HBV antigen specific binding molecules and fragments thereof

Abstract

Hepatitis B Virus (HBV) antigen specific binding molecules, in particular T Cell Receptors (TCRs), TCR polypeptides and fragments thereof. The invention is also related to modified cells containing the TCRs, TCR polypeptides or fragments, pharmaceutical composition or kits including the same or methods of making or using the same as is described. In particular, the invention discloses TCRs or a fragments thereof, capable of binding to a peptide of a Hepatitis B Virus (HBV) Env polypeptide presented by an MHC class I molecule comprising an MHC class I σ-chain encoded by an HLA-Cw*08 allele.

Claims

1. A T Cell Receptor (TCR), or a fragment thereof, optionally isolated, comprising: a TCR α-chain variable region comprising a CDR3a having the amino acid sequence: TABLE-US-00027 CDR3a: (SEQ ID NO: 3) AETLDNYGQNFV,  or a variant thereof in which one or two amino acids are replaced with another amino acid; and; a TCR β-chain variable region comprising a CDR3b having the amino acid sequence: TABLE-US-00028 CDR3b: (SEQ ID NO: 6) SAVDRDEPFHSNQPQH  or a variant thereof in which one or two amino acids are replaced with another amino acid.

2. A T Cell Receptor (TCR), or a fragment thereof, optionally isolated, comprising: a TCR α-chain variable region comprising CDRs having the amino acid sequences i) to): TABLE-US-00029 i) CDR1 a: (SEQ ID NO: 1) DXSSTY; ii) CDR2a: (SEQ ID NO: 2) IFSNMDM; iii) CDR3a: (SEQ ID NO: 3) AETLDNYGQNFV; or a variant thereof in which one or two amino acids in one or more of the sequences i) to iii) are replaced with another amino acid; where X=S or I.

3. A T Cell Receptor (TCR), or a fragment thereof, optionally isolated, comprising: a TCR β-chain variable region comprising CDRs having the amino acid sequences iv) to vi): TABLE-US-00030 iv) CDR1b: (SEQ ID NO: 4) DFQATT; v) CDR2b: (SEQ ID NO: 5) SNEGSKA; vi) CDR3b: (SEQ ID NO: 6) SAVDRDEPFHSNQPQH; or a variant thereof in which one or two amino acids in one or more of the sequences iv) to are replaced with another amino acid.

4. The TCR or a fragment according to claim 1, comprising: a TCR α-chain variable region comprising CDRs having the amino acid sequences i) to iii): TABLE-US-00031 i) CDR1 a: (SEQ ID NO: 1) DXSSTY; ii) CDR2a: (SEQ ID NO: 2) IFSNMDM; iii) CDR3a: (SEQ ID NO: 3) AETLDNYGQNFV; and; a TCR β-chain variable region comprising CDRs having the amino acid sequences iv) to vi): TABLE-US-00032 iv) CDR1 b: (SEQ ID NO: 4) DFQATT; v) CDR2b: (SEQ ID NO: 5) SNEGSKA; vi) CDR3b: (SEQ ID NO: 6) SAVDRDEPFHSNQPQH; or a variant thereof in which one or two amino acids in one or more of the sequences i) to vi) are replaced with another amino acid; where X=S or I.

5. An isolated nucleic acid encoding a TCR or fragment according to claim 1.

6. The isolated nucleic acid according to claim 5, wherein the nucleic acid comprises: (a) a nucleic acid sequence encoding a TCR α-chain comprising a variable region and a constant region; (b) a nucleic acid sequence encoding a TCR β-chain comprising a variable region and a constant region; and (c) a nucleic acid sequence encoding a cleavable linker; wherein sequence (c) is located in the isolated nucleic acid between sequences (a) and (b), and wherein sequences (a), (b) and (c) are in the same reading frame.

7. The isolated nucleic acid according to claim 6, wherein sequences (a), (b) and (c) are provided with the 5′ to 3′ orientation: 5′-(b)-(c)-(a)-3′.

8. The isolated nucleic acid according to claim 6, wherein the cleavable linker is a Picornavirus 2A (P2A) linker.

9. The isolated nucleic acid according to claim 6, wherein the constant region of the TCR α-chain and/or the constant region of the TCR β-chain additionally encode at least one non-native cysteine residue for forming a disulphide bond between the TCR α-chain and TCR β-chain.

10. A vector comprising the isolated nucleic acid according to claim 5, wherein the vector is selected from a group consists of plasmids, binary vectors, DNA vectors, mRNA vectors, retrovial vectors, lentiviral vectors, transposon-based vectors, and artificial chromosomes.

11. An isolated polypeptide encoded by the isolated nucleic acid according to claim 5.

12. A cell, optionally isolated, comprising the TCR or fragment according to claim 1.

13. The cell according to claim 12, wherein the cell displays one or more of the following properties: a) expression of IFNγ; h) cytotoxicity to a cell infected with HBV or comprising or expressing an HBV Env peptide or polypeptide; c) proliferation, increased IFN-′ expression, increased IL-2 expression, increased TNFα expression, increased perforin expression, increased granzyme expression and/or increased FAS ligand (FASL) expression in response to contact with a cell infected with HBV or comprising or expressing an HBV Env peptide or polypeptides.

14. An in vitro method of producing a Hepatitis B Virus (HBV) reactive T cell, comprising introducing into a cell the isolated nucleic acid according to claim 5.

15. The method of claim 14, wherein the method additionally comprises culturing the cell under conditions suitable for expression of the isolated nucleic acid or vector by the cell.

16. A cell, optionally isolated, wherein the cell is obtained or obtainable by the method of claim 14.

17. A complex, optionally an in vitro complex, comprising the TCR or fragment according to claim 1, and a Hepatitis B Virus (HBV) Env peptide or polypeptide, optionally further comprising an MHC class I molecule comprising an MHC class I α-chain encoded by an HLA-Cw*08 allele.

18. A pharmaceutical composition comprising a TCR or fragment according to claim 1, and a pharmaceutically acceptable carrier, adjuvant, excipient, or diluent.

19. A method of treating or preventing a disease or disorder in a subject, comprising: (a) isolating at least one T cell from a subject; (b) introducing into the at least one T cell the isolated nucleic acid according to claim 5, thereby modifying the at least one T cell; and (c) administering the modified at least one T cell to the subject.

20. An in vitro method for preparing a modified T cell, the method comprising introducing into a T cell the TCR or fragment according to claim 8.

21. A kit of parts comprising a predetermined quantity of the TCR or fragment according to claim 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:

(2) FIG. 1. Photograph showing results of ELISPOT analysis for IFNγ production by T cells in response to stimulation with HBV peptides.

(3) FIG. 2. Schematic representation of HBV peptides E34, E35 and E36, of HBV genotypes B and C.

(4) FIG. 3. Graphs showing CD8+ and CD107a+ expression by E35-stimulated T cells after expansion in vitro, compared to unstimulated control.

(5) FIG. 4. Graphs showing CD8+, CD107a+ and IFNγ expression by T cells after restimulation, compared to unstimulated control.

(6) FIG. 5. Graphs showing CD107a+ and IFNγ expression by T cells following stimulation with different HBV Env peptides as compared to unstimulated control.

(7) FIG. 6. Tables summarising HBV peptides and T cell responses. (A) Table showing HBV peptide sequences and positions within HBV Env. (B) Table showing the percentage of CD8+ and CD107a+, and CD8+ and IFNγ+ lymphocytes as a percentage of the total number of lymphocytes, following stimulation with the indicated peptides.

(8) FIG. 7. Graphs showing IFNγ production by T cells stimulated with different concentrations of different HBV peptides.

(9) FIG. 8. Table and graphs showing analysis of donor for HLA type.

(10) FIG. 9. Schematic representation of preparation of cDNA from T cells.

(11) FIG. 10. Schematic representation TOPO cloning of SMARTer cDNA for bacterial transformation and sequence anaylsis.

(12) FIG. 11. Amino acid and nucleic acid sequences for the complementarity determining regions of the TCR α and TCR β chains. Nucleic acid sequences determined by sequence analysis and following codon optimisation are shown.

(13) FIG. 12. Schematic representation of TCR α and TCR β chain MP71 retroviral vector constructs.

(14) FIG. 13. Schematic representation of retrovirus preparation and transduction of T cells.

(15) FIG. 14. Graphs showing Vb expression and E34 pentamer binding by CD8+ T cells transduced with TCR α and TCR β constructs as compared to non-transduced controls.

(16) FIG. 15. Graphs showing expression of CD107a and IFNγ by CD8+ T cells transduced with TCR α and TCR β constructs as compared to non-transduced controls, following incubation with peptide-pulsed EBVB cells.

(17) FIG. 16. Schematic representations of Vα-P2A-V/β and Vβ-P2A-Vα constructs.

(18) FIG. 17. Graphs showing Vb expression and E34 pentamer binding by CD8+ T cells transduced with Vα-P2A-Vβ and Vβ-P2A-Vα constructs.

(19) FIG. 18. Graphs showing expression of CD107a and IFNγ by CD8+ T cells transduced with Vα-P2A-Vβ and Vβ-P2A-Vα constructs, following incubation with peptide-pulsed EBVB cells.

EXAMPLES

(20) The inventors describe in the following Examples the identification and characterisation of HBV reactive T cell clone, including analysis of the epitope which the TCR binds, presentation of the HBV peptide by MHC class I, cloning and sequence determination of the TCR, production and optimisation of TCR constructs, generation of T cells engineered to express the TCR, and functional characterisation of T cells expressing the TCR.

Example 1: Screening of In Vitro Expanded Cells

(21) Blood was obtained from healthy donors having resolved acute Hepatitis B infection. PBMCs from donors were isolated by Ficoll-Hypaque density gradient centrifugation (Sigma Chemical Co., St. Louis, Mo.), and re-suspended in AIM-V medium (Gibco-BRL Laboratories, Gaithersburg, Md.) with 2% human AB serum.

(22) A library of short peptides overlapping by 10 amino acid residues and covering the whole HBV proteome sequence was prepared. In particular, the envelope protein was pooled in a 9-by-9 matrix containing nine peptides/pool and polymerase protein formed a 14-by-12 matrix containing 12 or 14 peptides/pool.

(23) PBMCs were aliquoted into plates and expanded in vitro with the synthetic peptides described above for 10 days.

(24) The peptide pools were then used to stimulate and screen for specific T cell clones. PBMCs were incubated for 1 h at 37° C., then washed and co-cultured with another 4-fold of PBMC in AIM-V medium with 2% human AB serum and 20 U/ml of IL-2 (R&D Systems, Abingdon, United Kingdom). HBV-specific T cell responses were analyzed by ELISPOT assay after expansion, as described in Tan et al., J Virol (2014), 88 (2): 1332-1341, and wells with a positive response were identified (FIG. 1).

(25) A T cell clone was identified as having high IFNγ production specific to peptide 35 of HBV Genotype C (herein referred to as E35 Gen C). E35 HBV genotype C peptide has the amino acid sequence FLGPLLVLQA (SEQ ID NO: 19), and E35 HBV genotype B peptide has the amino acid sequence LLGPLLVLQA (SEQ ID NO: 20) (see FIG. 2).

Example 2: Specificity Test to Confirm ELISPOT Response

(26) The identified E35-specific T cells were stimulated with E35 Gen C peptide (i.e. FLGPLLVLQA; E35 Gen C) for 5 hours to confirm specificity by cytotoxic degranulation assay. Cells were re-stimulated with 2 μg/ml of E35 Gen C peptide in the presence of CD107a and Brefeldin A. Expanded cells were labelled with Cy-chrome-conjugated anti-CD8+ and CD107a-PE antibody (BD Pharmingen, San Diego, Calif.) on ice for 15 min. Cells were then washed, fixed and permeabilised by treatment with Cytofix/Cytoperm (BD Biosciences) according to the manufacturer's instruction. Cells were then stained with anti-IFNγ PE (BD Biosciences) for 30 min, washed and re-suspended in PBS before acquired by FACS and analysed using FACs Diva software. FIG. 3 shows CD8+ and CD107a+ expression by E35 GenC-stimulated T cells after in vitro expansion, compared to expression by unstimulated control PBMCs. FIG. 4 shows CD8+ and CD107a+, and IFNγ expression following restimulation with peptide compared to expression by unstimulated control PBMCs. A clear increase in degranulation activity was detected, as demonstrated by increased frequency of CD8+ CD107+ T cell population.

(27) Because infection by HBV genotypes B and C is particularly prevalent in Asia, responses of the T cell clone to stimulation with overlapping peptides having sequences corresponding to genotypes B and C in the region of and flanking peptide E35 were investigated (see FIG. 2).

(28) E34 HBV genotype C peptide has the sequence STTSGFLGPLLVLQA (SEQ ID NO:21). E34 HBV genotype B peptide has the sequence STTSGLLGPLLVLQA (SEQ ID NO: 22). E36 corresponds to HBV genotypes B and C, and has the sequence VLQAGFFLLTRILT (SEQ ID NO: 23).

(29) 2 μg/ml of peptides were added together with CD107a and Brefeldin A. After 5 hours incubation, cells were stained for surface CD8 PE-Cy7-A, CD107a FITC-A and IFN-g PE-A, later acquired by FACS. The results are shown in FIG. 5. The T cell clone shows highest IFNγ production in response to stimulation with HBV genotype C E34 peptide (STTSGFLGPLLVLQ), with a lesser, but still significant, response observed in response to stimulation with HBV genotype C peptide E35 (FLGPLLVLQAGFFLL) and HBV genotype B E34 peptide (LLGPLLVLQAGFFLL).

(30) To further investigate the fine specificity of the epitope recognition, a panel of 9- to 11-mers specific to the overlapping region of E34 and E35 (FIG. 6A) were designed to test the T cell clone after a second round of re-stimulation according to same protocol as described above.

(31) The results are shown in FIG. 6B. The frequency of CD8+ and IFNγ+ cells is highest and similar for HBV Env epitope 171-180 expressed by both HBV genotype B (LLGPLLVLQA) and HBV genotype C (FLGPLLVLQA). This shows the T cell clone's conserved specificity for both genotype B and C.

Example 3: Dose Response for HBV Genotype B and C Peptides

(32) Epstein-Barr Virus-transformed B cells (EBVB cells) were pulsed with various concentration (1 μg/ml-1 μg/ml) of the identified HBV envelope epitopes (both genotypes B and C: F/LLGPLLVLQ) before incubation with short-term expanded T cell lines for 5 hours in the presence of BFA.

(33) The results are shown in FIG. 7. Both genotype B and C peptides elicited similar levels of IFNγ production by CD8+ T cells.

Example 4: Determining HLA Restriction

(34) The subject's HLA type was determined to 4-digit resolution by DNA sequencing. After pulsing a panel of known HLA class I-matched EBVB cells with E35 peptides, short-term expanded T cell lines were added and cultured for 5 hours, then IFNγ and CD107a-expressing CD8+ T cells were quantified by flow cytometry. It was been determined that the expanded T cell clone was restricted by Cw0801 (see FIG. 8; CF0515 and WGP22 are immortalized EBV B cell lines).

Example 5: Clonality and TCR Cloning

(35) Clonality of the HBV Env 171-180 specific, Cw0801 restricted T cell clone was investigated using a panel of T cell receptor Vb monoclonal antibodies. The TCR variable beta chain staining panel IO Test Beta Mark TCR V kit (Beckman Coulter) was used to determine the immunodominant Vβ on CD107a+ cells following peptide stimulation.

(36) The T cell clone was stimulated with 1 μg/ml of peptide for 2 h in the presence of anti-CD107a-APC and washed once before staining for dominant Vb using IOTest® Beta Mark TCR V beta Repertoire Kit (Beckman Coulter, CA). This procedure stained the T cells with all known Vb chain family members. E34-specific T cells were sorted using FACS Aria III (BD Biosciences) by gating on CD107a+Vβ+ cells. The staining gave a positive staining for the particular Vb chain TRBV20.1 indicating that the clone is homogenous.

(37) Total RNA was isolated from the sorted T cell clones using Arcturus PicoPure RNA Isolation Kit (Applied Biosysterms) according to the manufacturer's instructions. Briefly, total cellular extract was added into the purification column and eluted with ethanol. cDNA was synthesised using SMARTER™ RACE cDNA Amplification Kit (FIG. 9). SMARTer II A oligonucleotides and oligo (dT) primer were used together with SMARTScribe Reverse Transcriptase (RT) for mRNA synthesis. SMARTScribe RT adds several non-template residues when it reaches the end of the mRNA template. The non-template tail of the mRNA template acts as an extended priming area for the second strand synthesis. After two rounds of PCR reaction, the blunt PCR products were ligated into pCR™ 4blunt-TOPO vector for bacterial transformation (FIG. 10). Sequence analysis using the immunogenetics V-quest algorithm (http://imgt.cines.fr/IMGT_vquest/share/textes/) revealed the Complementarity Determining Region (CDR) in the Va chain (CDR 1a: gacagctcctccacctac (SEQ ID NO: 7), CDR 2a: attttttcaaatatggacatg (SEQ ID NO: 8), CDR 3a: gcagagaccttggataactatggtcagaattttgtc (SEQ ID NO: 9)) and CDR in Vb chain (CDR 1b: gactttcaggccacaact (SEQ ID NO: 10), CDR 2b: tccaatgagggctccaaggcc (SEQ ID NO: 11), CDR 3b: agtgctgtagacagggatgaacctttccatagcaatcagccccagcat (SEQ ID NO: 12))—see FIG. 11.

(38) A variant clone was also identified encoding a CDR1a having the amino acid sequence DISSTY (SEQ ID NO: 25).

Example 6: Functional Analysis of Retrovirally Transduced T Cells

(39) After determination of TCR α and β chain CDR sequences, the TCR genes were cloned into MP71 retroviral vectors individually to analyse for expression and function.

(40) Briefly, virus packaging cell line (Clontech Laboratories, US) was seeded at 2×10.sup.6 cells/dish together with IMDM, 10% FBS, 25 mM HEPES, Glutamax (Invitrogen) and Plasmocin (Invivogen) 1 day before transfection. On day 0, cells were transiently co-transfected with MP71 retroviral vectors using CaCl.sub.2 method together with amphotropic envelope (FIGS. 12 and 13). Cells were incubated for another day in Aim-V 2% human AB serum before viral supernatants were collected and mixed with 5×10.sup.5 activated T cells for 6 days with 50 ng/ml anti-CD3 (OKT-3, eBioscience, San Diego, Calif.) and 600 U/ml IL-2.

(41) On day 7, the expression efficacy of the transduced TCR was determined by separately staining for Vb and pentamer, and analysis by FACs. Anti-Vbeta antibodies (Beckman Coulter) and PE labelled HLA pentamer (Prolmmune) were used. Cells were stained with with E34 Pentamer for 10 min, at room temperature, and then stained for Vb and CD8 for 30 min, on ice before being acquired by FACs.

(42) The transduced T cells showed increased Vb expression and pentamer binding as compared to mock transduced cells (FIG. 14).

(43) On day 10, activated EBVB cells were used to confirm the functionality of the transduced T cells by degranulation assay.

(44) Briefly, EBVB cell line CF0515 (which encodes the HLA-C allele HLA-Cw*0801) was pulsed with 10 μg/mL of peptide for 1 h at room temperature. Peptide-pulsed cells were then co-cultured with TCR transduced cells or mock transduced cells in the presence of CD107a and BFA, and incubated overnight at 37° C.

(45) HBs171-180 TCR transduced T cells and mock transduced T cells were labelled with CD8 and CD107a antibody, permeabilised by cytofix/cytoperm and stained for anti-IFNγ PE, washed, and analysed by flow cytometry.

(46) The results are shown in FIG. 15. A clear increase in the frequency of CD8+ CD107a+ T cell population and IFNγ secreting CD8 T cells was observed.

Example 7: Codon Optimisation and Vector Construction

(47) The TCR genes were further optimised and constructed into a single cassette. Two amino acids changes were incorporated into the TCR α chain constant region and one in the β chain constant region to increase pairing and expression.

(48) Gene cassettes consisting of Vα-P2A-Vβ and Vβ-P2A-Vα orientations were cloned into MP71 to produce two different P2A-linked single cassette, codon optimized, cysteine-modified gene constructs (Genscript), with the TCR α and β chains in different orientations (see FIG. 16).

(49) Colonies were screened, and the constructs were transduced into primary human T cells to investigate expression and functionality.

(50) Expression efficiency was tested by Vb staining and pentamer staining after transduction, and the results are shown in FIG. 17. Anti-Vbeta antibodies and PE labeled HLA pentamers were used to monitor expression of transduced TCR as above.

(51) When the coding sequence for the β chain was positioned in the expression cassette 5′ to the coding sequence for the α chain, two-fold increase in Vb staining was seen while a remarkable 7-fold increase in pentamer staining, indicating a correctly paired TCR, was observed.

(52) The frequency virus-specific CD8 T cells was determined by analysis of degranulation and IFNγ production, and the results are shown in FIG. 18. Increased expression of the functional TCR translated into more than 4-fold increase in functionality.