COMPOSITION FOR DETERMINING FALSE POSITIVES USING A UNIQUE ARTIFICIAL NUCLEOTIDE SEQUENCE AND METHOD FOR DETERMINING FALSE POSITIVES USING THE SAME

Abstract

The present invention is a method for determining whether a test target group sample is contaminated by a positive control sample during a polymerase chain reaction (PCR) process. A target nucleotide sequence and a unique artificial nucleotide sequence are inserted into a positive control, and a probe for determining a false positive is designed that binds to a partial sequence of the target nucleotide and a partial sequence of the unique artificial nucleotide. According to the present invention, it is possible to simply and accurately determine whether it is a false positive by confirming the presence or absence of a unique artificial nucleotide sequence in the test target group.

Claims

1. A composition for determining a false positive, comprising: a positive control comprising a target nucleotide sequence and a unique artificial nucleotide sequence; a first probe for binding to the target nucleotide sequence; and a second probe for binding to a partial sequence of the target nucleotide with a partial sequence of the unique artificial nucleotide.

2. The composition of claim 1, further comprising a primer set specific to the target nucleotide sequence.

3. The composition of claim 1, wherein the target nucleotide sequence to which the first probe binds is complementary to a partial sequence of the target nucleotide sequence to which the second probe binds.

4. The composition of claim 1, wherein the unique artificial nucleotide sequence of the positive control is inserted into the target nucleotide sequence.

5. The composition of claim 1, wherein the unique artificial nucleotide sequence of the positive control is located independently of the target nucleotide sequence.

6. The composition of claim 1, wherein the positive control consists of a nucleotide, and is a plasmid or oligonucleotide.

7. The composition of claim 1, wherein the unique artificial nucleotide sequence has a length of 15 mer to 35 mer, and the unique artificial nucleotide to which the second probe binds has a length of 5 mer to 20 mer.

8. A method for determining a false positive, comprising: a. preparing a sample of a positive control comprising a target nucleotide sequence and a unique artificial nucleotide sequence; b. preparing a test target group sample after obtaining a genome from a specimen; c. adding (i) a first probe that binds to a target nucleotide sequence, (ii) a second probe that binds to a partial sequence of the target nucleotide together with a partial sequence of the unique artificial nucleotide, and (iii) a primer set in each of the positive control and the test target group sample; d. performing polymerase chain reaction (PCR) for each of the positive control and the test target group sample after step c.; and e. determining as a true positive when only a signal corresponding to the first probe appears in the test target group as a result of polymerase chain reaction (PCR).

9. The method of claim 8, further comprising: determining as a false positive when a signal corresponding to each of the first probe and the second probe appears in the test target group sample; and determining as a negative when signals corresponding to the first probe and the second probe do not appear.

10. The method of claim 8, wherein the primer set in step b. is specific to a target nucleotide sequence.

11. The method of claim 8, wherein the target nucleotide sequence to which the first probe binds in step c. is complementary to a partial sequence of the target nucleotide sequence to which the second probe binds.

12. The method of claim 8, wherein the unique artificial nucleotide sequence of the positive control is inserted into a target nucleotide sequence.

13. The method of claim 8, wherein the unique artificial nucleotide sequence of the positive control is located independently of a target nucleotide sequence.

14. The method of claim 8, wherein the positive control consists of a nucleotide, and is a plasmid or oligonucleotide.

15. The method of claim 8, wherein the unique artificial nucleotide sequence has a length of 15 mer to 35 mer, and the unique artificial nucleotide to which the second probe binds has a length of 5 mer to 20 mer.

Description

DESCRIPTION OF DRAWINGS

[0032] FIG. 1 is a mimetic PCR diagram showing whether a probe is bound according to the presence or absence of a unique artificial nucleotide.

[0033] FIG. 2 is a mimetic PCR diagram of a positive control in which multiple different target nucleotide sequences are present.

[0034] FIG. 3 is an image confirming whether it is determined as positive according to the presence or absence of a unique artificial nucleotide.

[0035] FIG. 4 shows the gene sequences of a positive control, a probe, a target nucleotide, and a primer prepared according to an experimental example of the present invention.

[0036] FIG. 5 is a mimetic diagram showing the coupling relationship between template A (SEQ ID NO:16), a second S probe (SEQ ID NO:24), and a second O probe (SEQ ID NO:25) prepared according to an exemplary embodiment of the present invention, respectively.

[0037] FIG. 6 is a mimetic diagram showing the coupling relationship between template B (SEQ ID NO:17), a second S probe (SEQ ID NO:24), and a second O probe (SEQ ID NO:25) prepared according to an exemplary embodiment of the present invention, respectively.

[0038] FIG. 7 is the result that according to an exemplary embodiment of the present invention, when S gene was set as a target nucleotide, a second probe (a second S probe) that binds to a nucleotide sequence of the S gene; and a unique artificial nucleotide sequence was used to determine whether it was contaminated by a positive control (template A) including the nucleotide sequence of the S gene and the unique artificial nucleotide sequence. Referring to FIG. 7, a second S probe having high specificity was expressed (luminescent) in the positive control (template A), and it can be confirmed that contamination by the positive control (template A) could be detected using the second S probe.

[0039] FIG. 8 is the result that according to an exemplary embodiment of the present invention, when S gene was set as a target nucleotide, a second probe (a second S probe) that binds to a nucleotide sequence of the S gene; and a unique artificial nucleotide sequence was used to determine whether contamination by a gene (template B) not including the nucleotide sequence of the S gene was detected. Referring to FIG. 8, since a second S probe having high specificity only to the positive control (template A) of the corresponding experiment was not expressed (luminescent) in contamination by template B, it can be confirmed that contamination by a gene (template B), which is not the positive control, was not detected.

[0040] FIG. 9 is the result that according to an exemplary embodiment of the present invention, when ORF1ab gene was set as a target nucleotide, a second probe (a second O probe) that binds to a nucleotide sequence of the ORF1ab gene; and a unique artificial nucleotide sequence was used to confirm contamination by a positive control (template B) including the nucleotide sequence of the ORF1ab gene and the unique artificial nucleotide sequence. It can be confirmed that contamination by the positive control (template B) can be detected according to the expression (luminescence) of the second O probe having high specificity to the positive control (template B) of FIG. 9.

[0041] FIG. 10 is the result that according to an exemplary embodiment of the present invention, when ORF1ab gene was set as a target nucleotide, a second probe (a second O probe) that binds to a nucleotide sequence of the ORF1ab gene; and a unique artificial nucleotide sequence was used to confirm contamination by a gene (template A) not including the nucleotide sequence of the ORF1ab gene. Referring to FIG. 10, the second O probe having high specificity only to the positive control (template B) of the corresponding experiment was not expressed (luminescent) even when contaminated by template A, and it can be confirmed that contamination by a gene (template A), which is not the positive control, was not detected.

[0042] FIG. 11 is a mimetic diagram showing when binding of a false positive determining probe and a target nucleotide are not required as in the conventional inventions, since one type of false positive determining probes having an identical sequence is expressed (luminescent) depending only on the presence or absence of a unique artificial nucleotide, it may cause a determination error due to other unintended gene sequences in case of false-positive determination by the positive control.

MODES OF THE INVENTION

[0043] Hereinafter, preferred exemplary embodiments of the present invention will be described in detail. The advantages and features of the present invention will be apparent with reference to the exemplary embodiments described below for achieving the same. However, the present invention is not limited to the exemplary embodiments to be disclosed below, but may be implemented in a variety of different forms. However, these exemplary embodiments are provided to make the disclosure of the present invention complete, and to fully inform the scope of the invention to those skilled in the art to which the present invention pertains, and the present invention is defined by the scope of the claims. The same reference numerals refer to the same constitutional elements throughout the specification.

[0044] Unless otherwise defined, all terms (including technical and scientific terms) used in the present specification may be used as meanings that can be commonly understood by those of ordinary skill in the art to which the present invention pertains. In addition, terms that are defined in a commonly used dictionary are not interpreted ideally or excessively unless explicitly defined specifically. The terms used in the present specification are for explaining the exemplary embodiments and are not intended to limit the present invention. In the present specification, the singular form also includes the plural form unless specifically stated in the phrase.

[0045] As used herein, the term “polymerase chain reaction (PCR)” is also referred to as polymerase chain reaction, and it is a method of amplifying a specific gene to a level that can be analyzed or genetically engineered using a heat-resistant DNA polymerase. In general, polymerase chain reaction refers to a process of exponentially synthesizing DNA at a specific site by repeating a process of binding, polymerizing, and detaching again a primer having a nucleotide sequence corresponding to both ends of an amplification site to amplification target DNA through temperature cycling.

[0046] As used herein, the term “real-time polymerase chain reaction (PCR)” is also referred to as real-time PCR, and it is an analysis method that monitors the amplified product of polymerase chain reaction (PCR) in real time, and it is possible to accurately quantify which is difficult to measure only with the conventional polymerase chain reaction (PCR) method. Real-time polymerase chain reaction (PCR) may be used in various ways not only for quantitative analysis such as nucleotide expression analysis, but also for qualitative analysis such as diagnosis of pathogen infection. Real-time polymerase chain reaction (PCR) detects the amount of PCR amplified products using fluorescence.

[0047] Real-time polymerase chain reaction (PCR) using a dual-labeled probe may use a pair of primers for PCR amplification (i.e., a forward oligonucleotide primer and a reverse oligonucleotide primer), and a dual-labeled probe may be used a detection probe. The detection probe is a single-stranded oligonucleotide that hybridizes to the sense or antisense strand of target template DNA somewhere between the forward primer binding site and the reverse primer binding site. During the annealing step, the oligonucleotide detection probe is annealed into a single stranded template. As amplification occurs, the probe is cleaved and degraded by the 5-prime exonuclease activity of the DNA polymerase. Therefore, as the amplification of a specific template sequence occurs, the detection probe is degraded in an exponential amount. The detection probe of real-time PCR generally consists of a reporter (referred to as a reporter fluorescent dye or a reporter) and a dulling agent (also referred to as a quencher). In general, the fluorophore is attached to or near the 5-prime end of an oligonucleotide, and the quencher is attached to or near the 3-prime end of an oligonucleotide. For example, a reporter is bound to the 5′ end of a dual-labeled probe, and a quencher that absorbs fluorescence is bound to the 3′ end, and when annealing occurs, the fluorescence expressed by the quencher is absorbed, but in the continuing extension process, the fluorophore attached to the 5′ is released from the detection probe to express fluorescence by the action of the 5′->3′ exonuclease of Taq DNA polymerase. By measuring the amount of fluorescence, the amplification amount of a target nucleotide may be measured. That is, when amplification of more target nucleotides occurs, more oligonucleotide detection probes are cleaved, more fluorophores and quenchers are released, and as a result, fluorophores/quencher pairs are separated, thereby increasing the fluorescence emission amplitude. Through this, it can be seen that the specific probe is bound to the complementary nucleotide sequence and the corresponding nucleotide sequence is present.

[0048] In the present invention, as the substance used as a quencher, Black Hole Quencher (BHQ1, BHQ2, and BHQ3), Blackberry Quencher (BBQ650), Dabcyl and Eclipes quencher, and the like are used frequently, but are not limited thereto, and any substance that may suppress the fluorescence of a fluorophore through FRET may be applicable. In addition, as the reporter, a fluorophore emitting fluorescence between 400 nm and 800 nm may be used, and fluorophores such as FAM. HEX, TET, JOE, CY3, CY5, CAL Fluor560, CAL Flour610, ATTO565 NHS-ester, ROX NHS-ester, TexasRed NHS-ester, Yakima Yellow, and the like are mainly used, but are not limited thereto.

[0049] As used herein, the term “oligonucleotide” generally refers to a short-stranded DNA or RNA molecule synthesized in a laboratory for biology and genomics, biochemistry, and molecular biology researches or substantially for genetic testing.

[0050] As used herein, the term “plasmid” refers to a DNA molecule other than a chromosome capable of independently proliferating by being replicated in bacterial cells.

[0051] As used herein, the term “target nucleotide sequence” refers to a nucleotide sequence to be detected, and the term “unique artificial nucleotide sequence” refers to any arbitrarily specified nucleotide sequence. In the present specification, the unique artificial nucleotide sequence has a gene sequence different from the target nucleotide sequence.

[0052] As used herein, the term “test target group” refers to a gene obtained from a specimen to confirm the presence or absence of a target nucleotide sequence to be detected, and the term “positive control” refers to a synthesized gene in which the “target nucleotide sequence” is present.

[0053] As used herein, the term “positive” means that the target nucleotide sequence is present in the test target group, and the term “false positive” means that it is determined as positive even though the target nucleotide sequence is not present.

[0054] As used herein, the term “contamination” means that the nucleotide sequence of the “positive control” is introduced into the “test target group” in the air or through an experimenter, experimental equipment, or the like. In this case, as a result of real-time polymerase chain reaction (PCR), even when the target nucleotide sequence is not present in the “test target group”, it may appear that the target nucleotide sequence is present, which is referred to as “a false positive”.

[0055] When expressing the position of the gene sequence in the present specification, the term “independent” means that the gene sequence is not mixed (inserted between sequences) and the unique gene sequence is maintained.

[0056] Hereinafter, the present invention will be described in detail through exemplary embodiments.

Example 1. Determination of False Positives Using a Positive Control Including a Unique Artificial Nucleotide Sequence and a Target Nucleotide Sequence; And a Second Probe in which the Gene Sequence Binding to the Target Nucleotide is Partially Complementary to a First Probe

[0057] According to an exemplary embodiment of the present invention, the composition for determining a false positive may include a positive control including a target nucleotide sequence and a unique artificial nucleotide sequence; a first probe for binding to the target nucleotide sequence; and a second probe for simultaneously binding to a partial sequence of the target nucleotide and the unique artificial nucleotide sequence, and additionally, a primer set specific to the target nucleotide sequence may be included.

[0058] In this case, the positive control may consist of a double strand or a single strand, and preferably, it may be in the form of an oligonucleotide or a plasmid.

[0059] The “unique artificial nucleotide sequence” of the positive control may be inserted into the “target nucleotide sequence” or may be present independently.

[0060] A first probe that binds to a specific site of the target nucleotide sequence; a second probe that binds to the target nucleotide sequence and the unique artificial nucleotide sequence; and the target nucleotide sequence to which each thereof binds may be sequences that are partially complementary to each other.

[0061] The mimetic diagram of Example 1 is as shown in FIG. 1. Referring to FIG. 1, when a unique artificial nucleotide sequence is inserted into a target nucleotide sequence, a second probe according to the present invention may simultaneously bind to a partial sequence of a target nucleotide and a partial sequence of a unique artificial nucleotide. The second probe may bind to a template strand when a target nucleotide sequence and a unique artificial nucleotide sequence are present. On the other hand, when a unique artificial nucleotide sequence is not present in the template strand, the second probe may not bind to the template strand.

[0062] FIG. 2 is a mimetic diagram of a plasmid constitution of a positive control having multiple target nucleotide sequences. Referring to FIG. 2, a unique artificial nucleotide sequence may be inserted into a target nucleotide A sequence. In the case of multiple target nucleotides, primers and probes capable of binding to each nucleotide may be used, and in this case, since a unique artificial nucleotide is inserted into the sequence of the target nucleotide (A), it reacts even without a separate primer such that the unique artificial nucleotide may be recognized.

Example 2. Determination of False Positives Using a Positive Control Including a Unique Artificial Nucleotide Sequence and a Target Nucleotide Sequence in the Positive Control; and a Second Probe in which the Gene Sequence Binding to the Target Nucleotide is Different from a First Probe

[0063] The overall constitution is the same as in Example 1, but the sequence of the target nucleotide to which a second probe binds does not overlap with a first probe, and may be different.

Experimental Example 1

[0064] 1-1. Preparation of a Positive Control Including a Unique Artificial Nucleotide

[0065] In order to confirm whether to determine false positives according to the presence or absence of a unique artificial nucleotide, target nucleotides A, B, C, and D (internal control nucleotides) were inserted into a plasmid. In this case, a unique artificial nucleotide was inserted in the middle of the target nucleotide A sequence.

[0066] 1-2. Preparation of a Positive Control not Including a Unique Artificial Nucleotide

[0067] A positive control was prepared under the same conditions as in Experimental Example 1-1, except that no unique artificial nucleotide was inserted into the plasmid.

[0068] The gene sequences used in Experimental Examples 1-1 and 1-2 are shown in Table 1 below, and the ratios of the samples used in the preparation are shown in Table 2 below.

TABLE-US-00001 TABLE 1  Name Sequence (5′->3′) mer Plasmid DNA Plasmid- (template)- TATGCTTGGAACAGGAAGAGGCTCAGCA Including a ACTGTGTTGCTGATTATTCTGTCTCGACGC unique  TGCGTTGTTCCGCATCATTTTCCACTCTGT artificial CCCTCATGTGGGCGAGCTACCAGTGGCTT nucleotide ACCGCAAGGTTCTTCTTGAACGGTAATAA sequence AGGAGCTGGTGCCGTGGTATTCTTGCTAG TTAGAAGCCATCCTTACTGCGCTTCGAAC GAAGCGCAGTAAGGATGGCTAGATTTG GACCTGCGAGCGTTTTCTGACCTGAAG GCTCTGCGCGATACTTG TGGAGACAGC CGCTC-(SEQ ID NO: 1) Plasmid DNA Plasmid- (template)- TATGCTTGGAACAGGAAGAGGCTCAGCA Not including ACTGTGTTGCTGATTATTCTGTTGTTCCGC a unique ATCATTTTCCACTCTGTCCCTCATGTGGGC artificial GAGCTACCAGTGGCTTACCGCAAGGTTCT nucleotide TCTTGAACGGTAATAAAGGAGCTGGTGCC sequence GTGGTATTCTTGCTAGTTAGAAGCCATCCT TACTGCGCTTCGAACGAAGCGCAGTAAGG ATGGCTAGATTTGGACCTGCGAGCGTTTTC TGACCTGAAGGCTCTGCGCGATACTTGTGG AGACAGCCGCTC-(SEQ ID NO: 2) Target TATGCTTGGAACAGGAAGAG (SEQ ID 20 nucleotide A NO: 3) forward primer Target AGTGGAAAATGATGCGGAA  19 nucleotide A (SEQ ID NO: 4) reverse primer Target TCAGCAACTGTGTTGCTGATTATTCTGT 20 nucleotide A (SEQ ID NO: 5) probe (FAM) Target GTCCCTCATGTGGGCGA  17 nucleotide C (SEQ ID NO: 6) forward primer Target CACCAGCTCCTTTATTACCGTT  22 nucleotide C (SEQ ID NO: 7) reverse primer Target TACCAGTGGCTTACCGCAAGGTTCTTCT 28 nucleotide C (SEQ ID NO: 8) gene probe (HEX) Target GTGGTATTCTTGCTAGTTA  19 nucleotide B (SEQ ID NO: 9) forward primer Target GAAGGTTTTACAAGACTCA  19 nucleotide B (SEQ ID NO: 10) reverse primer Target AGCCATCCTTACTGCGCTTCG  19 nucleotide B (SEQ ID NO: 11) probe (Cy5) AGATTTGGACCTGCGAGCG  19 Internal  (SEQ ID NO: 12) control nucleotide forward primer GAGCGGCTGTCTCCACAAGT  20 Internal  (SEQ ID NO: 13) control nucleotide reverse primer Internal  TTCTGACCTGAAGGCTCTGCGCG 23 control (SEQ ID NO: 14) nucleotide probe (CalRed610) Unique ACGCAGCGTCGAGACAGAATAATCAGC 22 artificial (SEQ ID NO: 15) nucleotide probe (Cy5.5)

TABLE-US-00002 TABLE 2 Volume Final Sample (μL) concentration 2X RT-qPCR Master Mix 10 1X Target nucleotide A forward primer (20 μM) 0.25  0.5 μM Target nucleotide A reverse primer (20 μM) 0.25  0.5 μM Target nucleotide A probe (5 μM) 0.25 0.125 μM Target nucleotide C gene forward primer 0.25  0.5 μM (20 μM) Target nucleotide C reverse primer (20 μM) 0.25  0.5 μM Target nucleotide C probe (5 μM) 0.25 0.125 μM Target nucleotide B forward primer (20 μM) 0.25  0.5 μM Target nucleotide B reverse primer (20 μM) 0.25  0.5 μM Target nucleotide B probe (5 μM) 0.25 0.125 μM Internal control nucleotide forward primer 0.25  0.5 μM (20 μM) Internal control nucleotide reverse primer 0.25  0.5 μM (20 μM) Internal control nucleotide probe (5 μM) 0.25 0.125 μM Unique artificial nucleotide probe (5 μM) 0.25 0.125 μM Distilled water 1.75 — Template 5 — Final volume 20 —

[0069] The positive controls prepared according to Experimental Examples 1-1 and 1-2 were subjected to PCR under the conditions of Table 3 below.

TABLE-US-00003 TABLE 3 Step Temperature (° C.) Time Reverse transcription 50 20 min Initial denaturation 95 10 min Denaturation 95 15 sec × 45 cycles Annealing & extension 60 30 sec

[0070] The results of the PCR are shown in FIG. 3. Referring to FIG. 3, it can be seen that the plasmids of Experimental Examples 1-1 and 1-2 include all of the target nucleotides A, B, C, and D (internal control). However, unlike the positive control of Experimental Example 1-1 in which a unique artificial nucleotide is expressed, it can be seen that the positive control of Experimental Example 1-2 does not express a unique artificial nucleotide. According to this, it is possible to confirm whether a sample is contaminated by a positive control by the presence or absence of a unique artificial nucleotide.

Experimental Example 2

[0071] When a false positive determining probe (second probe) is expressed (luminescent) by another gene that is not intended (e.g., a gene that does not include a target nucleotide sequence), it is possible to clarify the determination of contamination by the positive control.

[0072] For example, when the target nucleotide sequence is S, template A (a unique artificial nucleotide sequence is inserted into sequence S) is used as a positive control, and a first probe (binding to a target nucleotide) and a second probe (binding only to a unique artificial nucleotide sequence) may be used as probes. However, in the previous experiment, when template B (a unique artificial nucleotide sequence is inserted into the orf1ab gene sequence) was used as a positive control, and the second probe was used in the same manner, expression (luminescence) by the second probe occurred even when contaminated by template B. and there is a problem that it is not possible to determine whether it is contamination by the previous experiment (template B) or whether it is a false positive by the positive control (template A) in the current experiment.

[0073] On the other hand, the present invention is characterized in that a second probe that binds to a unique artificial nucleotide may also bind to a partial sequence of a target gene. In the present invention, as the second probe is required to bind to the target nucleotide in the corresponding experiment, the second probe does not bind to a gene without the target nucleotide sequence in the corresponding experiment such that only false positives due to the positive control may be selectively determined in the current experiment, and thus, the accuracy of false-positive determination is high. 2-1. Preparation of Oligonucleotides

[0074] Template genes (A and B) were prepared as PCR targets of the present experiment. Template A (SEQ ID NO:16) includes the sequence of S gene and the sequence of a unique artificial nucleotide, and the sequence of the S gene includes the sequences of genes represented by S (F), S (R), and S probe (FAM). In the present experiment, the sequence of the unique artificial nucleotide of template A is ACGAGACCTACTG (SEQ ID NO:26), and the sequence of the unique artificial nucleotide of template B is ACGAGACCTACTGGT (SEQ ID NO:27).

[0075] Template B (SEQ ID NO: 17) includes the sequence of the Orf1ab gene and the sequence of a unique artificial nucleotide, and the sequence of the Orf1ab gene includes the sequences of genes represented by Orf1ab (F), orf1ab (R), and orf1ab-probe (HEX).

[0076] The second probes used in Experimental Example 2 are a second S probe including a partial sequence of the S gene, and a second O probe including a partial sequence of the Orf1ab gene.

[0077] The gene sequence used in the present experiment was prepared as shown in FIG. 4

[0078] 2-2. Determination of False Positives when the Target Nucleotide is S Gene

[0079] 2-2-1. Determination of False Positives Using the Second S Probe when Contaminated by the Positive Control (Template A)

[0080] When template A (including a target nucleotide sequence S and a unique artificial nucleotide sequence) was used as a positive control, a second probe (a second S probe) that binds to a partial sequence of the S gene was used to determine whether it was contaminated by the positive control.

[0081] In Experimental Example 2-2-1, it was confirmed whether the second probe (the second S probe) was expressed (luminescent) upon contamination by template A (positive control). After the template A and the second S probe prepared according to Example 2-2 above were mixed as shown in Table 4 below, PCR was performed on the mixed sample in the order shown in Table 5 below.

TABLE-US-00004 TABLE 4 Volume (μL) Template A 5 Add 2x MasterMix chemical 10 S (FAM) Forward primer (F) 20 μm 0.25 Reverse primer (R) 20 μm 0.25 First S probe  5 μm 0.25 Second S probe  5 μm 0.25 (Including partial sequence of s gene)

TABLE-US-00005 TABLE 5 Step Temperature (° C.) Time Reverse transcription 50 20 min Initial denaturation 95 10 min Denaturation 95 15 sec × 45 cycles Annealing & extension 60 30 sec

[0082] The results of Experiment 2-2-1 are as shown in FIG. 7. Referring to FIG. 7, since the second probe used in the present experiment is a second S probe that binds to a part of the S gene (a target nucleotide sequence), two peaks due to the first probe and the second probe are all detected. Accordingly, it can be seen that the target nucleotide (S gene) is present (peak by the first probe), and it is a false positive by the positive control (peak by the second probe).

[0083] That is, when the target nucleotide is the S gene, template A in which a unique artificial nucleotide sequence is inserted into the S gene may be used as a positive control. In this case, since it is possible to confirm the presence or absence of the target nucleotide sequence and the unique artificial nucleotide sequence by confirming the expression (luminescence) of the second S probe (binding to the S gene and the unique artificial nucleotide sequence), it is possible to determine that it is a false positive by the positive control.

[0084] 2-2-2. Confirmation of the Expression (Luminescence) of the Second S Probe when Contaminated by a Gene (Template B) Other than the Positive Control

[0085] When the target nucleotide sequence is the S gene, if the second probe is expressed (luminescent) even when contaminated by template B that does not include the target nucleotide sequence, it interferes with the false-positive determination by the positive control.

[0086] In the present experiment, in order to confirm whether the second probe (the second S probe) that requires binding to the target nucleotide sequence (S gene) is expressed (luminescent) when contaminated by template B, template B and the second probe prepared according to Example 2-2 above were mixed as shown in Table 6 below, and PCR was performed on the mixed sample in the same order as Table 5 above.

TABLE-US-00006 TABLE 6 Volume (μL) Template B 5 Add 2x MasterMix chemical 10 ORF1ab Forward primer (F) 20 μm 0.25 (HEX) Reverse primer (R) 20 μm 0.25 First O probe  5 μm 0.25 Second S probe  5 μm 0.25 (Including partial sequence of s gene)

[0087] The results of Experiment 2-2-2 are as shown in FIG. 8. Referring to FIG. 8, the second S probe used in the experiment requires binding to the S gene (*not the orf1ab gene) sequence, and there is no sequence to which the second S probe can bind in template B. and thus, the second S probe was not detected.

[0088] According to the present experiment, when contaminated by template B in which the target nucleotide (gene S) sequence is not present, the second S probe is not expressed (luminescent).

[0089] That is, referring to Experimental Examples 2-2-1 and 2-2-2, the expression (luminescence) of the false-positive determining probe (second probe) means that both the target nucleotide sequence and the unique artificial nucleotide are present, and thus, it is possible to discriminate only false positives by the positive control (template A) by using the second probe.

[0090] 2-3. Determination of False Positives when Target Nucleotide is Orf1ab Gene

[0091] 2-3-1. Determination of False Positives Using a Second O Probe when Contaminated by Positive Control (Template B)

[0092] In the case of using template B (including the gene sequence of Orf1ab which is a target nucleotide sequence and a unique artificial nucleotide sequence) as a positive control, a second probe (second O probe) that binds to a partial sequence of the Orf1ab gene was used to confirm whether it was contaminated by the positive control.

[0093] In Experimental Example 2-3-1, it was confirmed whether it was expressed (luminescent) by the second probe (second O probe) when contaminated by the positive control template B.

[0094] After the template B and the second O probe prepared according to Example 2-2 above were mixed as shown in Table 7 below, PCR was performed on the mixed sample in the order shown in Table 5.

TABLE-US-00007 TABLE 7 Volume (μL) Template B 5 Add 2x MasterMix chemical 10 ORF1ab Forward primer (F) 20 μm 0.25 (HEX) Reverse primer (R) 20 μm 0.25 First O probe  5 μm 0.25 Second O probe  5 μm 0.25 (Including partial sequence of Orf1ab probe)

[0095] The results of Experiment 2-3-1 are as shown in FIG. 9. Referring to FIG. 9, by using the second O probe (binding to a part of the Orf1ab gene sequence which is a target nucleotide) as a second probe used in the present experiment, two peaks by the first probe and the second probe were all detected. Accordingly, it can be seen that the positive control gene (template B) was present (a first probe peak) and it was a false positive (a peak by the second probe) by the positive control.

[0096] That is, when the target nucleotide is the Orf1ab gene, template B (a unique artificial nucleotide sequence is inserted into the target nucleotide Orf1ab sequence) may be used as a positive control. In this case, since it is possible to confirm the presence or absence of the target nucleotide sequence and the unique artificial nucleotide sequence by confirming the expression (luminescence) of the 2 O probe that binds to a partial sequence of the Orf1ab gene and a partial sequence of the unique artificial nucleotide, it is possible to determine a false positive by the positive control.

[0097] 2-3-2. Confirmation of Expression (Luminescence) of Second O Probe when Contaminated by a Gene (Template A) that is not a Positive Control

[0098] When the target nucleotide is the Orf1ab gene, if the second probe is expressed even when contaminated by template A that does not include the target nucleotide sequence, it interferes with the false-positive determination by the positive control.

[0099] In the present experiment, in order to confirm whether the second probe (the second O probe) including the target nucleotide sequence (S gene) is expressed (luminescent) when contaminated by template A, the template A and the second O probe prepared according to Example 2-2 above were mixed as shown in Table 8 below, and PCR was performed on the mixed sample in the order as shown in Table 5 above.

TABLE-US-00008 TABLE 8 Volume (μL) Template A 5 Add 2x MasterMix chemical 10 S (FAM) Forward prime (F) 20 μm 0.25 Reverse primer (R) 20 μm 0.25 First S probe  5 μm 0.25 Second O probe  5 μm 0.25 (Including partial sequence of Orf1ab probe)

[0100] The results of Experiment 2-3-2 are as shown in FIG. 10. Referring to FIG. 10, the second O probe used in the experiment is required to bind to a part of the ORF1ab gene (*not S gene) sequence. In template A, since the ORF1ab gene sequence to which the second O probe can bind is not present, the second O probe is not detected. According to the present experiment, when contaminated by template A in which the target nucleotide (ORF1ab gene) sequence is not present, the 2 O probe is not expressed (luminescent).

[0101] If the second probe does not bind to a partial sequence of the target nucleotide (refer to FIG. 11), when the experiment equipment and the like are contaminated by the experiment (using A kit in FIG. 11) before the current experiment (using B kit in FIG. 11), there is a problem that the second probe is expressed (luminescent) by the residue of the previous experiment (template A, SEQ ID NO:16, in FIG. 11). In this case, even if the target gene sequence is not present in the test target group, a false positive determining probe (second probe; SEQ ID NO:28) is expressed (luminescent) in the test target group and the negative control, which interferes with the false positive determination by the positive control.

[0102] That is, in the case of using a false-positive determining probe (second probe) that binds to a target nucleotide and a unique artificial nucleotide, if an established unique target nucleotide is not present, the false-positive detection probe (second probe) is not detected. Therefore, when the present invention is used, it may be confirmed only whether it is contaminated by the positive control including the established unique target nucleotide.

[0103] According to the present invention, even when there are multiple target nucleotides, it is possible to determine the contamination only by the corresponding target nucleotide by specifying the target nucleotide.

[0104] The present invention has been illustrated and described with reference to preferred exemplary embodiments and experimental examples as described above, but is not limited to the above-described exemplary embodiments and experimental examples, and various changes and modifications may be made by those of ordinary skill in the art to which the present invention pertains within the scope not departing from the object of the present invention.