Recombinant adeno-associated virus delivery of exon 2-targeted U7SNRNA polynucleotide constructs
11230707 · 2022-01-25
Assignee
Inventors
- Kevin Flanigan (Columbus, OH, US)
- Adeline Vulin-Chaffiol (Columbus, OH, US)
- Nicolas Wein (Columbus, OH, US)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
C12N2750/14321
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2750/14333
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N2750/14132
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2750/14121
CHEMISTRY; METALLURGY
A01K2217/072
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to recombinant adeno-associated virus (rAAV) delivery of polynucleotides for treating Duchenne Muscular Dystrophy resulting from the duplication of DMD exon 2. The invention provides rAAV products and methods of using the rAAV in the treatment of Duchenne Muscular Dystrophy.
Claims
1. A recombinant adeno-associated virus (rAAV) comprising a genome comprising at least one Duchenne Muscular Dystrophy (DMD) exon 2-targeted U7snRNA polynucleotide construct, wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises the nucleotide sequence of any one of SEQ ID NOs: 4, 5, 7 and 8.
2. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises the nucleotide sequence of SEQ ID NO: 7.
3. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises the nucleotide sequence of SEQ ID NO: 8.
4. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences, each sequence comprising SEQ ID NO: 7.
5. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences, each sequence comprising SEQ ID NO: 8.
6. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences comprising the nucleotide sequence of SEQ ID NO: 7 and/or SEQ ID NO: 8.
7. The rAAV of claim 1 wherein the genome comprises in sequence four exon 2-targeted U7snRNA polynucleotide constructs comprising a first U7Along nucleotide sequence comprising SEQ ID NO: 7, a first U7C nucleotide sequence comprising SEQ ID NO: 8, a second U7C nucleotide sequence comprising SEQ ID NO: 8, and a second U7Along nucleotide sequence comprising SEQ ID NO: 7.
8. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises at least one nucleotide sequence comprising SEQ ID NO: 4 or 5.
9. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences comprising SEQ ID NO: 4 or 5.
10. The rAAV of claim 1 wherein the genome is a self-complementary genome and/or a single-stranded genome.
11. The rAAV of claim 1 wherein the rAAV is rAAV rh.74, rAAV-1, rAAV-2, rAAV-3, rAAV-4, rAAV-5, rAAV-6, rAAV-7, rAAV-8, rAAV-9, rAAV-10, or rAAV-11.
12. The rAAV of claim 11 wherein the rAAV is rAAV rh.74, rAAV-8, or rAAV-9.
13. The rAAV of claim 1 wherein the genome of the rAAV lacks AAV rep and cap DNA.
14. The rAAV of claim 1 further comprising an AAV rh.74 capsid, an AAV-1 capsid, an AAV-2 capsid, an AAV-3 capsid, an AAV-4 capsid, an AAV-5 capsid, an AAV-6 capsid, an AAV-7 capsid, an AAV-8 capsid, an AAV-9 capsid, an AAV-10 capsid, or an AAV-11 capsid.
15. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences, each sequence comprising SEQ ID NO: 4.
16. The rAAV of claim 1 wherein the at least one DMD exon 2-targeted U7snRNA polynucleotide construct comprises two or more nucleotide sequences, each sequence comprising SEQ ID NO: 5.
17. A composition comprising the rAAV of claim 1 and a carrier or diluent.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
EXAMPLES
(14) Aspects and embodiments of the invention are illustrated by the following examples.
Example 1
Isolation of AAV rh.74
(15) A unique AAV serotype was isolated from a rhesus macaque lymph node using a novel technique termed Linear Rolling Circle Amplification. Using the LRCA process, double-stranded circular AAV genomes were amplified from several rhesus macaques. The method is predicated on the ability to amplify circular AAV genomes by isothermic rolling circle amplification using phi29 phage DNA polymerase and AAV specific primers. LRCA products are contiguous head-to-tail arrays of the circular AAV genomes from which full-length AAV Rep-Cap molecular clones were isolated. Four isolates were sequenced and the predicted amino acid sequences for Rep and Cap ORFs were aligned and compared to previously published serotypes (Table). VP1 protein sequences were analyzed and revealed homology to the NHP AAV clades D, E, and AAV 4-like virus isolates. Analysis of the Rep78 (top portion of Table) ORF revealed strong homology to AAV 1 (98-99%).
(16) TABLE-US-00002 TABLE 1 AAV 1 AAV 4 AAV 7 AAV 8 rh.73 rh.74 rh.75 rh.76 AAV 1 90 98 95 98 98 99 AAV 4 63 90 87 90 90 90 AAV 7 85 63 96 97 98 98 AAV 8 84 63 88 97 97 95 rh.73 79 61 83 80 99 99 rh.74 84 63 88 93 80 99 rh.75 65 82 82 64 62 64 rh.76 85 63 91 86 84 86 84 Similarity of published AAV sequences and the new AAV sequences determined using one-pair alignment according to the Lipman-Pearson method implemented in the MegAlgn software in DNASTAR (DNASTAR Inc.) Light faced numbers (top, right) represent similarity in Rep78 sequences, whereas bold-faced numbers (lower, left) represent similarity in VP1 capsid sequences.
(17) One macaque tissue sample (rh426-M) yielded a divergent AAV8-like isolate termed rh.74 that shares 93% sequence identity with AAV8. The nucleotide sequence of the rh.74 genome is set out in
(18) The rh.74 capsid gene sequence was cloned into an AAV helper plasmid containing the Rep gene from AAV2 to provide vector replication functions for recombinant AAV vector production.
Example 2
DMD Models
(19) Examples of models of the DMD exon 2 duplication include in vivo and in vitro models as follows.
(20) mdx.sup.dup2 Mouse Model
(21) Mice carrying a duplication of exon 2 within the Dmd locus were developed. The exon 2 duplication mutation is the most common human duplication mutation and results in relatively severe DMD.
(22) First, from White et al., Hum. Mutat, 27(9): 938-945 (2006), the maximum extent of the 11 different human exon 2 duplications was examined by MLPA and long-range PCR. Results are shown in
(23) A map of the insertion vector is shown in
(24) Male C57BL/6 ES cells were transfected with the vector carrying the exon2 construct and then insertion was checked by PCR. One good clone was found, amplified and injected in dozens of albino BL/6 blastocysts. Injected blastocysts were implanted into recipient mice. The dystrophin gene from chimeric males was checked by PCR and then by RT-PCR. The colony was expanded and includes some female mice bred to homozygosity.
(25)
(26) Immortalized and Conditionally Inducible fibroMyoD Cell Lines
(27) Expression of the MyoD gene in mammalian fibroblasts results in transdifferentiation of cells into the myogenic lineage. Such cells can be further differentiated into myotubes, and they express muscle genes, including the DMD gene.
(28) Immortalized cell lines that conditionally express MyoD under the control of a tetracycline-inducible promoter were generated. This is achieved by stable transfection of the primary fibroblast lines of a lentivirus the tet-inducible MyoD and containing the human telomerase gene (TER). The resultant stable line allows MyoD expression to be initiated by treatment with doxycycline. Such cell lines were generated from patients with DMD who carry a duplication of exon 2.
(29) Using the line, duplication skipping using 2′-O-methyl antisense oligomers (AONs) provided by Dr. Steve Wilton (Perth, Australia) was demonstrated. Multiple cell lines were tested. Results from exemplary cells lines are shown in
(30) Transiently MyoD-Transfected Primary Cell Lines
(31) Proof-of-principle experiments using primary fibroblast lines transiently transfected with adenovirus-MyoD were conducted. The adenovirus constructs were not integrated in the cell genomes, yet MyoD was transiently expressed. The resulting DMD expression was sufficient to perform exon skipping experiments (although reproducibility favors the stably transfected lines.)
Example 3
Effectiveness of U7 snRNA-Mediated Skipping on Exon 2 Duplication Mutations
(32) Products and methods for virally-mediated exon skipping of duplicated exons were developed. The products and methods were modified compared to the U7snRNA systems described in Goyenvalle et al., Science, 306(5702): 1796-1799 (2004) or Goyenvalle et al., Mol. Ther., 20(6): 179601799 (2004).
(33) U7snRNA was modified to include a target antisense sequence to interfere with splicing at a given target exon (
(34) TABLE-US-00003 U7B (SEQ ID NO: 3) TCAAAAGAAAACATTCACAAAATGGGTA U7Along (SEQ ID NO: 4) GTTTTCTTTTGAAGATCTTCTCTTTCATcta U7Ashort (SEQ ID NO: 5) AGATCTTCTCTTTCATcta U7C (SEQ ID NO: 6) GCACAATTTTCTAAGGTAAGAAT
U7 snRNA constructs including the exon 2 target sequences were generated. Each U7 snRNA construct included one of the target sequences. U7 snRNA constructs targeted to selected other exons were also generated (based upon MyoD-transdifferentiated cell line studies, above). Self complementary (SC) AAV vectors with genomes including one or more of the U7 snRNA constructs were then produced.
(35) For experiments in cell culture and for intramuscular injection in Dup2 mice, rAAV1 vectors were utilized. Recombinant SC AAV vectors of a desired AAV serotype were produced by a modified cross-packaging approach using a plasmid comprising a desired vector genome by an adenovirus-free, triple plasmid DNA transfection (CaPO.sub.4 precipitation) method in HEK293 cells [Rabinowitz et al., J. Virol., 76:791-801 (2002)]. Vector was produced by co-transfecting with an AAV helper plasmid and an adenovirus helper plasmid in similar fashion as that previously described [Wang et al., Gene. Ther., 10:1528-1534 (2003)]. The adenovirus helper plasmid (pAdhelper) expresses the adenovirus type 5 E2A, E4ORF6, and VA I/II RNA genes which are required for high-titer rAAV production.
(36) Vectors were purified from clarified 293 cell lysates by sequential iodixanol gradient purification and anion-exchange column chromatography using a linear NaCl salt gradient as previously described [Clark et al., Hum. Gene Ther, 10:1031-1039 (1999)]. Vector genome (vg) titers were measured using QPCR based detection with a specific primer/probe set utilizing the Prism 7500 Taqman detector system (PE Applied Biosystems) as previously described (Clark et al., supra). Vector stock titers ranged between 1-10×10.sup.12 vg/mL.
(37) Initial exon-skipping analysis was by RT-PCR using the SC rAAV vectors to transduce Dup2 immortalized human fibromyoblasts. Dup 2 immortalized human fibroblasts that were able to transdifferentiate into muscle lineage cells under the control of doxycycline were produced by transduction with both telomerase-expressing and tet-inducible-MyoD expressing vectors. The converted human fibromyoblasts (FM) were then transduced with the SC rAAV carrying different U7 constructs incorporating exon 2 antisense sequences.
(38) RT-PCR results are shown in
(39) In subsequent experiments, exon-skipping efficiency was analyzed in vivo. The most efficient AAV-U7 vector, U7_ACCA SC rAAV1, was chosen for intramuscular injection in Dup2 mice. Results are shown below in
(40) Thus, a highly efficient AAV-mediated U7snRNA was designed to skip exon 2 allowing subsarcolemmal dystrophin restoration. Cardiac function; EDL and diaphragm force assessments; and treadmill and grip tests will be compared between untreated and treated mice.
(41) Based upon the degree of dystrophin expression detectable within the injected muscle, U7_ACCA SC rAAV was chosen for further experiments to be delivered intraveneously to a first cohort at 1E11 vg/kg, followed by dosing one log higher in a second cohort Injection will be performed at four weeks, and animals evaluated by physiologic assessment and histopathology at 10 and 24 weeks (n=8 animals per cohort) as described above.
Example 4
Intramuscular Delivery of U7-ACCA by AAV1 Results in Significant N-Truncated Dystrophin Expression in Dup2 Mice
(42) A rAAV1 comprising the genome insert of
(43) RT-PCR performed on DMD mRNA 4 weeks after TA intramuscular injection of 5e11vg AAV.1U7-ACCA showed nearly complete skipping of both copies of exon 2 in Dup2 animals [
(44) Immunoblot using a C-terminal antibody (PA1-21011, ThermoScientific) performed a month after infection showed significant expression of the N-truncated isoform (asterisk) in both Dup2 and control Bl6 mice [
(45) Immunofluorescent staining of dystrophin, β-dystroglycan, and neuronal nitric oxide synthase demonstrated restoration of members of the dystrophin associated complex [
(46) Normalized specific force following tetanic contraction in untreated Dup2 animals was significantly less than in Bl6 mice Intramuscular injection of AAV1.U7-ACCA, either alone or with prednisone, significantly increased force to levels that were not significantly different from that seen in Bl6 mice. No significant difference was observed between untreated Dup2 mice and those treated with prednisone along (Dup2+PDN) [
(47) Treatment significantly protected Dup2 muscle from loss of force following repetitive eccentric contractions, as assessed by published protocols (Hakim et al., supra). Treatment of Dup2 mice with AAV1.U7-ACCA alone resulted in a statistically significant improvement compared to untreated Dup2 mice. The combination of AAV1.U7-ACCA and prednisone resulted in no significant difference in comparison to control Bl6 mice in force retention following contractions #3 to #10 [
Example 5
Intravenous Injection of AAV9-U7_ACCA in the Dup2 Mouse Model Results in Significant Expression of the N-Truncated Isoform and Correction of Strength Deficit
(48) Based upon the degree of dystrophin expression detectable within injected muscle, we chose to deliver U7_ACCA SC rAAV intravenously for further experiments, and selected the serotype rAAV9 based upon known tissue distribution properties.
(49) A rAAV9 comprising the genome insert of
(50) RT-PCR was performed on five different Dup2 mouse muscles one month after tail vein injection of AAV9.U7-ACCA (3.3E12 vg/kg) [
(51) Western blot using a C-terminal antibody (PA1-21011, ThermoScientific) performed on five different muscles one month after injection demonstrated the presence of dystrophin in all tested muscles[
(52) Immunostaining using a C-terminal antibody (PA1-21011, ThermoScientific) of dystrophin on the same samples confirmed dystrophin expression and its proper localization at the sarcolemma [
(53) Evaluation of both forelimb and hindlimb grip strength demonstrated a complete correction of grip strength in Dup2 animals treated with AAV9.U7-ACCA [
(54) Normalized specific and total forces following tetanic contraction showed improvement in muscle force in comparison to untreated Dup2 animals [
(55) Cardiac papillary muscles demonstrated improvements in length-dependent force generation in treated animals [
(56) While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.
(57) All documents referred to in this application are hereby incorporated by reference in their entirety with particular attention to the content for which they are referred.