Probe and method of enriching target region applicable to high-throughput sequencing using the same

Abstract

The present invention discloses a probe applicable to high-throughput sequencing and a method of enriching a target region using the probe. The probe includes, in an order from a 5′ end, a ligation arm, a masking sequence 1, a UID sequence 1, an Illumina Tag1 sequence, a dU region, an Illumina Tag2 sequence, a UID sequence 2, a masking sequence 2 and an extension arm; wherein the masking sequence 1, the masking sequence 2, the dU region, the UID sequence 1, and the UID sequence 2 may be 0 bp. When sequencing is performed by using a library built by the probe of the present invention, it is not necessary to add a sequencing primer additionally, and adopting the method of the present invention may directly use an RNA as a template to capture a target region, so as to simplify the experiment procedure.

Claims

1. A probe, comprising, in an order from a 5′ end, a ligation arm, a masking sequence 1, a UID (Unique Identifier) sequence 1, an Illumina Tag1 sequence, an Illumina Tag2 sequence, a UID sequence 2, a masking sequence 2 and an extension arm, wherein the UID sequence 1 and the UID sequence 2 both consist of 3 to 12 random bases; the masking sequence 1 is 0 to 3 random bases which are not complementary with sequences on an upstream of a template corresponding to the ligation arm; and the masking sequence 2 is 0 to 3 random bases which are not complementary with sequences on a downstream of the template corresponding to the ligation arm; and wherein the Illumina Tag1 sequence is 5′-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3′ (SEQ ID NO: 15) sequentially reduced by 0-16 bases from the 3′ end, and the Illumina Tag2 sequence is 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ (SEQ ID NO: 16) sequentially reduced by 0-19 bases from the 5′ end.

2. The probe of claim 1, wherein, between the Illumina Tag1 sequence and the Illumina Tag2 sequence, there is further a dU region, which is 1 to 3 deoxyuridine bases.

3. The probe of claim 1, wherein the ligation arm is a base sequence of 15-45 bp and complementarily bonded with a nucleic acid template; and the extension arm is a base sequence of 15-45 bp and complementarily bonded with the nucleic acid template.

4. The probe of claim 1, wherein the extension arm is a modified extension arm.

5. The probe of claim 4, wherein the extension arm is a phosphonothioate-modified extension arm.

6. The probe of claim 5, wherein a Tm value of the ligation arm is more than 2° C. higher than the Tm value of the extension arm.

7. The probe of claim 1, wherein the ligation arm includes a phosphorylation modified 5′ end.

8. The probe of claim 1, wherein the Illumina Tag1 sequence and the Illumina Tag2 sequence are selected from sequences or combination of complementary or reverse complementary sequences thereof on transposon Adapters and connectors in a library building kit of an Illumina platform.

9. A method of enriching a target region applicable to high-throughput sequencing, comprising: hybridizing, extending and ligating reaction: the probe of claim 1 is hybridized to a template DNA or RNA, extended and ligated to obtain a first product; obtaining of a second product: enzyme digesting the remaining probe and template DNA, and performing a PCR amplification through a tag primer, to obtain the second product; purifying: purifying the second product to obtain a library; and just on-line sequencing the library.

10. The method of claim 9, wherein the hybridizing, extending and ligating reaction steps are: firstly hybridizing the template DNA or RNA with the probe, and then adding polymerase and ligase to perform extending and ligating to obtain the first product; or adding the template DNA, the probe, polymerase and ligase simultaneously, and performing hybridizing, extending and ligating simultaneously to obtain the first product.

11. The method of claim 10, wherein when it is firstly hybridizing the template DNA or RNA with the probe, and then adding polymerase and ligase to perform extending and ligating to obtain the first product, the reaction system and reaction procedure of the hybridizing, extending and ligating reaction are: Purified water 6 μL; 50 ng/μL template DNA 2 μL; 3×10.sup.−3 μM of the probe 1 μL; 10×Ampligase Buffer 1 μL; The procedure is: denaturing at 95° C. for 5 min, and incubating at 60° C. for 2 h; then adding the following reagents to the above system to perform extending and ligating reactions, and the reaction procedure is: incubating at 60° C. for 1 h; Purified water 1.4 μL; 1 mM dNTPs 1 μL; 5 U/μL Ampligase DNA ligase 1 μL; 10×Ampligase Buffer 0.5 μL; 50 mM NAD.sup.+ 0.1 μL; Phusion® High-Fidelity DNA Polymerase 1 μL; when the template is RNA, Nuclease-free water 5.5 μL; 50 ng/μL template RNA 2 μL; 3×10.sup.−3 μM of the probe 1 μL; RNase Inhibitor 0.5 μL; 10×Ampligase Buffer 1 μL; denaturing at 70° C. for 2 min, and incubating at 65° C. for 2 h; then adding the following reagents, reacting at 42° C. for 1 h, and performing extending and ligating reactions; 1 mM dNTPs 1 μL; 5 U/μL Ampligase DNA ligase 1 μL; 10×Ampligase Buffer 1 μL; 50 mM NAD.sup.+ 0.1 μL; 5×First-Strand Buffer 4 μL; 100 mM DTT 2 μL; SMART MMLV RT 1 μL.

12. The method of claim 10, wherein when it is adding the template DNA, the probe, and polymerase and ligase simultaneously, and performing hybridizing, extending and ligating simultaneously to obtain the first product, the reaction system and reaction procedure of the hybridizing, extending and ligating reaction are: Purified water 3.4 μL; 50 ng/μL template DNA 2 μL; 3×10.sup.−3 μM of the probe 1 μL; 1 mM dNTPs 1 μL; 5 U/μL Ampligase DNA ligase 1 μL; 10×Ampligase Buffer 1 μL; 50 mM NAD.sup.+ 0.1 μL; Phusion® HiFi DNA Polymerase 0.5 μL; The reaction procedure is: at 95° C. for 5 min and at 60° C. for 3 h.

13. The method of claim 9, wherein the obtaining of the second product is: firstly digesting the remaining probe and template DNA using an exonuclease, then linearizing the first product using a USER enzyme, and then performing a PCR amplification through a tag primer, to obtain the second product; or adding the exonuclease and tag upstream primer, tag downstream primer simultaneously, and performing enzyme digesting, linearizing and PCR amplifying simultaneously to obtain the second product, wherein the tag upstream primer and the tag downstream primer have a phosphorothioate modification at a 3′ end and a thio, amino or spacer arm modification at the 5′ end to protect the primer from being enzyme digested by the exonuclease.

14. The method of claim 13, wherein when it is firstly digesting the remaining probe and template DNA using an exonuclease, then linearizing the first product using a USER enzyme, and then performing a PCR amplification through a tag primer, to obtain the second product, the reaction system and procedure of obtaining of the second product are: The first product Exonuclease I 0.5 μL; Exonuclease III 0.5 μL; incubating at 37° C. for 40 min, and incubating at 95° C. for 5 min; and then adding the following reagents: 2×iProof HF Master Mix 50 μL; Purified water 29 μL; 20 μM tag upstream primer 2 μL; 20 μM tag downstream primer 2 μL; USER enzyme 1 μL; incubating at 37° C. for 15 min, and pre-denaturing at 98° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 58° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

15. The method of claim 13, wherein when it is adding the exonuclease and tag upstream primer, tag downstream primer simultaneously, and performing enzyme digesting, linearizing and PCR amplifying simultaneously to obtain the second product, when the template is the DNA, the reaction system and procedure of obtaining of the second product are: The first product 18 μL; Exonuclease Lambda 0.5 μL; Exonuclease III 1 μL; 2×iProof HF Master Mix 50 μL; H.sub.2O 29.5 μL; 20 μM tag upstream primer 2 μL; 20 μM tag downstream primer 2 μL; the procedure is: incubating at 37° C. for 5 min, incubating at 95° C. for 5 min, and pre-denaturing at 98° C. for 30 s; annealing at 58° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles, extending at 72° C. for 2 min, and heat preserving at 4° C.; or, when the template is the RNA, the reaction system and procedure are: The first product 10.1 μL; Exonuclease I 1 μL; RNase A 0.1 μL; RNase H 0.1 μL; 2×iProof HF Master Mix 50 μL; H.sub.2O 24.8 μL; 20 μM tag upstream primer 2 μL; 20 μM tag downstream primer 2 μL; incubating at 37° C. for 60 min, incubating at 95° C. for 5 min, and pre-denaturing at 98° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 60° C. for 30 s, extending at 72° C. for 30 s, and 27 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

16. The method of claim 13, wherein a structure of the upstream primer of the tag primers, starting from the 5′ end, is a sequence region for cluster generation and an index sequence region for Illumina sequencing; and a full-length sequence region inversely complementary paired with an Illumina Tag1 sequence; and a structure of the downstream primers of the tag primers, starting from the 5′ end, is a sequence region for cluster generation and an index sequence region for Illumina sequencing; and an Illumina Tag2 full-length sequence region.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The sole FIGURE is a diagram of one of probe structures in the present invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(2) Embodiments of the present invention will be described in details below, and examples of the embodiments are shown in the drawings, wherein the same or similar reference signs indicate the same or similar components or components having the same or similar functions from beginning to end. The embodiments described by referring to the drawings below are exemplary, and aim at explaining the present invention, but cannot be understood as limitations to the present invention. The embodiments in which specific techniques or conditions are not noted, are performed according to the techniques or conditions described in the documents within the prior art or according to the product instructions. The used reagents or instruments that are not marked with manufacturers are all conventional products that can be obtained through market shopping.

(3) The following primers and probes are synthesized by Biotech Bioengineering (Shanghai) Co., Ltd.

(4) HCT15 cells used in this embodiment can be purchased from biological companies such as Puno Biotech, Shanghai Yanyu Biological Engineering Co., Ltd., etc., and then the DNA just can be extracted according to a conventional DNA extraction method.

(5) The NCI-H3122 cell line can be purchased from companies such as Shanghai Zeye Biotechnology Co., Ltd. and Shanghai Jihe Biotechnology Co., Ltd., etc., and then the RNA just can be extracted according to a conventional RNA extraction method.

(6) The probe structure in the embodiment is understood and described below with reference to the probe structure in the sole FIGURE.

Embodiment 1: Enriching the Target Region with an Improved MIP Probe Library

(7) In the embodiment, four probes targeting the human breast cancer susceptibility gene (BRCA) are used. The experiment is divided into two groups. Group 1 has probes without dU structure, and Group 2 has probes with dU structure, and the other structure and sequence both are the same.

(8) Notes: B denotes it can be G, T or C; D denotes it can be G, A or T; H denotes it can be A, T or C; V denotes it can be G, A or C; N denotes it can be A, T, C or G; 5Phos denotes the phosphorylation modification; and -s- denotes performing the phosphorothioate modification between two bases.

(9) The probe sequences of Group 1 are as follows:

(10) P01:

(11) TABLE-US-00001 SEQ ID NO: 1 /5Phos/GGGCCGCTTCATTTTGTAAGACTTATNNNNNNNNNNNN CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

(12) wherein, starting from the 5′ end, the underlined part is the ligation arm, NNNNNNNNNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, the part of which the underline is the dotted line is the Illumina Tag2, and the wavy underlined part is the extension arm.

(13) P02:

(14) TABLE-US-00002 SEQ ID NO: 2 /5Phos/CTCTTTATACTCTTAAAAATTACTGAGGACCTAAAAGAGCAT TTGVVCTGTCTCTTATACACATCTCCGA NNNNNNNNNNNN

(15) wherein, starting from the 5′ end, the underlined part is the ligation arm, VV is the masking sequence 1, the double underlined part is the Illumina Tag1, the part of which the underline is the dotted line is the Illumina Tag2, NNNNNNNNNNNN is the UID sequence 2, and the wavy underlined part is the extension arm.

(16) P03:

(17) TABLE-US-00003 SEQ ID NO: 3 /5Phos/TGCATTCTTCAAAGCVBDNNNCTGTCTCTTATACACATC NNNBDB ;

(18) wherein, starting from the 5′ end, the underlined part is the ligation arm, VBD is the masking sequence 1, NNN is the UID sequence 1, the double underlined part is the Illumina Tag1, the part of which the underline is the dotted line is the Illumina Tag2, NNN is the UID sequence 2, BDB is the masking sequence 2, and the wavy underlined part is the extension arm.

(19) P04:

(20) TABLE-US-00004 SEQ ID NO: 4 /5Phos/CAGTGTTTAGAATCAGGTCACTCBNNNNNCTGTCTCTTATAC ACATCTCC NNNNNH

(21) wherein, starting from the 5′ end, the underlined part is the ligation arm, B is the masking sequence 1, NNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, the part of which the underline is the dotted line is the Illumina Tag2, NNNNN is the UID sequence 2, H is the masking sequence 2, and the wavy underlined part is the extension arm.

(22) The probe sequences of Group 2 are as follows:

(23) P05:

(24) TABLE-US-00005 SEQ ID NO: 4 /5Phos/GGGCCGCTTCATTTTGTAAGACTTATNNNNNNNNNNNNCTGT CTCTTATACACATCTCCGAGCCCACGAGACdUdUdU

(25) wherein, starting from the 5′ end, the underlined part is the ligation arm, NNNNNNNNNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, and the wavy underlined part is the extension arm.

(26) P06:

(27) TABLE-US-00006 SEQ ID NO: 6 /5Phos/CTCTTTATACTCTTAAAAATTACTGAGGACCTAAAAGAGCAT TTGVVCTGTCTCTTATACACATCTCCGAdU NNNNNNNNNNNN 

(28) wherein, starting from the 5′ end, the underlined part is the ligation arm, VV is the masking sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, NNNNNNNNNNNN is the UID sequence 2, and the wavy underlined part is the extension arm.

(29) P07:

(30) TABLE-US-00007 SEQ ID NO: 7 /5Phos/TGCATTCTTCAAAGCVBDNNNCTGTCTCTTATACACATCdU NNNBDB ;

(31) wherein, starting from the 5′ end, the underlined part is the ligation arm, VBD is the masking sequence 1, NNN is the UID sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, NNN is the UID sequence 2, BDB is the masking sequence 2, and the wavy underlined part is the extension arm.

(32) P08:

(33) TABLE-US-00008 SEQ ID NO: 8 /5Phos/CAGTGTTTAGAATCAGGTCACTCBNNNNNCTGTCTCTTATAC ACATCTCCdU NNNNNDBH .

(34) wherein, starting from the 5′ end, the underlined part is the ligation arm, B is the masking sequence 1, NNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, NNNNN is the UID sequence 2, DBH is the masking sequence 2, and the wavy underlined part is the extension arm.

(35) The hybridization reaction system is as follows:

(36) Purified water 6 μL;

(37) 50 ng/μL HCT15 cell DNA 2 μL;

(38) 3×10.sup.−3 μM P01-04 or P05-08 probe equally mixed mixture 1 μL;

(39) 10×Ampligase Buffer (Epicentre) 1 μL.

(40) The procedure is: denaturing at 95° C. for 5 min, and incubating at 60° C. for 2 h. Then, the following reagents are added to the above hybridization products to perform extending and ligating reaction, and The reaction procedure is: incubating at 60° C. for 1 h.

(41) Purified water 1.4 μL;

(42) 1 mM dNTPs (NEB) 1 μL;

(43) 5 U/L Ampligase DNA ligase (Epicentre) 1 μL;

(44) 10×Ampligase Buffer (Epicentre) 0.5 μL;

(45) 50 mM NAD.sup.+(NEB) 0.1 μL;

(46) Phusion® High-Fidelity DNA Polymerase(NEB) 1 μL.

(47) The remaining probes and DNA are digested by using the exonuclease. The following reagents are again added to the above products:

(48) Exonuclease I (NEB) 0.5 μL;

(49) Exonuclease III(NEB) 0.5 μL.

(50) Incubating at 37° C. for 40 min, and incubating at 95° C. for 5 min.

(51) In order to cut the circular product containing the dU structure group into linear single strands, the USER enzyme is added to the PCR reaction. That is, the following reagents are again added to the above product:

(52) 2×iProof HF Master Mix(Bio-Rad) 50 μL;

(53) Purified water 29 μL;

(54) 20 μM Tag1 primer 2 μL;

(55) 20 μM Tag2 primer 2 μL;

(56) USER enzyme 1 μL.

(57) Tag1 primer sequence:

(58) TABLE-US-00009 SEQ ID NO: 9 5′CAAGCAGAAGACGGCATACGAGATTTCTGCCT   ,

(59) Tag2 primer sequence:

(60) TABLE-US-00010 SEQ ID NO: 10 5′AATGATACGGCGACCACCGAGATCTACACTATAGCCT   -s-T .

(61) wherein the sequence underlined by the wavy line is a sequence on the connector of the 5 end of the Illumina TruSeq kit, and Illumina Tag2 in the probe structure of the present invention is that this sequence is reduced by 0 to 19 bases from the 5′ end. The double underlined part is a sequence used for cluster generation during Illumina sequencing and cannot be changed. The underlined parts are all index sequences, and the sequences can be changed. The part of which the underline is a dotted line is a sequence of Illumina Nextera Transposase Adapters Read 2 and is inversely complementary paired with the Illumina Tag1 in the probe structure of the present invention.

(62) Tag primer sequences are used for the PCR amplification of circular products. When the Tag1 and 2 sequences are replaced with sequences on transposon Adapters and connectors in the library building kit of the Illumina or other combinations, the sequences on the underlined and wavy dotted lines need to be changed accordingly.

(63) Incubating at 37° C. for 15 min, and pre-denaturing at 98° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 58° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

(64) After amplification, the library is purified by using the Agencourt AMPure XP magnetic beads. Then, the quality control is performed for the library, and the library is sequenced on the Illumina sequencer.

(65) TABLE-US-00011 TABLE 1 Result table of library building library production and template recovery rate by using the probes containing the dU structure and not containing the dU structure Library Template Experiment group production (ng) recovery rate Group 1 (the group without  62.3 22.6% containing the dU structure) Group 2 (the group containing 224.6 23.1% the dU structure)

(66) It can be seen from Table 1 that although the probe containing the dU structure has a slightly different template recovery rate compared with the probe without containing the dU structure, it can obviously improve the library production.

Embodiment 2: Enriching the Target Region with an MIP Probe Library that Optimizes the Melting Temperature (Tm) Value of the Ligation Arm and the Extension Arm

(67) The probe sequences are as follows:

(68) P09:

(69) on the basis of P5, performing the phosphorothioate modification among the finally three bases from the 3′ end thereof.

(70) P10:

(71) on the basis of P6, performing the phosphorothioate modification among the finally three bases from the 3′ end thereof.

(72) P11:

(73) on the basis of P7, performing the phosphorothioate modification among the finally three bases from the 3′ end thereof.

(74) P12:

(75) on the basis of P8, performing the phosphorothioate modification among the finally three bases from the 3′ end thereof.

(76) The PCR primer sequence is the same as that in Embodiment 1, that is, the Tag1 primer sequence is the same as the Tag1 primer sequence in Embodiment 1; and the Tag2 primer sequence here is the same as the Tag2 primer sequence in Embodiment 1.

(77) In this embodiment, the Tm value of the ligation arm is higher than the extension arm by more than 2° C. during the design of the probe, and the phosphorothioate modification is performed for the extension arm. The experiment is divided into two groups, a control group uses P05-P08 probes, and an optimized group uses optimized P09-P12 probes, and the specific steps are as follows:

(78) 1. Hybridizing, extending and ligating reactions, please refer to Table 2

(79) TABLE-US-00012 TABLE 2 Reaction system table Reagent Volume (μL) Purified water 3.4 50 ng/μL HCT15 cell DNA 2 3 × 10.sup.−3 μM P05-08 or P09-12 probe 1 equally mixed mixture 1 mM dNTPs (NEB) 1 5 U/μL Ampligase DNA ligase (Epicentre) 1 10× Ampligase Buffer (Epicentre) 1 50 mM NAD.sup.+(NEB) 0.1 Phusion ® HiFi DNA Polymerase (NEB) 0.5 The reaction procedure is: at 95° C. for 5 min, and at 60° C. for 3 h.

(80) 2. Adding the following reagents again to the above system to perform enzyme digesting reaction, wherein The reaction procedure is: incubating at 37° C. for 40 min, and incubating at 95° C. for 5 min.

(81) Exonuclease I (NEB) 0.5 μL;

(82) Exonuclease III(NEB) 0.5 μL;

(83) Exonuclease Lambda(NEB) 0.5 μL;

(84) 3. Adding the following reagents to the above system to perform product linearization and PCR amplification.

(85) 2×iProof HF Master Mix(Bio-Rad) 50 μL;

(86) Purified water 34 μL;

(87) 20 μM Tag1 primer 2 μL;

(88) 20 μM Tag2 primer 2 μL;

(89) USER enzyme 1 μL.

(90) The Tag1 primer sequence here is the same as the Tag1 primer sequence in Embodiment 1; and the Tag2 primer sequence here is the same as the Tag2 primer sequence in Embodiment 1.

(91) The reaction procedure is: incubating at 37° C. for 15 min, and pre-denaturing at 98° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 58° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

(92) 4. After amplification, the library is purified by using the Agencourt AMPure XP magnetic beads. Then, the quality control is performed for the library, and the library is sequenced on the Illumina sequencer. The analysis result refers to Table 3.

(93) TABLE-US-00013 TABLE 3 Experiment result table Library Template Experiment group production (ng) recovery rate Control group  22.5  3.4% (without containing the phosphorothioate modification) Optimized group 158.2 18.7% (containing the phosphorothioate modification)

(94) It can be seen from Table 3 that the library production and the template recovery rate of the optimized group are obviously higher than those of the control group by using the method of this embodiment.

Embodiment 3: Enriching the Target Region with an MIP Solution of which the Procedure is Improved

(95) In this embodiment, the optimized procedure is adding the enzyme digesting reagent and the PCR reagent to the reaction tube simultaneously. The hybridization reaction system is as follows:

(96) Purified water 6 μL;

(97) 50 ng/μL HCT15 cell DNA 2 μL;

(98) 3×10.sup.−3 μM P05-08 probe equally mixed mixture 1 μL;

(99) 10×Ampligase Buffer (Epicentre) 1 μL.

(100) The procedure is: denaturing at 95° C. for 5 min, and incubating at 60° C. for 2 h. Then, the following reagents are added to the above hybridization products again to perform extending and ligating reaction, and The reaction procedure is incubating at 60° C. for 1 h.

(101) Purified water 1.4 μL;

(102) 1 mM dNTPs (NEB) 1 μL;

(103) 5 U/μL Ampligase DNA ligase (Epicentre) 1 μL;

(104) 10×Ampligase Buffer (Epicentre) 0.5 μL;

(105) 50 mM NAD.sup.+(NEB) 0.1 μL;

(106) Phusion® High-Fidelity DNA Polymerase(NEB) 1 μL.

(107) The remaining probes and DNA are digested by using the exonuclease, and then the PCR amplification is performed for them. The following reagents are added to the above products.

(108) The reaction procedure is: incubating at 37° C. for 40 min, incubating at 95° C. for 5 min, and pre-denaturing at 95° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 58° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

(109) Exonuclease Lambda 0.5 μL;

(110) Exonuclease III 1 μL;

(111) 2×iProof HF Master Mix(Bio-Rad) 50 μL;

(112) H.sub.2O 29.5 μL;

(113) 20 μM Tag3 primer 2 μL;

(114) 20 μM Tag4 primer 2 μL.

(115) Tag3 primer sequence:

(116) TABLE-US-00014 SEQ ID NO: 11 5′-s-AAGCAGAAGACGGCATACGAGATTTCTGCCT ,

(117) Tag4 primer sequence:

(118) TABLE-US-00015 SEQ ID NO: 12 5′A-s-ATGATACGGCGACCACCGAGATCTACACTATAGCCT -s-T

(119) wherein the phosphorothioate modification is performed for the Tag3 primer sequence from the 5′ end on the basis of the Tag1 primer sequence, and the phosphorothioate modification is performed for the Tag4 primer sequence from the 5′ end on the basis of the Tag2 primer sequence.

(120) After amplification, the library is purified by using the Agencourt AMPure XP magnetic beads. Then, the quality control is performed for the library, and the library is sequenced on the Illumina sequencer. The library production is 58.5 ng, and the template recovery rate is 22.4%. It can be seen that a mixed solution of the enzyme digesting reagent and the PCR reagent is feasible, thereby simplifying the operation procedure.

Embodiment 4: Performing the Target Region Enrichment for the RNA Template with the MIP Solution of which the Procedure is Improved

(121) The probe sequences of this embodiment are:

(122) P13:

(123) TABLE-US-00016 SEQ ID NO: 13 /5Phos/AGCTCCATCTGCATGGCTTGHVDNNNNNCTGTCTCTTATAC ACATCTCCdU NNNNNHHH  

(124) wherein, starting from the 5′ end, the underlined part is the ligation arm, HVD is the masking sequence 1, NNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, NNNNN is the UID sequence 2, HHH is the masking sequence 2, and the wavy underlined part is the extension arm.

(125) P14:

(126) TABLE-US-00017 SEQ ID NO: 14 /5Phos/AGCTCCATCTGCATGGCTTGHVDNNNNNCTGTCTCTTATACA CATCTCCdU  NNNNN BBB

(127) wherein, starting from the 5′ end, the underlined part is the ligation arm, HVD is the masking sequence 1, NNNNN is the UID sequence 1, the double underlined part is the Illumina Tag1, dU is the deoxyuridine, the part of which the underline is the dotted line is the Illumina Tag2, NNNNN is the UID sequence 2, BBB is the masking sequence 2, and the wavy underlined part is the extension arm.

(128) In this embodiment, two probes targeting the human EML4-ALK (-echinodermal microtubule-binding protein-like 4-anaplastic lymphoma kinase) fusion gene are used. The hybridization reaction condition is as follows:

(129) Nuclease-free water (NEB) 5.5 μL;

(130) 50 ng/μL H3122 cell DNA 2 μL;

(131) 3×10.sup.−3 μM P13-14 probe equally mixed mixture 1 μL;

(132) RNase Inhibitor(TaKaRa) 0.5 μL;

(133) 10×Ampligase Buffer (Epicentre) 1 μL.

(134) The procedure is: denaturing at 70° C. for 2 min, and incubating at 65° C. for 2 h. Then, the following reagents are added to the above hybridization products, and the reaction procedure is: at 42° C. for 1 h, and performing extending and ligating reaction.

(135) 1 mM dNTPs (NEB) 1 μL;

(136) 5 U/μL Ampligase DNA ligase (Epicentre) 1 μL;

(137) 10×Ampligase Buffer (Epicentre) 1 μL;

(138) 50 mM NAD.sup.+(NEB) 0.1 μL;

(139) 5×First-Strand Buffer(TaKaRa) 4 μL;

(140) 100 mM DTT(TaKaRa) 2 μL;

(141) SMART MMLV RT(TaKaRa) 1 μL.

(142) The remaining probes, RNA and RNA on the DNA-RNA hybrid strand are digested by using the exonuclease and ribonuclease, and then the PCR amplification is performed for them.

(143) The following reagents are added to the above products. The reaction procedure is: incubating at 37° C. for 60 min, incubating at 95° C. for 5 min, and pre-denaturing at 95° C. for 30 s; denaturing at 98° C. for 10 s, annealing at 60° C. for 30 s, extending at 72° C. for 30 s, and 26 cycles; extending at 72° C. for 2 min, and heat preserving at 4° C.

(144) Exonuclease I 1 μL;

(145) RNase A 0.1 μL;

(146) RNase H 0.1 μL;

(147) 2×iProof HF Master Mix(Bio-Rad) 50 μL;

(148) H.sub.2O 24.8 μL;

(149) 20 μM Tag1 primer 2 μL;

(150) 20 μM Tag2 primer 2 μL.

(151) The Tag1 primer sequence here is the same as the Tag1 primer sequence in Embodiment 1; and the Tag2 primer sequence here is the same as the Tag2 primer sequence in Embodiment 1.

(152) After amplification, the library is purified by using the Agencourt AMPure XP magnetic beads. Then, the quality control is performed for the library, and the library is sequenced on the Illumina sequencer. The result refers to Table 4.

(153) TABLE-US-00018 TABLE 4 Experiment result table of Embodiment 4 Experiment Comparison group rate Coverage 1 96.24% 100% 2 95.87% 100% 3 96.16% 100%

(154) Experiment groups 1-3 are three repeated groups. It can be seen from Table 4 that the library sequencing results have a comparison rate of more than 95% and a coverage of 100%, indicating that using the MIP solution of which the procedure is improved can directly use the RNA as a template for enriching the target region.

(155) The above embodiments are only used for explaining rather than limiting the technical solution of the present invention. Although detailed explanations are taken on the present invention with reference to better embodiments, those skilled in the art should understand that modifications or equivalent replacements may be made on the technical solution without departing from the purpose and scope of the technical solution of the present invention, and they all should be covered in scopes of the claims of the present invention.