Combination method for treating cancer by targeting immunoglobulin superfamily member 1 (IGSF1) and mesenchymal-epithelial transition factor (MET)

Abstract

The present invention relates to a biomarker for predicting susceptibility to an MET inhibitor, and a use thereof, and more specifically, the present invention provides a method for predicting susceptibility to the MET inhibitor. According to the present invention, the present invention has an excellent effect of predicting susceptibility to the MET inhibitor for stomach cancer or lung cancer, and thus the present invention may be usefully employed for treating stomach cancer or lung cancer.

Claims

1. A method for treating gastric cancer cells or lung cancer cells, wherein said cells have been identified as having expression of the human immunoglobulin superfamily member 1 (IGSF1) gene and wherein said cells have been identified as having hepatocyte growth factor (HGF)-independent MET activation, the method comprising co-administering (a) an agent targeted to IGSF1 for inhibiting the expression of the IGSF1 gene or the expression or activity of its protein; and (b) an agent targeted to MET.

2. The method of claim 1, wherein the agent targeted to MET is a selective small molecule MET kinase inhibitor.

3. The method of claim 1, wherein the agent targeted to IGSF1 comprises at least one selected from the group consisting of small interfering RNA (siRNA) and short hairpin RNA (shRNA).

4. The method of claim 1, wherein the agent targeted to IGSF1 is selected from the group consisting of IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:3, IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:4, and IGSF1 shRNA comprising the nucleotide sequence of SEQ ID NO:6, wherein the agent targeted to MET is selected from the group consisting of MET siRNA comprising the nucleotide sequence of SEQ ID NO:5, and MET shRNA comprising the nucleotide sequence of SEQ ID NO: 7.

5. The method of claim 1, wherein the agent targeted to MET comprises an inhibitor for inhibiting the expression of MET gene or the expression or activity of its protein as an active ingredient.

6. A method for treating gastric cancer cells or lung cancer cells in a patient, the method comprising: obtaining or having obtained a biological sample from the patient; detecting or having detected the presence or absence of expression of at least the human immunoglobulin superfamily member 1 (IGSF1) gene in the biological sample; identifying or having identified whether MET is activated in a hepatocyte growth factor (HGF)-independent manner or -dependent manner in the biological sample; and if the IGSF1 gene is expressed and MET is activated in an HGF-independent manner, then co-administering to said patient a therapeutically effective amount of an agent targeted to IGSF1 and an agent targeted to MET.

7. The method of claim 6, wherein the agent targeted to MET is a selective small molecule MET kinase inhibitor.

8. The method of claim 6, wherein the agent targeted to IGSF1 comprises at least one selected from the group consisting of small interfering RNA (siRNA) and short hairpin RNA (shRNA).

9. The method of claim 6, wherein the agent targeted to IGSF1 is selected from the group consisting of IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:3, IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:4, and IGSF1 shRNA comprising the nucleotide sequence of SEQ ID NO:6, wherein the agent targeted to MET is selected from the group consisting of MET siRNA comprising the nucleotide sequence of SEQ ID NO:5, and MET shRNA comprising the nucleotide sequence of SEQ ID NO: 7.

10. The method of claim 6, wherein the agent targeted to MET comprises an inhibitor for inhibiting the expression of MET gene or the expression or activity of its protein as an active ingredient.

11. A method for treating gastric cancer cells or lung cancer cells in a patient, the method comprising: identifying the patient as having expression of an immunoglobulin superfamily member 1 (IGSF1) gene and having MET activated in an HGF-independent manner, and co-administering to said patient a therapeutically effective amount of an agent targeted to IGSF1 and an agent targeted to MET.

12. The method of claim 11, wherein the agent targeted to MET is a selective small molecule MET kinase inhibitor.

13. The method of claim 11, wherein the agent targeted to IGSF1 comprises at least one selected from the group consisting of small interfering RNA (siRNA) and short hairpin RNA (shRNA).

14. The method of claim 11, wherein the agent targeted to IGSF1 is selected from the group consisting of IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:3, IGSF1 siRNA comprising the nucleotide sequence of SEQ ID NO:4, and IGSF1 shRNA comprising the nucleotide sequence of SEQ ID NO:6, wherein the agent targeted to MET is selected from the group consisting of MET siRNA comprising the nucleotide sequence of SEQ ID NO:5, and MET shRNA comprising the nucleotide sequence of SEQ ID NO: 7.

15. The method of claim 11, wherein the agent targeted to MET comprises an inhibitor for inhibiting the expression of MET gene or the expression or activity of its protein as an active ingredient.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1A shows the identification of a marker for the induction of HGF-independent MET phosphorylation. The left panel is a graph showing the HGF-independent MET phosphorylation induced by overexpressing the MET wild-type DNA in HGF-negative human gastric cancer cell line AGS. The right panel is a blot assay showing the results of silver staining performed to identify the protein binding to MET after immunoprecipitation using p-MET antibody.

(2) FIG. 1B shows the results of the MALDI-TOF analysis for the identification of immunoglobulin superfamily member 1 (IGSF1) as a marker for the induction of HGF-independent MET phosphorylation.

(3) FIG. 2A shows the results of the analysis of correlation between the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the phosphorylation of MET in human gastric cancer cell lines. The left panel shows the results of western blot analysis performed using IGSF1 and pMET antibodies in 8 types of gastric cancer cell lines. The right panel shows that as a result of determining the HGF expression of SNU638 and MKN45, HGF was not detected as compared with the positive control U87MG cell line.

(4) FIG. 2B shows the results of the analysis of correlation between the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the phosphorylation of MET in human lung cancer cell lines. Furthermore, the results of western blot analysis performed using IGSF1 and pMET antibodies in 9 types of lung cancer cell lines are shown. The left panel indicates that the phosphorylation of MET was observed when MET and IGSF1 were co-expressed in human lung cancer cell lines H1944, H2228 and HCC827. The right panel shows that HGF was not detected as compared with the positive control U87MG cell line.

(5) FIG. 2C shows the results of the analysis of binding between IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the MET protein in human gastric cancer cell lines. Furthermore, the results of binding between IGSF1 and MET determined by western blot analysis after overexpressing MET and IGSF1 in gastric cancer cell line AGS, followed by immunoprecipitation using p-MET antibody are shown. The left panel shows that when MET was overexpressed in HGF-negative human gastric cancer cell line AGS, it was found that MET bound to IGSF1. The right panel shows that when the cytosol and membrane of HGF-negative human gastric cancer cell line AGS with overexpressed MET were fractionated, it was found that MET bound to IGSF1 in the cell membrane.

(6) FIG. 2D shows the specific binding positions between IGSF1, a marker for the induction of HGF-independent MET phosphorylation, and MET in human gastric cancer cell lines, as well as the results of the analysis of binding between MET and IGSF1 proteins.

(7) FIG. 2E shows the changes in phosphorylation of MET protein determined by western blot analysis after inhibiting the expression of IGSF1 or MET by siRNA method in human gastric cancer cell line (AGS) and lung cancer cell line (HCC827). To analyze the changes in MET phosphorylation by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human gastric cancer cell line (AGS (top, left panel), MKN45 (bottom panels), SNU638 (bottom panels)) and lung cancer cell line (HCC827 (top, right panel)), the expression of IGSF1 or MET was inhibited by the siRNA method and then the changes in phosphorylation of the MET protein were determined by western blot analysis.

(8) FIG. 2f shows the results of the analysis of the regulatory mechanism depending on the changes in expression of IGSF1 or MET in gastric cancer cell lines.

(9) FIG. 3A shows the results of the inhibition of the growth of cancer cells by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human gastric cancer cell lines.

(10) FIG. 3B shows the results of the inhibition of the growth of cancer cells by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human lung cancer cell lines.

(11) FIG. 4A shows the results of the inhibition of invasion and migration of cancer cells by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human gastric cancer cell lines.

(12) FIG. 4B shows the results of the inhibition of invasion of cancer cells by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human lung cancer cell lines.

(13) FIG. 5A shows the results of the comparative analysis of the efficacy of MET inhibitor depending on the presence or absence of IGSF1 expression in gastric cancer cell lines. Panel i shows the apoptosis induced by treatment of a MET inhibitor (PHA665752) at each concentration in SNU638 cell line, determined by trypan blue exclusion, and panel ii shows the results of the same experiment performed on MKN45 cell line. Panel iii shows the expression of cleaved caspase 3 (C-cas3) in cell lines (SNU638 and MKN45) increased by treatment of a MET inhibitor (PHA665752) at each concentration.

(14) FIG. 5b shows the results of the comparative analysis of the efficacy of MET inhibitor depending on the presence or absence of IGSF1 expression in lung cancer cell line.

(15) FIG. 6A shows the results of the simultaneous inhibition of IGSF1, a marker for induction of HGF-independent MET phosphorylation, and MET using microRNA.

(16) FIG. 6B shows the changes in expression of IGSF1 and MET by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET.

(17) FIG. 6C shows the results of the cell growth assay by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET.

(18) FIG. 6D shows the results of the inhibition of cell invasion and migration by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET.

(19) FIG. 6E shows the recovery of the expression of IGSF1 and MET inhibited by mir-34a and mir-34c using antagomir. Panel i shows the expression of MET and IGSF1, which was inhibited by miR-34a or miR-34c, recovered by transfection of gastric cancer cell line SNU638 with anti-miR-34a or anti-miR-34c, determined at the RNA level. Panel ii shows the results determined at the protein level. Panel iii shows decreased expression of pMET and IGSF1 and recovered expression of proteins, which was inhibited by anti-miR-34a and anti-miR-34c, by transfection of lung cancer cell lines HCC827 and H1944 with miR-34a or miR-34c.

(20) FIG. 6F shows the cell growth recovered by transfection of gastric cancer cell lines SNU638 and MKN45 with anti-miR-34a or anti-miR-34c (panels i and ii). Panel iii shows the results determined by the same experiment performed on lung cancer cell line (HCC827).

(21) FIG. 6G shows the migration of cells recovered by transfection of gastric cancer cell lines SNU638 and MKN45 with anti-miR-34a or anti-miR-34c (panels i and ii). Panel iii shows the invasion of cells was recovered by transfection of gastric cancer cell lines SNU638 and MKN45 with anti-miR-34a or anti-miR-34c. Panel iv shows recovered invasion and migration of cells determined by the same experiment performed on lung cancer cell line (HCC827).

(22) FIG. 7 shows the ratio of the activated expression of IGSF1, a marker for induction of HGF-independent MET phosphorylation, MET and in tissues of gastric cancer patients, as well as the representative patient's samples.

(23) Hereinafter, the following Examples are provided to illustrate the present invention in more detail, and it will be apparent to those skilled in the art to which the present invention pertains that the scope of the present invention is not limited to these Examples and various changes can be made without departing from the give of the preset invention.

(24) Experimental Method and Conditions

(25) Induction of HGF-Independent MET Phosphorylation

(26) HGF-independent human gastric cancer AGS cell lines were transfected with MET wild-type plasmid for 48 hours, and then the cell culture media were collected and analyzed by HGF ELISA assay (R&D Systems, Inc, Minneapolis, Minn., USA). Cell lysates were collected, and the changes in MET and IGSF1 proteins were verified by Western blot analysis.

(27) Immunoprecipitation and MALDI-TOF

(28) To identify the genes involved in HGF-independent MET activation, the MET wild-type plasmid was overexpressed in human gastric cancer cell line AGS for 48 hours, and then cell lysates were collected. 500 μg of human gastric cancer cell lysates were mixed with 1 μg of anti-pMET antibody, and then cultured at 4° C. for 12 hours. Then, 20 μl of Protein-Sepharose beads (Santa Cruz Biotechnology, Santa Cruz, Calif., USA) were added, and the mixture was further reacted for 2 hours. Immunoprecipitates were washed with a buffer (Nondiet P-40 lysis buffer) five times, and 20 μl of 2× SDS sample buffer was added and heated. The immunoprecipitates were subjected to SDS-PAGE and stained with silver staining kit (GE Healthcare Bio-Sciences Corp. NJ, USA). Proteins identified by silver staining were identified through mass spectrometry to identify the proteins involved in HGF-independent MET activation.

(29) Western Blot Analysis

(30) To perform Western blot analysis, proteins isolated from the respective cells were separated by SDS-PAGE and transferred to membranes (PolyScreen membranes; New England Nuclear, Boston, Mass., USA). The proteins were incubated with various antibodies (anti-phospho MET, E-cadherin (Cell signaling Technology, Beverly, Mass., USA), anti-MET, anti-r-tubulin (Santa Cruz Biotechnology, Santa Cruz, Calif., USA), anti-IGSF1 (Abnova, Jhouzih, Taipei, Taiwan)) at 4° C. for 12 hours and then washed with 1× TBS-T buffer three times for 10 minutes. The proteins were incubated with appropriate anti-rabbit-HRP or anti-mouse-HRP secondary antibody at room temperature for 2 hours and washed with 1× TBS-T buffer three times for 10 minutes, and then the expression of the proteins was detected using ECL solution (GE Healthcare Bio-Sciences Corp.).

(31) Invasion Chamber Assay and Cell Migration Assay

(32) HGF-independent human gastric cancer cell lines MKN45 and SNU638 and lung cancer cell line HCC827 were transfected with IGSF1 siRNA or MET siRNA for 48 hours. Plate inserts (BD Biosciences) of 8 mm pore size were placed in a 24-well plate, and each 100 μl of matrigel (BD Biosciences) was seeded on each at a concentration of 200 μg/ml and incubated in a CO.sub.2 incubator for 30 minutes. 2.5×10.sup.4 cells transfected with MET or IGSF1 siRNA were placed in the insert plate in a total volume of 100 μl in serum-free media. 400 μl of growth media (RPMI1640+10% FBS) were seeded on the bottom plate and cultured in a CO.sub.2 incubator for 24 hours. After 24 hours, the insert plate was washed with PBS, and the remaining cells were wiped with a cotton swab and fixed in 10% formalin for 20 minutes. After washing with purified water, the cells were stained with 0.01% crystal violet solution for 20 minutes and washed with warm water, and then the number of migrated cells was counted. In the case of the migration assay, the same procedure as above was carried out without coating the insert plate. The number of cells migrated through the insert plate in the control and the gastric cancer and lung cancer cell lines transfected with MET or IGSF1 siRNA was counted and verified.

(33) Inhibition of Gene Expression

(34) Production of siRNA and shRNA

(35) HGF-independent human gastric cell lines MKN45 and SNU638 and lung cancer cell line HCC827 were transfected with IGSF1 siRNA (SEQ ID NO: 3 IGSF1 #1; 5′-GCAGGUCUUUACCGGUGCU-3′, SEQ ID NO: 4 IGSF1 #2; 5′-GGUGCUGCUACUGGAAGGA-3′), MET siRNA (SEQ ID NO: 5; 5′-AAAGATAAACCTCTCATAATG-3′), IGSF1 shRNA (SEQ ID NO: 6; 5′-CAAAGAUGGAAGUGAAAUA UCUCUAUUUCACUUCCAUCUUUGUU-3′) and/or MET shRNA (SEQ ID NO: 7; 5′-GCCAGCCUGAAUGAUGACAUCUCUGUCAUCAUUCAGGCUGGCUU-3′) for 48 hours, and cell lysates were collected and the changes in MET and IGSF1 proteins were verified by Western blot analysis.

(36) Production of microRNA

(37) Human miRNA-34a (SEQ ID NO: 1; UGGCAGUGUCUUAGCUGGUUGU) or miRNA-34c (SEQ ID NO: 2; AGGCAGUGUAGUUAGCUGAUUGC) was purchased from Thermo Fisher Scientific. 4×10.sup.5 HGF-independent human gastric cancer SNU638 cells were seeded and transfected with 300 nM of miRNA-34a or miRNA-34c, and then the number of cells was counted using trypan blue exclusion method for 0, 1, 2 and 3 days.

(38) Determination of Cell Growth

(39) 4×10.sup.5 HGF-independent human gastric cancer SNU638 cells or 3×10.sup.5 MKN45 cells were transfected with 300 nM of miRNA-34a (SEQ ID NO: 1) or miRNA-34c (SEQ ID NO: 2), and then the number of cells was counted using trypan blue exclusion method for 0, 1, 2 and 3 days.

(40) Production of Antagomir

(41) Antagomirs of human miRNA-34a and miRNA-34c were purchased from Thermo Fisher Scientific. 4×10.sup.5 HGF-independent human gastric cancer SNU638 cells or 3×10.sup.5 MKN45 cells were seeded and transfected with 300 nM of miRNA-34a or miRNA-34c, and then the number of cells was counted using a trypan blue exclusion method for 0, 1, 2 and 3 days.

Example 1

Identification of IGSF1 as a Marker for Induction of HGF-Independent MET Phosphorylation

(42) To identify a marker for the induction of HGF-independent MET phosphorylation, the present inventors induced the HGF-independent MET phosphorylation by overexpressing the MET wild-type DNA in HGF-negative human gastric cancer cell line AGS (FIG. 1A, left graph). We performed immunoprecipitation using p-MET antibody and then silver staining was performed to identify the protein binding to MET (FIG. 1A, right gel image).

(43) Moreover, MALDI-TOF analysis was performed on the product to identify the protein binding to MET.

(44) As a result, as shown in FIG. 1B, immunoglobulin superfamily member 1 (IGSF1) was identified as a marker for the induction of HGF-independent MET phosphorylation.

Example 2

Determination of Correlation Between the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the Phosphorylation of MET

(45) 2-1. Analysis of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the Phosphorylation of MET in Human Gastric Cancer Cell Lines

(46) To determine the correlation between the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the phosphorylation of MET, the present inventors performed Western blot analysis using IGSF1 and pMET (phosphorylated active MET) antibodies in a total of 8 types of gastric cancer cell lines.

(47) As a result, as shown in FIG. 2A (left), when MET and IGSF1 were co-expressed in human gastric cancer cell lines SNU638 and MKN45, the phosphorylation MET was observed.

(48) Moreover, as a result of determining the HGF expression of SNU638 and MKN45, HGF was not detected as compared with the positive control U87MG cell line, as shown in FIG. 2A (right).

(49) Therefore, it could be seen that the phosphorylation of MET was induced only in the case of HGF-negative (independent) and when MET and IGSF1 were co-expressed.

(50) 2-2. Analysis of Correlation Between the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the Phosphorylation of MET in Human Lung Cancer Cell Lines

(51) To analyze the correlation between the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the phosphorylation of MET in human lung cancer cell lines, the present inventors performed Western blot analysis using IGSF1 and pMET (phosphorylated active MET) antibodies in a total of 9 types of lung cancer cell lines.

(52) As a result, as shown in FIG. 2B (left), the phosphorylation of MET was observed when MET and IGSF1 were co-expressed in human lung cancer cell lines H1944, H2228 and HCC827.

(53) Moreover, as a result of determining the HGF expression of H1944, H2228 and HCC827, HGF was not detected as compared with the positive control U87MG cell line, as shown in FIG. 2B (right).

(54) Therefore, it could be seen that the phosphorylation of MET was induced only in the case of HGF-negative (independent) and when MET and IGSF1 were co-expressed.

(55) 2-3. Determination of Binding Between IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the MET Protein in Human Gastric Cancer Cell Lines

(56) To analyze the binding between IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the MET protein in human gastric cancer cell lines, the present inventors overexpressed MET and IGSF1 in human gastric cancer cell line AGS, performed immunoprecipitation using p-MET antibody, and then determined the binding with IGSF1 by Western blot analysis.

(57) As a result, as shown in FIG. 2C (left), when MET was overexpressed in HGF-negative human gastric cancer cell line AGS, it was found that MET bound to IGSF1.

(58) Moreover, as shown in FIG. 2C (right), when the cytosol and membrane of HGF-negative human gastric cancer cell line AGS with overexpressed MET were fractionated, it was found that MET bound to IGSF1 in the cell membrane.

(59) To determine where the two proteins bind to each other, the present inventors produced constructs with deletion of each domain of IGSF1 protein. Moreover, we produced constructs with deletion of extracellular domain and constructs with deletion of helical or cytoplasmic domain. MET WT and IGSF1 deletion constructs were transfected into 293T cells, and the positions where the proteins were bound were determined by immunoprecipitation.

(60) As a result, as shown in FIG. 2D, it was found that the protein did not bind in the 571-1328 deletions (extracellular domain), and thus it was found that the two proteins bound to each other at these positions. Moreover, it was found that WT MET and IGSF1 were bound to each other.

(61) 2-4. Changes in MET Phosphorylation by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation in Human Gastric Cancer Cell Lines and Lung Cancer Cell Line

(62) To analyze the changes in MET phosphorylation by inhibition of the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation in human gastric cancer cell line (AGS, MKN45, SNU638) and lung cancer cell line (HCC827), the present inventors inhibited the expression of IGSF1 or MET by the siRNA method and then determined the changes in phosphorylation of the MET protein by western blot analysis.

(63) As a result, as shown in FIG. 2E, the phosphorylation of MET decreased in an IGSF1 siRNA or shRNA concentration-dependent manner in human gastric cancer cell lines (AGS, MKN45, SNU638) and lung cancer cell line (HCC827). Moreover, the expression of IGSF1 decreased in an MET shRNA concentration-dependent manner.

(64) 2-5. Analysis of the Regulatory Mechanism Depending on Changes in Expression of IGSF1 or MET in Gastric Cancer Cell Lines

(65) The present inventors inhibited the expression of IGSF1 or MET by the shRNA method in human gastric cancer cell lines SNU638 and MKN45 and then determined the changes in expression of each gene by real-time PCR.

(66) As a result, as shown in the upper panel of FIG. 2F, the expression of IGSF1 was decreased by the inhibition of expression of MET in both cell lines, and the expression of MET was decreased by the inhibition of expression of IGSF1. These results indicated that the expression was regulated at the RNA level.

(67) Moreover, as shown in the lower panel of FIG. 2F, it was found that the expression of IGSF1 and MET were not regulated at the protein level in the gastric cancer cell lines. The results were obtained by Western blot analysis after treatment with an MET inhibitor, followed by treatment with the respective inhibitors to determine the regulation of the expression of IGSF1.

(68) (PHA665752: c-MET inhibitor, MG132: proteasome inhibitor, Leupeptin & NH4Cl: lysosomal protease inhibitor)

Example 3

Inhibition of Cell Growth by Inhibition of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation

(69) 3-1. Analysis of the Inhibition of Cell Growth by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation in Human Gastric Cancer Cell Lines

(70) The present inventors inhibited the expression of IGSF1 or MET by the shRNA method in human gastric cancer cell lines SNU638 and MKN45 and then determined the inhibition of cell growth.

(71) As a result, as shown in the upper panel of FIG. 3A, when the number of cells was counted for 3 days, it was found that the cell growth was inhibited by the inhibition of expression of MET or IGSF1.

(72) Moreover, the expression of IGSF1 or MET in human gastric cancer cell lines SNU638 and MKN45 was inhibited, and then the degree of the inhibition of cell growth was determined by colony forming assay.

(73) As a result, as shown in the lower panel of FIG. 3A, it was found that the number of colonies decreased by the inhibition of expression of IGSF1 or MET.

(74) 3-2. Analysis of the Inhibition of Cell Growth by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation in Human Lung Cancer Cell Lines

(75) The present inventors inhibited the expression of IGSF1 or the expression of MET by the shRNA method in human lung cancer cell lines HCC827 and HCC194 and then determined the inhibition of cell growth.

(76) As shown in FIG. 3B, as a result of counting the number of cells at 24 hours and 48 hours, it was found that the cell growth was inhibited in the group with the inhibition of expression of MET or IGSF1.

Example 4

Determination of the Inhibition of Invasion and Migration of Cancer Cells by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation

(77) 4-1. Analysis of the Inhibition of Invasion and Migration of Cancer Cells by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation in Human Gastric Cancer Cell Lines

(78) The present inventors inhibited the expression of IGSF1 by the siRNA method in human gastric cancer cell lines SNU638 and MKN45 and then analyzed the degree of the inhibition of invasion and migration by invasion chamber assay and wound healing assay.

(79) As a result, as shown in FIG. 4A, it was observed that the cells inhibiting the expression of IGSF1 and the cells inhibiting the expression of MET similarly inhibited invasion and migration.

(80) 4-2. Analysis of the Inhibition of Invasion and Migration of Cancer Cells by Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation in Human Lung Cancer Cell Lines

(81) The present inventors inhibited the expression of IGSF1 by the siRNA method in human lung cancer cell lines HCC827 and H1944 and then analyzed the degree of the inhibition of invasion and migration by invasion chamber assay and wound healing assay.

(82) As a result, as shown in FIG. 4B, it was observed that the inhibition of IGSF1 in HCC827 and H1944 decreased the invasion to 80% or less as compared with the control (sc). In the case of the MET inhibition, a similar pattern was observed.

Example 5

Analysis of the Effect of IGSF1 on the Use of an MET Inhibitor in Gastric Cancer and Lung Cancer Cell Lines

(83) 5-1. Comparative Analysis of the Efficacy of MET Inhibitor Depending on the Presence or Absence of IGSF1 Expression in Gastric Cancer Cell Lines

(84) The present inventors found that the inhibition of the expression of IGSF1 in the gastric cancer cell lines SNU638 and MKN45 increased the response to the MET inhibitor. As shown in FIG. 5A, the induction of apoptosis by treatment of an MET inhibitor, PHA665752, at each concentration was determined by trypan blue exclusion, proving that the expression of cleaved caspase 3 increased.

(85) 5-2. Comparative Analysis of the Efficacy of MET Inhibitor Depending on the Presence or Absence of IGSF1 Expression in Lung Cancer Cell Line

(86) The present inventors found that the inhibition of the expression of IGSF1 in lung cancer cell line HCC827 increased apoptosis and increased the response to the MET inhibitor.

Example 6

Simultaneous Inhibition of the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the Expression of c-MET Using MicroRNA

(87) 6-1. Analysis of the Inhibition of IGSF1 and MET by miR-34a and miR-34c that Simultaneously Inhibit the Expression of IGSF1 as a Marker for the Induction of HGF-Independent MET Phosphorylation and the Expression of c-MET

(88) To analyze the degree of the inhibition by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET, the present inventors transfected the human 293 cell line with miR-34a or miR-34c using wild-type IGSF1, wild-type MET, and luciferase plasmids containing the mutated 3′UTR thereof.

(89) As a result, as shown in FIG. 6A, miR-34a and miR-34c exhibited low luciferase activity in wild-type MET. That is, the luciferase activity of IGSF1 and MET by miR-34a and miR-34c was inhibited only in the wild type. It was found that miR-34a and miR-34c bound simultaneously to the 3′UTR region of MET and IGSF1 genes and simultaneously inhibit the expression of both genes.

(90) 6-2. Changes in Expression of IGSF1 and c-MET by miR-34a and miR-34c that Simultaneously Inhibit the Expression of IGSF1 as a Marker for Induction of HGF-Independent MET Phosphorylation and the Expression of c-MET

(91) To analyze the degree of the change in IGSF1 and MET by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET, the present inventors transfected human gastric cancer cell lines MKN45 and SNU638 with miR-34a or miR-34c and then determined the expression of MET and the expression of IGSF1 by real-time PCR.

(92) As a result, as shown in the upper panel of FIG. 6B, it was observed that the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the expression of MET were decreased by miR-34a or miR-34c in cell line SNU638.

(93) Moreover, as shown in the lower panel of FIG. 6B, as a result of analyzing the expression of MET and IGSF1 after transfecting miR-34a or miR-34c into human gastric cancer cell lines MKN45 and SNU638, it was observed that the expression of IGSF1 as a marker for the induction of HGF-independent MET phosphorylation and the expression of c-MET were inhibited by miR-34a or miR-34c.

(94) 6-3. Analysis of Cell Growth by miR-34a and miR-34c that Simultaneously Inhibit the Expression of IGSF1 as a Marker for Induction of HGF-Independent MET Phosphorylation and the Expression of c-MET

(95) To analyze the cell growth by miR-34a and miR-34c that simultaneously inhibit the expression of IGSF1 as a marker for induction of HGF-independent MET phosphorylation and the expression of MET, the present inventors transfected human gastric cancer cell line SNU638 with miR-34a or miR-34c and then determined the growth of cancer cells.

(96) As a result, as shown in the upper panel of FIG. 6C, it was observed that the growth of cancer cells was significantly inhibited by miR-34a or miR-34c as compared with the control group.

(97) Moreover, as shown in the lower panel of FIG. 6C, it was found that the transfection of the human gastric cancer cell line with miR-34a or miR-34c decreased the expression of the relevant signaling pathway.

(98) 6-4. Analysis of the Inhibition of Cell Invasion and Migration by miR-34a and miR-34c that Simultaneously Inhibit the Expression of IGSF1 as a Marker for Induction of HGF-Independent MET Phosphorylation and the Expression of c-MET

(99) As shown in the upper panel of FIG. 6D, the present inventors found that the transfection of gastric cancer cell lines SNU638 and MKN45 with mir-34a or mir-34c inhibited the cell migration.

(100) Moreover, as shown in the middle panel of FIG. 6D, it was found that the transfection of the gastric cancer cell line with mir-34a or mir-34c inhibited the invasion of cells by about 50%.

(101) Furthermore, as shown in the lower panel of FIG. 6D, the transfection of gastric cancer cell line SNU638 with mir-34a or mir-34c inhibited the migration of cells and decreased the expression of MMP9.

(102) 6-5. Recovery of Inhibition of IGSF1 and MET by mir-34a and mir-34c Using Antagomir

(103) As shown in the upper panel of FIG. 6E, the present inventors found that the transfection of gastric cancer cell line SNU638 with anti-mir-34a or anti-mir-34c recovered the expression of MET and IGSF1 that was inhibited by mir-34a or mir-34c at the RNA level (left) and the protein level (right).

(104) Moreover, as shown in the lower panel of FIG. 6E, we found that the transfection of lung cancer cell lines HCC827 and H1944 with mir-34a or mir-34c decreased the expression of pMET and IGSF1 and recovered the expression of proteins that was inhibited by anti-mir-34a and anti-mir-34c.

(105) Meanwhile, as shown in the upper panel of FIG. 6F, the cell growth recovered by anti-mir-34a or anti-mir-34c in gastric cancer cell lines SNU638 and MKN45 was compared with the results of mir-34a and mir-34c.

(106) Further, as shown in the lower panel of FIG. 6F, the recovery of the cell growth was found from the same experiment on the lung cancer cell line.

(107) Meanwhile, as shown in the upper panel of FIG. 6G, it was found that the migration of cells was recovered by anti-mir-34a or anti-mir-34c in the gastric cancer cell line.

(108) In addition, as shown in the middle panel of FIG. 6G, it was found that the invasion of cells was recovered by anti-mir34a or anti-mir-34c in the gastric cancer cell line.

(109) Additionally, as shown in the bottom panel of FIG. 6G, it was found that the invasion and migration of cells were recovered by anti-mir-34a or anti-mir-34c in the lung cancer cell line (HCC827).

(110) Therefore, IGSF1, which induces HGF-independent MET phosphorylation, and MET show the potential as biomarkers for predicting susceptibility to MET inhibitors.

Example 7

Determination of the Activity of MET and the Expression Levels of IGSF1 and HGF in Tissues of Gastric Cancer Patients

(111) In order to determine the activity of MET and the expression levels of IGSF1 and HGF in tissues of gastric cancer patients, TMA slides were purchased from US Biomax and immunochemical staining was performed.

(112) As a result, as shown in the upper panel of FIG. 7, the activity of MET was observed in tissue microarray (TMA) tissues of gastric cancer patients with the expression of IGSF1, and the ratio of HGF not expressed was about 30%.