PRODUCTS AND COMPOSITIONS
20220025377 · 2022-01-27
Inventors
- Sibylle Dames (Berlin, DE)
- Ute Schaeper (Berlin, DE)
- Judith Hauptmann (Berlin, DE)
- Christian Frauendorf (Berlin, DE)
- Lucas Bethge (Berlin, DE)
- Adrien Weingärtner (Berlin, DE)
Cpc classification
A61P7/00
HUMAN NECESSITIES
C12N2310/317
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61K47/56
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to products and compositions and their uses. In particular the invention relates to nucleic acid products that interfere with the TMPRSS6 gene expression or inhibits its expression and therapeutic uses such as for the treatment of hemochromatosis, porphyria and blood disorders such as β-thalassemias, sickle cell disease and transfusional iron overload or myelodysplastic syndrome.
Claims
1. A nucleic acid for inhibiting expression of TMPRSS6, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from the TMPRSS6 gene, wherein said nucleic acid comprises the following first strand: 5′-3′: aaccagaagaagcagguga; optionally wherein the nucleic further comprises the following second strand: 5′-3′: ucaccugcuucuucugguu
2. A nucleic acid according to any preceding claim, wherein one or more nucleotides on the first and/or second strand are modified, to form modified nucleotides.
3. A nucleic acid of claim 2, wherein said first strand comprises a nucleotide sequence of SEQ ID NO:17, and wherein said second strand comprises the nucleotide sequence of SEQ ID NO:18. TABLE-US-00035 SEQ ID 5′aaccagaaga 6273646282647284546 NO: 17 agcagguga 3′ SEQ ID 5′ucaccugcuu 1727354715351718451 NO: 18 cuucugguu 3′ wherein the specific modifications are depicted by the following numbers 1=2′F-dU, 2=2′F-dA, 3-2′F-dC, 4=2′F-dG, 5=2′-OMe-rU; 6=2′-OMe-rA; 7=2′-OMe-rC; 8-2′-OMe-rG.
4. A nucleic acid according to any preceeding claim conjugated to a ligand, optionally at the 5′ end of the second strand.
5. A nucleic acid according to claim 4 wherein the ligand comprises (i) one or more N-acetyl galactosamine (GalNAc) moieties and derivatives thereof, and (ii) a linker, wherein the linker conjugates the GalNAc moieties to the nucleic acid.
6. A nucleic acid according to claim 4 or 5, wherein linker is a bivalent or trivalent or tetravalent branched structure.
7. A conjugated nucleic acid according to any of claims 4-6, having the structure: ##STR00051## ##STR00052## ##STR00053## ##STR00054## wherein Z is a nucleic acid according to any of claims 1 to 40.
8. A nucleic acid according to any one of claims 1 to 6, or a conjugated nucleic according to claim 7, wherein the nucleic acid is stabilised at the 5′ and/or 3′ end of either or both strands.
9. A nucleic acid according to claim 8 comprising a phosphorothioate linkage between the terminal one, two or three 3′ nucleotides and/or 5′ nucleotides of the first and/or the second strand, or comprising a phosphorodithioate linkage.
10. A nucleic acid according to claim 9 comprising two phosphorothioate linkage between each of the three terminal 3′ and between each of the three terminal 5′ nucleotides on the first strand, and two phosphorothioate linkages between the three terminal nucleotides of the 3′ end of the second strand, having the structure TABLE-US-00036 5′-3′ TMPRSS6- 6 (ps) 2 (ps) 736462826472845 (ps) 4 (ps) 6 hcm-9A 5′-3′ TMPRSS6- 17273547153517184 (ps) 5 (ps) 1 hcm-9B
11. A composition comprising a nucleic acid or conjugated nucleic acid of any preceding claim and a physiologically acceptable excipient.
12. A nucleic acid or conjugated nucleic acid or composition according to any preceding claim for use in the treatment of a disease or disorder.
13. Use of a nucleic acid or conjugated nucleic acid or composition according to any preceding claim in the manufacture of a medicament for treating a disease or disorder.
14. A method of treating a disease or disorder comprising administration of a nucleic acid or composition comprising a nucleic acid or conjugated nucleic acid according to any one preceding claim to an individual in need of treatment.
15. Use or method according to any of claims 13-14, or a nucleic acid for use according to claim 3, wherein said disease or disorder is selected from the group comprising hemochromatosis, erythropoietic porphyria, transfusional iron overload and blood disorders.
16. A nucleic acid for use according to claim 12, use according to claim 13 or 15 or a method according to claim 14 or 15, wherein the nucleic acid is for one or more or all of: (i) treatment of anemia, optionally suitably determined by an increase in haemoglobin; and/or (ii) amelioration of splenomegaly, optionally determined by a reduction of spleen size or weight: and/or (iii) reduction of stressed erythropoiesis in spleen, optionally determined by the proportion of erythroblasts and enucleated erythroid cells determined by FACS analysis, as described herein; and/or (iv) improvement of red blood cell maturation/erythropoiesis in the bone marrow, optionally determined by the proportion of erythroblasts and enucleated erythroid cells determined by FACS analysis.
Description
[0520] The invention will now be described with reference to the following non-limiting figures and examples in which:
[0521]
[0522]
[0523]
[0524]
[0525]
[0526]
[0527]
[0528]
[0529]
[0530]
[0531]
[0532]
[0533]
[0534]
[0535]
[0536]
[0537]
[0538]
[0539]
[0540]
[0541]
[0542]
[0543]
[0544]
[0545]
[0546]
[0547]
[0548]
[0549]
[0550]
[0551]
[0552]
[0553]
[0554]
[0555]
[0556]
[0557]
[0558]
[0559]
[0560]
[0561]
[0562]
[0563]
[0564]
[0565]
[0566]
[0567]
[0568]
[0569]
[0570]
[0571]
[0572]
EXAMPLES
Example 1
[0573] Nucleic acids in accordance with the invention were synthesised, using the oligos as set out in the tables below.
[0574] The method of synthesis was as follows, using one of the sequences of the invention as an example:
[0575] STS012 (GN-TMPRSS6-hcm-9)
[0576] First Strand
[0577] 5′mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 3′
[0578] Second Strand
[0579] 5′[ST23 (ps)]3 long trebler (ps) fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU 3′
[0580] fN (N=A, C, G, U) denotes 2′Fluoro, 2′ DeoxyNucleosides
[0581] mN (N=A, C, G, U) denotes 2′O Methyl Nucleosides
[0582] (ps) indicates a phosphorothioate linkage
[0583] ST23 is a GalNAc C4 phosphoramidite (structure components as below)
##STR00041##
[0584] Long trebler (STkS)
[0585] A further example is GN2-TMPRSS6-hcm-9 (STS12009L4):
[0586] First Strand
[0587] 5′mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 3′
[0588] Second Strand
[0589] 5′[ST23 (ps)]3 ST41 (ps) fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU 3′
[0590] fN (N=A, C, G, U) denotes 2′Fluoro, 2′ DeoxyNucleosides
[0591] mN (N=A, C, G, U) denotes 2′O Methyl Nucleosides
[0592] (ps) indicates a phosphorothioate linkage
[0593] ST23 is as above.
[0594] ST41 is as follows (and as described in WO2017/174657):
##STR00042##
[0595] All Oligonucleotides were either obtained from a commercial oligonucleotide manufacturer (Eurogentech, Belgium; Biospring, Germany) or synthesized on an AKTA oligopilot synthesizer using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidtes, 2′Fluoro DNA phosphoramidites (all standard protection) and commercially available long trebler phosphoramidite (Glen research) were used. Synthesis was performed using 0.1 M solutions of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). All other reagents were commercially available standard reagents.
[0596] Synthesis of PS2 containing oligonucleotides was performed according to the instructions of the manufacturer (Glen Research, AM Biotech). Vinyl-(E)-phosphonate 2′OMe-Uracil phosphoamidite was synthesized and used in oligonucleotide synthesis according to literature published methods (Haraszti et al., Nuc. Acids Res., 45(13), 2017, 7581-7592).
[0597] Conjugation of the GalNAc synthon (ST23) was achieved by coupling of the respective phosphoramidite to the 5′ end of the oligochain under standard phosphoramidite coupling conditions. Phosphorothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).
[0598] The single strands were cleaved off the CPG by using Methylamine. Where TBDMS protected RNA nucleosides were used, additional treatment with TEA*3HF was performed to remove the silyl protection. The resulting crude oligonucleotide was purified by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a Sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.
[0599] For annealing, equimolar amounts of the respective single strands were dissolved in water and heated to 80° C. for 5 min. After cooling the resulting Duplex was lyophilised.
[0600] The sequences of the resulting nucleic acids (siRNAs) are set out in Table 1.
TABLE-US-00016 SEQ ID Name - NO: TMPRSS6- . . . Sequence Modifications 1 hc-1A 5′augucuuuca 6181715172727184715 cacuggcuu 3′ 2 hc-1B 5′aagccagugu 2647364545462646361 gaaagacau 3′ 3 h-2A 5′auugaguaca 6154645272747282718 cgcagacug 3′ 4 h-2B 5′cagucugcgu 3645354745452717261 guacucaau 3′ 5 h-3A 5′aaguugaugg 6281546184546173748 ugaucccgg 3′ 6 h-3B 5′ccgggaucac 3748461727361726351 caucaacuu 3′ 7 hc-4A 5′uucuggaucg 5171846174537271847 uccacuggc 3′ 8 hc-4B 5′gccaguggac 4736454827461736462 gauccagaa 3′ 9 h-5A 5′auucacagaa 6153636462728284627 cagaggaac 3′ 10 h-5B 5′guuccucugu 4517353545171818261 ucugugaau 3′ 11 h-6A 5′guagucaugg 8164536184718173535 cuguccucu 3′ 12 h-6B 5′agaggacagc 2828463647361827163 caugacuac 3′ 13 h-7A 5′aguuguagua 6451816452645173728 aguucccag 3′ 14 h-7B 5′cugggaacuu 3548462715271636271 acuacaacu 3′ 15 hcmr-8A 5′uuguacccua 5181637352846261637 ggaaauacc 3′ 16 hcmr-8B 5′gguauuuccu 4816151735284816362 aggguacaa 3′ 17 hcm-9A 5′aaccagaaga 6273646282647284546 agcagguga 3′ 18 hcm-9B 5′ucaccugcuu 1727354715351718451 cuucugguu 3′ 19 hc-10A 5′uaacaaccca 5263627372838184625 gcguggaau 3′ 20 hc-10B 5′auuccacgcu 2517363835484518152 ggguuguua 3′ 21 hc-11A 5′guuucucuca 8151717172537284738 uccaggccg 3′ 22 hc-11B 5′cggccuggau 3847354825464646263 gagagaaac 3′ 23 hcm-12A 5′gcaucuucug 8361715354847151847 ggcuuuggc 3′ 24 hcm-12B 5′gccaaagccc 4736264737282646183 agaagaugc 3′ 25 hc-13A 5′ucacacugga 5363635482648182618 aggugaaug 3′ 26 hc-13B 5′cauucaccuu 3615363715372818182 ccaguguga 3′ 27 hcmr-14A 5′cacagaugug 7272825454538273738 ucgaccccg 3′ 28 hcmr-14B 5′cggggucgac 3848453827272535454 acaucugug 3′ 29 hcmr-15A 5′uguacccuag 5452737164826252736 gaaauacca 3′ 30 hcmr-15B 5′ugguauuucc 1845251537164845272 uaggguaca 3′ 31 Luc-siRNA-1A 5′ucgaaguauu 5382645251738381638 ccgcguacg 3′ 32 Luc-siRNA-1B 5′cguacgcgga 3816383856252715382 auacuucga 3′ 33 PTEN-A 5′uaaguucuag 5a6g5u7u6g7u8u8g5g8 cuguggugg 3′ 34 PTEN-B 5′ccaccacagc c7a7c6c6g7u6g6a7u5a uagaacuua 3′
[0601] Table 1
[0602] Table 1: nucleic acid sequences tested for inhibition of TMPRSS6 expression. Nucleic acids were synthesized by Biospring, Frankfurt. Nucleotides modifications are depicted by the following numbers (column 4), 1=2′F-dU, 2=F′-dA, 3=2′F-dC, 4=2′F-dG, 5=2′-OMe-dU; 6=2′-OMe-rA; 7=2′-OMe-dC; 8=2′-OMe-dG.
TABLE-US-00017 Corresponding SEQ nucleic ID Start Oligo acid NO: 253 GGUAUUUCCUAGGGUACAA TMPRSS6-hcmr-8 16 305 CAGUCUGCGUGUACUCAAU TMPRSS6-h-2 4 381 GCCAAAGCCCAGAAGAUGC TMPRSS6-hcm-12 24 426 CUGGGAACUUACUACAACU TMPRSS6-h-7 14 478 UCACCUGCUUCUUCUGGUU TMPRSS6-hcm-9 18 652 AAGCCAGUGUGAAAGACAU TMPRSS6-hc-1 2 682 AUUCCACGCUGGGUUGUUA TMPRSS6-hc-10 20 1234 GCCAGUGGACGAUCCAGAA TMPRSS6-hc-4 8 1318 CCGGGAUCACCAUCAACUU TMPRSS6-h-3 6 1418 GUUCCUCUGUUCUGUGAAU TMPRSS6-h-5 10 1481 CGGCCUGGAUGAGAGAAAC TMPRSS6-hc-11 22 1633 CAUUCACCUUCCAGUGUGA TMPRSS6-hc-13 26 1824 CGGGGUCGACACAUCUGUG TMPRSS6-hcmr-14 28 2018 AGAGGACAGCCAUGACUAC TMPRSS6-h-6 12 252 UGGUAUUUCCUAGGGUACA TMPRRS6-hcmr-15 30
[0603] Table 2
[0604] Table 2—the start position of each nucleic acid sequence within the TMPRSS6 mRNA sequence Ref NM_001289000.1.
[0605] Screen for Inhibition TMPRSS6 Expression in Human Hep31B Cells.
[0606] Cells were plated at a cell density of 80,000 cells per 6 well dish. The following day cells were transfected with 20 nM nucleic acid (listed in Table 1) and 1 μg/ml AtuFECT (50:50 formulation of cationic lipid Atufect01 and fusogenic lipid DPhyPE.). Two days after transfection cells were lysed and TMPRSS6 mRNA levels were determined by q-RT-PCR using the amplicons in Table 3. TMPRSS6 mRNA levels were normalized to expression levels of the house keeping gene PTEN. Nucleic acids for Luciferase and PTEN were used as non targeting control nucleic acids. Results are shown in
TABLE-US-00018 SEQ ID NO: hTMPRSS6 5′CCGCCAAAGCCCAGAAG 3′ 35 (upper) hTMPRSS6 5′GGTCCCTCCCCAAAGGAATAG 3′ 36 (lower) hTMPRSS6 5′CAGCACCCGCCTGGGAACTTACTACAAC 37 (probe) 3′ mTMPRSS6 5′CGGCACCTACCTTCCACTCTT 3′ 38 (upper) mTMPRSS6 5′TCGGTGGTGGGCATCCT 3′ 39 (lower) mTMPRSS6 5′CCGAGATGTTTCCAGCTCCCCTGTTCTA 40 (probe) 3′ h-Aktin 5′GCATGGGTCAGAAGGATTCCTAT 3′ 41 (upper) h-Aktin 5′TGTAGAAGGTGTGGTGCCAGATT 3′ 42 (lower) h-Aktin 5′CGAGCACGGCATCGTCACCAA 3′ 43 (probe) mAktin 5′GTTTGAGACCTTCAACACCCCA 3′ 44 (upper) mAktin 5′GACCAGAGGCATACAGGGACA 3′ 45 (lower) mAktin 5′CCATGTACGTAGCCATCCAGGCTGTG 3′ 46 (probe) PTEN 5′CACCGCCAAATTTAACTGCAGA 3′ 47 (upper) PTEN 5′AAGGGTTTGATAAGTTCTAGCTGT 3′ 48 (lower) PTEN 5′TGCACAGTATCCTTTTGAAGACCATAACCCA 49 (probe) 3′ mHAMP: 5′CCTGTCTCCTGCTTCTCCTCCT 3′ 50 (upper) mHAMP: 5′AATGTCTGCCCTGCTTTCTTCC 3′ 51 (lower) mHAMP: 5′TGAGCAGCACCACCTATCTCCATCAACA3′ 52 (probe)
[0607] Table 3
[0608] Table 3 Sequences of TMPRSS6, Actin, PTEN and HAMP amplicon sets that were used to measure mRNA levels of respective genes.
Example 2
[0609] Dose Response of TMPRSS6 Nucleic Acids for Inhibition of TMPRSS6 Expression in Human Hep3B Cells.
[0610] Cells were plated at a cell density of 150,000 cells per 6 well dish. The following day cells were transfected with 1 μg/ml AtuFECT (50:50 formulation of cationic lipid Atufect01 and fusogenic lipid DPhyPE.) and different amounts of TMPRSS6 nucleic acids (30; 10; 3; 1; 0.3; 0.1, 0.003 nM, respectively) as depicted by the X-axis of the graph in
Example 3
[0611] Inhibition of TMPRSS6 Expression in Liver Tissue by Different Doses of GalNAc Nucleic Acids.
[0612] C57/BL6 mice were treated with a single dose of 10, 3 or 1 mg/kg of GalNAc nucleic acid conjugates by subcutaneous administration. Sequence and modifications of respective siRNA conjugates are shown in
Example 4
[0613] Duration of Target Gene Inhibition by TMPRSS6 RNAi Molecules.
[0614] Mice were treated with 3 mg/kg GalNAc-TMPRSS6 RNAi molecules by subcutaneous injection. Sequence and modifications of respective siRNA conjugates are shown in
Example 5
[0615] Inhibition of TMPRSS6 Expression by Treatment with TMPRSS6 siRNA Reduces Iron Levels in Blood.
[0616] Iron levels were analyzed in serum 7, 14, 21, 27, 34 and 41 days after mice were treated subcutaneously with 3 mg/kg GalNAc nucleic acid conjugates. Serum iron levels were reduced up to 41 days post injection (dpi 41). Sequence and modifications of respective siRNA conjugates are shown in
Example 6
[0617] Inhibition of TMPRSS6 Expression by Receptor Mediated Uptake.
[0618] Primary mouse hepatocytes were plated on collagen coated dishes and incubated with siRNA conjugates diluted in cell culture medium at a concentration of 100 nM to 0.03 nM as indicated. 24 hours after exposing the cells to siRNA conjugates, total RNA was extracted and TMPRSS6 expression was quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to Actin mRNA levels. Dose dependent inhibition of TMPRSS6 expression was observed by both GalNAc-TMPRSS6 siRNA conjugates. GN2-Luc-siRNA1 GalNAc conjugate (GN2-Luc) was used as non targeting control and did not affect TMPRSS6 mRNA expression. Sequence and modifications of respective siRNA conjugates are depicted in
Example 7
[0619] Further TMPRSS6 siRNAs were Synthesised, in Accordance with the Method Described Above. The sequences and modifications are shown in Table 4 below:
[0620] Modification variants of an siRNA targeting TMPRSS6 (Sequence ID 17 and ID18). For each duplex, the first sequence (A strand) is listed on top and the second sequence (B strand) below. All sequences correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom). Modification codes are listed at the end of the Table 4.
TABLE-US-00019 A Du- strand plex B sequence sequence and ID strand (5′-3′) chemistry (5′-3′) TMP TMPJH aaccagaagaagcagguga 6273646282647284546 01 01A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 02 02A TMPJH ucaccugcuucuucugguu 1723314715355754815 02B TMP TMPJH aaccagaagaagcagguga 2273282646283248182 03 03A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 2273282646683248182 04 04A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 05 01A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 2273242242643244542 06 05A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2277646242643244542 07 06A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2277686242643244542 08 07A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2273242246687244542 09 08A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2273242682687244542 10 09A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 11 10A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2273242242643288586 12 11A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2273242246687284586 13 12A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 14 13A TMPJH ucaccugcuucuucugguu 5767354315755758855 13B TMP TMPJH aaccagaagaagcagguga 2273282282283284182 15 14A TMPJH ucaccugcuucuucugguu 5327318315315318415 14B TMP TMPJH aaccagaagaagcagguga 2273282282643284182 16 15A TMPJH ucaccugcuucuucugguu 5327318315315318415 14B TMP TMPJH aaccagaagaagcagguga 2237242242247244582 17 16A TMPJH ucaccugcuucuucugguu 1723314355311358411 16B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 18 10A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 19 10A TMPJH ucaccugcuucuucugguu 1723314715355754815 02B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 20 10A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 21 10A TMPJH ucaccugcuucuucugguu 5767354315755758855 13B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 22 10A TMPJH ucaccugcuucuucugguu 5327318315315318415 14B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 23 10A TMPJH ucaccugcuucuucugguu 1723314355311358411 16B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 24 02A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 25 02A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 26 02A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 27 02A TMPJH ucaccugcuucuucugguu 5767354315755758855 13B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 28 02A TMPJH ucaccugcuucuucugguu 5327318315315318415 14B TMP TMPJH aaccagaagaagcagguga 2237242282243284142 29 02A TMPJH ucaccugcuucuucugguu 1723314355311358411 16B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 30 13A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 31 13A TMPJH ucaccugcuucuucugguu 1723314715355754815 02B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 32 13A TMPJH ucaccugcuucuucugguu 5363718351715354815 03B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 33 13A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 34 13A TMPJH ucaccugcuucuucugguu 5327318315315318415 14B TMP TMPJH aaccagaagaagcagguga 6277646246687284586 35 13A TMPJH ucaccugcuucuucugguu 1723314355311358411 16B TMP TMPJH aaccagaagaagcagguga 2273242242643284586 36 10A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282242643284586 37 17A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 6277682242643288142 38 18A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 6277682242643288586 39 19A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2233282242643284142 40 20A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2277282242643284586 41 21A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282642643284586 42 22A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282282643284586 43 23A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282246643284586 44 24A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282242683284586 45 25A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 2273282242647284586 46 26A TMPJH ucaccugcuucuucugguu 1727354715351718451 01B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 47 01A TMPJH ucaccugcuucuucugguu 5727354315355754455 05B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 48 01A TMPJH ucaccugcuucuucugguu 5727754715355754855 27B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 49 01A TMPJH ucaccugcuucuucugguu 1723314311351714411 28B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 50 01A TMPJH ucaccugcuucuucugguu 5767354315355754455 29B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 51 01A TMPJH ucaccugcuucuucugguu 5727754315355754455 30B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 52 01A TMPJH ucaccugcuucuucugguu 5727358315355754455 31B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 53 01A TMPJH ucaccugcuucuucugguu 5727354315755754455 32B TMP TMPJH aaccagaagaagcagguga 6273646282647284546 54 01A TMPJH ucaccugcuucuucugguu 5727354315355758455 33B 1 = 2′F-dU 2 = 2′F-dA 3 = 2′F-dC 4 = 2′F-dG 5 = 2′OMe-rU 6 = 2′OMe-rA 7 = 2′OMe-rC 8 = 2′OMe-rG
[0621] Table 4
[0622] Table 4: Modifications are depicted by numbers shown in the rows at the bottom of the table, and for each duplex the first strand is on top and the second strand is below.
[0623] Different modification variants of one siRNA targeting TMPRSS6 were tested in human Hep3B cells, siRNAs targeting PTEN and Luciferase were used as non-related and non-targeting controls, respectively. All siRNAs were transfected with 1 μg/ml Atufect at 1 nM (0.1 nM when indicated). Total RNA was extracted 48 h after transfection and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to Actin mRNA levels. Each bar represents mean+/−SD of three technical replicates. The results are shown in
Example 8
[0624] Modification variants of a GalNAc-conjugated siRNA targeting TMPRSS6 were synthesised and are shown in
Example 9
[0625] Different modification variants of one GalNAc conjugated sequence targeting TMPRSS6 (STS012) reduce TMPRSS6 expression in mouse primary hepatocytes. For receptor-mediated uptake, cells were incubated with 100, 10, 1 and 0.1 nM siRNA conjugate for 24 hours. Total RNA was extracted and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to Actin mRNA levels. Mean+/−SD of each three technical replicates are shown in
Example 10
[0626] Different modification variants of one GalNAc-conjugated sequence targeting TMPRSS6 (STS012, GN-TMPRSS6-hcm9) were tested in vivo. 1 mg/kg and 3 mg/kg GalNAc-siRNA conjugate were subcutaneously injected into male C57BL/6JOIaHsd mice. 14 days after treatment, TMPRSS6 (A) and HAMP (B) mRNA levels in the liver were analyzed by Taqman qRT-PCR. Bars represent mean of at least 4 animals+/−SD. Results are shown in
Example 11
[0627] Two different modification variants of one GalNAc-conjugated sequence targeting TMPRSS6 (STS012) were tested in vivo. 1 mg/kg GalNAc-siRNA conjugates were subcutaneously injected into male C57BL/6JOIaHsd mice. 14 and 28 days after treatment, TMPRSS6 mRNA levels in the liver were analyzed by Taqman qRT-PCR (A). In addition, serum iron levels were analyzed (B). Results are shown in
[0628] The sequences are as in Example 10.
Example 12
[0629] Two different modification variants of one GalNAc-conjugated sequence targeting TMPRSS6 (STS12009L4, GN2-TMPRSS6-hcm9) were tested in vivo. 1 mg/kg and 0.3 mg/kg GalNAc-siRNA conjugates were subcutaneously injected into male C57BL/6JOIaHsd mice. 14 days after treatment, TMPRSS6 mRNA levels in the liver were analyzed by Taqman qRT-PCR (A). In addition, serum iron levels were analyzed (B). Results are shown in
[0630] The duplexes used are shown below in Table 5. All sequences correspond to SEQ ID NO:1.sup.7 and SEQ ID NO:18
TABLE-US-00020 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V2L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-mUmCmAmCfCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU STS12009V8L4 mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps) mA GN2-mUmCmAmCfCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU GN2-Luc mU(ps)fU(ps)mAfGmUfAmAfAmCfCmUfUmUfUmGfAmG(ps)fA(ps)mC GN2-fGmUfCmUfCmAfAmAfAmGfGmUfUmUfAmCfU(ps)mA(ps)fA mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA (ps)—phosphorothioate GN2 = GalNAc structure according to FIG. 8B
[0631] Table 5
[0632] Table 5: Modification variants of GalNAc-conjugated sequences targeting TMPRSS6.
Example 13
[0633] Different modification variants of one siRNA targeting TMPRSS6 were tested in human Hep3B cells. An siRNA targeting Luciferase was used as non-targeting control. All siRNAs were transfected with 1 μg/ml Atufect at 1 nM and 0.1 nM. Total RNA was extracted 48 h after transfection and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to PTEN mRNA levels. Results are shown in
[0634] The sequences are shown in Table 6 below. All sequences correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00021 duplex sequence and chemistry ID (top: first strand, bottom: second strand, both 5′-3′) TMP01 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU TMP66 mAfAmCfCmAmGfAmAmGmAmAmGmCfAmGmGmUmGmA mUmCmAmCmCmUfGmCfUmUmCmUmUmCmUmGmGm UmU TM P69 fAfAfCfCfAmGfAfAfGfAmAfGfCfAmGfGfUfGfA fUmCfAfCfCfUfGfClUtUfCmUfUmCfUfGfGfUfU IMP79 fAfAmaCfAmGfAfAfGfAmAfGfCfAmGfGmUmGmA mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU TMP80 fAfAmCmCfAmGfAfAfGrAmAfGfCfAmGfGmUmGmA mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU TMP81 fAfAmCfCfAmGfAfAfGfAmAfGmCfAmGfGmUmGmA mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA (ps)—phosphorothioate
[0635] Table 6
[0636] Table 6: Different modification variants of one siRNA targeting TMPRSS6.
Example 14
[0637] Modification variants of a GalNAc-conjugated siRNA targeting TMPRSS6 were tested in human Hep3B cells. 150,000 cells were seeded per 6-well. After 24 h, siRNA conjugates were transfected with 1 μg/ml Atufect at 10, 1, 0.1, 0.01, and 0.001 nM (A) or 5, 0.5, 0.05, 0.005 nM (B). A GalNAc-siRNA against Luciferase was used as non-targeting control. Total RNA was extracted 72 h after transfection and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to PTEN mRNA levels (A) or Actin mRNA levels (B). Results are shown in
[0638] Sequences are shown in Table 7 below
TABLE-US-00022 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V27L4 mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps) mA GN2-mUmCmAmCmCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU STS12009V41L4 mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps) mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU RNA mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA (ps)—phosphorothioate GN2 = GalNAc structure according to FIG. 8B
[0639] Table 7
[0640] Table 7: Modification variants of a GalNAc-conjugated siRNA targeting TMPRSS6
Example 15
[0641] A modification variant of a GalNAc-conjugated sequence targeting TMPRSS6 (STS12009L4) was tested in mouse primary hepatocytes. For receptor-mediated uptake, cells were incubated with 100, 25, 5, 1, 0.25 and 0.05 nM siRNA conjugate for 24 h. A GalNAc-siRNA targeting an unrelated sequence (GN-TTR) and a non-targeting GalNAc-siRNA (GN-Luc) were used as controls. Total RNA was extracted and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to PTEN mRNA levels. Results are shown in
[0642] Sequences are shown in Table 7, above.
Example 16
[0643] Different DNA- and LNA-containing variants of one siRNA targeting TMPRSS6 were tested in human Hep3B cells. Therefore, 150,000 cells were seeded per 6-well. After 24 h, siRNAs were transfected with 1 μg/ml Atufect at 0.1 nM siRNA. Total RNA was extracted 48 h after transfection and TMPRSS6 mRNA levels were quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to Actin mRNA levels. Results are shown in
[0644] Sequences are shown in Table 8, below. All sequences correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00023 duplex sequence and chemistry ID (top: first strand, bottom: second strand, both 5′-3′) TMP01 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU TMP95 mAfAmCmCmAmGmAmAmGmAmAmGmCfAmGmGm UmGmA fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU TMP99 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA mUmCmAmCmCmUfGmCfUmUmCmUmUmCmUmGm GmUmU TMP112 mA[A]mCmCmAmGmAmAmGmAmAmGmCfAmGmGm UmGmA fUmCfAmCfCmUlGmCfUmUrCmUfUmCfUmGfGmUfU TMP114 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA mUmCmAmCmCmU{G}mCfUmUmCmUmUmCmUmGm GmUmU TMP115 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA mUmCmAmCmCmUfGmC{U}mUmCmUmUmCmUmGm GmUmU TMP116 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA mUmCmAmCmCmU[G]mCfUmUmCmUmUmCmUmGm GmUmU TMP117 mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA mUmCmAmCmCmUfGmC[U]mUmCmUmUmCmUmGm GmUmU mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA [A], [T], [C], [G]—DNA {A}, {U}, {C}, {G}—LNA (ps)—phosphorothioate
[0645] Table 8
[0646] Table 8: Different DNA- and LNA-containing variants of one siRNA targeting TMPRSS6.
Example 17
[0647] The influence of inverted A and G RNA nucleotides at terminal 3′ positions was analyzed using an siRNA against TMPRSS6. TMP70 contains phosphorothioates at all termini, whereas TMP82 and TMP83 contain ivA (TMP82) and ivG (TMP83) at the 3′-end of the antisense and at the 3′-end of the sense. Both inverted nucleotides are present in addition to the terminal nucleotide of the respective strands and are linked via a phosphorothioate bond. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0648] The experiment was conducted in Hep3B cells. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0649] The sequences are shown below in Table 9. Sequences correspond to SEQ ID NO:17 (top) or SEQ ID NO:18 (bottom).
TABLE-US-00024 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) TMP70 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU IMP82 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivA TMP83 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivG mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA ivA, ivG—inverted RNA (3′-3′) (ps)—phosphorethioate
[0650] Table 9
[0651] Table 9: An siRNA against TMPRSS6 including inverted RNA nucleotides at different positions.
Example 18
[0652] Different siRNA duplexes containing inverted RNA nucleotides at both 3′-ends were tested for serum stability. TMP84-TMP87 contain inverted RNA in addition to the last nucleotide in the sense strand and instead of the last nucleotide in the antisense strand. TMP88-TMP91 contain inverted RNA in addition to the last nucleotide in the antisense strand and instead of the last nucleotide in the sense strand. All inverted RNA nucleotides substitute for terminally used phosphorothioates. In the design of TMP84-TMP87, ivA and ivG confer higher stability to the tested sequence than ivU and ivC (part A). In the design of TMP88-TMP91, there is no influence of base identity on duplex stability (part B).
[0653] Results are shown in
[0654] Sequences are show in the Table 10, below, and correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00025 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) TMP70 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU TMP84 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG TMP85 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivU fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG TMP86 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivC fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG TMP87 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG TMP88 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivA TMP89 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivU TMP90 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivC TMP91 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivG mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA ivA, ivG, ivC, ivG—inverted RNA (3′-3′) (ps)—phosphorethioate
Table 10
[0655] Table 10: Different siRNA duplexes containing inverted RNA nucleotides at both 3′-ends.
Example 19
[0656] The influence of inverted RNA nucleotides at terminal 3′ positions was analyzed using an siRNA against TMPRSS6. TMP70 contains phosphorothioates at all termini, whereas TMP84-TMP87 contain ivG at the 3′-end of the sense strand. The inverted RNA nucleotide is present in addition to the last nucleotide and substitutes for two phosphorothioates. At the antisense 3′-end, ivA (TMP84), ivU (TMP85), ivC (TMP86) and ivG (TMP87) were tested. These inverted RNA nucleotides were added instead of the terminal nucleotide and substitute for phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0657] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0658] The sequences are as in Table 10, above.
Example 20
[0659] The influence of inverted RNA nucleotides at terminal 3′ positions was analyzed using an siRNA against TMPRSS6. TMP70 contains phosphorothioates at all termini, whereas TMP88-TMP91 contain ivG at the 3′-end of the antisense strand. The inverted RNA nucleotide is present in addition to the last nucleotide and substitutes for two phosphorothioates. At the sense 3′-end, ivA (TMP88), ivU (TMP89), ivC (TMP90) and ivG (TMP91) were tested. These inverted RNA nucleotides were added instead of the terminal nucleotide and substitute for phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0660] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0661] Sequences are as shown in Table 10, above.
Example 21
[0662] The influence of inverted RNA nucleotides at terminal 3′ positions was analyzed using a GalNAc-siRNA conjugate targeting TMPRSS6 in liposomal transfections. STS12009-L4 contains phosphorothioates at all non-conjugated termini, whereas the tested variants contain an inverted RNA nucleotide at the 3′-end of both sense and antisense strand. The inverted RNA is present in addition to the last nucleotide and substitutes for two terminal phosphorothioates (STS12009V10-L4 and -V11-L4) or is used in addition to the terminal phosphorothioates (STS12009V29-L4 and STS12009V30-L4). Inverted A (STS12009V10-L4 and -V29-L4) and inverted G (STS12009V11-L4 and -V30-L4) were used. All tested variants show comparable activity under the tested conditions.
[0663] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 5 nM to 0.0016 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0664] Sequences are set out in Table 11, below and correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00026 sequence and chemistry Duplex ID (top: first strand, bottom: second strand, both 5′-3′) STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V10L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivA STS12009V11L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivG STS12009V29L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mAivA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fUivA STS12009V30L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mAivG GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fUivG mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA ivA, ivG—inverted RNA (3′-3′) (ps)—phosphorethioate GN2 = GalNAc structure according to FIG. 8B
[0665] Table 11
[0666] Table 11: An siRNA sequence including inverted RNA nucleotides at the 3′ ends
Example 22
[0667] Serum stability assay of GalNAc-siRNA conjugates containing one PS2 at individual ends. GalNAc was conjugated to the 5′-end of the sense strand and is internally stabilized by four PS. Phosphorodithioate modifications were placed at the 5′-antisense (STS12009V37L4), 3′-antisense (STS12009V36L4) and 3′-sense (STS12009V34L4) ends. STS12009L4 contains each two terminal PS at 5′-antisense, 3-antisense and 3′-sense ends, GalNAc is attached to the sense 5′-end and stabilized by four internal PS. 5 μM GalNAc-siRNA conjugates were incubated with 50% FBS for 3 d at 37° C. RNA was extracted and analyzed on 20% TBE polyacrylamide gels. Results are shown in
[0668] Sequences are shown in Table 12, below, and correspond to SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00027 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V34L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU(ps2)fU STS12009V36L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG(ps2)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V37L4 mA(ps2)fAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA (ps)—phosphorothioate (ps2)—phosphorodithioate GN2 = GalNAc structure according to FIG. 8B
[0669] Table 12
[0670] Table 12: GalNAc-siRNA conjugates containing one PS2 (phosphorodithioate) at individual ends.
Example 23
[0671] Activity of GalNAc-siRNA conjugates containing one PS2 at individual ends. GalNAc was conjugated to the 5′-end of the sense strand and is internally stabilized by four PS. Phosphorodithioate modifications were placed at the 5′-antisense (STS12009V37L4), 3′-antisense (STS12009V36L4) and 3′-sense (STS12009V34L4) ends. The experiment was conducted in mouse primary hepatocytes. Cells were seeded at a density of 250,000 cells per 6-well and treated with 100 nM, 10 nM and 1 nM GalNAc-siRNA. Transfections with 10 nM GalNAc-siRNA and 1 μg/ml Atufect served as control. Cells were lysed after 24 h, total RNA was extracted and TMPRSS6 and PTEN mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0672] Sequences are as set out in Table 12, above.
Example 24
[0673] Serum stability assay of a GalNAc-siRNA conjugate (STS12009V40L4) containing each one PS2 at the second strand 5′-end and at the second strand 3′-end. GalNAc was conjugated to the 5′-end of the second strand and is not stabilized by any internal PS. STS12009L4 contains each two terminal PS at 5′-antisense, 3-antisense and 3′-sense ends, GalNAc is attached to the sense 5′-end and stabilized by four internal PS. 5 μM GalNAc-siRNA conjugates were incubated with 50% FBS for 3 d at 37° C. RNA was extracted and analyzed on 20% TBE polyacrylamide gels. Results are shown in
[0674] Sequences are set out in Table 13, below, and are SEQ ID NO:17 (top) and SEQ ID NO:18 (bottom).
TABLE-US-00028 sequence and chemistry duplex ID (top: first strand, bottom: second strand, both 5′-3′) STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V40L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA GNo-fU(ps2)mCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU(ps2)fU mA, mU, mC, mG—2′-OMe RNA fA, fU, fC, fG—2′-F DNA (ps)—phosphorothioate (ps2)—phosphorodithioate GN2 = GalNAc structure according to FIG. 8B GNo—GN2 with phosphodiesters instead of (ps)
[0675] Table 13
[0676] Table 13: GalNAc-siRNA conjugate containing each one PS2 at the second strand 5′-end and at the second strand 3′-end.
Example 25
[0677] Activity of a GalNAc-siRNA conjugate (STS12009V40L4) containing each one PS2 at the sense strand 5′-end and at the sense strand 3-end. GalNAc was conjugated to the 5′-end of the sense strand and is not stabilized by any internal PS. STS12009L4 contains each two terminal PS at 5′-antisense, 3′-antisense and 3-sense ends, GalNAc is attached to the sense 5′-end and stabilized by four internal PS. The experiment was conducted in mouse primary hepatocytes. Cells were seeded at a density of 250.000 cells per 6-well and treated with 100 nM, 10 nM and 1 nM GalNAc-siRNA. A GalNAc conjugate of an siRNA against Luciferase (“GalNAc-Luc”) served as control. Cells were lysed after 24 h, total RNA was extracted and TMPRSS6 and PTEN mRNA levels were determined by Taqman qRT-PCR. Results are shown in
[0678] Sequences are as set out in Table 13, above.
Example 26
[0679] Inhibition of TMPRSS6 expression by different doses of GalNAc siRNAs in animal model for hereditary hemochromatosis. HFE.sup.−/− female mice (Herrmann et al., J. Mol. Med (Berl), 2004 82, 39-48) were treated subcutaneously with a single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate, respectively. Control groups were treated with PBS or with the non targeting control GN2-Luc siRNA1 (GN2-Luc) by subcutaneous injection. Target gene expression in liver tissue was assessed by qRT PCR three weeks after the injection of the conjugates. Group mean and +/−SD. Statistics: Kruskal-Wallis test with uncorrected Dunn. Sequence and modification of siRNA conjugates are depicted in
Example 27
[0680] Increase of serum Hepcidin levels by different doses of GalNAc siRNAs in an animal model for hereditary hemochromatosis. HFE.sup.−/− mice were treated with single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate by subcutaneous injection. Control groups were treated with PBS or with non targeting control conjugate GN2-Luc siRNA 1 (GN2-Luc). Hepcidin levels were determined in serum samples collected three weeks after injection of the conjugates using ELISA kit (Intrinsic Life Science). Group means with SD. Kruskal-Wallis test with uncorrected Dunn's test against control group (GN2-Luc siRNA). Results are shown in
Example 28
[0681] Reduction of serum iron levels by different doses of GalNAc siRNAs in animal model for hereditary hemochromatosis. HFE.sup.−/− mice were treated with single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate by subcutaneous administration. Control groups were treated with PBS or with non targeting control conjugate (GN2-Luc siRNA). Serum iron levels were determined three weeks after the treatment. Group means+/−SD. Kruskal-Wallis test with uncorrected Dunn's test against control group (GN2-Luc). Sequences and modifications of siRNA conjugates are depicted in
Example 29
[0682] Reduction of transferrin saturation by different doses of GalNAc siRNAs in animal model for hereditary hemochromatosis. HFE.sup.−/− mice were treated with single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate by subcutaneous administration. Control groups were treated with PBS or with non targeting control conjugate GN2-Luc siRNA1 (GN2-Luc). The % transferrin saturation in blood samples was determined three weeks after the treatment. Group means with SD. Kruskal-Wallis test with uncorrected Dunn's test against control group (GN2-Luc). Sequence and modification of siRNA conjugates are depicted in
Example 30
[0683] Increase in Unsaturated Iron Binding Capacity (UIBC) in animal model for hereditary hemochromatosis. HFE.sup.−/− mice were treated with single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate by subcutaneous administration. Control groups were treated with PBS or with non targeting control conjugate GN2-Luc siRNA1 (GN2-LUC). Serum samples were collected three weeks after treatment for determination of UIBC. Group means with SD. Kruskal-Wallis test with uncorrected Dunn's test against control group (GN2-Luc). Results are shown in
Example 31
[0684] Reduction of tissue iron levels by GalNAc siRNAs in animal model for hereditary hemochromatosis. HFE.sup.−/− mice were treated with single dose of 1 or 3 mg/kg of GalNAc siRNA conjugate by subcutaneous administration. Control groups were treated with PBS or with non targeting control conjugate GN2-Luc siRNA1 (GN2-Luc). Iron levels in kidney tissue was assessed three weeks after the treatment. Box and Wiskers (Tukey, median values) Kruskal-Wallis test with uncorrected Dunn's test against control group (GN2-Luc). Results are shown in
Example 32
[0685] Reduction of TMPRSS6 mRNA Expression by Different siRNAs in Hep3B Cells.
[0686] 8000 cells per well were plated in 96-well plates. The following day cells were transfected with 20 nM siRNA and 1 μg/ml AtuFECT. Two days after transfection cells were lysed and TMPRSS6 mRNA levels were determined by q-RT-PCR. TMPRSS6 mRNA levels were normalized to expression levels of the house keeping gene ApoB. An siRNAs against Luciferase was used as non targeting control. Average inhibition and standard deviation of triplicate values relative to untreated cells are shown in
TABLE-US-00029 SEQ ID Duplex ID strand ID NO: siRNA sequence TMPRSS6-SR1 hcTMP-SR1-A 133 mCfUmGfAmGfGmAfCmGfCmCfCmUfGmGfGmAfG mU hcTMP-SR1-B 134 fAmCfUmCfCmCfAmGfGmGfCmGfUmCfCmUfCmAf G TMPRSS6-SR2 hcTMP-SR2-A 135 mGfCmUfGmAfGmGfAmCfGmCfCmCfUmGfGmGfA mG hcTMP-SR2-B 136 fCmUfCmCfCmAfGmGfGmCfGmUfCmCfUmCfAmGf C TMPRSS6-SR3 hcTMP-SR3-A 137 mUfGmCfUmGfAmGfGmAfCmGfCmCfCmUfGmGfG mA hcTMP-SR3-B 138 fUmCfCmCfAmGfGmGfCmGfUmCfCmUfCmAfGmCf A TMPRSS6-SR4 hcTMP-SR4-A 139 mGfUmGfCmUfGmAfGmGfAmCfGmCfCmCfUmGfG mG hcTMP-SR4-B 140 fCmCfCmAfGmGfGmCfGmUfCmCfUmCfAmGfCmAf C TMPRSS6-SRS hcTMP-SRS-A 141 mGfGmUfGmCfUmGfAmGfGmAfCmGfCmCfCmUfG mG hcTMP-SRS-B 142 fCmCfAmGfGmGfCmGfUmCfCmUfCmAfGmCfAmCf C TMPRSS6-SR6 hcTMP-SR6-A 143 mGfGmGfUmGfCmUfGmAfGmGfAmCfGmCfCmCfU mG hcTMP-SR6-B 144 fCmAfGmGfGmCfGmUfCmCfUmCfAmGfCmAfCmCf C TMPRSS6-SR8 hcTMP-SR8-A 145 mCfGmGfGmGfUmGfCmUfGmAfGmGfAmCfGmCfC mC hcTMP-SR8-B 146 fGmGfGmCfGmUfCmCfUrnCfAmGfCmAfCmCfCmCf G TMPRSS6-SR9 hcTMP-SR9-A 147 mAfCmGfGmGfGmUfGmCfUmGfAmGfGmAfCmGfC mC hcTMP-SR9-B 148 fGmGfCmGfUmCfCmUfCmAfGmCfAmCfCmCfCmGf U TMPRSS6-SR10 hcTMP-SR10-A 149 mUfAmCfGmGfGmGfUmGfCmUfGmAfGmGfAmCfG mC hcTMP-SR10-B 150 fGmCfGmUfCmCfUmCfAmGfCmAfCmCfCmCfGmUf A TMPRSS6-SR11 hcTMP-SR11-A 151 mGfUmAfCmGfGmGfGmUfGmCfUmGfAmGfGmAfC mG hcTMP-SR11-B 152 fCmGfUmCfCmUfCmAfGmCfAmCfCmCfCmGfUmAf C TMPRSS6-SR12 hcTMP-SR12-A 153 mAfGmUfAmCfGmGfGmGfUmGfCmUfGmAfGmGfA mC hcTMP-SR12-B 154 fGmUfCmCfUmCfAmGfCmAfCmCfCmCfGmUfAmCf U TMPRSS6-SR13 hcTMP-SR13-A 155 mAfAmGfUmAfCmGfGmGfGmUfGmCfUmGfAmGfG mA hcTMP-SR13-B 156 fUmCfCmUfCmAfGmCfAmCfCmCfCmGfUmAfCmUf U TMPRSS6-SR15 hcTMP-SR15-A 157 mGfGmAfAmGfUmAfCmGfGmGfGmUfGmCfUmGfA mG hcTMP-SR15-B 158 fCmUfCmAfGmCfAmCfCmCfCmGfUmAfCmUfUmCf C TMPRSS6-SR16 hcTMP-SR16-A 158 mGfGmGfAmAfGmUfAmCfGmGfGmGfUmGfCmUfG mA hcTMP-SR16-B 160 fUmCfAmGfCmAfCmCfCmCfGmUfAmCf UmUfCmCf C TMPRSS6-SR17 hcTMP-SR17-A 161 mGfGmGfGmAfAmGfUmAfCmGfGmGfGmUfGmCfU mG hcTMP-SR17-B 162 fCmAfGmCfAmCfCmCfCmGfUmAfCmUfUmCfCmCf C TMPRSS6-SR18 hcTMP-SR18-A 163 mUfGmGfGmGfAmAfGmUfAmCfGmGfGmGfUmGfC mU hcTMP-SR18-B 164 fAmGfCmAfCmCfCmCfGmUfAmCfUrnUfCmCfCmCf A TMPRSS6-SR19 hcTMP-SR19-A 165 mCfUmGfGmGfGmAfAmGfUmAfCmGfGmGfGmUfG mC hcTMP-SR19-B 166 fGmCfAmCfCmCfCmGfUmAfCmUfUmCfCmCfCmAf G TMPRSS6-SR21 hcTMP-SR21-A 167 mAfGmCfUmGfGmGfGmAfAmGfUmAfCmGfGmGfG mU hcTMP-SR21-B 168 fAmCfCmCfCmGfUmAfCmUfUmCfCmCfCmAfGmCf U TMPRSS6-SR22 hcTMP-SR22-A 169 mUfAmGfCmUfGmGfGmGfAmAfGmUfAmCfGmGfG mG hcTMP-SR22-B 170 fCmCfCmCfGmUfAmCfUmUfCmCfCmCfAmGfCmUf A TMPRSS6-SR23 hcTMP-SR23-A 171 mGfUmAfGmCfUmGfGmGfGmAfAmGfUmAfCmGfG mG hcTMP-SR23-B 172 fCmCfCmGfUmAfCmUfUmCfCmCfCmAfGmCfUmAf C TMPRSS6-SR24 hcTMP-SR24-A 173 mAfGmUfAmGfCmUfGmGfGmGfAmAfGmUfAmCfG mG hcTMP-SR24-B 174 fCmCfGmUfAmCfUmUfCmCfCmCfAmGfCmUfAmCf U TMPRSS6-SR26 hcTMP-SR26-A 175 mGfUmAfGmUfAmGfCmUfGmGfGmGfAmAfGmUfA mC hcTMP-SR26-B 176 fGmUfAmCfUmUfCmCfCmCfAmGfCmUfAmCfUmAf C TMPRSS6-SR27 hcTMP-SR27-A 177 mAfGmUfAmGfUmAfGmCfUmGfGmGfGmAfAmGfU mA hcTMP-SR27-B 178 fUmAfCmUfUmCfCmCfCmAfGmCfUmAfCmUfAmCf U TMPRSS6-SR28 hcTMP-SR28-A 179 mGfAmGfUmAfGmUfAmGfCmUfGmGfGmGfAmAfG mU hcTMP-SR28-B 180 fAmCfUmUfCmCfCmCfAmGfCmUfAmCfUmAfCmUf C TMPRSS6-SR29 hcTMP-SR29-A 181 mCfGmAfGmUfAmGfUmAfGmCfUmGfGmGfGmAfA mG hcTMP-SR29-B 182 fCmUfUmCfCmCfCmAfGmCfUmAfCmUfAmCfUmCf G TMPRSS6-SR30 hcTMP-SR30-A 183 mGfCmGfAmGfUmAfGmUfAmGfCmUfGmGfGmGfA mA hcTMP-SR30-B 184 fUmUfCmCfCmCfAmGfCmUfAmCfUmAfCmUfCmGf C TMPRSS6-SR31 hcTMP-SR31-A 185 mGfGmCfGmAfGmUfAmGfUmAfGmCfUmGfGmGfG mA hcTMP-SR31-B 186 fUmCfCmCfCmAfGmCfUmAfCmUfAmCfUmCfGmCf C TMPRSS6-SR32 hcTMP-SR32-A 187 mGfGmGfCmGfAmGfUmAfGmUfAmGfCmUfGmGfG mG hcTMP-SR32-B 188 fCmCfCmCfAmGfCmUfAmCfUmAfCmUfCmGfCmCf C TMPRSS6-SR33 hcTMP-SR33-A 189 mGfGmGfGmCfGmAfGmUfAmGfUmAfGmCfUmGfG mG hcTMP-SR33-B 190 fCmCfCmAfGmCfUmAfCmUfAmCfUmCfGmCfCmCf C TMPRSS6-SR34 hcTMP-SR34-A 191 mUfGmGfGmGfCmGfAmGfUmAfGmUfAmGfCmUfG mG hcTMP-SR34-B 192 fCmCfAmGfCmUfAmCfUmAfCmUfCmGfCmCfCmCf A TMPRSS6-SR35 hcTMP-SR35-A 193 mUfUmGfGmGfGmCfGmAfGmUfAmGfUmAfGmCfU mG hcTMP-SR35-B 194 fCmAfGmCfUmAfCmUfAmCfUmCfGmCfCmCfCmAf A TMPRSS6-hc-16 TMPRSS6-hc-16A 195 mUfAmUfUmCfCmAfAmAfGmGfGmCfAmGfCmUfG mA TMPRSS6-hc-16B 196 fUmCfAmGfCmUfGmCfCmCfUmUfUmGfGmAfAmUf A TMPRSS6-hc-17 TMPRSS6-hc-17A 197 mAfUmCfUmUfCmUfGmGfGmCfUmUfUmGfGmCfG mG TMPRSS6-hc-17B 198 fCmCfGmCfCmAfAmAfGmCfCmCfAmGfAmAfGmAf U TMPRSS6-hc-18 TMPRSS6-hc-18A 199 mUfUmUfUmCfUmCfUmUfGmGfAmGfUmCfCmUfC mA TMPRSS6-hc-18B 200 fUmGfAmGfGmAfCmUfCmCfAmAfGmAfGmAfAmAf A TMPRSS6-hc-19 TMPRSS6-hc-19A 201 mGfAmAfUmAfGmAfCmGfGmAfGmCfUmGfGmAfG mU TMPRSS6-hc-19B 202 fAmCfUmCfCmAfGmCfUmCfCmGfUmCfUmAfUmUf C TMPRSS6-hc-21 TMPRSS6-hc-21A 203 mUfAmGfUmAfGmCfUmGfGmGfGmAfAmGfUmAfC mG TMPRSS6-hc-21B 204 fCmGfUmAfCmUfUmCfCmCfCmAfGmCfUmAfCmUf A TMPRSS6-hc-22 TMPRSS6-hc-22A 205 mAfGmAfUmCfCmUfGmGfGmAfGmAfAmGfUmGfG mC TMPRSS6-hc-22B 206 fGmCfCmAfCmUfUmCfUmCfCmCfAmGfGmAfUmCf U TMPRSS6-hc-23 TMPRSS6-hc-23A 207 mCfUmGfUmUfCmUfGmGfAmUfCmGfUmCfCmAfC mU TMPRSS6-hc-23B 208 fAmGfUmGfGmAfCmGfAmUfCmCfAmGfAmAfCmAf G TMPRSS6-hcmr-24 TMPRSS6-hcmr-24A 209 mCfUmCfAmCfCmUfUmGfAmAfGmGfAmCfAmCfC mU TMPRSS6-hcmr-24B 210 fAmGfGmUfGmUfCmCfUmUfCmAfAmGfGmUfGmAf G TMPRSS6-hcm-25 TMPRSS6-hcm-25A 211 mAfGmUfUmUfCmUfCmUfCmAfUmCfCmAfGmGfC mC TMPRSS6-hcm-25B 212 fGmGfCmCfUmGfGmAfUmGfAmGfAmGfAmAfAmCf U TMPRSS6-hcr-26 TMPRSS6-hcr-26A 213 mGfUmAfCmCfCmUfAmGfGmAfAmAfUmAfCmCfAm G TMPRSS6-hcr-26B 214 fCmUfGmGfUmAfUmUfUmCfCmUfAmGfGmGfUmAf C TMPRSS6-hc-27 TMPRSS6-hc-27A 215 mCfUmGfUmUfGmAfCmUfGmUfGmGfAmCfAmGfC mA TMPRSS6-hc-27B 216 fUmGfCmUfGmUfCmCfAmCfAmGfUmCfAmAfCmAf G
[0687] Table 14
[0688] Table 14: Sequences of siRNAs against TMPRSS6 tested in example 32. fU, fA, fC, fG-2′F modified deoxynucleotides. mU, mA, mC, mG-2′O-methyl modified nucleotides.
Example 33
[0689] Dose-Response of siRNAs Against TMPRSS6 in Hep3B Cells.
[0690] 8000 cells per well were plated in 96-well plates. The following day cells were transfected with siRNA in indicated concentrations (100 nM-0.03 nM) and 1 μg/ml AtuFECT. Two days after transfection cells were lysed and TMPRSS6 mRNA levels were determined by q-RT-PCR. TMPRSS6 mRNA levels were normalized to expression levels of the house keeping gene ApoB. Average inhibition and standard deviation of triplicate values relative to cells treated with 100 nM of a non-targeting Luciferase-control siRNA are shown in
TABLE-US-00030 95% kd at confidence 20 nM as Max interval shown in Duplex ID inhibition IC50 [nM] [nM] FIG. 34 sd TMPRSS6-hcrnr-24 73% 0.8 0.1-6.2 70% 2% TMPRSS-hc-17 82% 2.4 1.1-5.0 79% 5% TMPRSS-SR-27 94% 2.8 0.7-10.8 84% 4% TMPRSS-hcr-26 100% 3.5 1.4-9.0 98% 2% TMPRSS-hc-18 95% 4.6 1.5-14.1 90% 1% TMPRSS-hc-23 83% 4.6 1.9-11.1 70% 7% TMPRSS-hcm-25 87% 4.6 2.1-10.2 85% 3% TMPRSS-SR-21 100% 5.8 0.9-36.9 92% 4% TMPRSS-hc-19 100% 6.1 3.0-12.5 89% 2% TMPRSS-hc-16 100% 7.7 2.6-22.6 91% 3% TMPRSS-hc-22 99% 8.1 2.1-31.1 73% 20% TMPRSS-SR-16 100% 8.4 2.5-28.2 88% 2% TMPRSS-SR-5 100% 8.4 2.4-29.0 85% 2%
Table 15
[0691] Table 15: Maximum inhibition, IC50 and 95% confidence interval according to dose response shown in
Example 34
[0692] Inhibition of TMPRSS6 mRNA Expression by Receptor Mediated Uptake in 1° Human Hepatocytes.
[0693] Primary human hepatocytes were plated on collagen coated dishes and incubated with siRNA conjugates diluted in cell culture medium at concentrations of 300 nM to 1 nM as indicated. 24 hours after exposing the cells to siRNA conjugates total RNA was extracted and TMPRSS6 expression was quantified by Taqman qRT-PCR. TMPRSS6 mRNA levels were normalized to Actin mRNA levels and to target mRNA levels of cells treated with non targeting control siRNA conjugate GN2-Luc siRNA 1 (GN2-Luc). Dose dependent inhibition of TMPRSS6 expression was observed by the GalNAc-TMPRSS6 siRNA conjugate. Sequences and modifications of the conjugates are depicted in
Example 35
[0694] GalNAc TMPRSS6 siRNA Raises Hematocrit Values in Rodent Model for ⋅-Thalassemia Intermedia.
[0695] Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6-hcm9 (GN2-TMP), GN2-Luc siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 36 whole blood was collected into heparin coated tubes for full blood examination. Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Blood samples from untreated wild type (WT) mice (C57BL/6) were collected and analysed for comparisons. Scatter dot blot, mean+/−SD; n=3-6. Statistics: unpaired t test with Welch's correction. Results are shown in
Example 36
[0696] GalNAc TMPRSS6 siRNA Reduces Red Blood Cell Distribution Width in Rodent Model for b-Thalassemia Intermedia.
[0697] Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6-hcm9 (GN2-TMP), GN2-Luc siRNA1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 36 whole blood was collected into heparin coated tubes for full blood examination. The Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Blood samples from untreated wild type (WT) mice (C57BL/6) were collected and analysed for comparisons. Scatter dot blot, mean+/−SD: n=3-6. Statistics: unpaired t test with Welch's correction. Results are shown in
Examples 37
[0698] GalNAc TMPRSS6 siRNA Reduces the Proportion of Reticulocytes in Rodent Model for ⋅⋅ Thalassemia Intermedia
[0699] Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6 hcm9 (GN2-TMP), GN2-Luc siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 36 whole blood was collected into heparin coated tubes for full blood examination. The Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Blood samples from untreated wild type (WT) mice (C57BL/6) were collected and analysed for comparisons. Scatter dot blot, mean+/−SD; n=3-6. Statistics: unpaired t test with Welch's correction. Results are shown in
Examples 38
[0700] GalNAc TMPRSS6 siRNA reduces the amount of reactive oxygen species (ROS) in rodent model for ⋅-thalassemia intermedia. Hbb.sup.th3/+ mice (Th3/+; Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6 hcm9 (GN2-TMP) or GN2-Luc 1 siRNA (GN2-Luc) as non targeting control. On d 36 whole blood was collected into heparin coated tubes for full blood examination. ROS measurements were performed 5 min. after addition of 2′7′ dichloro-fluorescein as indicator (Siwaponanan et al, 2017 Blood, 129, 3087-3099). Blood samples from GN2-TMPRSS6 hcm9 treated mice were measured twice. The Hbb.sup.th3/+ mice (Th3/+) were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Blood samples from untreated wild type (WT) mice (C57BL/6) were collected and analysed for comparisons. Scatter dot blot, mean+/−SD; n=4-6. Statistic: unpaired t test with Welch's correction. Results are shown in
Example 39
[0701] GalNAc TMPRSS6 siRNA raises hemoglobin levels in rodent model for ⋅-thalassemia intermedia. Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6-hcm9 (GN2-TMP), GN2-Luc-siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 36 whole blood was collected into heparin coated tubes for full blood examination. Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Blood samples from untreated wild type (wt) mice (C57BL/6) were collected and analysed for comparisons. Scatter dot blot, mean+/−SD; n=5-7. Statistics: Welch's t-tests uncorrected for multiple comparison. Results are shown in
Example 40
[0702] GalNAc TMPRSS6 reduces splenomegaly in rodent model for ⋅-thalassemia intermedia. Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6-hcm9 (GN2-TMP), GN2-Luc-siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 39 spleen weights were assessed. Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Spleen weights from wild type (wt) mice (C57BL/6) treated with PBS were assessed for comparisons. Scatter dot blot, mean+/−SD; n=5-7. Statistics: Welch's t-tests uncorrected for multiple comparison. Results are shown in
Example 41
[0703] GalNAc TMPRSS6 improves red blood cell maturation in the bone marrow. Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6-hcm9 (GN2-TMP), GN2-Luc-siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, on d39 cells were collected from the bone marrow and analyzed by FACS analysis. Viable erythroid cells were separated into distinct populations based on CD71, Ter119 and CD44 staining. Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Erythroid cells from the bone marrow of wild type (wt) mice (C57BL/6) treated with PBS were assessed for comparisons. Bar graph, mean+/−SD; n=5-7. Statistics: Welch's t-tests uncorrected for multiple comparison. Results are shown in
Example 42
[0704] GalNAc TMPRSS6 reduces ineffective erythropoiesis in the spleen. Hbb.sup.th3/+ mice (Yang et al. 1995, PNAS Vol. 92, 11608-11612) were treated on d1 and on d15 subcutaneously with 3 mg/kg GN2-TMPRSS6 hcm9 (GN2-TMP), GN2-Luc siRNA 1 (GN2-Luc) or PBS as non targeting control or as vehicle control, respectively. On d 39 cells were collected from the spleen and analyzed by FACS analysis. Viable erythroid cells were separated into distinct populations based on CD71, Ten 19 and CD44 staining. Hbb.sup.th3/+ mice were obtained from Jackson Laboratory (Bar Harbor, Me.) and maintained on a C57BL/6 background. Erythroid cells from the from wild type (wt) mice (C57BL/6) treated with PBS were assessed for comparisons. Bar graph, mean+/−SD; n=5-7. Statistics: Welch's t-tests uncorrected for multiple comparison. Results are shown in
Example 43
[0705] Reduction of TMPRSS6 Expression in Human Hepatocytes by GalNAc siRNA Conjugates.
[0706] 30,000 cpw human primary hepatocytes were seeded in collagen-coated 96-well plates. Cell were treated with indicated amounts of siRNA conjugates immediately after plating. Cells were lyed 24 hours post treatment and TMPRSS6 mRNA expression analyzed by TaqMan qRT-PCR. Triplicate values of TMPRSS6 normalized to ApoB (housekeeper) and to mean of untreated cells are shown.
[0707] Results are shown in
Example 44
[0708] Serum stability assay of GalNAc-siRNA conjugates with phosphorothioates, phosphorodithioates and phosphodiesters in terminal positions and in the GalNAc moiety. GalNAc was conjugated to the 5′-end of the sense strand and is internally stabilized by four PS (STS12009L4) or not, then phosphodiester linkages are used instead (STS12009V54L50-V57L50). Phosphorodithioate modifications were placed at all terminal positions of the duplex except of the first strand 5′-end (-V54L50), at the 3′-ends only (-V55L50, -V57L50) or at the 3′-end of the second strand only (-V56L50). In certain designs, phosphodiesters were used in terminal positions of the siRNA duplex (-V56L50, -V57L50). 5 μM GalNAc-siRNA conjugates were incubated with 50% FBS for 3 d at 37° C. RNA was extracted and analyzed on 20% TBE polyacrylamide gels. “UT” indicates untreated samples, “FBS” indicates FBS treatment. “Control” indicates a less stabilized GalNAc-siRNA conjugate of different sequence.
[0709] GalNAc conjugates of an siRNA targeting TMPRSS6 containing different end stabilization chemistries (phosphorothioate, phosphorodithioate, phosphodiester) were tested by receptor-mediated uptake in primary mouse hepatocytes. GalNAc was conjugated to the 5′-end of the second strand and is internally stabilized by four PS (STS12009L4) or not, then phosphodiester linkages are used instead (STS12009V54L50-V57L50). Phosphorodithioate modifications were placed at all terminal positions of the duplex except of the first strand 5′-end (-V54L50), at the 3′-ends only (-V55L50, -V57L50) or at the 3′-end of the second strand only (-V56L50). In certain designs, phosphodiesters were used in terminal positions of the siRNA duplex (-V56L50, -V57L50). The experiment was conducted in mouse primary hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well and treated with 125 nM to 0.2 nM GalNAc-siRNA. Cells were lysed after 24 h, total RNA was extracted and TMPRSS6 and PTEN mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0710] Results and relevant sequences are shown in
Example 45
[0711] Reduction of TMPRSS6 expression in primary murine hepatocytes by GalNAc siRNA conjugates with 2′-O-methyl-uridine or 5′-(E)-vinylphosphonate-2′-O-methyl-uridine replacing the 2′-O-methyl-adenin at the 5′ position of the first strand.
[0712] Murine primary hepatocytes were seeded into collagen pre-coated 96 well plates (Thermo Fisher Scientific, #A1142803) at a cell density of 30,000 cells per well and treated with siRNA-conjugates at concentrations ranging from 100 nM to 0.1 nM. 24 h post treatment cells were lysed and RNA extracted with InviTrap® RNA Cell HTS 96 Kit/C24×96 preps (Stratec #7061300400) according to the manufactures protocol. Transcripts levels of TMPRSS6 and housekeeping mRNA (PtenII) were quantified by TaqMan analysis.
[0713] siRNA conjugates:
TABLE-US-00031 first strand / siRNA second duplex strand sequence & modification STS12009L4 TMSS6- mA (ps) TA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG (X0027) hcm9-A fG mU (ps) fG (ps) mA TMSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG hcm9-BL4 fG (ps) mU (ps) fU STS12209V4 TMPRSS6- vinylphosphonate-mU (ps) fA (ps) mC fC mA fG mA fA mG L4 (X0204) hcm209AV4 fA mA fG mC fA mG fG mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG hcm209-BL4 fG (ps) mU (ps) fA STS12209V5 TMPRSS6- vinylphosphonate-mU fA mC fC mA fG mA fA mG fA mA fG L4 (x0205) hcm209- mC fA mG fG mU (ps) fG (ps) mA AV5 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG hcm209-BL4 fG (ps) mU (ps) fA STS12209L4 TMPRSS6- mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG (x0207) hcm209A fG mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG hcm209-BL4 fG (ps) mU (ps) fA STS12209V1 TMPRSS6- mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU L4 (x0208) hcm9-AV1 (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG hcm209-BL4 fG (ps) mU (ps) fA STS18001 STS18001A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(p (X0028) s)fC(ps)mG STS18001B GN2 fCmGfUmAfCmGfCmGfGmAfAmUfAmCfUmUfC (ps) L4 mG (ps) fA Legend: mN 2′-O-methyl ribonucleotide (e.g. mU - 2′-O-methyl Uracil) fN 2′-fluoro ribonucleotide (e.g. fC - 2′-fluoro Cytidin) (ps) phosphorothioate vinylphosphonate vinyl-(E)-phosphonate GN2 strcuture according to FIG. 8B
TABLE-US-00032 Taq Man primer and probes PTEN-2 CACCGCCAAATTTAACTGCAGA PTEN-2 AAGGGTTTGATAAGTTCTAGCTGT PTEN-2 FAM- TGCACAGTATCCTTTTGAAGACCATAACCCA- TAMRA hTMSS6:379U17 CCGCCAAAGCCCAGAAG hTMSS6:475L21 GGTCCCTCCCCAAAGGAATAG hTMSS6:416U28FL FAM- CAGCACCCGCCTGGGAACTTACTACAAC-BHQ1 Legend: FAM - 6-carboxyfluorescein (fluorescent dye) TAMRA - tetramethylrhodamine (quencher) BHQ1 - black hole quencher 1 (quencher)
[0714] In Vitro Dose Response
[0715] Target gene expression in primary murine hepatocytes 24 h following treatment with TMPRSS6-siRNA carrying vinyl-(E)-phosphonate 2′OMe-Uracil at the 5-position of the anti-sense strand and two phosphorothioate linkages between the first three nucleotides (STS12209V4L4), vinyl-(E)-phosphonate 2′OMe-Uracil at the 5-position of the anti-sense strand and phosphodiester bonds between the first three nucleotides (STS12209V5L4), carrying 2′-O-methyl-Uracil and two phosphorothioate linkages between the first three nucleotides at the 5′-position (STS12209L4) or carrying 2′-O-methyl-Uracil and two phosphodiester linkages between the first three nucleotides at the 5′-position (STS12209V1L4) or ) or (STS12009L4) as reference or a non-targeting GalNAc-siRNA (STS18001) at indicated concentrations or left untreated (UT).
[0716] Results are shown in
[0717] Serum Stability
[0718] Serum stability of siRNA conjugates incubated for 4 hours (4 h) or 3 days (3d) or left untreated (0 h) in 50% FCS at 37° C. Following RNA was extracted by phenol/chlorophorm/isoamyl alcohol extraction. Degradation was visualized by TBE-Polyacrylamid-gel-electrophoresis and staining RNA with SybrGold.
[0719] Results are shown in
TABLE-US-00033 SEQ ID NO Name Sequence (5′-3′) 1 TMPRSS6-hc-1A 6181715172727184715 2 TMPRSS6-hc-1B 2647364545462646361 3 TMPRSS6-h-2A 6154645272747282718 4 TMPRSS6-h-2B 3645354745452717261 5 TMPRSS6-h-3A 6281546184546173748 6 TMPRSS6-h-3B 3748461727361726351 7 TMPRSS6-hc-4A 5171846174537271847 8 TMPRSS6-hc-4B 4736454827461736462 9 TMPRSS6-h-5A 6153636462728284627 10 TMPRSS6-h-5B 4517353545171818261 11 TMPRSS6-h-6A 8164536184718173535 12 TMPRSS6-h-6B 2828463647361827163 13 TMPRSS6-h-7A 6451816452645173728 14 TMPRSS6-h-7B 3548462715271636271 15 TMPRSS6-hcmr-8A 5181637352846261637 16 TMPRSS6-hcmr-8B 4816151735284816362 17 TMPRSS6-hcm-9A 6273646282647284546 18 TMPRSS6-hcm-9B 1727354715351718451 19 TMPRSS6-hc-10A 5263627372838184625 20 TMPRSS6-hc-10B 2517363835484518152 21 TMPRSS6-hc-11A 8151717172537284738 22 TMPRSS6-hc-11B 3847354825464646263 23 TMPRSS6-hcm-12A 8361715354847151847 24 TMPRSS6-hcm-12B 4736264737282646183 25 TMPRSS6-hc-13A 5363635482648182618 26 TMPRSS6-hc-13B 3615363715372818182 27 TMPRSS6-hcmr-14A 7272825454538273738 28 TMPRSS6-hcmr-14B 3848453827272535454 29 TMPRSS6-hcmr-15A 5452737164826252736 30 TMPRSS6-hcmr-15B 1845251537164845272 31 TMPRSS6-Luc-siRNA- 5382645251738381638 1A 32 TMPRSS6-Luc-siRNA- 3816383856252715382 1B 33 TMPRSS6-PTEN-A 5a6g5u7u6g7u8u8g5g8 34 TMPRSS6-PTEN-B c7a7c6c6g7u6g6a7u5a 35 hTMPRSS6 (upper) ccgccaaagcccagaag 36 hTMPRSS6 (lower) ggTcccTccccaaaggaaTag 37 hTMPRSS6 (probe) cagcacccgccTgggaacTTacTacaac 38 mTMPRSS6 (upper) cggcaccTaccTTccacTcTT 39 mTMPRSS6 (lower) TcggTggTgggcaTccT 40 mTMPRSS6 (probe) ccgagaTgTTTccagcTccccTgTTcTa 41 h-Aktin (upper) gcaTgggTcagaaggaTTccTaT 42 h-Aktin (lower) TgTagaaggTgTggTgccagaTT 43 h-Aktin (probe) TcgagcacggcaTcgTcaccaa 44 mAktin (upper) gTTTgagaccTTcaacacccca 45 mAktin (lower) gaccagaggcaTacagggaca 46 mAktin (probe) ccaTgTacgTagccaTccaggcTgTg 47 PTEN (upper) caccgccaaaTTTaacTgcaga 48 PTEN (lower) aagggTTTgaTaagTTcTagcTgT 49 PTEN (probe) TgcacagTaTccTTTTgaagaccaTaaccca 50 mHAMP (upper) ccTgTcTccTgcTTcTccTccT 51 mHAMP (lower) aaTgTcTgcccTgcTTTcTTcc 52 mHAMP (probe) TgagcagcaccaccTaTcTccaTcaaca 53 TMPRSS6-hcmr-8B 4816151735284816362 54 TMPRSS6-h-2B 3645354745452717261 55 TMPRSS6-hcm-12B 4736264737282646183 56 TMPRSS6-h-7B 3548462715271636271 57 TMPRSS6-hcm-9B 1727354715351718451 58 TMPRSS6-hc-1B 2647364545462646361 59 TMPRSS6-hc-10B 2517363835484518152 60 TMPRSS6-hc-4B 4736454827461736462 61 TMPRSS6-h-3B 3748461727361726351 62 TMPRSS6-h-5B 4517353545171818261 63 TMPRSS6-hc-11B 3847354825464646263 64 TMPRSS6-hc-13B 3615363715372818182 65 TMPRSS6-hcmr-14B 3848453827272535454 66 TMPRSS6-h-6B 2828463647361827163 67 TMPJH01A 6273646282647284546 66 TMPJH01B 1727354715351718451 69 TMPJH02A 2237242282243284142 70 TMPJH02B 1723314715355754815 71 TMPJH03A 2273262646263246182 72 TMPJH03B 5363718351715354815 73 TMPJH04A 2273282646683248182 74 TMPJH05A 2273242242643244542 75 TMPJH05B 5727354315355754455 76 TMPJH06A 2277646242643244542 77 TMPJH07A 2277686242643244542 78 TMPJH08A 2273242246687244542 79 TMPJH09A 2273242682687244542 80 TMPJH10A 2273242242643284586 81 TMPJH11A 2273242242643288586 82 TMPJH12A 2273242246687284586 83 TMPJH13A 6277646246687284586 84 TMPJH13B 5767354315755758855 85 TMPJH14A 2273282282283284182 86 TMPJH14B 5327318315315318415 87 TMPJH15A 2273282282643284182 88 TMPJH16A 2237242242247244582 89 TMPJH16B 1723314355311358411 90 TMPJH17A 2273282242643284586 91 TMPJH18A 6277682242643288142 92 TMPJH19A 6277682242643288586 93 TMPJH20A 2233282242643284142 94 TMPJH21A 2277282242643284586 95 TMPJH22A 2273282642643284586 96 TMPJH23A 2273282282643284586 97 TMPJH24A 2273282246643284586 98 TMPJH25A 2273282242683284586 99 TMPJH26A 2273282242647284586 100 TMPJH27B 5727754715355754855 101 TMPJH28B 1723314311351714411 102 TMPJH29B 5767354315355754455 103 TMPJH30B 5727754315355754455 104 TMPJH31B 5727358315355754455 105 TMPJH32B 5727354315755754455 106 TMPJH33B 5727354315355758455 107 GN-TTR-hc-A ucuugguuac augaaauccc a 108 GN-TTR-hc-B ugggauuuca uguaaccaag a 109 GN2-Luc-siRNA 1-A 5(ps)3(ps)826452517383816(ps)3(ps)8 110 GN2-Luc-siRNA 1-B GN2-38163838462527153(ps)8(ps)2 111 STS012-A 6(ps)2(ps)736462826472845(ps)4(ps)6 112 STS012-B GN-17273547153517184(ps)5(ps)1 113 STS012-1-A 6(ps)2(ps)736462826472845(ps)4(ps)6 114 STS012-1-B GN-57677547153517588(ps)5(ps)5 115 STS012-2-A 6(ps)2(ps)736462826472845(ps)4(ps)6 116 STS012-2-B GN-57673543157557588(ps)5(ps)5 117 STS012-3-A 6(ps)2(ps)736462826472845(ps)4(ps)6 118 STS012-3-B GN-57A70547153517T8G(ps)5(ps)T 119 STS012-4-A 6(ps)2(ps)776462466872845(ps)8(ps)6 120 STS012-4-B GN-57673543157557588(ps)5(ps)5 121 STS012-5-A 6(ps)2(ps)736462426472845(ps)4(ps)6 122 STS012-5-B GN-17273543153517184(ps)5(ps)1 123 STS012-6-A 6(ps)2(ps)73646242647284546(ps)7(ps)7 124 STS012-6-B GN-17273543153517184(ps)5(ps)1 125 STS012-7-A 6(ps)2(ps)776866866472885(ps)8(ps)6 126 STS012-7-B GN-57677547153517588(ps)5(ps)5 127 STSo12-8-A 6(ps)2(ps)776866866472885(ps)8(ps)6 128 STS012-8-B GN-57673543157557588(ps)5(ps)5 129 STS012-9-A 2(ps)2(ps)772422422472445(ps)4(ps)2 130 STS012-9-B GN-57277547157557544(ps)5(ps)5 131 control siRNA A 5(ps)1(ps)645262735151828(ps)2(ps)7 132 control siRNA B GN-45353626284515271(ps)6(ps)2 133 hcTMP-SR1-A mCfUmGfAmGfGmAfCmGfCmCfCmUfGmGfGmAfGmU 134 hcTMP-SR1-B fAmCfUmCfCmCfAmGfGmGfCmGfUmCfCmUfCmAfG 135 hcTMP-SR2-A mGfCmUfGmAfGmGfAmCfGmCfCmCfUmGfGmGfAmG 136 hcTMP-SR2-B fCmUfCmCfCmAfGmGfGmCfGmUfCmCfUmCfAmGfC 137 hcTMP-SR3-A mUfGmCfUmGfAmGfGmAfCmGfCmCfCmUfGmGfGmA 138 hcTMP-SR3-B fUmCfCmCfAmGfGmGfCmGfUmCfCmUfCmAfGmCfA 139 hcTMP-SR4-A mGfUmGfCmUfGmAfGmGfAmCfGmCfCmCfUmGfGmG 140 hcTMP-SR4-B fCmCfCmAfGmGfGmCfGmUfCmCfUmCfAmGfCmAfC 141 hcTMP-SR5-A mGfGmUfGmCfUmGfAmGfGmAfCmGfCmCfCmUfGmG 142 hcTMP-SR5-B fCmCfAmGfGmGfCmGfUmCfCmUfCmAfGmCfAmCfC 143 hcTMP-SR6-A mGfGmGfUmGfCmUfGmAfGmGfAmCfGmCfCmCfUmG 144 hcIMP-SR6-B fCmAfGmGfGmCfGmUfCmCfUmCfAmGfCmAfCmCfC 145 hcTMP-SR8-A mCfGmGfGmGfUmGfCmUfGmAfGmGfAmCfGmCfCmC 146 hcTMP-SR8-B fGmGfGmCfGmUfCmCfUmCfAmGfCmAfCmCfCmCfG 147 hcTMP-SR9-A mAfCmGfGmGfGmUfGmCfUmGfAmGfGmAfCmGfCmC 148 hcTMP-SR9-B fGmGfCmGfUmCfCmUfCmAfGmCfAmCfCmCfCmGfU 149 hcTMP-SR10-A mUfAmCfGmGfGmGfUmGfCmUfGmAfGmGfAmCfGmC 150 hcTMP-SR10-B fGmCfGmUfCmCfUmCfAmGfCmAfCmCfCmCfGmUfA 151 hcTMP-SR11-A mGfUmAfCmGfGmGfGmUfGmCfUmGfAmGfGmAfCmG 152 hcTMP-SRI1-B fCmGfUmCfCmUfCmAfGmCfAmCfCmCfCmGfUmAfC 153 hcTMP-SR12-A mAfGmUfAmCfGmGfGmGfUmGfCmUfGmAfGmGfAmC 154 hcTMP-SR12-B fGmUfCmCfUmCfAmGfCmAfCmCfCmCfGmUfAmCfU 155 hcTMP-SR13-A mAfAmGfUmAfCmGfGmGfGmUfGmCfUmGfAmGfGmA 156 hcTMP-SR13-B fUmCfCmUfCmAfGmCfAmCfCmCfCmGfUmAfCmUfU 157 hcTMP-SR15-A mGfGmAfAmGfUmAfCmGfGmGfCmUfGmCfUmGfAmG 158 hcTMP-SR15-B fCmUfCmAfGmCfAmCfCmCfCmGfUmAfCmUfUmCfC 159 hcTMP-SR16-A mGfGmGfAmAfGmUfAmCfGmGfGmGfUmGfCmUfGmA 160 hcTMP-SR16-B fUmCfAmGfCmAfCmCfCmCfGmUfAmCfUmUfCmCfC 161 hcTMP-SR17-A mGfGmGfGmAfAmGfUmAfCmGfGmGfGmUfGmCfUmG 162 hcTMP-SR17-B fCmAfGmCfAmCfCmCfCmGfUmAfCmUfUmCfCmCfC 163 hcTMP-SR18-A mUfGmGfGmGfAmAfGmUfAmCfGmGfGmGfUmGfCmU 164 hcTMP-SR18-B fAmGfCmAfCmCfCmCfGmUfAmCfUmUfCmCfCmCfA 165 hcTMP-SR19-A mCfUmGfGmGfGmAfAmGfUmAfCmGfGmGfGmUfGmC 166 hcTMP-SR19-B fGmCfAmCfCmCfCmGfUmAfCmUfUmCfCmCfCmAfG 167 hcTMP-SR21-A mAfGmCfUmGfGmGfGmAfAmGfUmAfCmGfGmGfGmU 168 hcTMP-SR21-B fAmCfCmCfCmGfUmAfCmUfUmCfCmCfCmAfGmCfU 169 hcTMP-SR22-A mUfAmGfCmUfGmGfGmGfAmAfGmUfAmCfGmGfGmG 170 hcTMP-SR22-B fCmCfCmCfGmUfAmCfUmUfCmCfCmCfAmGfCmUfA 171 hcTMP-SR23-A mGfUmAfGmCfUmGfGmGfGmAfAmGfUmAfCmGfGmG 172 hcTMP-SR23-B fCmCfCmGfUmAfCmUfUmCfCmCfCmAfGmCfUmAfC 173 hcTMP-SR24-A mAfGmUfAmGfCmUfGmGfGmGfAmAfGmUfAmCfGmG 174 hcTMP-SR24-B fCmCfGmUfAmCfUmUfCmCfCmCfAmGfCmUfAmCfU 175 hcTMP-SR26-A mGfUmAfGmUfAmGfCmUfGmGfGmGfAmAfGmUfAmC 176 hcTMP-SR26-B fGmUfAmCfUmUfCmCfCmCfAmGfCmUfAmCfUmAfC 177 hcTMP-SR27-A mAfGmUfAmGfUmAfGmCfUmGfGmGfGmAfAmGfUmA 178 hcTMP-SR27-B fUmAfCmUfUmCfCmCfCmAfGmCfUmAfCmUfAmCfU 179 hcTMP-SR28-A mGfAmGfUmAfGmUfAmGfCmUfGmGfGmGfAmAfGmU 180 hcTMP-SR28-B fAmCfUmUfCmCfCmCfAmGfCmUfAmCfUmAfCmUfC 181 hcTMP-SR29-A mCfGmAfGmUfAmGfUmAfGmCfUmGfGmGfGmAfAmG 182 hcTMP-SR29-B fCmUfUmCfCmCfCmAfGmCfUmAfCmUfAmCfUmCfG 183 hcTMP-SR30-A mGfCmGfAmGfUmAfGmUfAmGfCmUfGmGfGmGfAmA 184 hcTMP-SR30-B fUmUfCmCfCmCfAmGfCmUfAmCfUmAfCmUfCmGfC 185 hcTMP-SR31-A mGfGmCfGmAfGmUfAmGfUmAfGmCfUmGfGmGfGmA 186 hcTMP-SR31-B fUmCfCmCfCmAfGmCfUmAfCmUfAmCfUmCfGmCfC 187 hcTMP-SR32-A mGfGmGfCmGfAmGfUmAfGmUfAmGfCmUfGmGfGmG 188 hcTMP-SR32-B fCmCfCmCfAmGfCmUfAmCfUmAfCmUfCmGfCmCfC 189 hcIMP-SR33-A mGfGmGfGmCfGmAfGmUfAmGfUmAfGmCfUmGfGmG 190 hcTMP-SR33-B fCmCfCmAfGmCfUmAfCmUfAmCfUmCfGmCfCmCfC 191 hcTMP-SR34-A mUfGmGfGmGfCmGfAmGfUmAfGmUfAmGfCmUfGmG 192 hcTMP-SR34-B fCmCfAmGfCmUfAmCfUmAfCmUfCmGfCmCfCmCfA 193 hcTMP-SR35-A mUfUmGfGmGfGmCfGmAfGmUfAmGfUmAfGmCfUmG 194 hcTMP-SR35-B fCmAfGmCfUmAfCmUfAmCfUmCfGmCfCmCfCmAfA 195 TMPRSS6-hc-16A mUfAmUfUmCfCmAfAmAfGmGfGmCfAmGfCmUfGmA 196 TMPRSS6-hc-16B fUmCfAmGfCmUfGmCfCmCfUmUfUmGfGmAfAmUfA 197 TMPRSS6-hc-17A mA(ps)fU(ps)mCfUmUfCmUfGmGfGmCfUmUfUmGfGmC(ps)fG(ps)mG 198 TMPRSS6-hc-17B GN3-fCmCfGmCfCmAfAmAfGmCfCmCfAmGfAmAfG(ps)mA(ps)fU 199 TMPRSS6-hc-18A mU(ps)fU(ps)mUfUmCfUmCfUmUfGmGfAmGfUmCfCmU(ps)fC(ps)mA 200 TMPRSS6-hc-18B GN3-fUmGfAmGfGmAfCmUfCmCfAmAfGmAfGmAfA(ps)mA(ps)fA 201 TMPRSS6-hc-19A mGfAmAfUmAfGmAfCmGfGmAfGmCfUmGfGmAfGmU 202 TMPRSS6-hc-19B fAmCfUmCfCmAfGmCfUmCfCmGfUmCfUmAfUmUfC 203 TMPRSS6-hc-21A mUfAmGfUmAfGmCfUmGfGmGfGmAfAmGfUmAfCmG 204 TMPRSS6-hc-21B fCmGfUmAfCmUfUmCfCmCfCmAfGmCfUmAfCmUfA 205 TMPRSS6-hc-22A mAfGmAfUmCfCmUfGmGfGmAfGmAfAmGfUmGfGmC 206 TMPRSS6-hc-22B fGmCfCmAfCmUfUmCfUmCfCmCfAmGfGmAfUmCfU 207 TMPRSS6-hc-23A mC(ps)fU(ps)mGfUmUfCmUfGmGfAmUfCmGfUmCfCmA(ps)fC(ps)mU 208 TMPRSS6-hc-23B GN3-fAmGfUmGfGmAfCmGfAmUfCmCfAmGfAmAfC(ps)mA(ps)fG 209 TMPRSS6-hcmr-24A mCfUmCfAmCfCmUfUmGfAmAfGmGfAmCfAmCfCmU 210 TMPRSS6-hcmr-24B fAmGfGmUfGmUfCmCfUmUfCmAfAmGfGmUfGmAfG 211 TMPRSS6-hcm-25A mA(ps)fG(ps)mUfUmUfCmUfCmUfCmAfUmCfCmAfGmG(ps)fC(ps)mC 212 TMPRSS6-hcm-25B GN3-fGmGfCmCfUmGfGmAfUmGfAmGfAmGfAmAfA(ps)mC(ps)fU 213 TMPRSS6-hcr-26A mG(ps)fU(ps)mAfCmCfCmUfAmGfGmAfAmAfUmAfCmC(ps)fA(ps)mG 214 TMPRSS6-hcr-26B GN3-fCmUfGmGfUmAfUmUfUmCfCmUfAmGfGmGfU(ps)mA(ps)fC 215 TMPRSS6-hc-27A mCfUmGfUmUfGmAfCmUfGmUfGmGfAmCfAmGfCmA 216 TMPRSS6-hc-27B fUmGfCmUfGmUfCmCfAmCfAmGfUmCfAmAfCmAfG 217 STS12009L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 218 STS12009L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 219 STS12009V2L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 220 STS12009V2L4-B GN2-mUmCmAmCfCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU 221 STS12009V8L4-A mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps)mA 222 STS12009V8L4-B GN2-mUmCmAmCfCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU 223 GN2-Luc-A mU(ps)fU(ps)mAfGmUfAmAfAmCfCmUfUmUfUmGfAmG(ps)fA(ps)mC 224 GN2-Luc-B GN2-fGmUfCmUfCmAfAmAfAmGfGmUfUmUfAmCfU(ps)mA(ps)fA 225 TMP01-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 226 TMP01-B fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU 227 TMP66-A mAfAmCfCmAmGfAmAmGmAmAmGmCfAmGmGmUmGmA 228 TMP66-B mUmCmAmCmCmUfGmCfUmUmCmUmUmCmUmGmGmUmU 229 TMP69-A fAfAfCfCfAmGfAfAfGfAmAfGfCfAmGfGfUfGfA 230 TMP69-B fUmCfAfCfCfUfGfCfUfUfCmUfUmCfUfGfGfUfU 231 IMP79-A fAfAmCfCfAmGfAfAfGfAmAfGfCfAmGfGmUmGmA 232 TMP79-B mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU 233 TMP80-A fAfAmCmCfAmGfAfAfGfAmAfGfCfAmGfGmUmGmA 234 TMP80-B mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU 235 TMP81-A fAfAmCfCfAmGfAfAfGfAmAfGmCfAmGfGmUmGmA 236 TMP81-B mUmCfAmCfCmUfGfCfUmUmCmUmUmCmUfGfGmUmU 237 STS12009V27L4-A mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps)mA 238 STS12009V27L4-A GN2-mUmCmAmCmCmUfGfCfUmUmCmUmUmCmUmGmG(ps)mU(ps)mU 239 STS12009V41L4-A mA(ps)fA(ps)mCmCmAmGmAmAmGmAmAfGmCfAmGmGmU(ps)mG(ps)mA 240 STS12009V41L4-A GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 241 TMP95-A mAfAmCmCmAmGmAmAmGmAmAmGmCfAmGmGmUmGmA 242 TMP95-B fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU 243 TMP99-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 244 TMP99-B mUmCmAmCmCmUfGmCfUmUmCmUmUmCmUmGmGmUmU 245 TMP112-A mA[A]mCmCmAmGmAmAmGmAmAmGmCfAmGmGmUmGmA 246 TMP112-B fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU 247 TMP114-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 248 TMP114-B mUmCmAmCmCmU{G}mCfUmUmCmUmUmCmUmGmGmUmU 249 TMP115-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 250 TMP115-B mUmCmAmCmCmUfGmC{U}mUmCmUmUmCmUmGmGmUmU 251 TMP116-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 252 TMP116-B mUmCmAmCmCmU[G]mCfUmUmCmUmUmCmUmGmGmUmU 253 TMP117-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 254 TMP117-B mUmCmAmCmCmUfGmC[U]mUmCmUmUmumUmGmGmUmU 255 TMP70-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 256 TMP70-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 257 TMP82-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivA 258 TMP82-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivA 259 TMP83-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivG 260 TMP83-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivG 261 TMP84-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivA 262 TMP84-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 263 TMP85-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivU 264 TMP85-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 265 TMP86-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivC 266 TMP86-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 267 TMP87-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivG 268 TMP87-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 269 TMP88-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 270 TMP88-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivA 271 TMP89-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 272 TMP89-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivU 273 TMP90-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 274 TMP90-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivC 275 TMP91-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 276 TMP91-B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivG 277 STS12009V10L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivA 278 STS12009V10L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivA 279 STS12009V11L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG 280 STS12009V11L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivG 281 STS12009V29L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mAivA 282 STS12009V29L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fUivA 283 STS12009V30L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmfiAmGfGmU(ps)fG(ps)mAivG 284 STS12009V30L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fUivG 285 STS12009V34L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 286 STS12009V34L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU(ps2)fU 287 STS12009V36L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG(ps2)mA 288 STS12009V36L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 289 STS12009V37L4-A mA(ps2)fAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 290 STS12009V37L4-B GN2-fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 291 STS12009V40L4-A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 292 STS12009V40L4-B GNo-fU(ps2)mCfAmCfCmUfGmCfUmUfCmUfUmCgUmGgGmU(ps2)fU 293 STS12209V4L4-A vinylphosphonate-mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 294 STS12209V4L4-B GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA 295 STS12209V5L4-A vinylphosphonate-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 296 STS12209V5L4-B GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA 297 STS12209L4-A mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 298 STS12209L4-B GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA 299 STS12209V1L4-A mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 300 STS12209V1L4-B GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA 301 STS18001-A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(ps)fC(ps)mG 302 STS18001-B GN2 fCmGfUmAfCmGfCmGfGmAfAmUfAmCfUmUfC (ps) mG (ps) fA 303 PTEN-2-A caccgccaaaTTTaacTgcaga 304 PTEN-2-B aagggTTTgaTaagTTcTagcTgT 305 PTEN-2-C FAM-TgcacagTaTccTTTTgaagaccaTaaccca-TAMRA 306 hTMSS6:379U17 ccgccaaagcccagaag 307 hTMSS6:475L21 ggTcccTccccaaaggaaTag 308 hTMSS6:416U28FL FAM-cagcacccgccTgggaacTTacTacaac-BHQ1 309 STS12009V54L50-A mA (ps) fA (ps) mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ps2) mA 310 STS12009V54L50-B GNo - fU (ps2) mCfAmCfCmUfGmCIUmUfCmUfUmCfUmGfGmU (ps2) fU 311 STS12009V55L50-A mA (ps) fA (ps) mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG (ps2) mA 312 STS12009V55L50-B GNo - fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU (ps2) fU 313 STS12009V56L50-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 314 STS12009V56L50-B GNo - fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU (ps2) fU 315 STS12009V57L50-A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG (ps2) mA 316 STS12009V57L50-B GNo - fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU (ps2) fU 317 TMPRSS6-hc-1A augucuuucacacuggcuu 318 TMPRSS6-hc-1B aagccagugugaaagacau 319 TMPRSS6-h-2A auugaguacacgcagacug 320 TMPRSS6-h-2B cagucugcguguacucaau 321 TMPRSS6-h-3A aaguugauggugaucccgg 322 TMPRSS6-h-3B ccgggaucaccaucaacuu 323 TMPRSS6-hc-4A uucuggaucguccacuggc 324 TMPRSS6-hc-4B gccaguggacgauccagaa 325 TMPRSS6-h-5A auucacagaacagaggaac 326 TMPRSS6-h-5B guuccucuguucugugaau 327 TMPRSS6-h-6A guagucauggcuguccucu 328 TMPRSS6-h-6B agaggacagccaugacuac 329 TMPRSS6-h-7A aguuguaguaaguucccag 330 TMPRSS6-h-7B cugggaacuuacuacaacu 331 TMPRSS6-hcmr-8A uuguacccuaggaaauacc 332 TMPRSS6-hcmr-8B gguauuuccuaggguacaa 333 TMPRSS6-hcm-9A aaccagaagaagcagguga 334 TMPRSS6-hcm-9B ucaccugcuucuucugguu 335 TMPRSS6-hc-10A uaacaacccagcguggaau 336 TMPRSS6-hc-10B auuccacgcuggguuguua 337 TMPRSS6-hc-11A guuucucucauccaggccg 338 TMPRSS6-hc-11B cggccuggaugagagaaac 339 TMPRSS6-hcm-12A gcaucuucugggcuuuggc 340 TMPRSS6-hcm-12B gccaaagcccagaagaugc 341 TMPRSS6-hc-13A ucacacuggaaggugaaug 342 TMPRSS6-hc-13B cauucaccuuccaguguga 343 TMPRSS6-hcmr-14A cacagaugugucgaccccg 344 TMPRSS6-hcmr-14B cggggucgacacaucugug 345 TMPRSS6-hcmr-15A uguacccuaggaaauacca 346 TMPRSS6-hcmr-15B ugguauuuccuaggguaca 347 TMPRSS6-Luc-siRNA- ucgaaguauuccgcguacg 1A 348 TMPRSS6-Luc-siRNA- cguacgcggaauacuucga 1B 349 TMPRSS6-PTEN-A uaaguucuagcuguggugg 350 TMPRSS6-PTEN-B ccaccacagcuagaacuua 351 GN-TTR-hc-A ucuugguuac augaaauccc a 352 GN-TTR-hc-B ugggauuuca uguaaccaag a 353 STS012-6-A aaccagaagaagcaggugacc 354 control siRNA A uuaguaaaccuuuugagac 355 control siRNA B gucucaaaagguuuacuaa 356 hcTMP-SR1-A cugaggacgcccugggagu 357 hcTMP-SR1-B acucccagggcguccucag 358 hcTMP-SR2-A gcugaggacgcccugggag 359 hcTMP-SR2-B cucccagggcguccucagc 360 hcTMP-SR3-A ugcugaggacgcccuggga 361 hcTMP-SR3-B ucccagggcguccucagca 362 hcTMP-SR4-A gugcugaggacgcccuggg 363 hcTMP-SR4-B cccagggcguccucagcac 364 hcTMP-SR5-A ggugcugaggacgcccugg 365 hcTMP-SR5-B ccagggcguccucagcacc 366 hcTMP-SR6-A gggugcugaggacgcccug 367 hcTMP-SR6-B cagggcguccucagcaccc 368 hcTMP-SR8-A cggggugcugaggacgccc 369 hcTMP-SR8-B gggcguccucagcaccccg 370 hcTMP-SR9-A acggggugcugaggacacc 371 hcTMP-SR9-B ggcguccucagcaccccgu 372 hcTMP-SR10-A uacggggugcugaggacgc 373 hcTMP-SR10-B gcguccucagcaccccqua 374 hcTMP-SR11-A guacggggugcugaggacg 375 hcTMP-SR11-B cguccucagcaccccguac 376 hcTMP-SR12-A aguacggggugcugaggac 377 hcTMP-SR12-B guccucagcaccccguacu 378 hcTMP-SR13-A aaguacggggugcugagga 379 hcTMP-SR13-B uccucagcaccccguacuu 380 hcTMP-SR15-A ggaaguacggggugcuaaa 381 hcTMP-SR15-B cucagcaccccguacuucc 382 hcTMP-SR16-A gggaaguacggggugcuga 383 hcTMP-SR16-B ucagcaccccguacuuccc 384 hcTMP-SR17-A ggggaaguacggggugcug 385 hcTMP-SR17-B cagcaccccguacuucccc 386 hcTMP-SR18-A uggggaaguacggggugcu 387 hcTMP-SR18-B agcaccccguacuucccca 388 hcTMP-SR19-A cuggggaaguacggggugc 389 hcTMP-SR19-B gcaccccguacuuccccag 390 hcTMP-SR21-A agcuggggaaguacggggu 391 hcTMP-SR21-B accccguacuuccccagcu 392 hcTMP-SR22-A uagcugagaaaguacgggg 393 hcTMP-SR22-B ccccguacuuccccagcua 394 hcTMP-SR23-A guagcuggggaaguacggg 395 hcTMP-SR23-B cccguacuuccccagcuac 396 hcTMP-SR24-A aguagcuggggaaguacga 397 hcTMP-SR24-B ccguacuuccccagcuacu 398 hcTMP-SR26-A guaguagcuggggaaguac 399 hcTMP-SR26-B guacuuccccagcuacuac 400 hcTMP-SR27-A aguaguagcuggggaagua 401 hcTMP-SR27-B uacuuccccagcuacuacu 402 hcTMP-SR28-A gaguaguagcuggggaagu 403 hcTMP-SR28-B acuuccccagcuacuacuc 404 hcTMP-SR29-A cgaguaguagcuggggaag 405 hcTMP-SR29-B cuuccccagcuacuacucg 406 hcIMP-SR30-A gcgaguaguagcuggggaa 407 hcTMP-SR30-B uuccccagcuacuacucgc 408 hcTMP-SR31-A ggcgaguaguagcugggga 409 hcTMP-SR31-B uccccagcuacuacucgcc 410 hcTMP-SR32-A gggcgaguaguagcugggg 411 hcTMP-SR32-B ccccagcuacuacucgccc 412 hcTMP-SR33-A ggggcgaguaguagcuggg 413 hcTMP-SR33-B cccagcuacuacucgcccc 414 hcTMP-SR34-A uggggcaaguaguaacugg 415 hcTMP-SR34-B ccagcuacuacucgcccca 416 hcTMP-SR35-A uuggggcgaguaguagcug 417 hcTMP-SR35-B cagcuacuacucgccccaa 418 TMPRSS6-hc-16A uauuccaaagggcagcuga 419 TMPRSS6-hc-16B ucagcugcccuuuggaaua 420 TMPRSS6-hc-17A aucuucugggcuuuggcgg 421 TMPRSS6-hc-17B ccgccaaagcccagaagau 422 TMPRSS6-hc-18A uuuucucuuggaguccuca 423 TMPRSS6-hc-18B ugaggacuccaagagaaaa 424 TMPRSS6-hc-19A gaauagacggagcuggagu 425 TMPRSS6-hc-19B acuccagcuccgucuauuc 426 TMPRSS6-hc-21A uaguagcuggggaaguacg 427 TMPRSS6-hc-21B cguacuuccccagcuacua 428 TMPRSS6-hc-22A agauccugggagaaguggc 429 TMPRSS6-hc-22B gccacuucucccaggaucu 430 TMPRSS6-hc-23A cuguucuggaucguccacu 431 TMPRSS6-hc-23B aguggacgauccagaacag 432 TMPRSS6-hcmr-24A cucaccuugaaggacaccu 433 TMPRSS6-hcmr-24B agguguccuucaaggugag 434 TMPRSS6-hcm-25A aguuucucucauccaggcc 435 TMPRSS6-hcm-25B ggccuggaugagagaaacu 436 TMPRSS6-hcr-26A guacccuaggaaauaccag 437 TMPRSS6-hcr-26B cugguauuuccuaggguac 438 TMPRSS6-hc-27A cuguugacuguggacagca 439 TMPRSS6-hc-27B ugcuguccacagucaacag 440 STS12209V4L4-A uaccagaagaagcagguga 441 STS12209V4L4-B ucaccugcuucuucuggua 442 STS18001-A ucgaaguauuccgcguacg 443 STS18001-B cguacgcggaauacuucga 444 PTEN-2-A caccgccaaaTTTaacTgcaga 445 PTEN-2-B aagggTTTgaTaagTTcTagcTgT 446 PTEN-2-C TgcacagTaTccTTTTgaagaccaTaaccca 447 hTMSS6:379U17 ccgccaaagcccagaag 448 hTMSS6:475L21 ggTcccTcccaaaggaaTag 449 hTMSS6:416U28FL cagcacccgccTgggaacTTacTacaac Key 1 = 2′F-dU 2 = 2′F-dA 3 = 2′F-dc 4 = 2′F-dG 5 = 2′OMe-rU 6 = 2′OMe-rA 7 = 2′OMe-rC 8 = 2′OMe-rG T = dT u = rU a = rA c = rC g = rG mA, mU, mC, mG - 2′-OMe RNA fA, fU, fC, fG - 2′-F DNA (ps) - phosphorothioate GN = GaINAc linker GN according to FIG. 8A GN2 = GaINAc structure according to FIG. 8B GN3 = GaINAc linker structure according to FIG. 8C GNo = GN2 with phosphodiesters instead of (ps) [A], [T], [C], [G] - DNA {A, {U}, {C}, {G} - LNA ivA, ivC, ivU, ivG - inverted RNA (3′-3′) (ps2) - phosphorodithioate vinylphosphonate vinyl-(E)-phosphonate FAM - 6-Carboxyfluorescein TAMRA - 5-Carboxytetramethylrhodamine BHQ - Black Hole Quencher 1
[0720] Where specific linkers and or modified linkages are taught within an RNA sequence, such as PS, PS2, GN, GN2, GN3 etc etc, these are optional parts of the sequence, but are a preferred embodiment of that sequence.
[0721] The following abbreviations may be used:
TABLE-US-00034 ivN Inverted nucleotide, either 3′-3′ or 5′-5′ (ps2) Phosphorodithioate vinylphosphonate Vinyl-(E)-phosphonate FAM 6-Carboxyfluorescein TAMRA 5-Carboxytetramethylrhodamine BHQ1 Black Hole Quencher 1 (ps) Phosphorothioate GN