity in Pelizaeus-Merzbacher Disease. Neuron 36, 585-596 (2002). 67. M. Lu et al., Opposing unfolded-protein-response signals converge on death receptor 5 to control apoptosis. Science 345, 98-101 (2014). 68. J. A. Moreno et al., Sustained translational repression by eIF2alpha-P mediates prion neurodegeneration. Nature 485, 507-511 (2012). 69. K. A. Pirog et al., Abnormal chondrocyte apoptosis in the cartilage growth plate is influenced by genetic background and deletion of CHOP in a targeted mouse model of pseudoachondroplasia. PloS one 9, e85145 (2014). 70. K. L. Posey et al., Chop (Ddit3) is essential for D469del-COMP retention and cell death in chondrocytes in an inducible transgenic mouse model of pseudoachondroplasia. Am J Pathol 180, 727-737 (2012). 71. C. Jousse et al., Inhibition of a constitutive translation initiation factor 2α phosphatase, CReP, promotes survival of stressed cells. The Journal of Cell Biology 163, 767-775 (2003). 72. A. L. De Sousa-Coelho, P. F. Marrero, D. Harm, Activating transcription factor 4-dependent induction of FGF21 during amino acid deprivation. Biochem J 443, 165-171 (2012). 73. T. L. Cameron et al., Transcriptional Profiling of Chondrodysplasia Growth Plate Cartilage Reveals Adaptive ER-Stress Networks That Allow Survival but Disrupt Hypertrophy. PloS one 6, e24600 (2011). 74. A. Kharitonenkov et al., FGF-21 as a novel metabolic regulator. The Journal of Clinical Investigation 115, 1627-1635 (2005). 75. M. A. Gomez-Samano et al., Fibroblast growth factor 21 and its novel association with oxidative stress. Redox Biol 11, 335-341 (2017). 76. K. H. Kim, M. S. Lee, FGF21 as a mediator of adaptive responses to stress and metabolic benefits of anti-diabetic drugs. J Endocrinol 226, R1-16 (2015). 77. A. Salminen, K. Kaarniranta, A. Kauppinen, Regulation of longevity by FGF21: Interaction between energy metabolism and stress responses. Ageing Res Rev 37, 79-93 (2017). 78. K. H. Kim et al., Autophagy deficiency leads to protection from obesity and insulin resistance by inducing Fgf21 as a mitokine. Nat Med 19, 83-92 (2013). 79. Y. Sekine et al., Mutations in a translation initiation factor identify the target of a memory-enhancing compound. Science 348, 1027 (2015). 80. C. Sidrauski et al., Pharmacological dimerization and activation of the exchange factor eIF2B antagonizes the integrated stress response. eLife 4, e07314 (2015). 81. G. V. Di Prisco et al., Translational control of mGluR-dependent long-term depression and object-place learning by eIF2alpha. Nature neuroscience 17, 1073-1082 (2014). 82. R. Savarirayan, V. Cormier-Daire, R. S. Lachman, D. L. Rimoin, Schmid type metaphyseal chondrodysplasia: a spondylometaphyseal dysplasia identical to the “Japanese” type. Pediatric Radiology 30, 460-463 (2000). 83. D. Samartzis et al., Classification of Schmorl's nodes of the lumbar spine and association with disc degeneration: a large-scale population-based MRI study. Osteoarthritis and Cartilage 24, 1753-1760. 84. H. Wang et al., Role of death receptor, mitochondrial and endoplasmic reticulum pathways in different stages of degenerative human lumbar disc. Apoptosis 16, 990 (2011). 85. M. Franke et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature 538, 265-269 (2016). 86. S. Cuddapah et al., Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome Research 19, 24-32 (2009). 87. Darfo G. Lupiáñez et al., Disruptions of Topological Chromatin Domains Cause Pathogenic Rewiring of Gene-Enhancer Interactions. Cell 161, 1012-1025. 88. O. Symmons et al., Functional and topological characteristics of mammalian regulatory domains. Genome Res 24, 390-400 (2014). 89. Y. Hotta et al., Fibroblast Growth Factor 21 Regulates Lipolysis in White Adipose Tissue But Is Not Required for Ketogenesis and Triglyceride Clearance in Liver. Endocrinology 150, 4625-4633 (2009). 90. H. E. Ryan, J. Lo, R. S. Johnson, HIF-1α is required for solid tumor formation and embryonic vascularization. The EMBO Journal 17, 3005 (1998). 91. E. Schipani et al., Hypoxia in cartilage: HIF-1α is essential for chondrocyte growth arrest and survival. Genes & development 15, 2865-2876 (2001). 92. J. Quackenbush, Computational analysis of microarray data. Nature reviews. Genetics 2, 418-427 (2001). 93. A. K. Jain, Data clustering: 50 years beyond K-means. Pattern Recognition Letters 31, 651-666. (2010). 94. M. Ashburner et al., Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-29 (2000). 95. G. Dennis, Jr. et al., DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4, P3 (2003). 96. S. Heinz et al., Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular cell 38, 576-589 (2010). 97. E. Wingender, P. Dietze, H. Karas, R. Knuppel, TRANSFAC: a database on transcription factors and their DNA binding sites. Nucleic Acids Res 24, 238-241 (1996). 98. P. J. Balwierz et al., ISMARA: automated modeling of genomic signals as a democracy of regulatory motifs. Genome Res 24, 869-884 (2014). 99. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10, R25-R25 (2009). 100. V. Y. L. Leung, W. C. W. Chan, S.-C. Hung, K. M. C. Cheung, D. Chan, Matrix Remodeling During Intervertebral Disc Growth and Degeneration Detected by Multichromatic FAST Staining. Journal of Histochemistry and Cytochemistry 57, 249-256 (2009). 101. A. W. K. Wai et al., Disrupted expression of matrix genes in the growth plate of the mouse cartilage matrix deficiency (cmd) mutant. Developmental Genetics 22, 349-358 (1998). 102. L.-J. Ng et al., SOX9 Binds DNA, Activates Transcription, and Coexpresses with Type II Collagen during Chondrogenesis in the Mouse. Developmental Biology 183, 108-121 (1997). 103. C. Sidrauski et al., Pharmacological brake-release of mRNA translation enhances cognitive memory. Elife 2, e00498 (2013). 104. G. V. Di Prisco et al., Translational control of mGluR-dependent long-term depression and object-place learning by eIF2[alpha]. Nature neuroscience 17, 1073-1082 (2014). 105. H. Zeng et al., An inducible and reversible mouse genetic rescue system. PLoS Genetics 4(5):e1000069. doi: 10.1371/journal.pgen.1000069 (2008). 106. W. C. W. Chan et al., Activating the unfolded protein response in osteocytes causes hyperostosis consistent with craniodiaphyseal dysplasia. Human Molecular Genetics doi: 10.1093/hmg/ddx339 (2017).