Increased production of ginsenosides through yeast cell organelle improvement
11186616 · 2021-11-30
Assignee
Inventors
- Ju Young Lee (Gyeonggi-do, KR)
- In Seung Jang (Busan, KR)
- Seohyun Kim (Busan, KR)
- Sun-Chang Kim (Daejeon, KR)
- Suk Chea Jung (Daejeon, KR)
- Jong Geon Jegal (Ulsan, KR)
Cpc classification
C12P19/56
CHEMISTRY; METALLURGY
International classification
C12P19/56
CHEMISTRY; METALLURGY
Abstract
Provided are a recombinant yeast having improved ability to produce ginsenoside, which is prepared by overexpressing INO2 and INO4 or deleting OPT1 in a yeast having ability to produce ginsenoside, a method of preparing the yeast, and a method of producing ginsenoside by using the yeast.
Claims
1. A method of preparing ginsenoside or a precursor thereof, the method comprising the step of culturing a recombinant yeast for producing ginsenoside or a precursor thereof, wherein an expression level of a INO2 (INOsitol requiring 2) gene is increased, as compared with its intrinsic expression level, wherein the INO2 (INOsitol requiring 2) gene comprises the nucleotide sequence of SEQ ID NO: 1, and wherein the precursor is squalene, 2,3-oxidosqualene or protopanaxadiol.
2. The method of claim 1, wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae (S. cerevisiae), Saccharomyces bayanus (S. bayanus), Saccharomyces boulardii (S. boulardii), Saccharomyces bulderi (S. bulderi), Saccharomyces cariocanus (S. cariocanus), Saccharomyces cariocus (S. cariocus), Saccharomyces chevalieri (S. chevalieri), Saccharomyces dairenensis (S. dairenensis), Saccharomyces ellipsoideus (S. ellipsoideus), Saccharomyces eubayanus (S. eubayanus), Saccharomyces exiguus (S. exiguus), Saccharomyces florentinus (S. florentinus), Saccharomyces kluyveri (S. kluyveri), Saccharomyces martiniae (S. martiniae), Saccharomyces monacensis (S. monacensis), Saccharomyces norbensis (S. norbensis), Saccharomyces paradoxus (S. paradoxus), Saccharomyces pastorianus (S. pastorianus), Saccharomyces spencerorum (S. spencerorum), Saccharomyces turicensis (S. turicensis), Saccharomyces unisporus (S. unisporus), Saccharomyces uvarum (S. uvarum), and Saccharomyces zonatus (S. zonatus).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(5) The present invention will be described in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of various elements disclosed in this application fall within the scope of the present application. Further, the scope of the present application is not limited by the specific description described below.
(6) An aspect to achieve the objects of the present invention provides a recombinant yeast for producing ginsenoside or a precursor thereof, in which an expression level of a transcription factor of a phospholipid biosynthetic gene is changed, as compared with an intrinsic expression level.
(7) The present invention is characterized in that among yeast cell's organelles, endoplasmic reticulum (ER) which functions in protein synthesis, formation of a secondary structure of proteins, and transport of proteins to the intracellular position responsible for each function is improved to increase the space of endoplasmic reticulum or to control a membrane composition and a stress response against unfolded proteins, thereby increasing production of ginsenoside or a precursor thereof.
(8) In the present invention, expressions of genes involved in phospholipid biosynthesis are regulated, and specifically, expression levels of transcription factors regulating expressions of the genes involved in phospholipid biosynthesis are changed, in order to improve the endoplasmic reticulum of the yeast. More specifically, transcription factors of the genes involved in phospholipid biosynthesis may be one or more selected from the group consisting of INO2, INO4, and OPI1.
(9) As used herein, the term “INO2 (INOsitol requiring 2)” and “INO4 (INOsitol requiring 4)” are transcription factors that regulate expressions of 70 or more genes responsible for various functions such as formation of protein structures, including genes involved in phospholipid biosynthesis. Overexpression of the transcription factors increases expressions of the genes involved in phospholipid biosynthesis, thereby increasing the size of endoplasmic reticulum, controlling cell membrane components, and inducing stress responses against unfolded proteins. INO2 and INO4 are transcription factors that function as a complex, but unlike INO4, INO2 was reported to plays a critical role in transcriptional regulation (Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae. Curr Genet. 1997 June; 31(6): 462-8. Schwank S, Hoffmann B, Sch-uller H J.).
(10) Information of INO2 and a gene encoding INO2 may be obtained from database such as GenBank at US NIH, and for example, the INO2 gene may have a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
(11) Further, the INO2 gene may include not only the nucleotide sequence of SEQ ID NO: 1 but also a nucleotide sequence having 80% or more, specifically 90% or more, more specifically 95% or more, and much more specifically 99% or more homology with the above sequence and encoding a transcription factor which shows effects substantially identical or corresponding to those of the transcription factor, without limitation. Further, it is apparent that any nucleotide sequence having a deletion, modification, substitution, or addition of some sequence may be within the scope of the present invention, as long as the nucleotide sequence has the above homology.
(12) Information of INO4 and a gene encoding INO4 may be obtained from database such as GenBank at US NIH, and for example, the INO4 gene may have a nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
(13) Further, the INO4 gene may include not only the nucleotide sequence of SEQ ID NO: 2 but also a nucleotide sequence having 80% or more, specifically 90% or more, more specifically 95% or more, and much more specifically 99% or more homology with the above sequence and encoding a transcription factor which shows effects substantially identical or corresponding to those of the transcription factor, without limitation. Further, it is apparent that any nucleotide sequence having a deletion, modification, substitution, or addition of some sequence may be within the scope of the present invention, as long as the nucleotide sequence has the above homology.
(14) As used herein, the term “OPI1 (OverProducer of Inositol 1)” is a transcription repressor of the transcriptional complex INO2-INO4 in response to phospholipid precursor availability. When precursors become limiting, OPI1 is retained at the endoplasmic reticulum (ER) and INO2-INO4 complex activates INO1 and other genes required for phospholipid biosynthesis, whereas abundant precursor availability results in targeting of OPI1 to the nucleus to repress transcription of these genes. OPI1 binds directly to phosphatidic acid, which is required for ER targeting and may act as a sensing mechanism for precursor availability, as phosphatidic acid becomes rapidly depleted upon phospholipid biosynthesis.
(15) Information of OPI1 and a gene encoding OPI1 may be obtained from database such as GenBank at US NIH, and for example, the OPI1 gene may have a nucleotide sequence of SEQ ID NO: 3, but is not limited thereto.
(16) Further, the OPI1 gene may include not only the nucleotide sequence of SEQ ID NO: 3 but also a nucleotide sequence having 80% or more, specifically 90% or more, more specifically 95% or more, and much more specifically 99% or more homology with the above sequence and encoding a transcription factor which shows effects substantially identical or corresponding to those of the transcription factor, without limitation. Further, it is apparent that any nucleotide sequence having a deletion, modification, substitution, or addition of some sequence may be within the scope of the present invention, as long as the nucleotide sequence has the above homology.
(17) As used herein, the term “homology” refers to identity to a given amino acid sequence or nucleotide sequence and may be expressed as percentage. In the specification, a homologous sequence having activity equal or similar to a given amino acid sequence or nucleotide sequence is expressed as “% homology”. For example, homology may be identified using a standard software program which calculates parameters of score, identity and similarity, specifically, BLAST 2.0, or by comparing sequences in a Southern hybridization experiment under stringent conditions as defined. Defining appropriate hybridization conditions are within the skill of the art and may be determined by a method known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, N.Y., 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
(18) As used herein, the term “intrinsic expression level” refers to an expression level of mRNA or a protein which is expressed in a parent strain at a natural state or before modification of the expression level of the corresponding gene. This is intrinsically the production degree of a given mRNA or protein in a cell such as a microorganism or a tissue under normal situation or prior to regulating expression of a particular gene. The intrinsic expression level may be compared between kinds of strains, types of cells, and tissues, or compared with an expression level induced by some stimulation. Specifically, the intrinsic expression level may be an mRNA expression level or a protein expression level in a microorganism in which expression of the transcription factor of the phospholipid biosynthetic gene is not regulated.
(19) Another aspect of the present invention provides a recombinant yeast having an increased expression level of INO2 or INO4 or increased expression levels of both of them, as compared with their intrinsic expression levels, or having a decreased expression level of OPI1, as compared with its intrinsic expression level.
(20) As used herein, the term “increased expression level, as compared with the intrinsic expression level” means that a gene encoding a corresponding polypeptide is expressed at a higher level than that under a natural state or before modification, and as a result, a large number of the functional corresponding polypeptide are produced.
(21) In the present invention, specifically, the increased expression levels of INO2 and INO4 may be achieved by, but are not limited to:
(22) 1) increasing the copy numbers of the polynucleotides encoding the transcription factors,
(23) 2) modifying expression regulatory sequences to increase the expressions of the polynucleotides,
(24) 3) modifying the polynucleotide sequences on the chromosome to enhance activities of the transcription factors, or
(25) 4) a combination thereof.
(26) 1) The increasing of the copy numbers of the polynucleotides may be achieved, but is not limited to, in a form of being operably linked to a vector or in a form of being integrated into the chromosome of a host cell. Specifically, the copy number of the polynucleotide in the chromosome of the host cell may be achieved by introducing into the host cell the vector which is operably linked to the polynucleotide encoding the enzyme of the present invention and replicates and functions independently of the host cell or by introducing into the host cell the vector which is operably linked to the polynucleotide and is able to integrate the polynucleotide into the chromosome of the host cell.
(27) As used herein, the term “vector” refers to a DNA construct including a nucleotide sequence encoding the desired protein, which is operably linked to an appropriate expression regulatory sequence to express the desired protein in a suitable host cell. The regulatory sequence may include a promoter that may initiate transcription, any operator sequence for regulating the transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After the vector is introduced into the suitable host cell, it may replicate or function independently of the host genome, and may be integrated into the genome itself.
(28) The vector used in the present invention is not particularly limited, as long as it is able to replicate in the host cell, and any vector known in the art may be used. Examples of commonly used vectors may include a natural or recombinant plasmid which may include a replication origin, a promoter, and a terminator. The replication origin may include an autonomous replication sequence (ARS) of yeast. The autonomous replication sequence of yeast may be stabilized by a centromeric sequence (CEN). The promoter may be selected from the group consisting of a CYC promoter, a TEF promoter, a GPD promoter, a PGK promoter, and an ADH promoter. The terminator may be selected from the group consisting of PGK1, CYC1, and GAL1. The vector may further include a selection marker.
(29) As such, the polynucleotide encoding the desired protein in the chromosome may be replaced by a mutated polynucleotide by using a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
(30) As used herein, the term “transformation” means the introduction of a vector including a polynucleotide encoding a target protein into a host cell in such a way that the protein encoded by the polynucleotide is expressed in the host cell. As long as the transformed polynucleotide may be expressed in the host cell, it may be integrated into and placed in the chromosome of the host cell, or it may exist extrachromosomally. Further, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form, as long as it may be introduced into the host cell and expressed therein. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene construct including all elements required for its autonomous expression. Commonly, the expression cassette includes a promoter operably linked to the polynucleotide, transcriptional termination signals, ribosome binding sites, and translation termination signals. The expression cassette may be in the form of a self-replicable expression vector. Also, the polynucleotide as it is may be introduced into the host cell and operably linked to sequences required for expression in the host cell, but is not limited thereto.
(31) As used herein, the term “operably linked” means a functional linkage between a polynucleotide sequence encoding the desired protein of the present invention and a promoter sequence which initiates and mediates transcription of the polynucleotide sequence.
(32) Next, 2) the modifying of the expression regulatory sequences to increase the expressions of the polynucleotides may be achieved, but is not particularly limited to, by inducing a modification on the sequence by deletion, insertion, non-conservative or conservative substitution of nucleotide sequence, or a combination thereof in order to further enhance the activity of expression regulatory sequence, or by replacing the expression regulatory sequence with a nucleotide sequence having stronger activity. The expression regulatory sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence coding for a ribosome-binding site, and a sequence regulating the termination of transcription and translation.
(33) A strong heterologous promoter instead of the original promoter may be linked upstream of the polynucleotide expression unit, and examples of the strong promoter may include a GPD promoter, a TEF promoter, an ADR promoter, CCW12, a GAL promoter. More specifically, a Saccharomyces cerevisiae-derived promoter, PGK1 is operably linked to the polynucleotide encoding the enzyme so that its expression rate may be increased, but is not limited thereto.
(34) Furthermore, 3) the modifying of the polynucleotide sequences on the chromosome may be achieved, but is not particularly limited to, by inducing a modification on the expression regulatory sequence by deletion, insertion, non-conservative or conservative substitution of nucleotide sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence, or by replacing the polynucleotide sequence with a polynucleotide sequence having stronger activity.
(35) In an embodiment of the present invention, a PGK1 promoter substitution vector was prepared in order to replace the promoter of the gene by a PGK1 promoter, which is a strong constitutive promoter, for induction of overexpression of INO2 or INO4, and a substitution cassette prepared by using this vector was transformed into a PPD yeast mutant strain to prepare an INO2 or INO4-overexpressing recombinant yeast (Example 2).
(36) As used herein, the term “decreased expression level, as compared with the intrinsic expression level” means that a gene encoding a corresponding polypeptide is not expressed or is expressed at a lower level than that under a natural state or before modification, or the corresponding polypeptide is not functional even though it is expressed.
(37) The term “decreased expression level, as compared with the intrinsic expression level” also means that the gene encoding the corresponding polypeptide is completely inactivated, or its expression level is weak or remarkably low, as compared with the intrinsic expression level, and therefore, the gene is not substantially expressed. The gene inactivation may be either complete (knock-out) or partial (e.g., the gene is a hypomorphic gene which shows an expression level lower than the intrinsic expression level or a product of a mutant gene showing a partial reduction in activity affected thereby).
(38) Specifically, inactivation of OPI1 in the present invention may be achieved by
(39) 1) deletion of part or all of the polynucleotide encoding the protein,
(40) 2) modification of the expression regulatory sequence to decrease the expression of the polynucleotide,
(41) 3) modification of the polynucleotide sequence on the chromosome to weaken the activity of the protein, or
(42) 4) a combination thereof, but is not particularly limited thereto.
(43) 1) The method of deleting part or all of the polynucleotide encoding the protein may be performed by replacing the polynucleotide encoding the endogenous target protein in the chromosome by a polynucleotide with a partial deletion of a nucleotide sequence or by a marker gene, through a vector for chromosomal gene insertion. The “part” may differ depending on the kind of the polynucleotide, but is specifically 1 bp to 300 bp, more specifically 1 bp to 100 bp, and much more specifically 1 bp to 50 bp.
(44) Next, 2) the method of modifying the expression regulatory sequence to decrease the expression of the polynucleotide may be achieved, but is not particularly limited to, by inducing mutations in the expression regulatory sequence through deletion, insertion, conservative or non-conservative substitution of nucleotide sequence or a combination thereof to further weaken the activity of the expression regulatory sequence, or by replacing the expression regulatory sequence with a nucleotide sequence having weaker activity. The expression regulatory sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence regulating the termination of transcription and translation, but is not limited thereto.
(45) Furthermore, 3) the method of modifying the polynucleotide sequence on the chromosome may be achieved by inducing mutations in the sequence through deletion, insertion, conservative or non-conservative substitution of nucleotide sequence or a combination thereof to further weaken the activity of the protein, or by replacing the polynucleotide sequence with a polynucleotide sequence which is improved to have weaker activity, but is not limited thereto.
(46) In an embodiment of the present invention, a deletion cassette for removing OPI1 was prepared and transformed into a PPD yeast mutant strain to prepare an OPI1-deleted recombinant yeast (Example 3).
(47) According to a specific embodiment, the recombinant yeast was used to compare the production of squalene, 2,3-oxidosqualene, and protopanaxadiol, which are intermediate products in ginsenoside biosynthesis, with that of a control group. As a result, the production was increased in both the INO2- and INO4-overexpressed recombinant yeasts and the OPI1-deleted recombinant yeast, as compared with the control group, and in particular, the greatest production was observed in the INO2-overexpressed recombinant yeast (Example 4, Table 5, Table 6, and
(48) The recombinant yeast of the present invention may increase production of ginsenoside, squalene and 2,3-oxidosqualene.
(49) As used herein, the term “ginsenoside-producing recombinant yeast” refers to a yeast that naturally has the ability to produce ginsenoside or a yeast prepared by providing a parent strain having no ability to produce ginsenoside with the ability to produce ginsenoside.
(50) As used herein, the term “ginsenoside” refers to a dammarane-type saponin derived from ginseng, or a derivative thereof, and has a unique chemical structure that is different from saponin found in other plants. Examples of the ginsenoside may include, but are not particularly limited to, PPD (protopanaxadiol)-type ginsenoside, PPT (protopanaxatriol)-type ginsenoside, etc. For another example, PPD, PPT, Ra3, Rb1, Rb2, Rb3, Rc, Rd, Re, Rg1, Rg2, Rg3, Rh1, Rh2, Rs1, C-O, C-Y, C-Mc1, C-Mc, F1, F2, compound K, gypenoside XVII, gypenoside LXXV, Rs2, PPD, Re, Rg1, Rf, F1, Rg2, PPT and Rh1 may be used alone or in combination. For still another example, PPD, PPT, compound. K, Rb1, Rb2, Rb3, Rc, Rd, Re, F1, F2, Rg1, Rg2, Rg3, Rh1, Rh2 may be used alone or in combination. Specifically, the ginsenoside may be protopanaxadiol-type ginsenoside.
(51) As used herein, the term “ginsenoside precursor-producing recombinant yeast” refers to a yeast that naturally has the ability to produce a ginsenoside precursor or a yeast prepared by providing a parent strain having no ability to produce a ginsenoside precursor with the ability to produce a ginsenoside precursor.
(52) As used herein, the term “ginsenoside precursor” refers to an intermediate product in the ginsenoside biosynthesis. In the ginsenoside biosynthesis, isopentenyl diphosphate and dimethylallyl diphosphate are produced by a mevalonic acid metabolic pathway, and converted to squalene and 2,3-oxidosqualene which is an oxidized form of squalene. Dammarenediol-II is produced by cyclization of 2,3-oxidosqualene, and various ginsenosides are synthesized from dammarenediol-II. The ginsenoside precursor may include all these intermediate products. The ginsenoside precursor may also include other types of saponin produced through these precursors. The ginsenoside precursor may also include β-amyrin or oleanate.
(53) Specifically, the ginsenoside precursor-producing recombinant yeast may produce squalene or 2,3-oxidosqualene.
(54) In a specific embodiment of the present invention, provided is the recombinant yeast, in which the ginsenoside precursor includes squalene and 2,3-oxidosqualene.
(55) As used herein, the term “squalene” refers to a compound belonging to an isoprenoid-type or a terpenoid-type, and is a polyunsaturated lipid having 6 double bonds and has a chemical formula of C.sub.30H.sub.50. Squalene is an intermediate product in the ginsenoside biosynthesis, and produced via a mevalonic acid pathway. Further, squalene has a strong antioxidant action in the body, and used in biosynthesis of steroid hormones, vitamin D, bile acid, and cholesterol which is a component of cell membrane, and also used as an adjuvant for swine flu vaccine, etc.
(56) As used herein, the term “2,3-oxidosqualene” is an intermediate in the synthesis of lanosterol and cycloartenol which are the cell membrane sterol precursors, as well as saponins including ginsenosides. 2,3-oxidosqualene is produced by oxidation of squalene by squalene epoxidase.
(57) The yeast may be a strain belonging to Saccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Schizosaccharomyces, Issatchenkia, Yarrowia, or Hansenula.
(58) The strain belonging to Saccharomyces may be, for example, Saccharomyces cerevisiae (S. cerevisiae), Saccharomyces bayanus (S. bayanus), Saccharomyces boulardii (S. boulardii), Saccharomyces bulderi (S. bulderi), Saccharomyces cariocanus (S. cariocanus), Saccharomyces cariocus (S. cariocus), Saccharomyces chevalieri (S. chevalieri), Saccharomyces dairenensis (S. dairenensis), Saccharomyces ellipsoideus (S. eliipsoideus), Saccharomyces eubayanus (S. eubayanus), Saccharomyces exiguus (S. exiguus), Saccharomyces florentinus (S. florentinus), Saccharomyces kluyveri (S. kluyveri), Saccharomyces martiniae (S. martiniae), Saccharomyces monacensis (S. monacensis), Saccharomyces norbensis (S. norbensis), Saccharomyces paradoxus (S. paradoxus), Saccharomyces pastorianus (S. pastorianus), Saccharomyces spencerorum (S. spencerorum), Saccharomyces turicensis (S. turicensis), Saccharomyces unisporus (S. unisporus), Saccharomyces uvarum (S. uvarum), or Saccharomyces zonatus (S. zonatus).
(59) In a specific embodiment of the present invention, the yeast may be Saccharomyces cerevisiae (S. cerevisiae), but is not limited thereto.
(60) In general, the Saccharomyces cerevisiae is known as one of yeasts used in various fermentation processes, and known to have ability to convert sugars into ethanol.
(61) The ginsenoside-producing yeast may be, but is not particularly limited to, a yeast which is modified to have increased activity of HMG-CoA reductase (tHMG1) which converts HMG-CoA to mevalonic acid and increased activity Panax ginseng-derived squalene epoxidase (PgSE) which converts squalene to 2,3-oxidosqualene, as compared with their intrinsic activities, in order to enhance the mevalonic acid metabolic pathway for increasing the biosynthesis of squalene which is a precursor essential for ginsenoside biosynthesis, and modified to have activity of Panax ginseng-derived dammarenediol-II synthase (PgDDS) which converts 2,3-oxidosqualene to dammarenediol-II, and activities of Panax ginseng-derived cytochrome P450 CYP716A47 (PgPPDS) and Panax ginseng-derived NADPH-cytochrome P450 reductase (PgCPR) which convert dammarenediol-II to protopanaxadiol in order to introduce the ginsenoside biosynthetic pathway.
(62) Still another aspect of the present invention provides the recombinant yeast, in which expression of a gene involved in ginsenoside synthesis is increased, as compared with the intrinsic expression level.
(63) Still another aspect of the present invention provides the recombinant yeast, in which the gene is one or more selected from the group consisting of PgDDS (Panax ginseng, dammarenediol-II synthase), PgPPDS (Panax ginseng cytochrome P450 CYP716A47), PgCPR (P NADPH-cytochrome P450 reductase), tHMG1 (S. cerevisiae HMG-CoA reductase) and PgSE (Panax ginseng, squalene epoxidase).
(64) In an embodiment of the present invention, the enzymes involved in the ginsenoside biosynthetic pathway were introduced by transformation, and the enzymes involved in the mevalonic acid metabolic pathway were transcribed from a GPD1 (TDH3) promoter which is a strong constitutive promoter, and thus their expression levels were increased, as compared with their intrinsic expression levels (Example 1).
(65) In this regard, genes encoding the enzymes may include, but are not particularly limited to, specifically nucleotide sequences having 70% or more, more specifically 80% or more, more specifically 90% or more homology with nucleotide sequences of SEQ ID NOS: 4 to 8, respectively.
(66) Still another aspect of the present invention provides a method of preparing the recombinant yeast having improved ability to produce ginsenoside, the method including the step of changing the expression level of the transcription factor of the phospholipid biosynthetic gene in the ginsenoside-producing yeast strain
(67) In a specific embodiment of the present invention, provided is the method of preparing the recombinant yeast, in which the expression level of the phospholipid biosynthetic gene, INO2 or INO4, or the expression levels of both of them is/are increased, as compared with their intrinsic expression levels, or the expression level of OPI1 is decreased, as compared with its intrinsic expression level.
(68) The ginsenoside-producing yeast strain, the transcription factor of the phospholipid biosynthetic gene, INO2, INO4, OPI1 and the intrinsic expression level are the same as described above.
(69) In another specific embodiment of the present invention, the ginsenoside-producing yeast strain may have increased expression levels of one or more genes selected from the group consisting of PgDDS (Panax ginseng, dammarenediol-II synthase), PgPPDS (Panax ginseng cytochrome P45G CYP716A47), PgCFR (P NADPH-cytochrome P450 reductase), tHMG1 (S. cerevisiae HMG-CoA reductase) and PgSE (Panax ginseng, squalene epoxidase), as compared with their intrinsic expression levels.
(70) Still another aspect of the present invention provides a method of preparing the recombinant yeast having improved ability to produce the ginsenoside precursor, the method including the step of changing the expression level of the transcription factor of the phospholipid biosynthetic gene in the ginsenoside precursor-producing yeast strain
(71) In a specific embodiment of the present invention, provided is the method of preparing the recombinant yeast, in which the ginsenoside precursor includes squalene and 2,3-oxidosqualene.
(72) In another specific embodiment of the present invention, provided is the method of preparing the recombinant yeast, in which the expression level of the phospholipid biosynthetic gene, INO2 or INO4, or the expression levels of both of them is/are increased, as compared with their intrinsic expression levels, or the expression level of OPI1 is decreased, as compared with its intrinsic expression level.
(73) The transcription factor of the phospholipid biosynthetic gene, INO2, INO4, OPI1, and intrinsic expression level are the same as described above.
(74) Still another aspect of the present invention provides a method of producing ginsenoside or a precursor thereof, the method including the step of culturing the recombinant yeast.
(75) In the method, the step of culturing the yeast may be performed by, but is not particularly limited to, a known batch, continuous, or fed-batch culturing method. With regard to culture conditions, basic compounds (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or acidic compounds (e.g. phosphoric acid or sulfuric acid) may be used to adjust pH at an appropriate level (e.g., pH 5 to pH 9, specifically pH 6 to pH 8, most specifically pH 6.8), and aerobic conditions may be maintained by introducing oxygen or oxygen-containing gas mixtures into the culture, but are not limited thereto. The culture temperature may be maintained at 20° C. to 45° C., specifically at 25° C. to 40° C. Culturing may be performed for about 10 hours to 160 hours. The ginsenoside produced by the above culture may be secreted into the medium or may remain in the cells.
(76) Furthermore, sugar sources that may be used in the culture medium may include sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid). These substances may be used individually or in a mixture, but are not limited thereto. Nitrogen sources may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal, and urea) or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate). These nitrogen sources may also be used individually or in a mixture, but are not limited thereto. Phosphorus sources which may be used include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or the corresponding sodium salts. These nitrogen sources may also be used individually or in a mixture, but are not limited thereto. The culture medium may include essential growth stimulators, such as metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and vitamins.
(77) The method may further include the step of recovering the produced ginsenoside. This recovering process may be a step of recovering cultured cells or a supernatant thereof, and a process suitable for the recovery may be selected by those skilled in the art.
(78) The method of recovering the ginsenoside produced in the culturing step of the present invention may be performed by an appropriate method known in the art, for example, in a batch, continuous, or fed-batch manner, to collect the desired product from the culture.
(79) Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present invention is not intended to be limited by these Examples and Experimental Examples.
Example 1: Preparation of PPD Mutant Yeast Strain
(80) To prepare a yeast cell of the present invention, Saccharomyces cerevisiae (S. cerevisiae) CEN.PK2-1D wild-type strain [(MATα ura 3-52; trp1-289; leu2-3, 112; his3Δ1; MAL2-8; SUC2), EUROSCARF accession number: 30000B] was introduced with a ginsenoside biosynthetic pathway and enhanced a mevalonic acid metabolic pathway to enhance biosynthesis of squalene which is an essential precursor in ginsenoside biosynthesis to prepare protopanaxadiol (PPD) producing yeast strain. This yeast strain was designated as a PPD mutant yeast strain.
(81) Genotype of the PPD strain was S. cerevisiae CEN.PK2-1D Δtrp1::P.sub.GPD1 tHMG1+P.sub.GPD1 PgSE Δleu2::P.sub.GPD1 PgDDS+P.sub.GPD1 PgPPDS+P.sub.GPD1 PgCPR. Respective genes encoding PgDDS (Panax ginseng, dammarenediol-II synthase, SEQ ID NO: 4), PgPPDS (Panax ginseng cytochrome P450 CYP716A47, SEQ ID NO: 5) and PgCPR (Panax ginseng NADPH-cytochrome P450 reductase, SEQ ID NO: 6) which are ginsenoside biosynthetic enzymes and tHMG1 (S. cerevisiae HMG-CoA reductase, SEQ ID NO: 7) and PgSE (Panax ginseng, squalene epoxidase, SEQ ID NO: 8) which are enzymes in a metabolic pathway for enhancing the mevalonic acid metabolic pathway were transcribed and expressed from GPD1 (TDH3) promoter which is a strong constitutive promoter.
Example 2: Preparation of INO2 or INO4-Overexpressing Mutant Yeast Strain
(82) In order to examine whether overexpression of INO2 or INO4, which is involved in phospholipid biosynthesis to increase the size of endoplasmic reticulum, to control cell membrane components, and to induce a stress response against unfolded proteins, in the PPD mutant yeast strain, is involved in growth and PFD producing ability of the mutant yeast strain, mutant yeast strains overexpressing the genes were prepared. First, in order to induce overexpression of INO2 or INO4, a PGK1 promoter substitution vector was prepared for substitution of the promoter of the gene with a strong constitutive PGK1 promoter, and a substitution cassette prepared by using the vector was transformed into the PPD mutant yeast strain to prepare an INO2 or INO4-overexpressing mutant; yeast strain.
(83) In detail, to prepare the PGK1 promoter substitution vector, the strong constitutive PGK1 promoter region sequence from genomic DNA of S. cerevisiae CEN.PK2-1D were made to have restriction enzyme recognition sites SacI and XbaI at the 5′- and 3′-ends by PCR (Polymerase Chain Reaction) using a primer combination of PGK1 pro F and PGK1 pro R (Table 1). After amplification, the PCR product was subjected to electrophoresis to obtain a desired fragment. In this regard, PCR was repeated for 25 cycles of denaturation at 95° C. for 30 seconds, annealing at 56° C. for 30 seconds, and elongation at 72° C. for 30 seconds. The amplified fragment was treated with SacI and XbaI, and ligated with a pUC57-URA3HA vector (Ju Young Lee, Chang Duk Kang, Seung Hyun Lee, Young Kyoung Park and Kwang Myung Cho (2015) Engineering cellular redox balance in Saccharomyces cerevisiae for improved production of L-lactic acid. Biotechnol. Bioeng., 112, 751-756) treated with the same restriction enzymes, thereby preparing a pUC57-URA3HA-PGK1 vector (
(84) TABLE-US-00001 TABLE 1 Primer sequences and restriction enzymes for preparation of pUC57-URA3HA-PGK1 vector SEQ Restriction Primer Primer sequence ID NO: enzyme PGK pro F 5′-CGAGCTCAGACGCGAATTTTTCGAAGAAG-3′ 9 SacI PGK pro R 5′-GACTAGTTCTAGATGTTTTATATTTGTTGTAAA 10 xba I AAGTAGATAATTACTTCC-3′
(85) PCR was performed by using the prepared pUC57-URA3HA-PGK1 vector as a template and a primer combination of P_INO2 F and P_INO2 R which are homologous recombination sequences of the INO2 promoter region to prepare a cassette for replacing the INO2 promoter by the PGK1 promoter. In the same manner, PCR was performed by using a primer combination of P_INO4 F and P_INO4 R which are homologous recombination sequences of the INO4 promoter region to prepare a cassette for replacing the INO4 promoter by the PGK1 promoter. In this regard, PCR was repeated for 25 cycles of denaturation at 95° C. for 30 seconds, annealing at 56° C. for 30 seconds, and elongation at 72° C. for 2 minutes.
(86) The prepared cassette for INO2 promoter or INO4 promoter substitution was introduced into the PPD mutant yeast strain, respectively. The introduction was performed by a general heat shock transformation method, and after transformation, the cells were cultured in a uracil dropout medium (6.7 g of Yeast Nitrogen Base without amino acids, 0.77 g of CSM minus uracil, 20 g of Glucose per 1 L) to substitute the INO2 promoter or INO4 promoter on the genome with PGK1 promoter by the cassette.
(87) To confirm substitution of the PGK1 promoter in the obtained mutant yeast strain, PCR was performed by using the genome of the cells as a template and a primer combination of INO2 to PGK1 F and INO2 to PGK1 R. As a result, substitution of the PGK1 promoter for the INO2 promoter was confirmed. Further, PCR was performed by using a primer combination of INO4 to PGK1 F and INO4 to PGK1 R. As a result, substitution of the PGK1 promoter for the INO4 promoter was confirmed. Finally, PPD-INO2 (P.sub.INO2::P.sub.PGK1) and PPD-INO4 ((P.sub.INO4::P.sub.PGK1) mutant yeast strains were prepared.
(88) TABLE-US-00002 TABLE 2 Primer sequences for preparation of PGK1 promoter substitution cassette and substitution confirmation Primer Primer sequence SEQ ID NO: P_INO2 F 5′-CATTTAGCAGCGCCAGCGCCCTTCTAAGCTCTTCCATACCTATACGCATGA 11 GGTTTCCCGACTGGAAAGC-3′ P_INO2 R 5′-TTATCCAGATCTAGGATACCCAGTAATTCGTTCCCAGTTGCTTGTTGCATT 12 GTTTTATATTTGTTGTAAAAAGTAGATAA-3′ P_INO4 F 5′-AAAAATGAATCCGGGATATTCAATTCTAGGAACCTCGAACTATATTGCATA 13 GGTTTCCCGACTGGAAAGC-3′ P_INO4 R 5′-TCGGACAATCCCGGCTGTATTGTTTGTATCTCCTTAATATCGTTCGTCATT 14 GTTTTATATTTGTTGTAAAAAGTAGATAA-3′ INO2 to PGK1 F 5′-GCGCCCTTCTAAGCTCTTCC-3′ 15 INO2 to PGK1 R 5′-ACCCAGTAATTCGTTCCCAGTTG-3′ 16 INO4 to PGK1 F 5′-CCGGGATATTCAATTCTAGGAACCT-3′ 17 INO4 to PGK1 R 5′-TTTCTTCACATTAGCCAGTTCACCC-3′ 18
Example 3: Preparation of OPI1-Deleted Mutant Yeast Strain
(89) In order to examine whether deletion of OPI1, which is a repressor to repress expression of the genes involved in phospholipid biosynthesis to increase the size of endoplasmic reticulum, to control cell membrane components, and to induce a stress response against unfolded proteins, in the PPD mutant yeast strain, is involved in growth and PPD producing ability of the mutant yeast strain, a mutant yeast strain where the gene was deleted was prepared. First, a deletion cassette for OPI1 deletion was prepared and transformed into the PDD mutant yeast strain to prepare an OPI1-deleted mutant yeast strain.
(90) In detail, to prepare the cassette for OPI1 deletion, PCR was performed by using the pUC57-URA3HA vector as a template and a primer combination (Table 3) of De1 OPI1 F and De1 OPI1 R which are OPI1 homologous recombination sequences, thereby preparing the cassette for OPI1 deletion. In this regard, PCR was repeated for 25 cycles of denaturation at 95° C. for 30 seconds, annealing at 56° C. for 30 seconds, and elongation at 72° C. for 1 minute.
(91) TABLE-US-00003 TABLE 3 Primer sequences for preparation of OPI1 deletion cassette Primer Primer sequence SEQ ID NO: Del OPI1 F 5′-TTAAAGCGTGTGTATCAGGACAGTG 19 TTTTTAACGAAGATACTAGTCATTGCCA GTCACGACGTTGTAAAA-3′ Del OPI1 R 5′-TATAATATTATTACTGGTGGTAATG 20 CATGAAAGACCTCAATCTGTCTCGGAGG TTTCCCGACTGGAAAGC-3′
(92) The prepared cassette for OPI1 deletion was introduced into the PPD mutant yeast strain. The introduction was performed by a general heat shock transformation method, and after transformation, the cells were cultured in a uracil dropout medium (6.7 g of Yeast Nitrogen Base without amino acids, 0.77 g of CSM minus uracil, 20 g of Glucose per 1 L) to substitute OPI1 ORF on the genome by the cassette. To confirm deletion of OPI1 in the obtained strain, PCR was performed by using the genome of the cells as a template and a primer combination of OPI1 F and OPI1 R (Table 4). Finally, PPDΔOPI1 (Δopi1) mutant yeast strain was prepared.
(93) TABLE-US-00004 TABLE 4 Primer sequences for OPI1 deletion Primer Primer sequence SEQ ID NO: OPI1 F 5′-GCGTGTGTATCAGGACAGTGT-3′ 21 OPI1 R 5′-CTGGTGGTAATGCATGAAAGACCTC-3′ 22
Example 4: Examination of Growth and PPD Production of Transformed Mutant Yeast Strain
(94) Each of the transformed mutant yeast strains was inoculated in 50 ml of a minimal URA drop-out medium containing 2% glucose so that OD.sub.600 value was 0.5, and each of them was cultured under shaking at 30 rpm to 250 rpm for 144 hours under aerobic conditions. Cell growth during culture was examined by measuring OD.sub.600 values with a spectrophotometer. Intracellular metabolites (squalene, 2,3-oxidosqualene, Protopanaxadiol) were analyzed by HPLC (High performance liquid chromatography).
(95) As a result of culturing (144 h), cell growth, i.e., OD.sub.600 values of the culture, and concentrations of the intracellular metabolites are as shown in the following Tables 5 and 6, and
(96) TABLE-US-00005 TABLE 5 Metabolite concentration according to culturing of transformed mutant yeast strain Cell 2,3- growth Squalene Oxidosqualene Protopanaxadiol Strain (OD.sub.600) (mg/L) (mg/L) (mg/L) Control group 13.59 2.03 0.56 5.35 INO2- 16.47 494.50 20.23 42.32 overexpressing strain INO4- 14.60 1.72 0.65 11.94 overexpressing strain OPI1-deleted 13.35 3.44 0.33 2.21 strain
(97) TABLE-US-00006 TABLE 6 Fold change of metabolite concentration according to culturing of transformed mutant yeast strain 2,3- Squalene Oxidosqualene Protopanaxadiol Strain (mg/L) (mg/L) (mg/L) Control group 1 1 1 INO2-overexpressing 243.01 35.81 7.90 strain INO4-overexpressing 0.85 1.15 2.23 strain OPI1-deleted strain 1.69 0.58 0.41
(98) In Tables 5 and 6, the control group represents the PPD mutant yeast strain (S. cerevisiae CEN.PK2-1D Δtrp1::P.sub.GPD1 tHMG1+P.sub.GPD1 PGSE Δleu2::P.sub.GPD1 PgDDS+P.sub.GPD1 PgPPDS+P.sub.GPD1 PgCPR), the INO2-overexpressing mutant yeast strain represents PPD-INO2(P.sub.INO2::P.sub.PKG1), the INO4-overexpressing mutant yeast strain represents PPD-INO4 (P.sub.INO4::P.sub.PKG1), and the OPI1-deleted mutant yeast strain represents PPDΔOPI1 (Δopi1). The values in Table 6 represent fold change of each metabolite produced in each prepared mutant yeast strain when a production concentration of each metabolite (squalene, 2,3-oxidosqualene, protopnanxadiol) produced in control yeast strain was taken as 1.
(99) The above results showed that transformation of the mutant yeast strains did not greatly influence the cell growth. Further, the results of measuring the concentrations of the intracellular metabolites showed that increased phospholipid biosynthesis by INO2 and INO4 overexpression or OPI1 deletion led to increased size of endoplasmic reticulum to increase metabolites of ginsenoside biosynthesis, finally indicating improvement of ginsenoside producing ability.
Effect of the Invention
(100) A recombinant yeast having improved ability to produce ginsenoside of the present invention is modified to have an increased expression level of INO2 having a nucleotide sequence of SEQ ID NO: 1 or INO4 having a nucleotide sequence of SEQ ID NO: 2 or increased expression levels of both of them, as compared with their intrinsic expression levels, or to have a decreased expression level of OPI1 having a nucleotide sequence of SEQ ID NO: 3, as compared with its intrinsic expression level, and as a result, it has improved ability to produce ginsenoside. Accordingly, the recombinant yeast may be effectively used in the production of ginsenosides.