Method for multiplex detection of methylated DNA
11186866 · 2021-11-30
Assignee
Inventors
Cpc classification
C12Q2525/161
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a method of detecting methylation of target DNA in a multiplex manner and a composition for detecting methylation of target DNA, and more particularly to a method for detecting methylation of target DNA, comprising: constructing an oligonucleotide, which comprises a target-specific sequence capable of binding complementarily to the target DNA and a universal primer that does not bind complementarily to the target DNA; linearly amplifying the target DNA for linear target enrichment by using the oligonucleotide as a primer; and amplifying the linearly amplified target DNA using an oligonucleotide, which is capable of binding complementarily to the linearly amplified target DNA, a universal primer, and a probe.
Claims
1. A method for detecting methylated DNA, comprising: (a) treating a target DNA-containing sample with bisulfite which modifies a non-methylated DNA site to be distinguished from a methylated DNA site; (b) constructing an oligonucleotide, which comprises a target-specific sequence designed to be capable of binding complementarily to the target DNA treated with the reagent, and a universal primer that does not bind complementarily to the target DNA; (c) performing one direction asymmetric linear amplification using, as a template, the target DNA treated with the reagent in step (a), and using, as a primer, the oligonucleotide constructed in step (b); (d) amplifying the target DNA using an oligonucleotide, which is capable of binding complementarily to the DNA linearly amplified in step (c), and a universal primer; and (e) detecting methylation of the target DNA by a probe capable of hybridizing complementarily to the target DNA sequence amplified in step (d).
2. The method of claim 1, wherein a plurality of target DNA methylations in samples in a single reactor is detected.
3. The method of claim 1, wherein the universal primer of the step (b) or (d) comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 7 and 35 to 41.
4. The method of claim 1, wherein the target-specific sequence of step (b) binds complementarily to a methylated site and/or a non-methylated site of the target DNA.
5. The method of claim 1, wherein the target-specific sequence of step (b) comprises one or more CpG dinucleotides.
6. The method of claim 1, wherein the target-specific sequence of step (b) comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 2, 5, 9, 14, 17, 21 and 26.
7. The method of claim 1, wherein the detection of methylation is performed by any one method selected from the group consisting of PCR, methylation specific PCR, real-time methylation specific PCR, PCR Using Methylated DNA-specific binding protein, PCR Using Methylated DNA-specific binding antibody, quantitative PCR, DNA chip Assay, sequencing, Sequencing-by-synthesis, and Sequencing-by-ligation.
8. The method of claim 1, wherein the oligonucleotide of step (d) comprises one or more CpG dinucleotides.
9. The method of claim 1, wherein the oligonucleotide of step (d) comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 1, 4, 8, 10 to 13, 15, 16, 18 to 20, 22 to 25, 27 and 28.
10. The method of claim 1, wherein the probe of step (e) comprises one or more CpG dinucleotides.
11. The method of claim 1, wherein the probe of step (e) comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 3, 6, 29, 30, and 31 to 34.
12. A kit for detecting methylated DNA, comprising: bisulfite, which modifies a non-methylated DNA to be distinguished from a methylated DNA of a target DNA-containing sample; an oligonucleotide, which comprises a target-specific sequence capable of binding complementarily to a target DNA sequence treated with the reagent, and a universal primer that does not bind complementarily to the target DNA; an oligonucleotide, which is capable of binding complementarily to a linearly amplified target DNA, and a universal primer; and a probe capable of hybridizing complementarily to the linearly amplified target DNA sequence.
13. The kit of claim 12, constituted for detecting methylation of a plurality of target DNAs in a sample in a single reactor.
14. The kit of claim 12, wherein the universal primer comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 7 and 35 to 41.
15. The kit of claim 12, wherein the target-specific sequence binds complementarily to a methylated site and/or a non-methylated site of the target DNA.
16. The kit of claim 12, wherein the target-specific sequence comprises one or more CpG dinucleotides.
17. The kit of claim 12, wherein the target-specific sequence comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 2, 5, 9, 14, 17, 21 and 26.
18. The kit of claim 12, wherein the oligonucleotide comprises one or more CpG dinucleotides.
19. The kit of claim 12, wherein the oligonucleotide comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 1, 4, 8, 10 to 13, 15, 16, 18 to 20, 22 to 25, 27 and 28.
20. The kit of claim 12, wherein the probe comprises one or more CpG dinucleotides.
21. The kit of claim 12, wherein the probe comprises a sequence having an identity of at least 50% to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 3, 6, 29, 30, and 31 to 34.
22. A kit for detecting methylated DNA, which comprises: at least one reagent for treating a target DNA-containing sample, to modify a non-methylated DNA to be distinguished from a methylated DNA, said at least one reagent comprising sodium bisulfite; an oligonucleotide, which comprises a target-specific sequence capable of binding complementarily to a target DNA sequence treated with the reagent, and a universal primer that does not bind complementarily to the target DNA, said oligonucleotide comprising the universal primer of SEO ID NO: 7 linked with the SDC2-specific sequence of SEO ID NO: 2; an oligonucleotide, which is capable of binding complementarily to a linearly amplified target DNA, and a universal primer, said oligonucleotide comprising the universal primer of SEQ ID NO: 7 linked with the COL2A1-specific sequence of SEQ ID NO: 5; and a probe capable of hybridizing complementarily to the linearly amplified target DNA sequence, said probe comprising the COL2A1 probe of SEQ ID NO: 6.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
BEST MODE FOR CARRYING OUT THE INVENTION
(5) Unless defined otherwise, all the technical and scientific terms used herein have the same meaning as those generally understood by one of ordinary skill in the art to which the invention pertains. Generally, the nomenclature used herein and the experiment methods, which will be described below, are those well known and commonly employed in the art.
(6) In one aspect, the present disclosure is directed to a method for detecting methylated DNA, comprising the steps of: (a) treating a target DNA-containing sample with at least one reagent which modifies a non-methylated DNA site to be distinguished from a methylated DNA site;
(7) (b) constructing an oligonucleotide, which comprises a target-specific sequence designed to be capable of binding complementarily to the target DNA treated with the reagent, and a universal primer that does not bind complementarily to the target DNA;
(8) (c) performing one direction asymmetric linear amplification using, as a template, the target DNA treated with the reagent in step (a), and using, as a primer, the oligonucleotide constructed in step (b);
(9) (d) amplifying the target DNA using an oligonucleotide, which is capable of binding complementarily to the DNA linearly amplified in step (c), and a universal primer that does not bind complementarily to the linearly amplified target DNA; and
(10) (e) detecting methylation of the target DNA by a probe capable of hybridizing complementarily to the target DNA sequence amplified in step (d).
(11) In the present disclosure, a method capable of early diagnosing disease by detecting methylated DNA with high sensitivity was developed, and the performance of the method was examined. In one example of the present disclosure, an internal control gene and a target DNA were first linearly amplified using a target-specific sequence capable of binding complementarily to the target DNA, and a universal primer that does not bind complementarily to the target DNA bound to the target-specific sequence, and then methylated DNA was analyzed by a detection method using an oligonucleotide capable of binding complementarily to a sequence complementary to the target DNA, a probe capable of hybridizing complementarily to the target DNA sequence, and the universal primer that does not bind complementarily to the linearly amplified target DNA. As a result, it was confirmed that the method of the present disclosure could detect methylated DNA with higher sensitivity and accuracy than a conventional method.
(12) Specifically, fecal DNA derived from normal person, and fecal DNA derived from patients with colorectal cancer at each stage, were treated with bisulfite, and non-methylated cytosines were all converted to uracil, and then the DNAs were linearly amplified using an oligonucleotide which is capable of binding specifically to each of methylated SDC2 (target DNA) and COL2A1 (internal control) and capable of binding complementarily to the target DNA fused with a universal primer, after which real-time PCR was performed using a specific probe capable of hybridizing to each target probe, an oligonucleotide capable of binding complementarily to a sequence complementary to the target DNA, and the universal primer (
(13) In the present disclosure, step (a) is a step of treating a target DNA-containing sample with at least one reagent which modifies a non-methylated DNA site to be distinguished from a methylated DNA site.
(14) “Methylation” as used in the present disclosure means that a methyl group is attached to the 5.sup.th carbon atom of the cytosine base ring to form 5-methylcytosine (5-mC). 5-methylcytosine (5-mC) is always attached only to the C of a CG dinucleotide (5′-mCG-3′), which is frequently marked CpG. The C of CpG is mostly methylated by attachment with a methyl group. The methylation of this CpG inhibits a repetitive sequence in genomes, such as Alu or transposon, from being expressed. In addition, this CpG is a site where an epigenetic change in mammalian cells appears most often. The 5-mC of this CpG is naturally deaminated to T, and thus, the CpG in mammal genomes shows only 1% of frequency, which is much lower than a normal frequency (¼×¼=6.25%).
(15) Regions in which CpGs are exceptionally integrated are known as CpG islands. The term “CpG islands” refer to sites which are 0.2-3 kb in length, and have a C+G content of more than 50% and a CpG ratio of more than 3.75%. There are about 45,000 CpG islands in the human genome, and they are mostly found in promoter regions regulating the expression of genes. Actually, the CpG islands occur in the promoters of housekeeping genes accounting for about 50% of human genes.
(16) The presence of CpG methylation in the target DNA may be an indicator of disease. For example, CpG methylation of any one of the promoter, 5′-untranslated region and intron of the target DNA may be measured.
(17) A CpG-containing gene is generally DNA. However, the method of the present disclosure may be applied to a sample containing DNA or a sample containing DNA and RNA, including mRNA, wherein the DNA or RNA may be single-stranded or double-stranded. Alternatively, the sample may also be a sample containing a DNA-RNA hybrid.
(18) A nucleic acid mixture may also be used. As used herein, the term “multiplex” includes both the case in which there are a plurality of specific nucleic sequence regions to be detected in one kind of gene and the case in which a single tube (single reactor) includes a plurality of target DNAs. The specific nucleic acid sequence to be detected may be a large molecular fraction, and the specific sequence may be present from the beginning in the form of an isolated molecule constituting the entire nucleic acid sequence. The nucleic acid sequence need not be a nucleic acid present in a pure form, and the nucleic acid may be a small fraction in a complex mixture such as one containing the whole human DNA.
(19) Specifically, the present disclosure is directed to a method for detecting a plurality of target DNA methylations in samples in a single reactor, wherein the sample may contain a plurality of multiple target DNAs. The target DNA may be used without limitation as long as it is not only a control gene, but also any gene that affects the development or progression of cancer when it expression is inhibited by abnormal methylation.
(20) The sample may be derived from the human body. For example, the sample may be derived from liver cancer, glioblastoma, ovarian cancer, colon cancer, head and neck cancer, bladder cancer, renal cell cancer, gastric cancer, breast cancer, metastatic cancer, prostate cancer, pancreatic cancer, or lung cancer patients. In the present disclosure, the sample may be any one selected from among solid or liquid tissue, cells, feces, urine, blood, serum and plasma.
(21) At least one reagent that modifies a non-methylated DNA site to be distinguished from a methylated DNA site can be used without limitation as long as it can distinguish between a non-methylated cytosine base and a methylated cytosine base. For example, the reagent may be one or more selected from among bisulfite, hydrogen sulfite, disulfite, and combinations thereof, but is not limited thereto. Specifically, a cytosine base methylated by the reagent is not converted, but a cytosine base unmethylated by the reagent may be converted to uracil or to another base other than or cytosine.
(22) In the present disclosure, step (b) is a step of constructing an oligonucleotide, which comprises a target-specific sequence designed to be capable of binding complementarily to the target DNA treated with the reagent, and a universal primer that does not bind complementarily to the target DNA.
(23) For common multiplex PCR, pairs of forward and reverse primers, which correspond to the number of targets, should be constructed and used simultaneously. However, in the method of the present disclosure, only one target-specific sequence (reverse primer) capable of binding complementarily to a target DNA sequence by a universal primer may be used in a real-time PCR process for simultaneously detecting several multiple methylated DNAs, and only an oligonucleotide (forward primer) capable of binding complementarily to the linearly amplified DNA may be used in the same number as the targets to be detected. Accordingly, only a small number of primers may be used for simultaneous detection of methylation of several targets, and thus the complexity of PCR and variation of PCR efficiency are reduced.
(24) The target-specific sequence is a sequence capable of binding complementarily to a target DNA, and as the target-specific sequence, a sequence capable of binding complementarily to a methylated site of the target DNA, as well as a sequence capable of binding complementarily to a non-methylated site of the target DNA may also be used selectively.
(25) The target-specific sequence may comprise, for example, one or more CpG dinucleotides. Specifically, the target-specific sequence may comprise a sequence having an identity of at least 50%, specifically, at least 55%, 60%, 70%, 80% or 90%, to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 2, 5, 9, 14, 17, 21 and 26.
(26) The universal primer that can be used in the present disclosure is may be linked to either any one of a target-specific sequence (reverse primer) capable of binding complementarily to a target DNA sequence and an oligonucleotide (forward primer) capable of binding complementarily to the linearly amplified DNA, or both the reverse primer and the forward primer.
(27) The universal primer can be used without limitation as long as it comprises a nucleotide sequence that does not bind complementarily to a target DNA amplifiable irrespective of the target DNA, but for example, may comprise a nucleotide sequence that is not present in the human genome. Specifically, the universal primer may comprise a sequence having an identity of at least 50%, specifically, at least 55%, 60%, 70%, 80% or 90%, to a nucleotide sequence represented by SEQ ID NO: 7. In addition, the universal primer may comprise a sequence such as T7, SP6, M13 or the like, but is not limited thereto.
(28) Further, the universal primer may be one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 35 to 41. The universal primer may be, for example, a T7 sequence of 5′-TAATACGACTCACTATAGG-3′ (SEQ ID NO: 35), an SP6 sequence of 5′-TATTTAGGTGACACTATAG-3′ (SEQ ID NO: 36), or an M13 sequence of 5′-GTAAAACGACGGCCAG-3 (SEQ ID NO: 37: -20F), 5′-GTTTTCCCAGTCACGAC-3′(SEQ ID NO: 38: -40F), 5′-CGCCAGGGTTTTCCCAGTCACGAC-3′ (SEQ ID NO: 39: -47F), 5′-GAAACAGCTATGACCATG-3′ (SEQ ID NO: 40: R) or 5′-AGCGGATAACAATTTCACACAGG-3′ (SEQ ID NO: 41: -48R).
(29) The method of the present disclosure comprises a step (c) of performing asymmetric linear amplification using, as a template, the target DNA treated with the reagent in step (a), and using, as a primer, the oligonucleotide constructed in step (b).
(30) A DNA treated with bisulfite in a real-time PCR process through the step (c) was not used immediately, but a linearly amplified DNA was used, and thus a detection rate and the sensitivity of detection are excellent (
(31) In the present disclosure, only a target DNA is asymmetrically amplified linearly in one direction, and thus this leads to enrichment of the target DNA. In one embodiment, linear amplification for enriching a methylated target DNA may be performed by unidirectional PCR using as a primer an oligonucleotide comprising a universal primer bound to the 5′ end of a target-specific sequence.
(32) The linear amplification means that an amplification product is produced linearly with respect to the number of amplification cycles, including double-strand denaturation, primer annealing and nucleic acid synthesis. The linear amplification is distinguished from a polymerase chain reaction (PCR) that produces an amplification product exponentially with respect to the number of amplification cycles.
(33) Next, the method of the present disclosure comprises a step (d) of amplifying the target DNA using an oligonucleotide, which is capable of binding complementarily to the DNA linearly amplified in step (c), and the universal primer.
(34) In some cases, step (d) may further comprise a step of detecting methylation of the target DNA by use of a self-reporting or energy transfer labeled primer.
(35) As used herein, the term “self-reporting” is also named “energy transfer labeled”, and may be used interchangeably with “energy transfer labeled”. As used herein, “self-reporting universal primer” may be used interchangeably with the term “energy transfer labeled primer”.
(36) “Self-reporting” or “energy transfer labeled” means that the primer is capable of self-quenching or self-probing such that when amplification does not occur, fluorescence is not emitted due to self-quenching, but when amplification occurs, quenching is released and fluorescence is emitted. Self-reporting or energy transfer-labeled substances include, but are not limited to, TaqMan probes, fluorophores and molecular beacons.
(37) In one example, the oligonucleotide (forward primer) capable of binding complementarily to the linearly amplified DNA may comprise a sequence capable of binding complementarily to the target DNA constructed in step (d) and amplifying the target DNA, for example, one or more CpG dinucleotides.
(38) Specifically, the oligonucleotide may comprise a sequence having an identity of at least 50%, specifically, at least 55%, 60%, 70%, 80% or 90%, to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 1, 4, 8, 10 to 13, 15, 16, 18 to 20, 22 to 25, 27 and 28.
(39) The description of the universal primer is applied in the same manner as in step (b) as mentioned above.
(40) The method of the present disclosure comprises a step (e) of detecting methylation of the target DNA by a probe capable of hybridizing complementarily to the target DNA sequence amplified in step (d).
(41) In one example, the detection of methylation may be performed by any one method selected from the group consisting of PCR, methylation specific PCR, real-time methylation specific PCR, PCR Using Methylated DNA-specific binding protein, PCR Using Methylated DNA-specific binding antibody, quantitative PCR, DNA chip Assay, sequencing, Sequencing-by-synthesis, and Sequencing-by-ligation.
(42) Method for Detection of Methylation
(43) (1) Methylation-Specific PCR:
(44) When genomic DNA is treated with bisulfite to detect methylation by the methylation-specific PCR, cytosine in the 5′-CpG′-3 region remains intact, if it was methylated, but the cytosine changes to uracil, if it was unmethylated. Accordingly, based on the base sequence converted after bisulfite treatment, PCR primer sets corresponding to a region having the 5′-CpG-3′ base sequence are constructed. When genomic DNA is amplified by PCR, the PCR product is detected in the PCR mixture employing the primers corresponding to the methylated base sequence, if the genomic DNA was methylated, and this methylation can be quantitatively analyzed by agarose gel electrophoresis. Herein, the probe for detection of methylation may be a TaqMan probe, a molecular beacon probe, or a self-reporting or energy transfer-labeled probe, but is not limited thereto.
(45) (2) Real-Time Methylation Specific PCR
(46) Real-time methylation-specific PCR is a real-time measurement method modified from the methylation-specific PCR method and comprises treating genomic DNA with bisulfite, designing PCR primers corresponding to the methylated base sequence, and performing real-time PCR using the primers. Methods of detecting the methylation of the genomic DNA include two methods: a method of detection using a TanMan probe complementary to the amplified base sequence; and a method of detection using Sybergreen. Thus, the real-time methylation-specific PCR allows selective quantitative analysis of methylated DNA. Herein, a standard curve is plotted using an in vitro methylated DNA sample, and a gene containing no ‘-CpG-3’ sequence in the base sequence is also amplified as a negative control group for standardization to quantitatively analyze the degree of methylation.
(47) (3) PCR Using Methylated DNA-Specific Binding Protein, Quantitative PCR, and DNA Chip Assay
(48) When a protein binding specifically only to methylated DNA is mixed with DNA, the protein binds specifically only to the methylated DNA. Thus, either PCR using a methylation-specific binding protein or a DNA chip assay allows selective isolation of only methylated DNA.
(49) In addition, methylation of DNA can also be measured by a quantitative PCR method, and methylated DNA isolated with a methylated DNA-specific binding protein can be labeled with a fluorescent probe and hybridized to a DNA chip containing complementary probes, thereby measuring methylation of the DNA.
(50) (4) Detection of Differential Methylation-Bisulfate Sequencing Method
(51) Another method for detecting a methylated CpG-containing nucleic acid comprises the steps of: bringing a nucleic acid-containing sample into contact with an agent that modifies unmethylated cytosine; and amplifying the CpG-containing nucleic acid in the sample using CpG-specific oligonucleotide primers, wherein the oligonucleotide primers distinguish between modified methylated nucleic acid and non-methylated nucleic acid and detect the methylated nucleic acid. The amplification step is optional and desirable, but not essential. The method relies on the PCR reaction to distinguish between modified (e.g., chemically modified) methylated DNA and unmethylated DNA.
(52) (5) Bisulfite Sequencing Method
(53) Another method for detecting a methylated CpG-containing nucleic acid comprises the steps of: contacting a nucleic acid-containing sample with an agent that modifies a non-methylated cytosine; and amplifying the CpG-containing nucleic acid in the sample by means of methylation-independent oligonucleotide primers. Herein, the oligonucleotide primers can amplify the nucleic acid without distinguishing modified methylated and non-methylated nucleic acids. The amplified product may be sequenced by the Sanger method using a sequencing primer or by a next-generation sequencing method linked with bisulfite sequencing for detection of methylated nucleic acid.
(54) (6) Herein, the next-generation sequencing method may be performed by sequencing-by-synthesis and sequencing-by-ligation. This method is characterized in that a single DNA fragment is spatially separated in place of making a bacterial clone, and is amplified in situ (clonal amplification) and sequenced. Herein, it analyzes hundreds of thousands of fragments at the same time, and thus is called “massively parallel sequencing”.
(55) It is based on sequencing-by-synthesis, and relies on a method of obtaining a signal while sequentially attaching mono- or di-nucleotides. It includes pyrosequencing, ion torrent and Solexa methods.
(56) NGS systems based on sequencing-by synthesis include a Roche 454 platform, an Illumina HiSeq platform, an Ion PGM platform (Life Technology), and a PacBio platform (Pacific BioSciences). The 454 and Ion PGM platforms use emersion PCR that is a clonal amplification method, and the HiSeq platform uses Bridge amplification. The sequencing-by-synthesis method analyzes a sequence by detecting phosphate which is generated when synthesizing a DNA while sequentially attaching single nucleotides, hydrogen ion, or a pre-labeled fluorescence dye. To detect a sequence, the 454 platform uses a pyrosequencing method employing phosphate, and the Ion PGM platform uses hydrogen ion detection. The HiSeq and PacBio platforms analyze a sequence by detecting fluorescence.
(57) Sequencing-by-ligation is a sequencing technique employing DNA ligase, and is performed by identifying nucleotides at specific positions in a DNA nucleotide sequence. Unlike most sequencing techniques employing polymerase, sequencing-by-ligation does not use a polymerase, and uses the characteristic in that DNA ligase does not ligate a mismatch sequence. It includes a SOLiD system. In this technique, two bases are read in each step, and the reading steps are independently repeated five times through the primer reset process. Thus, each base is read twice to increase accuracy.
(58) In the case of sequencing-by-ligation, among dinucleotide primer sets made of 16 combinations, dinucleotide primers corresponding to the nucleotide sequence of interest are sequentially ligated, and a combination of the ligations is analyzed, thereby determining the nucleotide sequence of the DNA of interest.
(59) Regarding the primers that are used in the present disclosure, when the target DNA is treated with the reagent (e.g., bisulfite) in step (a), cytosine in the 5′-CpG′-3 region remains intact, if it was methylated, but the cytosine changes to uracil, if it was not methylated. Accordingly, based on the base sequence converted after reagent (e.g., bisulfite) treatment, PCR primers corresponding to a region having the 5′-CpG-3′ base sequence may be constructed.
(60) The primers may be designed to be “substantially” complementary to each strand of the locus to be amplified of a target DNA. This means that the primers must be sufficiently complementary to hybridize with their respective strands under polymerization reaction conditions.
(61) Methylation of the product amplified by an oligonucleotide, which is capable of binding complementarily to the DNA linearly amplified, and the universal primer in step (d) is detected by a probe capable of hybridizing to the target DNA, and the probe can be used without limitation as long as it can hybridizing to the target DNA to detect the methylation, but may comprise, for example, one or more CpG dinucleotides. In addition, there is a method in which detection is performed using a self-reporting fluorescent substance or an energy transfer labeling primer, in addition to the above-described oligonucleotide or universal primer.
(62) Specifically, the probe may comprise a sequence having an identity of at least 50%, specifically, at least 55%, 60%, 70%, 80% or 90%, to one or more sequences selected from the group consisting of sequences represented by SEQ ID NOs: 3, 6, 29, 30, and 31 to 34.
(63) In some embodiments, the probe may have a reporter or a quencher attached to both ends. The reporter may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2′, 4′, 5′, 7′-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3, and Cy5. The quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl. The quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl.
(64) In another aspect, the present disclosure is directed to a composition for detecting methylated DNA, comprising: at least one reagent treated to a target DNA-containing sample, which modify a non-methylated DNA to be distinguished from a methylated DNA;
(65) an oligonucleotide, which comprises a target-specific sequence capable of binding complementarily to a target DNA sequence treated with the reagent, and a universal primer that does not bind complementarily to the target DNA;
(66) an oligonucleotide, which are capable of binding complementarily to a linearly amplified target DNA, and a universal primer that does not bind complementarily to the linearly amplified target DNA; and
(67) a probe capable of hybridizing complementarily to the linearly amplified target DNA sequence.
(68) The composition according to the present disclosure overlaps with the above-described constitutions, including performing treatment with at least one reagent which modifies methylated DNA and non-methylated DNA so as to be distinguished between each other, performing linear amplification using an oligonucleotide which amplifies target DNA treated with the reagent and comprises a target-specific sequence capable of binding complementarily to a target DNA sequence and a universal sequence that does not hybridize to the target DNA, and detecting methylated DNA using an oligonucleotide, which is capable of binding complementarily to the linearly amplified DNA, a universal primer and a probe, and thus the detailed description thereof is omitted.
(69) In still another aspect, the present disclosure is directed to a kit for detecting methylation of a target DNA, which comprises the composition.
(70) In one example, the kit may comprise a carrier means compartmentalized to receive a sample therein, a container that receives a reagent therein, a container containing PCR primers for amplification of a 5′-CpG-3′ base sequence of a target DNA, and a container containing a probe for detecting an amplified PCR product.
(71) Carrier means are suited for containing one or more containers such as vials, tubes, and the like, each of the containers comprising one of the separate elements to be used in the method. In view of the description provided herein of the inventive method, those of skill in the art can readily determine the apportionment of the necessary reagents among the containers.
EXAMPLES
(72) Hereinafter, the present disclosure will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present disclosure.
Example 1
Determination of Detection Limit Using Methylated DNA Derived from Cell Line
(73) HCT116, SW480 and HT-29 cell lines, which are human colorectal cancer cell lines, were purchased from the Korean Cell Line Bank (Seoul, Korea), and cultured in RPMI media (JBI, Seoul, South Korea) containing 10% fetal bovine serum (JBI, Seoul, South Korea), penicillin and streptomycin in an incubator at 37° C. under 5% carbon dioxide.
(74) Genomic DNA was extracted using a QiaAmp DNA Mini kit (Qiagen, Hilden, Germany) and treated with sodium bisulfite by means of an EZ DNA Methylation-Gold kit (ZYMO Research, Irvine, USA). In brief, genomic DNA was treated with bisulfite at 65° C. for 2.5 hours, and then desulfonated by leaving it at room temperature for 20 minutes. Next, it was bound to a Zymo-Spin IC column (Zymo Research, Irvine, USA), and then extracted with 10 μl of distilled water and stored at 20° C.
(75) In order to determine the detection limit of the method of the present disclosure compare it with a meSDC2-qMSP that does not comprise the LTE process, methylated DNA derived from the HCT116 cell line was dispensed at a concentration of 100 to 10 pg, and then mixed with 20 ng of a human leukocyte genomic DNA (BioChain Instititute Inc., Hayward, Calif.) amplified using an Illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare, Cleveland, USA), followed by serial dilution.
(76) Next, the DNA was amplified linearly using an oligonucleotide, which comprises the universal primer of SEQ ID NO: 7 linked with the SDC2-specific sequence of SEQ ID NO: 2, and an oligonucleotide which comprises the universal primer of SEQ ID NO: 7 linked with the COL2A1-specific sequence of SEQ ID NO: 5, under the following conditions: 95° C. for 5 min, and then 35 cycles, each consisting of 95° C. for 15 sec and 60° C. for 1 min. Next, real-time PCR was performed using the probe of SEQ ID NO: 3, the oligonucleotide of SEQ ID NO: 1 that can bind complementarily to the linearly amplified DNA, the probe of SEQ ID NO: 6, the oligonucleotide of SEQ ID NO: 4 that can bind complementarily to the linearly amplified DNA, and the universal primer of SEQ ID NO: 7, under the following conditions: 95° C. for 5 min, and then 40 cycles, each consisting of 95° C. for 15 sec and 60° C. for 1 min. The experiment was repeated 24 times (Table 1 and
(77) TABLE-US-00001 TABLE 1 Primer and probe sequences SEQ ID NO: Description Sequences SEQ ID Oligonuc- 5′-GTAGAAATTAATAAGTGAGAGGGC-3′ NO: 1 leotide capable of binding complemen- tarily to SDC2 SEQ ID SDC2- 5′- AAAGATTCGGCGACCACCGA NO: 2 specific ACGACTCAAACTCGAAAACTCG-3′ sequence SEQ ID SDC2 probe 5′-FAM-TTCGGGGCGTAGTTGCGGGCGG- NO: 3 3′ SEQ ID Oligonuc- 5′-GTAATGTTAGGAGTATTTTGTGGITA- NO: 4 leotide 3′ capable of binding complemen- tarily to COL2A1 SEQ ID COL2A1- 5′- AAAGATTCGGCGACCACCGA NO: 5 specific CTAICCCAAAAAAAC CCAATCCTA-3′ sequence SEQ ID COL2A1 probe 5′-Cy5- NO: 6 AGAAGAAGGGAGGGGTGTTAGGAGAGG-3′ SEQ ID Universal 5′-AAAGATTCGGCGACCACCGA-3′ NO: 7 primer Underlined: CpG dinucleotide; italic: universal primer; I: inosine nucleotide * the sequences of SEQ ID NO: 2 and SEQ ID NO: 5 are SDC2 and COL2A1 target specific sequences, respectively, and correspond to sequences other than the universal primer sequence of SEQ ID NO: 7, and an oligonucleotide comprising a target-specific sequence and a universal primer that does not hybridize to the target DNA was used as a primer.
(78) As a result, it was confirmed that the conventional method showed a detection rate of 100% in 200 pg of DNA, but showed a detection rate of 37.5% in 20 pg and a detection rate of 0% in 10 pg, whereas the method of the present disclosure showed a detection of 100% in 200 pg to 20 pg and showed a detection rate of 33.3% even in 10 pg (
(79) TABLE-US-00002 TABLE 2 Comparison of detection rate between the conventional method (qMSP) and the method of the present disclosure (LTE-qMSP) Number of detections Number of of detections DNA methylated of concentration DNA by LTE- Detection methylated Detection (pg) qMSP rate DNA by qMSP rate 10 8 out of 24 33.3 0 out of 24 N.D 20 24 out of 24 100 9 out of 24 37.5 50 24 out of 24 100 19 out of 24 79.2 100 24 out of 24 100 23 out of 24 95.8 200 24 out of 24 100 24 out of 24 100 Negative 0 out of 24 N.D 0 out of 24 N.D control
Example 2
Comparison Between LTE-qMSP and qMSP
(80) In order to evaluate the ability of the SDC2 gene to diagnose colorectal cancer, 18 sets of methylation-specific detection primers and probes which can represent all CpG islands of the SDC2 gene were designed (Table 3), and LTE-qMSP was performed. To this end, genomic DNA was isolated (QIAamp DNA Stool Mini kit, Qiagen) from the feces of each of normal persons and 25 colorectal cancer patients, and treated with bisulfite by an EZ DNA methylation-Gold kit. Then, the DNA was extracted with 10 μl of sterile distilled water and used in LTE-qMSP (Linear Target Enrichment-Methylation-specific real time PCR). Using the bisulfite-treated genomic DNA as a template, linear target enrichment (LTE) was performed using the designed target-specific sequence (R) shown in Table 3 below (
(81) qMSP was performed using a Rotor-Gene Q PCR system (Qiagen). It was performed using a total of 40 μl of a PCR reaction solution (20 μl of a primary LTE product; 8 μl of 5× AptaTaq DNA Master (Roche Diagnostics); 1 μl (10 pmole) of a PCR primer capable of binding complementarily to DNA; 1 μl (10 pmole) of an oligonucleotide capable of binding complementarily to SDC2; DNA; 1 μl (5 pmole) of an oligonucleotide capable of binding complementarily to COL2A1; 1 μl (10 pmole) of a universal primer (SEQ ID NO: 7); 1 μl (5 pmole) of an SDC2 TaqMan probe; 1 μl (2.5 pmole) of a COL2A1 TaqMan probe; 6 μl of D.W.) under the following PCR conditions: treatment at 95° C. for 5 min, and then 40 cycles, each consisting of 95° C. for 15 sec and a suitable annealing temperature (58° C. to 61° C.) for 1 min. Whether the PCR product would be amplified was determined by measuring the cycle threshold (Ct) value. Methylated and non-methylated control DNAs were tested along with sample DNAs using an EpiTect PCR control DNA set (Qiagen, cat. no. 59695). As an internal control gene, the COL2A1 gene (Kristensen et al., 2008) was used.
(82) TABLE-US-00003 TABLE 3 Primer and probe sequences for SDC2 gene LTE-qMSP Amplifi- cation product SEQ size ID Set Primers Sequences (5′.fwdarw.3′) (bp) NO: 1 F1 AAGAAAAGGATTGAGAAAAC 155 8 R1 AAAGATTCGGCGACCACCGACGAAAAA 9 AATTCCTACAAAATTACACG Probe 1 CGTGTAATTTTGTAGGAATTTTTTTCG 29 2 F2 GGTTTGTCGGTGAGTAGAGTCGGC 124 10 R1 AAAGATTCGGCGACCACCGACGAAAAA 9 AATTCCTACAAAATTACACG Probe 1 CGTGTAATTTTGTAGGAATTTTTTTCG 29 3 F3 GTTATAGCGCGGAGTCGCGGC 97 11 R1 AAAGATTCGGCGACCACCGACGAAAAA 9 AATTCCTACAAAATTACACG Probe 1 CGTGTAATTTTGTAGGAATTTTTTTCG 29 4 F4 GGTTTTCGGAGTTGTTAATC 69 12 R1 AAAGATTCGGCGACCACCGACGAAAAA 9 AATTCCTACAAAATTACACG Probe 1 CGTGTAATTTTGTAGGAATTTTTTTCG 29 5 F5 TTATTTGGGAGTTATATTGTC 156 13 R2 AAAGATTCGGCGACCACCGACGCGCCG 14 CGCCTCCCTCCCCG Probe 2 CGGGGAGGGAGGCGCGGCGCG 30 6 F6 TTTTAGTCGTTTAGGGGAGTTC 126 15 R2 AAAGATTCGGCGACCACCGACGCGCCG 14 CGCCTCCCTCCCCG Probe2 CGGGGAGGGAGGCGCGGCGCG 30 7 F7 CGTAGTCGCGGAGTTAGTGGTTTC 152 16 R3 AAAGATTCGGCGACCACCGACGCTAAC 17 TTAAACTACG Probe 3 CGTAGTTTTTTTTTAAGTTAGCG 31 8 F8 CGCGTTGTTTTTTAGATATTTTC 121 18 R3 AAAGATTCGGCGACCACCGACGCTAAC 17 TTAAACTACG Probe 3 CGTAGTTTTTTTTTAAGTTAGCG 31 9 F9 CGCGCGGATCGCGCGTTTTCGTC 87 19 R3 AAAGATTCGGCGACCACCGACGCTAAC 17 TTAAACTACG Probe 3 CGTAGTTTTTTTTTAAGTTAGCG 31 10 F10 CGGTACGGGAAAGGAGTTCGCG 113 20 R4 AAAGATTCGGCGACCACCGACGACACG 21 AAATTAATACTCCG Probe 4 CGGAGTATTAATTTCGTGTCG 32 11 F11 GTAGAAATTAATAAGTGAGAGGGC 144 1 R5 AAAGATTCGGCGACCACCGAACGACTC 2 AAACTCGAAAACTCG Probe5 CGAGTTTTCGAGTTTGAGTCGT 33 12 F11 GTAGAAATTAATAAGTGAGAGGGC 144 1 R5 AAAGATTCGGCGACCACCGAACGACTC 2 AAACTCGAAAACTCG Probe TTCGGGGCGTAGTTGCGGGCGG 3 5-1 13 F12 TCGCGTTTTCGGGGCGTAGTTGC 119 22 R5 AAAGATTCGGCGACCACCGAACGACTC 2 AAACTCGAAAACTCG Probe5 CGAGTTTTCGAGTTTGAGTCGT 33 14 F13 CGGCGGGAGTAGGCGTAGGAGGAGGAA 93 23 GC R5 AAAGATTCGGCGACCACCGAACGACTC 2 AAACTCGAAAACTCG Probe 5 CGAGTTTTCGAGTTTGAGTCGT 33 15 F14 AGGAAGCGAGCGTTTTCGAGTTTC 71 24 R5 AAAGATTCGGCGACCACCGAACGACTC 2 AAACTCGAAAACTCG Probe 5 CGAGTTTTCGAGTTTGAGTCGT 33 16 F15 AATCGTTGCGGTATTTTGTTTC 133 25 R6 AAAGATTCGGCGACCACCGACCAAAAA 26 CCGACTACTCCCAACCG Probe 6 CGGTTGGGAGTAGTCGGTTTTTGG 34 17 F16 GATTCGTGTGCGCGGGTTGC 110 27 R6 AAAGATTCGGCGACCACCGACCAAAAA 26 CCGACTACTCCCAACCG Probe 6 CGGTTGGGAGTAGTCGGTTTTTGG 34 18 F17 CGAGCGTTGGGTAGGAGGTTTC 88 28 R6 AAAGATTCGGCGACCACCGACCAAAAA 26 CCGACTACTCCCAACCG Probe 6 CGGTTGGGAGTAGTCGGTTTTTGG 34 * Italic: universal sequence (SEQ ID NO: 7) * Sequences of R1 to R6 are target-specific sequences which correspond to sequences other than the universal sequence of SEQ ID NO: 7. * F1 to F17 correspond to oligonucleotides capable of binding complementarily to linearly amplified target DNA.
(83) A. Results of Comparison Between LTE-qMSP and qMSP for Set 6
(84) According to the method described in Example 1, the sensitivity of detection by set 6 was compared between the LTE-qMSP method and the qMSP method. As a result, it was confirmed that the conventional method showed a detection rate of 100% in 200 pg of DNA, but showed a detection rate of 37.5% in 20 pg and a detection rate of 0% in 10 pg, whereas the method of the present disclosure showed a detection rate of 100% in 200 pg to 20 pg and a detection rate of 33.3% even in 10 pg (
(85) TABLE-US-00004 TABLE 4 Comparison of detection rate between the conventional method (qMSP) and the method of the present disclosure (LTE-qMSP) Number of detections Number of of detections DNA methylated of concentration DNA by LTE- Detection methylated Detection (pg) qMSP rate DNA by qMSP rate 10 8 out of 24 33.3 0 out of 24 N.D 20 24 out of 24 100 9 out of 24 37.5 50 24 out of 24 100 19 out of 24 79.2 100 24 out of 24 100 23 out of 24 95.8 200 24 out of 24 100 24 out o 24f 100 Negative 0 out of 24 N.D 0 out of 24 N.D control
(86) B. Results of Comparison Between LTE-qMSP and qMSP for Set 17
(87) According to the method described in Example 1, the sensitivity of detection by set 17 was compared between the LTE-qMSP method and the qMSP method. As a result, it was confirmed that the qMSP method showed a detection rate of 100% in 200 pg of DNA, but showed a detection rate of 45.0% in 20 pg and a detection rate of 0% in 10 pg, whereas the method of the present disclosure showed a detection rate of 100% in 200 pg to 20 pg and a detection rate of 91.7% in 20 pg and a detection rate of 29.2% even in 10 pg (
(88) TABLE-US-00005 TABLE 5 Comparison of detection rate between the conventional method (qMSP) and the method of the present disclosure (LTE-qMSP) Number of detections Number of of detections DNA methylated of concentration DNA by LTE- Detection methylated Detection (pg) qMSP rate DNA by qMSP rate 10 7 out of 24 29.2 0 out of 24 N.D 20 22 out of 24 91.7 11 out of 24 45.0 50 23 out of 24 95.8 18 out of 24 75.0 100 24 out of 24 100 23 out of 24 95.8 200 24 out of 24 100 24 out of 24 100 Negative 0 out of 24 N.D 0 out of 24 N.D control
Example 3
Evaluation of the Ability of SDC2 Gene to Diagnose Colorectal Cancer in Feces by LTE-qMSP
(89) The degree of methylation in each of the samples shown in Table 3 of Example 2 was measured by the Ct value, and the sensitivity and specificity of each primer and probe set were calculated by ROC curve analysis (MedCalc program, Belgium) (Table 6).
(90) Methylation of the SDC2 gene was analyzed using fecal DNA derived from normal persons and colorectal cancer patients. As a result, it was confirmed that the sensitivity for diagnosis of colorectal cancer was as high as 76% (19/25) to 88.0% (22/25) and the specificity was as high as 88.0% (3/25) to 100% (0/25). This suggests that the use of methylation of the SDC2 gene is highly useful for diagnosis of colorectal cancer.
(91) TABLE-US-00006 TABLE 6 Evaluation of the ability of SDC2 gene to diagnose colorectal cancer Primer and Cut-off Sensitivity Specificity probe set (Ct) P value (%), n = 25 (%), n = 25 1 <32.1 <0.001 76.0 92.0 2 <32.0 <0.001 80.0 96.0 3 <32.3 <0.001 76.0 88.0 4 <32.1 <0.001 80.0 92.0 5 <32.0 <0.001 84.0 96.0 6 <32.5 <0.001 88.0 92.0 7 <32.5 <0.001 76.0 96.0 8 <32.2 <0.001 80.0 88.0 9 <32.3 <0.001 88.0 100 10 <32.5 <0.001 76.0 92.0 11 <32.0 <0.001 80.0 100 12 <32.0 <0.001 88.0 92.0 13 <32.1 <0.001 88.0 88.0 14 <32.0 <0.001 84.0 92.0 15 <32.2 <0.001 80.0 96.0 16 <32.3 <0.001 76.0 100 17 <32.5 <0.001 84.0 100 18 <32.0 <0.001 88.0 96.0
(92) In order to further evaluate the ability of the LTE-qMSP method for multiplex detection of methylation, the ability of a combination of set 1 and set 2 to diagnose colorectal cancer was evaluated using fecal DNA in a single tube.
(93) TABLE-US-00007 TABLE 7 Evaluation of the ability of combination of set 1 and set 12 to diagnose colorectal cancer Primer and Cut-off Sensitivity Specificity probe set (Ct) P value (%), n = 25 (%), n = 25 1 + 12 <32.2 <0.001 88.0 92.0
(94) Clinical verification of a combination of set 1 and set 12 was performed, and as a result, it was confirmed that the sensitivity and the specificity were as extremely high as 88% and 92%, respectively. Thus, it was confirmed again that it is possible to detect methylation using the LTE-qMSP method in which several methylated targets are simultaneously amplified in a single tube.
INDUSTRIAL APPLICABILITY
(95) As described above, the method for detecting methylated DNA according to the present disclosure uses a universal primer, and hence can efficiently amplify multiple target DNAs even when using only one additional primer, even if a sample contains various kinds of genes. Furthermore, the complexity of PCR (real-time PCR) which is used to detect methylation by linear amplification can decrease, and variation in the efficiency of PCR can decrease, indicating that the sensitivity of detection is significantly high and the method is useful. In addition, the method has an advantage in that it can enrich methylated target DNA with higher specificity in the step of linearly amplifying the target DNA (LTE step).
(96) Although the present disclosure has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present disclosure. Thus, the substantial scope of the present disclosure will be defined by the appended claims and equivalents thereof.