Concatemeric RNA molecules, compositions, and methods and uses thereof
11230708 · 2022-01-25
Assignee
Inventors
- Paula T. Hammond Cunningham (Newton, MA, US)
- Connie Wu (Cambridge, MA, US)
- Kevin E. Shopsowitz (Brookline, MA, US)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N2310/51
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to concatemeric RNA molecules, compositions, particles, and methods of uses thereof.
Claims
1. A concatemeric RNA molecule, comprising at least a first and a second repeat units, each of the first and the second repeat units including: a first segment having a first nucleotide sequence; a second segment having a second nucleotide sequence, complementary to the first nucleotide sequence; and a connecting segment covalently attached to the second segment, wherein the first segment and the second segment of at least one of the first or the second repeat units are not covalently attached.
2. A concatemeric RNA molecule, comprising at least a first and a second repeat units, each of the first and the second repeat units including: a first segment having a first nucleotide sequence; a second segment having a second nucleotide sequence, complementary to the first nucleotide sequence; and a connecting segment covalently attached to the second segment, wherein at least one of the first or the second repeat units further includes a loop segment having a loop nucleotide sequence, the loop segment being covalently attached to the first and the second segments, wherein the loop nucleotide sequence includes at least one enzyme-specific nucleotide sequence; said enzyme-specific nucleotide sequence is excluded from the connecting segment.
3. The concatemeric RNA molecule of claim 2, wherein the first segment, the second segment, and the loop segment of at least one of the first or the second repeat units form a hairpin loop structure by non-covalent complementary nucleotide pairing of the first nucleotide sequence and the second nucleotide sequence.
4. The concatemeric RNA molecule of claim 2, wherein the enzyme is selected from the group consisting of RNAse T1, RNAse T2, RNase U2, RNase A, RNase H, and ribozyme.
5. The concatemeric RNA molecule of claim 2, wherein the enzyme-specific nucleotide sequence is a self-cleaving ribozyme sequence.
6. The concatemeric RNA molecule of claim 1, wherein each connecting segment contains 4 nucleotides to 20 nucleotides.
7. The concatemeric RNA molecule of claim 6, wherein the connecting segment contains 6 nucleotides or 12 nucleotides.
8. The concatemeric RNA molecule of claim 2, wherein the loop segment contains 4 nucleotides to 20 nucleotides.
9. The concatemeric RNA molecule of claim 8, wherein the loop segment contains 6 nucleotides or 12 nucleotides.
10. The concatemeric RNA molecule of claim 2, wherein the first and second segment form a double stranded stem segment comprising anti-sense and sense strands containing 19 nucleotides to 50 nucleotides.
11. The concatemeric RNA molecule of claim 2, wherein the first and second segment comprise a silencing sequence.
12. The concatemeric RNA molecule of claim 11, wherein the silencing sequence comprises an RNAi target sequence.
13. The concatemeric RNA molecule of claim 12, wherein the RNAi target sequence silences a human or non-human gene.
14. A pharmaceutical composition comprising the concatemeric RNA molecule of claim 2.
15. A particle comprising the concatemeric RNA molecule of Claim 2.
16. A method for generating a concatemeric RNA molecule comprising: (a) providing a DNA template; (b) transcribing said DNA template by rolling circle transcription (RCT) or rolling circle amplification (RCA) under appropriate conditions to yield a plurality of concatemeric RNA molecules; wherein the RNA molecule comprises at least a first and a second repeat units, each of the first and the second repeat units including: a first segment having a first nucleotide sequence; a second segment having a second nucleotide sequence, complementary to the first nucleotide sequence; a connecting segment covalently attached to the second segment, wherein the connecting segment of the first repeat unit is covalently attached to the first segment of the second repeat unit; and a loop segment having a loop nucleotide sequence, the loop segment being covalently attached to the first and the second segments, wherein the loop nucleotide sequence includes at least one enzyme-specific nucleotide sequence; said enzyme-specific nucleotide sequence is excluded from the connecting segment and (c) isolating the plurality of concatemeric RNA molecules.
17. The method of claim 16, wherein the DNA template comprises a dumbbell DNA template.
18. The method of claim 16, wherein the DNA template comprises a DNA molecule comprising a stem region, a first loop region, and a second loop region.
19. The method of claim 18, wherein the stem region of said DNA template comprises a double stranded DNA molecule contains 19 nucleotides to 50 nucleotides.
20. The method of claim 19, wherein the stem region of said DNA template comprises contains 25 nucleotides.
21. The method of claim 16, wherein the DNA template comprises a silencing sequence.
22. The method of claim 18, wherein the first and second loop region contains 4 nucleotides to 20 nucleotides.
23. The method of claim 22, wherein the first loop region of said DNA template contains 6 nucleotides and the second loop region contains 12 nucleotides.
24. The method of claim 22, wherein the first loop region of said DNA template contains 12 nucleotides and the second loop region contains 12 nucleotides.
25. The method of claim 22, wherein the first loop region of said DNA template comprises a nucleotide sequence having at least one Cytosine nucleotide.
26. The method of claim 25, wherein the first loop region of said DNA template comprises a nucleotide sequence having all Cytosine nucleotides.
27. The method of claim 25, wherein the first loop region of said DNA template comprises a nucleotide sequence having no Cytosine nucleotides.
28. The method of claim 22, wherein the second loop region of said DNA template comprises a nucleotide sequence having at least one Cytosine nucleotide.
29. The method of claim 28, wherein the second loop region of said DNA template comprises a nucleotide sequence having all Cytosine nucleotides.
30. The method of claim 28, wherein the second loop region of said DNA template comprises a nucleotide sequence having no Cytosine nucleotides.
31. The method of claim 25, wherein the first loop region of said DNA template comprises a Cytosine nucleotide at positions 1, 5, and 6 from the 5′ end of the first loop region.
32. The method of claim 25, wherein the first loop region of said DNA template comprises a Cytosine nucleotide at position 4 from the 5′ end of the first loop region.
33. The method of claim 16, further comprising a step (d), wherein the step (d) comprises contacting the isolated concatemeric RNA molecules of step (c) to at least one enzyme.
34. The method of claim 33, wherein the at least one enzyme is selected from the group consisting of RNAse T1, RNAse T2, RNase U2, RNase A, RNase H, and ribozyme.
35. The method of claim 16, wherein step (b) further includes contacting the DNA template by an RNA polymerase.
36. The method of claim 35, wherein the RNA polymerase is selected from T7 bacteriophage, phage T3, or phage SP6.
37. A method of gene silencing comprising administering to a subject in need thereof a therapeutically effective amount of the RNA molecule of claim 1 or claim 2.
38. The concatemeric RNA molecule of claim 1, wherein the first and second segment form a double stranded stem segment comprising anti-sense and sense strands containing 19 nucleotides to 50 nucleotides.
39. The concatemeric RNA molecule of claim 1, wherein the first and second segment comprise a silencing sequence.
40. The concatemeric RNA molecule of claim 39, wherein the silencing sequence comprises an RNAi target sequence.
41. The concatemeric RNA molecule of claim 40, wherein the RNAi target sequence silences a human or non-human gene.
42. A pharmaceutical composition comprising the concatemeric RNA molecule of claim 1.
43. A particle comprising the concatemeric RNA molecule of claim 1.
44. The concatemeric RNA molecule of claim 40, wherein the RNAi target sequence silences a non-human gene.
Description
BRIEF DESCRIPTION OF FIGURES
(1) The present invention will become more fully understood from the detailed description given herein below and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
DETAILED DESCRIPTION OF THE INVENTION
(30) A. Abbreviations and Definitions
(31) As used herein the abbreviations: “csiRNA” is equivalent to “p-shRNA” “csi25” is equivalent to “p-sh25” “open-ended csiRNA” is equivalent to “op-shRNA” “T1-csi25” is equivalent to “op-sh25”
(32) The term “concatemer,” is used interchangeably with “periodic” and used herein in the context of nucleic acid molecules, refers to a nucleic acid molecule, such as a RNA molecule, that contains multiple copies of the same RNA sequences linked in a series. “Concatemeric” is the adjective describing such RNA molecules. For example, a concatemer comprising ten copies of a specific sequence of nucleotides (e.g., [XYZ].sub.10), would comprise ten copies of the same specific sequence linked to each other in series, e.g., 5′-XYZXYZXYZXYZXYZXYZXYZXYZXYZXYZ-3′. A concatemer may comprise any number of copies of the repeat unit or sequence, e.g., at least 2 copies, at least 3 copies, at least 4 copies, at least 5 copies, at least 10 copies, at least 100 copies, at least 1000 copies, etc. A concatemer may be a linear nucleic acid molecule, or may be circular.
(33) The term “enzyme,” as used herein, refers to an protein, for example a RNase or a ribozyme, capable of cleaving a phosphodiester bond connecting nucleotide residues in a nucleic acid molecule. In some embodiments, an enzyme is a RNase or ribozyme, e.g., an enzyme that can bind a nucleic acid molecule and cleave a phosphodiester bond connecting nucleotide residues within the nucleic acid molecule. In some embodiments, an enzyme is a site-specific enzyme, binding and/or cleaving a specific phosphodiester bond within a specific nucleotide sequence, which is also referred to herein as the “recognition sequence,” the “enzyme target site,” or the “enzyme-specific nucleotide sequence.” In some embodiments, the enzyme is RNase T1, which cleaves the 3′ end of unpaired Guanines. In some embodiments, the enzyme is RNase T2, which cleaves all four unpaired residue but preferentially cleaves the 3′ end of Adenines. In some embodiments, the enzyme is RNase U2, which cleaves the 3′ end of unpaired Adenines. In some embodiments, the enzyme is RNase A, which cleaves the 3′ end of unpaired Cytosines and Uracils. In some embodiments, the enzyme-specific nucleotide sequence is a self-cleaving ribozyme sequence. In some embodiments, an enzyme recognizes a single stranded target site, while in other embodiments, an enzyme recognizes a double-stranded target site, for example a double-stranded DNA-RNA target site. For example, RNase H cleaves the 3′-O—P bond of RNA in a DNA/RNA duplex substrate to produce 3′-hydroxyl and 5′-phosphate terminated products.
(34) Unpaired nucleotides at the end of a double-stranded DNA or RNA molecule are referred to as “overhangs,” e.g., as “5′-overhang” or as “3′-overhang,” depending on whether the unpaired nucleotide(s) form(s) the 5′ or the 3′ end of the respective DNA or RNA strand. Double-stranded DNA or RNA molecule ends ending with unpaired nucleotide(s) are also referred to as sticky ends, as they can “stick to” other double-stranded DNA molecule ends comprising complementary unpaired nucleotide(s).
(35) The terms “nucleic acid” and “nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g. nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” encompasses RNA molecules, single and/or double-stranded RNA. Nucleic acids may be a non-naturally occurring molecule, e.g., a recombinant or synthetic DNA, RNA, or DNA/RNA hybrid, or including non-naturally occurring nucleotides or nucleosides. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
(36) Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5′ to 3′ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g. adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose), or modified phosphate groups(e.g., phosphorothioates and 5′-N-phosphoramidite linkages). In some embodiments, nucleic acids include phosphodiester backbone linkages; alternatively or additionally, in some embodiments, nucleic acids include one or more non-phosphodiester backbone linkages such as, for example, phosphorothioates and 5′-N-phosphoramidite linkages.
(37) The term “silencing sequence,” refers to a sequence within a nucleic acid molecule that is targeted by RNAi. In some embodiments, the silencing sequence comprises a RNAi target sequence that silences a human gene. In some embodiments, the silencing sequence comprises a RNAi target sequence that silences a non-human gene.
(38) The term “treat” refers to partially or completely alleviating, ameliorating, relieving, inhibiting, preventing (for at least a period of time), delaying onset of, reducing severity of, reducing frequency of and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition in a subject in need thereof. In some embodiments, treatment may be administered to a subject who does not exhibit symptoms, signs, or characteristics of a disease and/or exhibits only early symptoms, signs, and/or characteristics of the disease, for example for the purpose of decreasing the risk of developing pathology associated with the disease. In some embodiments, treatment may be administered after development of one or more symptoms, signs, and/or characteristics of the disease, disorder, or condition of interest (e.g., cancer, infection, etc).
(39) The phrase “rolling circle amplification” (RCA) and/or “rolling circle transcription” (RCT) refers to a methodology for production of concatemeric RNA molecules for use herein. Exemplary RCA strategies include, for example, single-primer initiated RCA and by various two-primer amplification methods such as ramification amplification (RAM), hyperbranched RCA, cascade RCA, and exponential RCA. In certain embodiments, RNA-containing molecules can be produced via rolling circle transcription (RCT). RCA/RCT may be particularly useful for production of long nucleic acid molecules, and/or furthermore may generate nucleic acid molecules. Those skilled in the art will appreciate that a nucleic acid molecule produced by RCA/RCT will typically have a nucleotide sequence comprising or consisting of multiple copies of the complement of the circular template being amplified.
(40) More details of RCA can be found in US Patent Application No. 2010/0189794, the contents of which are incorporated herein by reference. Features of the compositions and methods described in the application may be applied in various combinations in the embodiments described herein. In some embodiments, a first single-stranded nucleic acid molecule is formed by RCA. In some embodiments, the first single-stranded nucleic acid molecule is formed with the aid of a first primer and a nucleic acid polymerase. In some embodiments, a second single-stranded nucleic acid molecule is formed by amplifying the first single-stranded nucleic acid with the aid of a second primer and a polymerase. In some embodiments, a third single-stranded nucleic acid molecule is formed by amplifying the second single-stranded nucleic acid molecule with the aid of a third primer and a polymerase.
(41) A RCA can be repeated with as many primers as desired, e.g., 4, 5, 6, 7, 8, 9, 10 or more primers can be used. In some embodiments, a plurality of primers can be added to templates to form nucleic acid molecules, wherein the plurality can comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 primers. In some embodiments, more than 100 primers are used. In some embodiments, random fragments of short nucleic acid fragments, e.g., comprising digested or otherwise degraded DNAs, are used as non-specific primers to prime the formation of nucleic acid molecules using rolling circle amplification. As described herein and will be appreciated by those of skill in the art, polymerization reaction conditions can be adjusted as desired to form nucleic acid molecules and self-assembled particles. For example, reaction conditions that favor stringent nucleic acid hybridization, e.g., high temperature, can be used to favor more specific primer binding during amplification.
(42) The phrase “dumbbell template” or “dumbbell-shaped template” refers to a nucleotide template used for RCA/RCT as described herein is or comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), glycol nucleic acid (GNA) and/or threose nucleic acid (TNA). The template may comprise nucleotide sequence that includes one or more coding sequences, one or more non-coding sequences, and/or combinations thereof. The template may comprise nucleotide sequence that includes one or more silencing sequences, directed to one or more human or non-human gene of interest. In some embodiments, the dumbbell template comprises a stem region, a first loop region, and a second loop region. In some embodiments, the stem region of the dumbbell comprises a double stranded nucleotide molecule containing 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In some embodiments, the first and second loop region contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the first loop or second loop contains an enzyme cleavage site when transcribed. In some embodiments, the first loop of the DNA template contains an enzyme cleavage site and the second loop lacks the enzyme cleavage site contained in the first loop. When RCT/RCA is carried out with the aforementioned DNA template, the concatemeric RNA molecules contain an enzyme cleavage site in the loop segments, but the connecting segments lacks the enzyme cleavage site contained in the loop segments. Upon addition of an enzyme, cleavage occurs only at the enzyme cleavage site contained in the loop segment, whereas the connecting segments are left intact.
(43) As used herein, an “effective amount” refers to an amount of a therapeutic agent or a combination of therapeutic agents that is therapeutically or prophylactically sufficient to treat the target disorder. An effective amount will depend on the age, gender, and weight of the patient, the current medical condition of the patient, and the nature of the esophageal cancer being treated. Those of skill in the art will be able to determine appropriate dosages depending on these and other factors.
(44) As used herein, the term “subject” refers to a mammal, preferably a human, but can also mean an animal in need of veterinary treatment, e.g., companion animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like).
(45) The present invention, among other things, describes concatemeric RNA molecules, pharmaceutical compositions, particles, and methods and uses thereof.
(46) B. Concatemeric RNA Molecule
(47) Concatemeric RNA molecules are provided herein comprising at least a first and a second repeat units, each of the first and the second repeat units including: a first segment having a first nucleotide sequence; a second segment having a second nucleotide sequence, complementary to the first nucleotide sequence; and a connecting segment covalently attached to the second segment, wherein the connecting segment of the first repeat unit is covalently attached to the first segment of the second repeat unit. In some embodiments, the concatemeric RNA molecules may comprise one, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, twenty-five, thirty, thirty-five, forty, forty-five, fifty, fifty-five, sixty, sixty-five, seventy, seventy-five, eighty, eighty-five, ninety, ninety-five, and one hundred repeat units. In some embodiments, the first segment and the second segment of at least one of the first or the second repeat units form a stem structure by non-covalent complementary nucleotide pairing of the first nucleotide sequence and the second nucleotide sequence.
(48) In some embodiments, the first segment and the second segment of at least one of the first or the second repeat units are not covalently attached. In some embodiments, at least one of the first or the second repeat units further includes a loop segment having a loop nucleotide sequence, the loop segment being covalently attached to the first and the second segments, wherein the loop nucleotide sequence includes at least one enzyme-specific nucleotide sequence. In some embodiments, the first segment, the second segment, and the loop segment of at least one of the first or the second repeat units form a hairpin loop structure by non-covalent complementary nucleotide pairing of the first nucleotide sequence and the second nucleotide sequence.
(49) In some embodiments, the enzyme is selected from the group consisting of RNAse T1, RNAse T2, RNase U2, RNase A, RNase H, and ribozyme. In some embodiments, the enzyme-specific nucleotide sequence is a self-cleaving ribozyme sequence. In some embodiments, the connecting segment contains 4 nucleotides to 20 nucleotides. In some embodiments, the connecting segment contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the connecting segment contains 6 nucleotides or 12 nucleotides. In some embodiments, the loop segment contains 4 nucleotides to 20 nucleotides. Upon cleavage, each open end may contain overhangs, up to the number of nucleotides in the original loop segment. In some embodiments, the loop segment contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the loop segment contains 6 nucleotides or 12 nucleotides. Certain concatemeric RNA molecules are designed such that the loop segment to be cleaved contain one or more of the nucleotides that the RNase specifically cuts, and the connecting segments do not contain that nucleotide. In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 1-7. Such sequences may be digested by RNase T1.
(50) TABLE-US-00001 (SEQ ID NO: 1) 5′-GGUCAG-3′; (SEQ ID NO: 2) 5′-AACUUCCUAUCA-3′; (SEQ ID NO: 3) 5′-AAGAAA-3′; (SEQ ID NO: 4) 5′-GGGGGGGGGGGG-3′; (SEQ ID NO: 5) 5′-AUAUCA-3′; (SEQ ID NO: 6) 5′-GGCUUCCUAUGG-3′; and (SEQ ID NO: 7) 5′-GGGGGG-3′.
(51) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 8-10. Such sequences may be digested by RNase T2.
(52) TABLE-US-00002 (SEQ ID NO: 8) 5′-AAAAAA-3′; (SEQ ID NO: 9) 5′-CCACCC-3′; and (SEQ ID NO: 10) 5′-ACUUCCUGGCCA-3′.
(53) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 11-14. Such sequences may be digested by RNase U2.
(54) TABLE-US-00003 (SEQ ID NO: 11) 5′-AAAAAA-3′; (SEQ ID NO: 12) 5′-AAAGGG-3′; (SEQ ID NO: 13) 5′-CCACCC-3′; and (SEQ ID NO: 14) 5′-ACUUCCUGGCCA-3′.
(55) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 15-18. Such sequences may be digested by RNase A.
(56) TABLE-US-00004 (SEQ ID NO: 15) 5′-CCCCCC-3′; (SEQ ID NO: 16) 5′-UUUUUU-3′; (SEQ ID NO: 17) 5′-CUUCUU-3′; and (SEQ ID NO: 18) 5′-CGUUACU-3′.
(57) In some embodiments, the connecting or loop segment comprises the nucleic acid sequence set forth in SEQ ID NO: 19. Such sequences may be digested by Ribozyme. 5′-CGCGGCAUUAAUGCAGCUUUAUUGCC-3′ (SEQ ID NO: 19).
(58) In some embodiments, the nucleic acid sequences set forth in SEQ ID NOs: 1-7 may comprise substitutions and additions such that the sequences can be cleaved by RNAse T2, RNase U2, RNase A, RNase H, and ribozyme. A substitution may comprise the replacement of one or more nucleotides by different nucleotides, respectively, as compared to a nucleotide sequence of a parental fragment thereof. In some embodiments, the first and second segment form a double stranded stem segment comprising anti-sense and sense strands containing 19 nucleotides to 50 nucleotides. In some embodiments, the stem segment may comprise 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In some embodiments, the first and second segment comprises a Drosha recognized cleavage site and a Dicer recognized cleavage site. In some embodiments, the Drosha recognized cleavage site and the Dicer recognized cleavage site may be spaced and connected by the silencing sequence.
(59) In some embodiments, the first and second segment comprise a silencing sequence. In some embodiments, the silencing sequence comprises an RNAi target sequence. In some embodiments, the RNAi target sequence comprises antisense and sense strands ranging from 19 to 50 base pairs, with or without base pair mismatches for improved RCT yield. In some embodiments, the RNAi target sequence silences any human or non-human gene associated with a particular disease, disorder, or condition of interest (e.g., cancer, infection, neurological disorder, metabolic disease, inflammation, etc). Other diseases include, but not limited to, persistent infectious disease, proliferative diseases, neurodegenerative diseases, cancers, psychological diseases, metabolic diseases, autoimmune diseases, sexually transmitted diseases, gastro-intestinal diseases, pulmonary diseases, cardiovascular diseases, stress- and fatigue-related disorders, fungal diseases, pathogenic diseases, obesity-related disorders, viral infections, bacterial infections, or biomarkers regarding same. Viral infectious diseases including human papilloma virus (HPV), hepatitis A Virus (HAV), hepatitis B Virus (HBV), hepatitis C Virus (HCV), retroviruses such as human immunodeficiency virus (HIV-1 and HIV-2), herpes viruses such as Epstein Barr Virus (EBV), cytomegalovirus (CMV), HSV-1 and HSV-2, influenza virus, Hepatitis A and B, FIV, lentiviruses, pestiviruses, West Nile Virus, measles, smallpox, cowpox, ebola, coronavirus, retrovirus, herpesvirus, potato S virus, simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV) promoter, Moloney virus, ALV, Cytomegalovirus (CMV), Epstein Barr Virus (EBV), or Rous Sarcoma Virus (RSV). The aptamers of the present invention may detect antigens, antibodies, or other analytes associated with pathogens such as various parasites, like malaria. In addition, bacterial, fungal and other pathogenic diseases are included, such as Aspergillus, Brugia, Candida, Chikungunya, Chlamydia, Coccidia, Cryptococcus, Dengue, Dirofilaria, Gonococcus, Histoplasma, Leishmania, Mycobacterium, Mycoplasma, Paramecium, Pertussis, Plasmodium, Pneumococcus, Pneumocystis, P. vivax in Anopheles mosquito vectors, Rickettsia, Salmonella, Shigella, Staphylococcus, Streptococcus, Toxoplasma and Vibriocholerae. Exemplary species include Neisseria gonorrhea, Mycobacterium tuberculosis, Candida albicans, Candida tropicalis, Trichomonas vaginalis, Haemophilus vaginalis, Group B Streptococcus sp., Microplasma hominis, Hemophilus ducreyi, Granuloma inguinale, Lymphopathia venereum, Treponema pallidum, Brucella abortus, Brucella melitensis, Brucella suis, Brucella canis, Campylobacter fetus, Campylobacter fetus intestinalis, Leptospira pomona, Listeria monocytogenes, Brucella ovis, Chlamydia psittaci, Trichomonas foetus, Toxoplasma gondii, Escherichia coli, Actinobacillus equuli, Salmonella abortus ovis, Salmonella abortus equi, Pseudomonas aeruginosa, Corynebacterium equi, Corynebacterium pyogenes, Actinobaccilus seminis, Mycoplasma bovigenitalium, Aspergillus fumigatus, Absidia ramosa, Trypanosoma equiperdum, Clostridium tetani, Clostridium botulinum; or, a fungus, such as, e.g., Paracoccidioides brasiliensis; or other pathogen, e.g., Plasmodium falciparum. Also included are National Institute of Allergy and Infectious Diseases (NIAID) priority pathogens. These include Category A agents, such as variola major (smallpox), Bacillus anthraces (anthrax), Yersinia pestis (plague), Clostridium botulinum toxin (botulism), Francisella tularensis (tularaemia), filoviruses (Ebola hemorrhagic fever, Marburg hemorrhagic fever), arenaviruses (Lassa (Lassa fever), Junin (Argentine hemorrhagic fever) and related viruses); Category B agents, such as Coxiella burnetti (Q fever), Brucella species (brucellosis), Burkholderia mallei (glanders), alphaviruses (Venezuelan encephalomyelitis, eastern & western equine encephalomyelitis), ricin toxin from Ricinus communis (castor beans), epsilon toxin of Clostridium perfringens; Staphylococcus enterotoxin B, Salmonella species, Shigella dysenteriae, Escherichia coli strain O157:H7, Vibrio cholerae, Cryptosporidium parvum; Category C agents, such as nipah virus, hantaviruses, yellow fever in Aedes mosquitoes, and multidrug-resistant tuberculosis; helminths, such as Schistosoma and Taenia; and protozoa, such as Leishmania (e.g., L. mexicana) in sand flies, Plasmodium, Chagas disease in assassin bugs.
(60) Bacterial pathogens include, but are not limited to, such as bacterial pathogenic gram-positive cocci, which include but are not limited to: pneumococci; staphylococci; and streptococci. Pathogenic gram-negative cocci include: meningococci; and gonococci. Pathogenic enteric gram-negative bacilli include: enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigellosis; hemophilus; chancroid; brucellosis; tularemia; yersinia (pasteurella); streptobacillus moniliformis and spirilum; listeria monocytogenes; erysipelothrix rhusiopathiae; diphtheria; cholera; anthrax; and donovanosis (granuloma inguinale). Pathogenic anaerobic bacteria include; tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include: syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis. Other infections caused by higher pathogen bacteria and pathogenic fungi include: actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis. Rickettsial infections include rickettsial and rickettsioses. Examples of mycoplasma and chlamydial infections include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic protozoans and helminths and infections eukaryotes thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; pneumocystis carinii; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
(61) The term “cancer” as used herein refers to an abnormal growth of cells which tend to proliferate in an uncontrolled way and, in some cases, to metastasize (spread). The types of cancer include, but is not limited to, solid tumors (such as those of the bladder, bowel, brain, breast, endometrium, heart, kidney, lung, uterus, lymphatic tissue (lymphoma), ovary, pancreas or other endocrine organ (thyroid), prostate, skin (melanoma or basal cell cancer) or hematological tumors (such as the leukemias and lymphomas) at any stage of the disease with or without metastases.
(62) Additional non-limiting examples of cancers include, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytomas, atypical teratoid/rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer (osteosarcoma and malignant fibrous histiocytoma), brain stem glioma, brain tumors, brain and spinal cord tumors, breast cancer, bronchial tumors, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-Cell lymphoma, embryonal tumors, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing sarcoma family of tumors, eye cancer, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gastrointestinal stromal cell tumor, germ cell tumor, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumors (endocrine pancreas), Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leukemia, Acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, hairy cell leukemia, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, Burkitt lymphoma, cutaneous T-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, lymphoma, Waldenstrom macroglobulinemia, medulloblastoma, medulloepithelioma, melanoma, mesothelioma, mouth cancer, chronic myelogenous leukemia, myeloid leukemia, multiple myeloma, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma, malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Ewing sarcoma family of tumors, sarcoma, kaposi, Sezary syndrome, skin cancer, small cell Lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, Wilms tumor.
(63) In some embodiments, the gene can be, but not limited to, to brain derived neurotrophic factor (BDNF), glial derived neurotrophic factor (GDNF), neurotrophic factor 3 (NT3), fibroblast growth factor (FGF), transforming growth factor (TGF), platelet transforming growth factor, milk growth factor, endothelial growth factors (EGF), endothelial cell-derived growth factors (ECDGF), alpha-endothelial growth factors, beta-endothelial growth factor, neurotrophic growth factor, nerve growth factor (NGF), vascular endothelial growth factor (VEGF), 4-1 BB receptor (4-1BBR), TRAIL (TNF-related apoptosis inducing ligand), artemin (GFRalpha3-RET ligand), BCA-1 (B cell-attracting chemokinel), B lymphocyte chemoattractant (BLC), B cell maturation protein (BCMA), brain-derived neurotrophic factor (BDNF), bone growth factor such as osteoprotegerin (OPG), bone-derived growth factor, megakaryocyte derived growth factor (MGDF), keratinocyte growth factor (KGF), thrombopoietin, platelet-derived growth factor (PGDF), megakaryocyte derived growth factor (MGDF), keratinocyte growth factor (KGF), platelet-derived growth factor (PGDF), bone morphogenetic protein 2 (BMP2), BRAK, C-10, Cardiotrophin 1 (CT1), other chemokines, interleukins and combinations thereof.
(64) Upon cleavage of the enzyme-specific nucleotide sequence by an RNase selected from the group consisting of RNAse T1, RNAse T2, RNase U2, RNase A, RNase H, and ribozyme, the concatemeric RNA molecule has enhanced properties. Such enhanced properties include, but not limited to, enhanced Dicer processing efficiency, enhanced target knockdown capabilities, enhanced silencing activity, improved stability, and decreased toxicity when introduced into a cell or subject in need thereof. The enzyme Dicer cuts double-stranded RNA molecule into approximately 21-nt RNA duplexes in the cytoplasm, where it can be converted to siRNA by the RNA-induced silencing complex (RISC) for gene silencing. The enhanced Dicer processing efficiency can be measured as an increased percent conversion of the concatemeric RNA molecules into siRNA fragments. The increased percent conversion may comprise about 70%, 75%, 80%, 85%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% conversion of the concatemeric RNA molecules into siRNA fragments. The enhanced target knockdown can be measured as an increased percent knockdown of a RNAi target sequence of about 70%, 75%, 80%, 85%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% knockdown of the human or non-human gene. The enhanced silencing activity can be measured as an sustained or prolonged silencing duration or time period of the concatemeric RNA molecules of up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.
(65) The present invention encompasses the recognition that the concatemeric RNA molecules can be designed and/or prepared to simultaneously deliver to a target site (e.g., to a cancer cell) a plurality of different nucleic acid agents (e.g., siRNAs), each of which is directed to a different specific molecular target of interest.
(66) C. Pharmaceutical Compositions
(67) In certain aspects, provided herein are pharmaceutical compositions comprising a concatemeric RNA molecule, as described above. In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the composition includes a combination of multiple (e.g., two or more) concatemeric RNA molecules.
(68) The pharmaceutical compositions disclosed herein may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation.
(69) Methods of preparing these formulations or compositions include the step of bringing into association any of the concatemeric RNA molecules described herein with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
(70) Pharmaceutical compositions suitable for parenteral administration comprise any of the concatemeric RNA molecules described herein in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
(71) Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
(72) Regardless of the route of administration selected, the agents provided herein, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions disclosed herein, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.
(73) In some embodiments, the pharmaceutical composition described herein, when administered to a subject, can be useful for silencing genes particular to any of the aforementioned diseases, disorders, and conditions. Said pharmaceutical compositions can be useful for the prophylactic and/or therapeutic treatment of these diseases, disorders, and conditions.
(74) D. Particles
(75) In certain aspects, provided herein are particles comprising the concatemeric RNA molecules of the present invention. Said particles can contain a particle core, which can optionally be coated by a film. Upon coating, a particle can be converted from a first configuration to a second configuration. In some embodiments, the greatest dimension of a particle (in its first or second configuration) may be greater or less than 5 μm, 2 μm, 1 μm, 800 nm, 500 nm, 200 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm, 10 nm, or even 5 nm. In some embodiments, the greatest dimension a particle (in its first or second configuration) may be in a range of any two values above. In some embodiments, a particle in a first configuration has the greatest dimension in a range of about 5 μm to about 2 μm or about 2 μm to about 1 .mu.m. In some embodiments, a particle in a second configuration has the greatest dimension in may be in a range of about 500 nm to about 200 nm, about 200 nm to about 100 nm or about 100 nm to about 50 nm. In some embodiments, a particle can be substantially spherical. In some embodiments, the dimension of a particle is a diameter, wherein the diameter can be in a range as mentioned above.
(76) In various embodiments, a particle described herein can comprise a particle core, a coating film (including one or more layers; in some embodiments one or more polyelectrolyte layers), and one or more agents such as diagnostic, therapeutic and/or targeting agents.
(77) i. Nucleic Acid-Containing Core
(78) A particle core can consist of or include one or more nucleic acid molecules. In some embodiments, a core is comprised of a plurality of nucleic acid molecules. Individual nucleic acid molecules within a core can have different nucleic acid sequences or substantially the same nucleic acid sequence. In some embodiments, nucleic acid molecule(s) within a core have sequences that share at least one common sequence element.
(79) In some embodiments, at least one nucleic acid molecule in a core has a nucleotide sequence that comprises multiple copies of at least a first sequence element. In some embodiments, at least one nucleic acid molecule in a core has a nucleotide sequence that comprises multiple copies of each of at least a first and a second sequence element. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that comprises alternating copies of the first and second sequence elements. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that comprises multiple copies of each of three or more sequence elements.
(80) In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that includes one or more sequence elements found in a natural source. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that includes a first sequence element that is found in a first natural source and a second sequence element that is found in a second natural source. The first and second natural sources can be the same or difference.
(81) In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that represents an assemblage of sequence elements found in one or more source nucleic acid molecules. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that represents an assemblage of at least two different sequence elements found in two different source nucleic acid molecules.
(82) In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that fold into higher order structures (e.g., double and/or triple-stranded structures). In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that comprise two or more complementary elements. In some embodiments, such complementary elements can form one or more (optionally alternative) stem-loop (e.g., hairpin) structures. In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that include one or more portions that remain single stranded (i.e., do not pair intra- or inter-molecularly with other core nucleic acid sequence elements).
(83) In some embodiments, at least one nucleic acid molecules in a core contains at least one cleavage site. In some embodiments, a cleavage site is a bond or location susceptible to cleavage by a cleaving agent such as a chemical, an enzyme (e.g., nuclease, dicer, DNAase and RNAase), radiation, temperature, etc. In some embodiments, the cleaving agent is a sequence specific cleaving agent in that it selectively cleaves nucleic acid molecules at a particular site or sequence.
(84) In some embodiments, at least one nucleic acid molecules in a core contains at least one cleavage site susceptible to cleavage after delivery or localization of a particle as described herein to a target site of interest. In some embodiment, nucleic acid molecule(s) in a core have a plurality of cleavage sites and/or are otherwise arranged and constructed so that multiple copies of a particular nucleic acid of interest are released at the target site, upon delivery of a particle as described herein.
(85) In some embodiments, nucleic acid molecule(s) within a core have a self-assembled structure and/or are characterized by an ability to self-assemble in that it/they fold(s) into a stable three-dimensional structure, typically including one or more non-covalent interactions that occur between or among different moieties within the nucleic acid, without requiring assistance of non-nucleic acid entities. In some embodiments, nucleic acid molecule(s) within a core are arranged in a crystalline structure comprising lamellar sheets. In some embodiments, a core comprises or consists of one or more entangled nucleic acid molecules.
(86) In some embodiments, nucleic acid molecule(s) in a core have a molecular weight greater than about 1×10.sup.10 g/mol, about 1×10.sup.9 g/mol, about 1×10.sup.8 g/mol, about 1×10.sup.7 g/mol, about 1×10.sup.6 g/mol, or about 1×10.sup.5 g/mol.
(87) As described herein, in some embodiments, nucleic acid molecule(s) in a core includes multiple copies of at least one sequence element (e.g., concatenated in one or more long nucleic acid molecules whose sequence comprises or consists of multiple copies of the sequence element, and/or as discrete nucleic acid molecules each of which has a sequence that comprises or consists of the element, or a combination of both) whose length is within the range between a lower length of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or more and an upper length of not more than 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30 or less, wherein the upper length is greater than the lower length.
(88) Particles described herein are characterized by a high loading of nucleic acids. In some embodiments, a particle core comprises at least about 1×10.sup.3, about 1×10.sup.4, about 1×10.sup.5, about 1×10.sup.6, about 1×10.sup.7, about 1×10.sup.8, about 1×10.sup.9, or about 1×10.sup.10 copies of a particular sequence element of interests. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of about 1×10.sup.3 to about 1×10.sup.4, about 1×10.sup.4 to about 1×10.sup.5, about 1×10.sup.5 to about 1×10.sup.6, about 1×10.sup.6 to about 1×10.sup.7, about 1×10.sup.7 to about 11×10.sup.8, about 11×10.sup.8 to about 11×10.sup.9, or about 11×10.sup.9 to about 11×10.sup.10. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of about 1×10.sup.3 to about 1×10.sup.10, about 1×10.sup.4 to about 1×10.sup.8 or about 1×10.sup.5 to about 1×10.sup.7. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of any two values above.
(89) ii. Coating Films
(90) Particles provided by the present invention may include a coating film on a nucleic acid-containing core. In some embodiments, a film substantially covers at least one surface of a particle core. In some embodiments, a film substantially encapsulates a core.
(91) A film can have an average thickness in various ranges. In some embodiments, an averaged thickness is about or less than 200 nm, 100 nm, 50 nm, 40 nm, 30 nm, 20 nm, 15 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or 0.1 nm. In some embodiments, an averaged thickness is in a range from about 0.1 nm to about 100 nm, about 0.5 nm to about 50 nm, or about 5 nm to about 20 nm. In some embodiments, an averaged thickness is in a range of any two values above.
(92) In some embodiments, a coating film include one or more layers. A plurality of layers each can respectively contain one or more materials. According to various embodiments of the present disclosure, a layer can consist of or comprise metal (e.g., gold, silver, and the like), semi-metal or non-metal, and metal/semi-metal/non-metal oxides such as silica (SiO.sub.2). In certain embodiments, a layer can consist of or comprise a magnetic material (e.g., iron oxide).
(93) Additionally or alternatively, materials of a layer can be polymers. For example, a layer can be polyethyleneimine as demonstrated in Example 1. In some embodiments, a layer is or includes one or more polymers, particularly polymers that which have been approved for use in humans by the U.S. Food and Drug Administration (FDA) under 21 C.F.R. § 177.2600, including, but not limited to, polyesters (e.g. polylactic acid, poly(lactic-co-glycolic acid), polycaprolactone, polyvalerolactone, poly(1,3-dioxan-2-one)); polyanhydrides (e.g. poly(sebacic anhydride)); polyethers (e.g., polyethylene glycol); polyurethanes; polymethacrylates; polyacrylates; polycyanoacrylates; copolymers of PEG and poly(ethylene oxide) (PEO). In some embodiments, a polymer is a lipid.
(94) In some embodiments, a layer is or includes at least a degradable material. Such a degradable material can be hydrolytically degradable, biodegradable, thermally degradable, enzymatically degradable, and/or photolytically degradable polyelectrolytes. In some embodiments, degradation may enable release of one or more agents associated with a particle described herein.
(95) Degradable polymers known in the art, include, for example, certain polyesters, polyanhydrides, polyorthoesters, polyphosphazenes, polyphosphoesters, certain polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, poly(amino acids), polyacetals, polyethers, biodegradable polycyanoacrylates, biodegradable polyurethanes and polysaccharides. For example, specific biodegradable polymers that may be used include but are not limited to polylysine (e.g., poly(L-lysine) (PLL)), poly(lactic acid) (PLA), poly(glycolic acid) (PGA), poly(caprolactone) (PCL), poly(lactide-co-glycolide) (PLG), poly(lactide-co-caprolactone) (PLC), and poly(glycolide-co-caprolactone) (PGC). Another exemplary degradable polymer is poly(beta-amino esters), which may be suitable for use in accordance with the present application.
(96) In some embodiments, layer-by-layer (LBL) films can be used alternatively or in addition to other layers to coat a particle core in accordance with the present invention. A LBL film may have any of a variety of film architectures (e.g., numbers of layers, thickness of individual layers, identity of materials within films, nature of surface chemistry, presence and/or degree of incorporated materials, etc), as appropriate to the design and application of a coated particle core as described herein. In certain embodiments, a LBL film may has a single layer.
(97) LBL films may be comprised of multilayer units in which alternating layers have opposite charges, such as alternating anionic and cationic layers. Alternatively or additionally, LBL films for use in accordance with the present invention may be comprised of (or include one or more) multilayer units in which adjacent layers are associated via other non-covalent interactions. Exemplary non-covalent interactions include, but are not limited to ionic interactions, hydrogen bonding interactions, affinity interactions, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, pi stacking interactions, van der Waals interactions, magnetic interactions, dipole-dipole interactions and combinations thereof Detailed description of LBL films can be found in U.S. Pat. No. 7,112,361, the contents of which are incorporated herein by reference. Features of the compositions and methods described in the patent may be applied in various combinations in the embodiments described herein.
(98) In some embodiments, a layer can have or be modified to have one or more functional groups. Apart from changing the surface charge by introducing or modifying surface functionality, functional groups (within or on the surface of a layer) can be used for association with any agents (e.g., detectable agents, targeting agents, or PEG).
(99) iii. Agents
(100) In some embodiments, the present invention provides compositions that comprise one or more agents. In some embodiments, one or more agents are associated independently with a core, a film coating the core, or both. For example, agents can be covalently linked to or hybridized to a nucleic acid-containing core, and/or encapsulated in a coating film of a particle described herein. In certain embodiments, an agent can be associated with one or more individual layers of an LBL film that is coated on a core, affording the opportunity for exquisite control of loading and/or release from the film.
(101) In theory, any agents including, for example, therapeutic agents (e.g. antibiotics, NSAIDs, glaucoma medications, angiogenesis inhibitors, neuroprotective agents), cytotoxic agents, diagnostic agents (e.g. contrast agents; radionuclides; and fluorescent, luminescent, and magnetic moieties), prophylactic agents (e.g. vaccines), and/or nutraceutical agents (e.g. vitamins, minerals, etc.) may be associated with the LBL film disclosed herein to be released.
(102) In some embodiments, compositions described herein include one or more therapeutic agents. Exemplary agents include, but are not limited to, small molecules (e.g. cytotoxic agents), nucleic acids (e.g., siRNA, RNAi, and microRNA agents), proteins (e.g. antibodies), peptides, lipids, carbohydrates, hormones, metals, radioactive elements and compounds, drugs, vaccines, immunological agents, etc., and/or combinations thereof. In some embodiments, a therapeutic agent to be delivered is an agent useful in combating inflammation and/or infection.
(103) In some embodiments, a therapeutic agent is or comprises a small molecule and/or organic compound with pharmaceutical activity. In some embodiments, a therapeutic agent is a clinically-used drug. In some embodiments, a therapeutic agent is or comprises an antibiotic, anti-viral agent, anesthetic, anticoagulant, anti-cancer agent, inhibitor of an enzyme, steroidal agent, anti-inflammatory agent, anti-neoplastic agent, antigen, vaccine, antibody, decongestant, antihypertensive, sedative, birth control agent, progestational agent, anti-cholinergic, analgesic, anti-depressant, anti-psychotic, β-adrenergic blocking agent, diuretic, cardiovascular active agent, vasoactive agent, anti-glaucoma agent, neuroprotectant, angiogenesis inhibitor, etc.
(104) In some embodiments, a therapeutic agent may be a mixture of pharmaceutically active agents. For example, a local anesthetic may be delivered in combination with an anti-inflammatory agent such as a steroid. Local anesthetics may also be administered with vasoactive agents such as epinephrine. To give but another example, an antibiotic may be combined with an inhibitor of the enzyme commonly produced by bacteria to inactivate the antibiotic (e.g., penicillin and clavulanic acid).
(105) In some embodiments, a therapeutic agent may be an antibiotic. Exemplary antibiotics include, but are not limited to, β-lactam antibiotics, macrolides, monobactams, rifamycins, tetracyclines, chloramphenicol, clindamycin, lincomycin, fusidic acid, novobiocin, fosfomycin, fusidate sodium, capreomycin, colistimethate, gramicidin, minocycline, doxycycline, bacitracin, erythromycin, nalidixic acid, vancomycin, and trimethoprim. For example, β-lactam antibiotics can be ampicillin, aziocillin, aztreonam, carbenicillin, cefoperazone, ceftriaxone, cephaloridine, cephalothin, cloxacillin, moxalactam, penicillin G, piperacillin, ticarcillin and any combination thereof.
(106) An antibiotic used in accordance with the present disclosure may be bacteriocidial or bacteriostatic. Other anti-microbial agents may also be used in accordance with the present disclosure. For example, anti-viral agents, anti-protazoal agents, anti-parasitic agents, etc. may be of use.
(107) In some embodiments, a therapeutic agent may be or comprise an anti-inflammatory agent. Anti-inflammatory agents may include corticosteroids (e.g., glucocorticoids), cycloplegics, non-steroidal anti-inflammatory drugs (NSAIDs), immune selective anti-inflammatory derivatives (ImSAIDs), and any combination thereof. Exemplary NSAIDs include, but not limited to, celecoxib (Celebrex®); rofecoxib (Vioxx®), etoricoxib (Arcoxia®), meloxicam (Mobic®), valdecoxib, diclofenac (Voltaren®, Cataflam®), etodolac (Lodine®), sulindac (Clinori®), aspirin, alclofenac, fenclofenac, diflunisal (Dolobid®), benorylate, fosfosal, salicylic acid including acetylsalicylic acid, sodium acetylsalicylic acid, calcium acetylsalicylic acid, and sodium salicylate; ibuprofen (Motrin), ketoprofen, carprofen, fenbufen, flurbiprofen, oxaprozin, suprofen, triaprofenic acid, fenoprofen, indoprofen, piroprofen, flufenamic, mefenamic, meclofenamic, niflumic, salsalate, rolmerin, fentiazac, tilomisole, oxyphenbutazone, phenylbutazone, apazone, feprazone, sudoxicam, isoxicam, tenoxicam, piroxicam (Feldene®), indomethacin (Indocin®), nabumetone (Relafen®), naproxen (Naprosyn®), tolmetin, lumiracoxib, parecoxib, licofelone (ML3000), including pharmaceutically acceptable salts, isomers, enantiomers, derivatives, prodrugs, crystal polymorphs, amorphous modifications, co-crystals and combinations thereof.
(108) Those skilled in the art will recognize that this is an exemplary, not comprehensive, list of agents that can be released using compositions and methods in accordance with the present disclosure. In addition to a therapeutic agent or alternatively, various other agents may be associated with a coated device in accordance with the present disclosure.
(109) More details of particle can be found in U.S. Patent Application No. US2014/0328931, the contents of which are incorporated herein by reference.
(110) E. DNA Templates
(111) The DNA template may comprise a stem region, a first loop region, and a second loop region. These regions together form a dumbbell DNA template. Each first and second loop region can comprise 4 nucleotides to 20 nucleotides. In some embodiments, the first and second loop region can comprise 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the first and second loop region can comprise the sequences comprises the nucleic acid sequences set forth in SEQ ID NOs: 20-26. Such sequences when transcribed by RCT/RCA may be digested by RNase T1.
(112) TABLE-US-00005 (SEQ ID NO: 20) 5′-CTGACC-3′; (SEQ ID NO: 21) 5′-TGATAGGAAGTT-3′; (SEQ ID NO: 22) 5′-TTTCTT-3′; (SEQ ID NO: 23) 5′-CCATAGGAAGCC-3′; (SEQ ID NO: 24) 5′-CCCCCCCCCCCC-3′; (SEQ ID NO: 25) 5′-TGATAT-3′; (SEQ ID NO: 26) 5′-CCCCCC-3′.
(113) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 27-29. Such sequences when transcribed by RCT/RCA may be digested by RNase T2.
(114) TABLE-US-00006 (SEQ ID NO: 27) 5′-TTTTTT-3′; (SEQ ID NO: 28) 5′-GGGTGG-3′; and (SEQ ID NO: 29) 5′-TGGCCAGGAAGT-3′.
(115) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 30-33. Such sequences when transcribed by RCT/RCA may be digested by RNase U2.
(116) TABLE-US-00007 (SEQ ID NO: 30) 5′-TTTTTT-3′; (SEQ ID NO: 31) 5′-GGGTTT-3′; (SEQ ID NO: 32) 5′-GGGTGG-3′; and (SEQ ID NO: 33) 5′-TGGCCAGGAAGT-3′.
(117) In some embodiments, the connecting or loop segment comprises the nucleic acid sequences set forth in SEQ ID NOs: 34-37. Such sequences when transcribed by RCT/RCA may be digested by RNase A.
(118) TABLE-US-00008 (SEQ ID NO: 34) 5′-GGGGGG-3′; (SEQ ID NO: 35) 5′-AAAAAA-3′; (SEQ ID NO: 36) 5′-AAGAAG-3′; and (SEQ ID NO: 37) 5′-AGTAACG-3′.
(119) In some embodiments, the connecting or loop segment comprises the nucleic acid sequence set forth in SEQ ID NO: 38. Such sequences when transcribed by RCT/RCA may be digested by Ribozyme.
(120) TABLE-US-00009 (SEQ ID NO: 38) 5′-GGCAATAAAGCTGCATTAATGCCGCG-3′.
(121) In some embodiments, the nucleic acid sequences set forth in SEQ ID NOs: 8-14 may comprise substitutions and additions such that the sequences can be cleaved by RNAse T2, RNase U2, RNase A, RNase H, and ribozyme. A substitution may comprise the replacement of one or more nucleotides by different nucleotides, respectively, as compared to a nucleotide sequence of a parental fragment thereof. In some embodiments, the stem region of the DNA template may comprise 19 to 50 nucleotides. In some embodiments, the stem region may comprise 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, to 50 nucleotides. In some embodiments, the stem region of said DNA template comprises contains 25 nucleotides. In some embodiments, the DNA template comprises a silencing sequence. In some embodiments, the first loop region of said DNA template comprises contains 6 nucleotides and the second loop region contains 12 nucleotides. In some embodiments, the first loop region of said DNA template comprises contains 12 nucleotides and the second loop region contains 12 nucleotides.
(122) In some embodiments, the first loop region of said DNA template comprises a nucleotide sequence having at least one Cytosine nucleotide. In some embodiments, the first loop region of said DNA template comprises a nucleotide sequence having all Cytosine nucleotides. In some embodiments, the first loop region of said DNA template comprises a nucleotide sequence having no Cytosine nucleotides. In some embodiments, the second loop region of said DNA template comprises a nucleotide sequence having at least one Cytosine nucleotide. In some embodiments, the second loop region of said DNA template comprises a nucleotide sequence having all Cytosine nucleotides. In some embodiments, the second loop region of said DNA template comprises a nucleotide sequence having no Cytosine nucleotides. In some embodiments, the first fragment is provided as a complementary DNA fragment hybridized to the second fragment of at least one repeat to generate a DNA-RNA hybrid. In some embodiments, the DNA-RNA hybrid is cleaved by RNase H to generate the concatemeric RNA molecule of the present invention.
(123) In some embodiments, the first loop region of said DNA template comprises a Cytosine nucleotide at positions 1, 5, and 6 from the 5′ end of the first loop region. In some embodiments, the first loop region of said DNA template comprises a Cytosine nucleotide at position 4 from the 5′ end of the first loop region. In some embodiments, the first loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 14 and the second loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the first loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 8 and the second loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the first loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 10 and the second loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the first loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 12 and the second loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the first loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 13 and the second loop region of said DNA template comprises the nucleotide sequence set forth in SEQ ID NO: 9.
(124) Methods and Uses
(125) The present invention among other things provide methods of making and using the concatemeric RNA molecules described herein. Those of ordinary skill in the art will appreciate that the concatemeric RNA molecules in accordance with the present invention may be prepared by any available technology. In some aspects, rolling circle amplification (RCA) and/or rolling circle transcription (RCT) can be a particularly useful methodology for production of the concatemeric RNA molecules described herein. Exemplary RCA strategies include, for example, single-primer initiated RCA and by various two-primer amplification methods such as ramification amplification (RAM), hyperbranched RCA, cascade RCA, and exponential RCA. In certain embodiments, RNA-containing molecules can be produced via rolling circle transcription (RCT). RCA/RCT may be particularly useful for production of long nucleic acid molecules, and/or furthermore may generate RNA molecules. Those skilled in the art will appreciate that a RNA molecule produced by RCA/RCT will typically have a nucleotide sequence comprising or consisting of multiple copies of the complement of the circular template being amplified.
(126) In some embodiments, a template used for RCA/RCT as described herein is or comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), glycol nucleic acid (GNA) and/or threose nucleic acid (TNA).
(127) In some embodiments, a template used for RCA/RCT as described herein has a nucleotide sequence that includes one or more silencing.
(128) In some particular embodiments of RCA/RCT contemplated herein, a polymerase selected from the group consisting of T7, T3, or SP6 is utilized to perform the RCA/RCT.
(129) More details of RCA can be found in US Patent Application No. 2010/0189794, the contents of which are incorporated herein by reference. Features of the compositions and methods described in the application may be applied in various combinations in the embodiments described herein. In some embodiments, a first single-stranded nucleic acid molecule is formed by RCA. In some embodiments, the first single-stranded nucleic acid molecule is formed with the aid of a first primer and a nucleic acid polymerase. In some embodiments, a second single-stranded nucleic acid molecule is formed by amplifying the first single-stranded nucleic acid with the aid of a second primer and a polymerase. In some embodiments, a third single-stranded nucleic acid molecule is formed by amplifying the second single-stranded nucleic acid molecule with the aid of a third primer and a polymerase.
(130) A RCA can be repeated with as many primers as desired, e.g., 4, 5, 6, 7, 8, 9, 10 or more primers can be used. In some embodiments, a plurality of primers can be added to templates to form nucleic acid molecules, wherein the plurality can comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 primers. In some embodiments, more than 100 primers are used. In some embodiments, random fragments of short nucleic acid fragments, e.g., comprising digested or otherwise degraded DNAs, are used as non-specific primers to prime the formation of nucleic acid molecules using rolling circle amplification. In some embodiments, the DNA templates described in section E above are used in the RCA/RCT.
(131) As described herein and will be appreciated by those of skill in the art, polymerization reaction conditions can be adjusted as desired to form nucleic acid molecules and self-assembled particles. For example, reaction conditions that favor stringent nucleic acid hybridization, e.g., high temperature, can be used to favor more specific primer binding during amplification.
(132) One aspect of the invention relates to a method of gene silencing comprising administering the concatemeric RNA molecules described herein to treat a subject in need thereof. In some embodiments, the concatemeric RNA molecules may be provided in as a pharmaceutical composition or as part of a particle. In some embodiments, a plurality of concatemeric RNA molecules are released at the target site.
(133) In some embodiments, a plurality of concatemeric RNA molecules comprises one or more silencing sequence that targets one or more genes associated with a particular disease, disorder, or condition of interest (e.g., cancer, infection, etc).
(134) In some embodiments, the concatemeric RNA molecules may be provided comprising a plurality of silencing sequences, for example targeting the same disease, disorder or condition of interest. To give but one example, in some embodiments, the concatemeric RNA molecules comprises a plurality of silencing sequences, each of which targets a different cancer pathway, for example, as an siRNA that inhibits expression of a protein whose activity contributes to or supports the pathway.
(135) The present invention encompasses the recognition that the concatemeric RNA molecules can be designed and/or prepared to simultaneously deliver to a target site (e.g., to a cancer cell) a plurality of different silencing sequences (e.g., siRNAs), each of which is directed to a different specific molecular target of interest. Certain particles comprising the concatemeric RNA molecules permit facile and close control of relative amounts of such different nucleic acid agents that are or can be delivered (e.g., substantially simultaneously) to the site. To give but one example, RCA/RCT templates can be designed and/or assembled with desired relative numbers of copies of different sequences of interest (e.g., complementary to different siRNAs of interest), so as to achieve precise control over the stoichiometry of delivered siRNA(s). In some embodiments, such control achieves synergistic effects (e.g., with respect to inhibiting tumor growth).
(136) In some embodiments, provided particles or pharmaceutical compositions are administered or implanted using methods known in the art, including invasive, surgical, minimally invasive and non-surgical procedures, depending on the subject, target sites, and agent(s) to be delivered. Particles or pharmaceutical compositions described herein can be delivered to a cell, tissue, organ of a subject. Examples of target sites include but are not limited to the eye, pancreas, kidney, liver, stomach, muscle, heart, lungs, lymphatic system, thyroid gland, pituitary gland, ovaries, prostate, skin, endocrine glands, ear, breast, urinary tract, brain or any other site in a subject.
EXEMPLIFICATION
(137) The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The following Examples are offered by way of illustration and not by way of limitation.
Example 1
Materials and Methods for Example 2
(138) 1. General
(139) All reagents used for in vitro transcription were purchased from New England Biolabs (NEB). The transfection reagents used in this study were either Lipofectamine® 2000 (Life Technologies) or TransIT-X2® (Mirus). The poly-I:C used for all experiments was poly(I:C) HMW from Invivogen, which has an average size of 1.5-8 kb. Nucleic acid ladders were purchased from New England Biolabs and all gels were stained with GelRed (Biotium) for visualization and quantification. RNA quantification was carried out by UV-260 absorbance (Nanodrop) and Quant-iT Ribogreen assay (ThermoFisher). Antibodies used were NF-κB p65 (Abcam ab32536) and Alexa 488-labelled goat anti-rabbit 2° antibody (Thermo A-11008). Nuclear staining was carried out with NucBlue (Molecular Probes).
(140) 2. Circular DNA Template Design and Synthesis
(141) ssDNA oligos with a 5′-phosphate modification were purchased from Integrated DNA Technologies with PAGE purification. For a complete list of template sequences, please refer to Table 1. All templates were designed to fold into dumbbell structures with the 5′ and 3′ ends within the ds-region. For circularization, the templates were first diluted to 3 μM in 1× quick ligation buffer (NEB) and heated to 95° C. for 2 min followed by a gradual cooling to 25° C. (˜1° C./min) to facilitate folding. T4 DNA ligase was next added to the DNA solution at a ratio of 400 U/0.4 nmol DNA, and the ligation reaction was left at 25° C. for 2 h. Ligation was confirmed by denaturing PAGE (15% TBE-urea); the circularized templates were immediately used for rolling circle transcription without purification.
(142) TABLE-US-00010 TABLE 1 DNA Template Sequences Used Examples 1 and 2 Code Name Sequence 1 GFP-3 5′P-CCTGAAGTTCATGACATGAACTTCAGG (22 bp) GTCAGCTTGCTGACAGCAAGCTGAC 2 GFP-5 5′P-CCTGAAGTTCATTGTTTGAACTTCAGG (21 bp) GTCAGCTTGCTTGTTGCAAGCTGAC 3 GFP-6 5′P-CCTGAAGTTCATGACAGGATGAACTTC (22 bp) AGGGTCAGCTTGCTGACAGGAGCAAGCTGAC 4 GFP-8 5′P-CCTGAAGITCAACAGGAAGTGAACTTC (21 bp) AGGGTCAGCTTGCACAGGAAGGCAAGCTGAC 5 GFP-5/10 5′P-CCTGAAGTTCATGACAGGAAGTGAACT (21 bp) TCAGGGTCAGCTTGCTTGTTGCAAGCTGAC 6 GFP-10a 5′P-CCTGAAGTTCATGACAGGAAGTGAACT (21 bp) TCAGGGTCAGCTTGC TGACAGGAAGGCAAGCTGAC 7 GFP-10b 5′P-CCTGAAGTTCATGACAGGAAGTGAACT (21 bp) TCAGGGTCAGCTTGC TGAGAGGAAGGCAAGCTGAC 8 GFP-10C 5′P-CCTGAAGTTCATGAGAGGAAGTGAACT (21 bp) TCAGGGTCAGCTTGC TGAGAGGAAGGCAAGCTGAC 9 GFP-10d 5′P-CCTGAAGTTCATCCGACCAGCTGAACT (21 bp) TCAGGGTCAGCTTGC TCCGACCAGCGCAAGCTGAC 10 GFP-10e 5′P-CCTGAAGTTCACCCCCCCCCCTGAACT (21 bp) TCAGGGTCAGCTTGC CCCCCCCCCCGCAAGCTGAC 11 GFP-12 5′P-CCTGAAGTTCATGACAGGAAGATTGAA (21 bp) CTTCAGGGTCAGCTTGC TGACAGGAAGATGCAAGCTGAC 12 GFP-10 5′P-CCTGAAGTTCATCTGTGACAGGAAGCA (25 bp) GATGAACTTCAGGGTCAGCTTGCTGACAGGA AGGCAAGCTGAC 13 GFP-10 5′P-CCTGAAGTTCATCTGTGACAGGAAGTA (25 bp w/ GATGAACTTTAGGGTCAGCTTGT mismatch) TGACAGGAAGGCAAGCTGAC 14 GFP-10 5′P-CCTGAAGTTCATCTGCATGACAGGAAG (27 bp) TGCAGATGAACTTCAGGGTCAGCTTGCTGAC AGGAAGGCAAGCTGAC 15 GFP-10 5′P-CCTGAAGTTCATCTGCATGACAGGAAG (27 bp w/ TGTAGATGAATTTTAGGGTTAGCTTGTTGAC mismatch) AGGAAGGCAAGCTGAC 16 GFP-10 5′P-CCTGAAGTTCATCTGCACCTGACAGGA (29 bp w/ AGGGTGTAGATGAATTTTAGGGTTAGTTTGT mismatch) TGACAGGAAGGCAAGCTGAC 17 Luc-10 CTCTAGAGGATGTGACAGGAAGCATCCTCTA (21 bp) GAGGATAGAATGTGACAGGAAGCATTCTATC 18 Luc-10 5′P-CTCAGCGTAAGTGATTGACAGGAAGAT (25 bp) CACTTACGCTGAGTACTTCGATTTGACAGGA AGAATCGAAGTA 19 Luc-12/6C 5′P-GAGCACTTCTTCATCTGATAGGAAGTT (25 bp)′ GATGAAGAAGTGCTCGTCCT CGTCCCCCCCCGGACGAGGAC 20 GFP-12/6C 5′P-CCTGAAGTTCATCTGTGATAGGAAGTT (25 bp) CAGATGAACTTCAGGGTCAGCTTGCCCCCCC GCAAGCTGAC i) Complementary regions highlighted in bold.
RCT Optimization
(143) Rolling circle transcription was optimized according to a central composited design screen (SAS JMP 11). Reactions were all made to have a final volume of 25 μL with varying volumes of DNA template (3 μM), NTPs (25 mM each), and T7 RNA polymerase (50 U/μL). Reactions were allowed to proceed for 24 h at 37° C., treated with DNase, then analyzed by Quant-IT Ribogreen® assay and agarose gel electrophoresis (
(144) TABLE-US-00011 TABLE 2 CCD Screen for RCT Optimization from Template 6 Vol. Vol. Vol RNA Template Enzyme NTP Yield Long/Short Pattern.sup.a (μL) (μL) (μL) (μg/μL) RNA +++ 16 4 2 0.68 1.98 −++ 4 4 2 0.06 0.01 +−+ 16 0.5 2 0.09 0.00 −−+ 4 0.5 2 0.01 0.00 −+− 4 4 0.5 0.18 1.20 −−− 4 0.5 0.5 0.02 0.00 0 10 2.25 1.25 0.35 2.47 00a 10 2.25 0.5 0.10 0.19 00A 10 2.25 2 0.22 1.05 A00 16 2.25 1.25 0.48 3.08 0a0 10 0.5 1.25 0.05 0.00 ++− 16 4 0.5 0.27 1.46 +−− 16 0.5 0.5 0.06 0.00 0 10 2.25 1.25 0.32 3.02 0A0 10 4 1.25 0.69 3.05 a00 4 2.25 1.25 0.17 1.72 .sup.aPatterns indicate relative amounts of different components used in the screen (0 = center point; a/− = lower point; A/+ = higher point).
3. Cell Culture
(145) GFP-expressing HeLa and A549 cell lines were purchased form CellBioLabs and maintained in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. Luciferase-expressing SKOV3 and UCI101 ovarian cancer cells were kind gifts from Dr. Lorenzo Ceppi, Dr. Wei Wei, and Dr. Michael Birrer (Massachusetts General Hospital). These were maintained in RPMI with 10% FBS, 1% penicillin/streptomycin and 40 μg/mL blasticidin for selection. All cells were maintained at 37° C. in a 5% CO.sub.2 humidified atmosphere.
(146) 4. Rolling Circle Transcription and Isolation of p-shRNA
(147) Optimized reaction conditions for RCT were found by varying the concentrations of NTPs, circular DNA, and T7 RNA polymerase according to a central composite design. Optimal conditions were determined by response surface modeling carried out in JMP Pro 11; these conditions were then used for all subsequent experiments (for additional details see the Supplemental Information). The optimized RCT reaction conditions for a typical 200 μL reaction were as follows: 120 μL of the DNA ligation reaction (3 μM DNA) was combined with 20 μL of 10× RNAPol reaction buffer, 12.5 μL of 100 mM mixed NTPs, 40 μL of T7 RNA polymerase (50,000 U/mL), and 7.5 μL of RNase-free water. The reaction mixture was incubated for 48 h at 37° C. before quenching with 20 μL of 0.5 M EDTA (this step also dissolves magnesium pyrophosphate/RNA microsponge particles, releasing all RNA into the solution (Shopsowitz, K E et al. (2014) Small 10: 1623-1633)); 20 min later, the RNA was isolated by pressure-driven ultrafiltration (200 kDa MWCO), washed 3× with 1 mL of RNase-free water and resuspended in 200 μL of RNase-free water. p-shRNA concentration, quality, and size distribution were determined by UV-absorbance (Nanodrop) and gel electrophoresis (1.5% agarose, 1× TBE). Denaturing gel electrophoresis was performed by heating the RNA samples in formamide-containing buffer (RNA loading buffer, NEB) for 10 min at 70° C. then loading onto either a formaldehyde-agarose gel (1.5% agarose, 1× MOPS buffer, 7% formaldehyde) or a 15% PAGE-Urea gel (Bio-Rad).
(148) 5. Circular Dichroism
(149) Circular dichroism was measured with an Aviv Model 202 CD spectrometer. RNA samples were dissolved at 60 ng/mL in TE buffer and spectra were collected from 200-300 nm with a 1 nm bandwidth and 5 s averaging. After collecting an initial spectrum at 25° C., the CD signal at 210 nm was monitored while heating to 95° C. (CD signal measured at 2° C. intervals with 0.25 min equilibration time). A final spectrum was then collected at 95° C.
(150) 6. Enzymatic Digests and Serum Stability
(151) RNase I digests were performed with recombinant RNase I.sub.f (New England Biolabs). p-shRNA samples were dissolved at a final concentration of 60 ng/μL in the recommended buffer (NEBuffer 3) and sonicated for 5 min prior to the addition of 1 μL of enzyme solution (50,000 Units/mL). The reaction was incubated at 37° C. for 10 min, then inactivated through the addition of 3 μL of 0.5 M EDTA and heating for 10 min at 70° C. For analysis, 10 μL aliquots from each reaction were run on a non-denaturing 15% TBE-PAGE gel for 1.5 h at 80 V, stained with GelRed® (Biotium) and imaged under UV illumination.
(152) RNase T1 digests were performed using recombinant RNase T1 (New England Biolabs) following a similar procedure except that 50 mM Tris buffer containing 2 mM EDTA was used with 7 Units of enzyme, and the digests were carried out for 5 h at 37° C. For analysis, 10 μL aliquots were immediately loaded onto a non-denaturing PAGE gel (15% TBE), or for denaturing PAGE analysis, samples were mixed with formamide-containing denaturing buffer and heated to 70° C. for 10 min prior to loading onto a denaturing PAGE gel (15% TBE-urea). Band quantification was performed using Image J and the ratios of large to small fragments are reported as the average of three experiments±s.e.m.
(153) Serum degradation studies were carried out using 50% human serum (Corning Cellgro). p-shRNA or siRNA samples were first diluted to 25 ng/μL in PBS then mixed with an equal volume of human serum and incubated at 37° C. Aliquots were removed at the indicated time points, combined with RNaseOut (to inactivate serum nucleases), and stored at −80° C. until analysis. Samples were run on a non-denaturing PAGE gel (15% TBE) at 80 V for 1.5 h, stained with GelRed, and imaged under UV illumination. Band quantification was performed using Image J and half-lives were calculated by fitting an exponential decay function in Prism. An additional gel showing a serum only control is provided in the Supplemental Information (
(154) 7. Structural Prediction
(155) Folding predictions were performed using 2-6 repeat sequences of p-shRNA, assuming that transcription was initiated at one of the single-stranded loops. The minimum free energy (MFE) and co-transcriptionally folded structures were determined using the RNAfold (Gruber, A R et al. (2008) Nucleic Acids Res 36: 70-74) and CoFold (Proctor, J R et al. (2013) Nucleic Acids Res 41: 1-11) web servers, respectively. Both predictions were carried out using the energy/folding parameters indicated in the text. 3D models based on MFE or co-transcriptional folding were generated using RNAComposer (Popenda, M et al. (2012) Nucleic Acids Res 40: 1-12) and measurements/rendering was performed using PyMol.
(156) 8. p-shRNA Complexation with Transfection Reagents
(157) Complexation with Lipofectamine® 2000: RNA was dissolved in Opti-MEM at a concentration of 6 μg/mL and combined with Lipofectamine® 2000 reagent dissolved in an equal volume of Opti-MEM (1.7 μL of Lipofectamine/μg RNA). After mixing, the sample was allowed to sit for 15 min at room temperature prior to use, giving a final RNA concentration of 3 μg/mL.
(158) Complexation with Mirus TransIT-X2®: TransIT-X2® reagent was added to a 5.5 μg/mL solution of RNA in Opti-MEM at a ratio of 3.7 μL of reagent/pg of RNA. The solution was mixed thoroughly and allowed to sit for 25 min before diluting with Opti-MEM to a final RNA concentration of 3 μg/mL. Lipofectamine® and TransIT-X2® only samples were both prepared following the above procedures but excluding RNA.
(159) 9. Cell Viability and Knockdown Assays
(160) Cell viability: Experiments were carried out 24 h after seeding cells in a 96-well plate with 100 μL of complete DMEM (10% FBS), at which point the cells were ˜50% confluent. Complexes formed in serum-free Opti-MEM were added to the cells at volumes ranging from 1 μL to 100 μL (each condition was performed in triplicate); following the addition of RNA, well volumes were all adjusted to 200 μL final volume with Opti-MEM and left to incubate for 48 h (final [FBS]=5%). Cell viability was then assayed with CellTiter-Glo reagent (Promega) according to the manufacturer's instructions and IC.sub.50 values were calculated by fitting a 3-parameter log-logistic model to the dose-response data via the DRC package in R (Ritz, C et al. (2005) J Sta Softw 12: 1-22).
(161) Caspase activity: Caspase activation was measured using the Caspase-Glo 3/7, Caspase-Glo 8, and Caspase-Glo 9 assay systems (Promega). Cells were incubated with p-shRNA or poly-I:C/Lipofectamine complexes for 14 h prior to measuring caspase activity according to the manufacturer's protocol.
(162) GFP knockdown: Cells were prepared in a 96-well plate as described above. RNA complexes formed in Opti-MEM were added to the cells to give a final RNA concentration of 10 or 30 nM (with respect to dsRNA units; this corresponds to ˜180-540 ng/mL RNA); after 24 h, the media was replaced with fresh DMEM and the cells were left for an additional 48 h before analyzing reporter gene expression (i.e., 72 h after adding RNA). GFP was analysed by flow cytometry using a FACSCalibur flow cytometer equipped with a high-throughput sampler (λ.sub.Ex=488 nm; λ.sub.Em=530/30 nm). To prepare the cells for flow cytometry, they were first washed with PBS, disassociated with trypsin, and resuspended in DMEM containing 10% FBS. The resulting data was analyzed using FloJo and presented as mean fluorescence averaged over three independent samples, normalized to the average fluorescence of untreated cells.
(163) Luciferase knockdown: Cells were prepared in a 96-well plate as described above. RNA complexes formed in Opti-MEM were added to cells to give a final concentration of 15 nM and the medium was replaced with fresh RPMI medium 24 hours after transfection. After an additional 48 hours, the cells were lysed with 75 μL 1× Glo Lysis Buffer (Promega). For each well, a 25 μL aliquot of the cell lysate was transferred to another 96-well plate and assayed for total protein content with the Pierce BCA Protein Assay Kit. Luciferase expression in the remaining cell lysate was measured with the Steady-Glo luciferase assay system (Promega) using a Tecan Infinite M200 Pro 96-well plate reader. Luminescence readings were first normalized to total protein and presented as the mean for three independent samples normalized to the corresponding value for untreated cells.
(164) 10. NF-κB Nuclear Translocation Assay
(165) p-shRNA or poly-I:C/Lipofectamine complexes were added to SKOV3 cells in a 24 well plate (˜50% confluent) 24 h after seeding at varying concentrations. After 1 h, the media was removed and cells were fixed with 3.7% formaldehyde in PBS (10 min), permeabilized with 0.1% Triton-X in PBS (5 min), incubated with 1° NF-κB antibody (diluted 350×) for 1 h at RT, then stained with 2° antibody (500× dilution) for 1 hr in the dark at RT. During the final 10 min of staining, DAPI (NucBlue) was added to each well (one drop/well) prior to washing the cells with PBS and adding mounting medium. Cells were imaged on an Olympus IX51 epifluorescence microscope using appropriate filter sets for DAPI and AF488. Image analysis was carried out using Cell Profiler (Carpenter, A E et al. (2006) Genome Biol 7: R100).
(166) 11. Statistical Analysis
(167) All pairwise statistical comparisons were made using a two-sided Welch's test. A p-value cutoff of 0.05 was used for determining statistical significance. Where appropriate, p-values were corrected for multiple comparisons using Holm's method. Results are presented as mean or geometric mean±s.d., s.e.m., or 95% C.I., as specified in the figure legends.
Example 2
Periodic-shRNA Molecules are Capable of Gene Silencing, Cytotoxicity and Innate Immune Activation in Cancer Cells
(168) 1. p-shRNA Synthesis
(169) A schematic of the rolling circle transcription reaction used in this study is illustrated in
(170) TABLE-US-00012 TABLE 3 Fitted Parameters for Linear Models Predicting RNA Yield and Long/Short RNA Y-Parameter Term Estimate Std Error t Ratio Prob > |t| RNA Yield Intercept 0.3431243 0.054021 6.35 <.0001 RNA Yield [Template](4.16) 0.1138413 0.041844 2.72 0.0199 RNA Yield [Enzyme](0.5.4) 0.1650017 0.041844 3.94 0.0023 RNA Yield [NTP](0.5.2) 0.0421143 0.041844 1.01 0.3358 RNA Yield [NTP]*[NTP] −0.174741 0.068332 −2.56 0.0266 Long/Short Intercept 2.3876419 0.301311 7.92 <.0001 Long/Short [Template](4.16) 0.3592858 0.210678 1.71 0.1265 Long/Short [Enzyme](0.5.4) 0.7685621 0.210678 3.65 0.0065 Long/Short [NTP](0.5.2) 0.0184949 0.210678 0.09 0.9322 Long/Short [Template]*[Enzyme] 0.2794688 0.235546 1.19 0.2695 Long/Short [Template]*[NTP] 0.2144736 0.235546 0.91 0.3691 Long/Short [Enzyme]*[Enzyme] −0.498333 0.388991 −1.28 0.236 Long/Short [NTP]*[NTP] −1.400933 0.388991 −3.6 0.007
(171) To assess the scope of useable dumbbell templates for RCT, the lengths and sequences were varied of both the single-stranded and double-stranded regions of DNA dumbbells and analysed the RNA products by gel electrophoresis and Ribogreen assays after 24 h in vitro transcription reactions (
(172) To test whether the effect of loop size on RCT productivity was primarily due to transcription initiation or elongation, RCT from an asymmetric DNA dumbbell was carried out containing 5- and 10-base loops (GFP-5/10). RCT from GFP-5/10 yielded only slightly less RNA than the symmetric template with two 10-base loops (262 vs. 299 μg/mL), with a similar RNA size distribution (
(173) We also investigated the influence of the double-stranded stem length on the yield of RCT. It was previously reported that a stem length of 29 bp required the introduction of mismatches for efficient transcription, whereas stems of ≤25 bp gave efficient transcription without mismatches (Seyhan, A A et al. (2006) Oligonucleotides 363: 353-363). These findings were confirm and similar p-shRNA products were observed from templates with 25 and 27 bp stems (with 10-base loops; templates 12-16) compared to the analogous 21 bp template, with the introduction of three mismatches appearing to improve the reaction yield. In contrast, a drop-off in yield for a template containing a 29 bp stem with three mismatches was observed (
(174) 2. p-shRNA Structure and Stability
(175) The secondary structure of the RNA molecules produced by RCT were characterized using circular dichroism (CD) and enzymatic digests, focusing on RNA produced from template 6 (GFP-10a).
(176) p-shRNA molecules can potentially fold into several different structures that are consistent with the above results. The predicted MFE structure for p-shRNAs involves the entire molecule folded back on itself, as depicted in
(177) RNase T1—which selectively cleaves ssRNA 3′ to guanines—was next used to distinguish between the different predicted folded structures of p-shRNA. A DNA template was used with two different 10-base loops—one containing a single cytosine and the other lacking cytosines (template 7)—to give p-shRNA with one loop containing a single guanine and the other loop without any guanines. Since this template had equally sized loops with nearly identical sequences, it was predicted that transcription would initiate randomly from either loop leading to the two co-transcriptionally folded structures shown in
(178) 3. Cytotoxicity, Silencing Activity, and Immunostimulation
(179) The toxicity of large dsRNA in cancer cells has been largely attributed to TLR3 (Salaun, B et al. (2006) J Immunol 176: 4894-4901; Jiang, Q et al. (2008) BMC Cancer 8: 12) and the cytosolic PRRs RIG-I/MDA5, particularly when dsRNA is delivered with transfection reagents (Besch, R et al. (2009) J Clin Invest 119: 2399-2411; Ktibler, K et al. (2011) Eur J Immunol 41: 3028-39; Liu, J et al. (2012) Exp Hematol 40: 330-341; Duewell, P et al. (2014) Cell Death Differ 21: 1825-1837). The cytotoxicity of p-shRNA in HeLa cells was tested when delivered with Lipofectamine as a function of p-shRNA length (
(180) The dose-response behavior for the lipofection of p-shRNA and HMW poly-I:C were compared in a panel of cancer cell lines (HeLa, A549, SKOV3, and UCI101) and NIH-3T3 fibroblasts. Two different p-shRNAs were tested with 21 or 25 bp ds-regions (from templates 17 and 18; referred to here as p-shRNA-21 and p-shRNA-25). Overall, poly-I:C and p-shRNA-25 were found to be similarly cytotoxic (
(181) The cytotoxicity of lipofected poly-I:C was previously shown to proceed through a caspase-dependent apoptotic pathway in cancer cells (Besch, R et al. (2009) J Clin Invest 119: 2399-2411). Caspase activation in SKOV3 cells 14 h following treatment with p-shRNA-25 or poly-I:C delivered with Lipofectamine was compared (
(182) To test the generality of p-shRNA toxicity in cancer cells, the same four cancer cell lines were treated with p-shRNA-25 complexed to a polymeric transfection reagent (TransIT-X2).
(183) Reporter gene knockdown using p-shRNA was initially measured in GFP-expressing HeLa cells (
(184) The activation and nuclear translocation of NF-κB is a canonical marker of innate immune stimulation (
Example 3
Materials and Methods for Example 4
(185) 1. DNA Template and p-shRNA Synthesis.
(186) All reagents for in vitro transcription were purchased from New England Biolabs (NEB, Ipswich, Mass.). Custom PAGE-purified, 5′-phosphorylated DNA oligos and HPLC-purified RNA oligo were purchased from Integrated DNA Technologies (Coralville, Iowa) and resuspended in RNase-free water. For a typical reaction, DNA oligo was diluted to 3 μM in NEBNext® Quick Ligation Reaction Buffer and heated at 95° C. for 2 minutes before slowly cooling to room temperature. Ligation was carried out by adding 1 μL T4 DNA ligase (400,000 units/mL) to give a total ligation reaction volume of 120 μL. After a 2 hour incubation at room temperature, the ligation reaction was mixed with 20 μL 10× T7 RNA polymerase reaction buffer, 12.5 μL ribonucleotide solution mix, 1.5 μL water, 6 μL MgCl.sub.2 (200 mM), and 40 μL T7 RNA polymerase (50,000 units/mL). Transcription was allowed to proceed for 24 hours at 37° C. before addition of 20 μL of 0.5 M ethylenediaminetetraacetic acid (EDTA) to dissolve RNA microsponges that were formed from RCT. The resulting p-shRNA from both the dissolved microsponges and the rest of the transcription reaction was purified by filtration using Advantec disposable ultrafiltration units (200 kDa molecular weight cutoff; Cole-Parmer, Vernon Hills, Ill.). For RCT yield quantification, the transcription reaction before purification was treated with DNase I, followed by addition of EDTA and analysis by Quant-IT Ribogreen® assay (Thermo Fisher Scientific, Cambridge, Mass.).
(187) 2. RNase Digestions.
(188) Purified p-shRNA was diluted and incubated with RNase T1 (Thermo Fisher Scientific, Cambridge, Mass.) at a ratio of 1 μg RNA:1 unit RNase T1 in 50 mM Tris-HCl (pH 7.5) and 2 mM EDTA at 37° C. for one hour. For RNase I digestion, 1.5 μg p-shRNA was diluted in 1× NEBuffer 3 and incubated with 50 units of RNase I.sub.f (NEB) at 37° C. for 10 minutes before addition of 3 uL EDTA (0.5 M) and heating at 70° C. for 20 minutes to inactivate the enzyme. Digest products were analyzed on 15% precast Tris-borate-EDTA (TBE) or TBE-urea polyacrylamide gels (Bio-Rad, Hercules, Calif.), which were stained with GelRed™ (Biotium, Hayward, Calif.) for 1 hour before visualization with a UV transilluminator.
(189) 3. Dicer Cleavage Assays.
(190) For each p-shRNA and op-shRNA, 500 ng of RNA were incubated with 1 unit of recombinant human Dicer enzyme (Genlantis, San Diego, Calif.) and reaction buffer at 37° C. according to the manufacturer's instructions. Aliquots of 10 μL were withdrawn at the specified timepoints, and 2 μL Dicer stop solution was added. Each timepoint sample along with a control RNA sample incubated at 37° C. without Dicer was analyzed on a 15% precast TBE polyacrylamide gel.
(191) 4. In Vitro Transfections.
(192) GFP-expressing HeLa cells (Cell Biolabs, San Diego, Calif.) were cultured in Dulbecco's Modified Eagle Medium (Mediatech, Manassas, Va.) with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S), and firefly luciferase-expressing SKOV3 and UCI101 cells (generously contributed from Dr. Michael Birrer's group at Massachusetts General Hospital) were cultured in RPMI-1640 with 10% FBS, 1% P/S, and 40 μg/mL blasticidin, at 37° C. in a 5% CO.sub.2 humidified atmosphere. One day before transfection, cells were seeded at 10,000 cells/well in a 96-well plate. After 24 hours, transfections with TransIT-X2 (Mirus Bio, Madison, Wis.) and Lipofectamine 2000 (Life Technologies, Carlsbad, Calif.) were carried out (with or without 1% P/S in the medium, respectively) with p-shRNA, op-shRNA, and siRNA according to the manufacturers' instructions. Complexes were added at the appropriate concentrations of effective siRNA, with each condition performed in triplicates. The medium was replaced with fresh medium 24 hours after transfection. Three days after transfection, GFP expression of HeLa cells was analyzed by flow cytometry (excitation 480 nm; emission 530 nm) using a BD FACSCalibur equipped with a high throughput sampler. Luciferase expression in SKOV3 and UCI101 cells was analyzed by the Steady-Glo luciferase assay system (Promega, Madison, Wis.) and normalized to total protein per well (Pierce BCA Protein Assay Kit, Thermo Fisher Scientific, Cambridge, Mass.), using a Tecan Infinite M200 Pro 96-well plate reader. For extended knockdown experiments, a quarter of the cells trypsinized for flow cytometry analysis were propagated every two days.
(193) 5. Cell Viability Assays.
(194) For each cell line used for transfections, cells were seeded at 10,000 cells/well in a white 96-well plate. After 24 hours, p-shRNA and op-shRNA complexed with Lipofectamine 2000 or TransIT-X2 were added at increasing concentrations in triplicate wells. Cell viability was assessed by CellTiter-Glo luminescent cell viability assay (Promega, Madison, Wis.) after 48 hours of incubation.
(195) 6. Complex Formation with bPEI.
(196) RNase T1-cleaved p-shRNA was purified and washed with 10 mM NaCl using a Nanosep centrifugal device (30 kDa MWCO; Pall Corporation, Westborough, Mass.). For the gel retardation assays, 2 kDa branched PEI (Sigma-Aldrich, St. Louis, Mo.) was added to an equal volume of either op-shRNA or siRNA diluted to 120 ng/μL at increasing N/P ratios. After thorough pipette mixing and incubation for 30 minutes at room temperature, the complexes were analyzed on a 2% agarose gel containing GelRedi'm in TBE buffer. The hydrodynamic sizes and zeta potentials of op-shRNA and siRNA complexes formed with 2 kDa branched PEI were measured using a Malvern Zetasizer Nano ZS90 particle analyzer. For the heparin displacement assays, op-shRNA and siRNA complexes were allowed to form with bPEI at N/P 15 for 30 minutes before addition of increasing amounts of heparin (Santa Cruz Biotechnology, Dallas, Tex.). After equilibration for 30 minutes, the heparin-complex mixtures were analyzed on a 2% agarose gel (1× TBE).
Example 4
Engineering Periodic shRNA for Enhanced Silencing Efficacy
(197) 1. Design of Open-Ended p-shRNA by RNase T1 Digestion of p-shRNA Hairpin Loops
(198) To achieve selective processing, RNase T1 was used, which preferentially cleaves single stranded RNA (ssRNA) at the 3′ ends of guanine (G) residues. The p-shRNA generated by RCT from a dumbbell template, using T7 RNA polymerase, folds into a kinetically trapped configuration: the loop at which RNA transcription initiates acts as the linker between shRNA monomers, while the other loop acts as the hairpin loop in each monomer (Shopsowitz, K E et al. (2015) Nucleic Acids Res 44: 545-557). By controlling the hairpin loops to contain one or more Gs and the linker loops to contain no Gs, it was predicted that RNase T1 would selectively cleave the hairpin loops to yield an open-ended p-shRNA (op-shRNA) that stably retains its polymeric form through base-pairing interactions. As an initial investigation, RCT was performed on a dumbbell DNA template with a 25 base pair (bp) stem and asymmetrically sized loops: a smaller loop (6 nt) containing all cytosines (Cs), encoding a loop of all Gs, and a larger loop (12 nt) containing no Cs (
(199) TABLE-US-00013 TABLE 4 DNA template sequences used for rolling circle transcription. Bolded regions indicate double stranded stem region encoding siRNA sequence. Template Stem or Target Encoded Se- p-shRNA quence Template Sequence p-sh25 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT CAGATGAACTTCAGGGTCAGCTTGC CCCCCC GCAAGCTGAC-3′ p-sh25 Firefly 5′-GAGCACTTCTTCATC TGATAGGAAGTT luci- GATGAAGAAG TGCTCGTCCT CGTCC ferase CCCCCC GGACGAGGAC-3′ 1 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT CAGATGAACTTCAGGGTCAGCTTGC CTGACC GCAAGCTGAC-3′ 2 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT CAGATGAACTTCAGGGTCAGCTTGC TTTCTT GCAAGCTGAC-3′ 3 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT CAGATGAACTTCAGGGTCAGCTTGC CCATAGGAAGCC GCAAGCTGAC-3′ 4 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT CAGATGAACTTCAGGGTCAGCTTGC CCCCCCCCCCCC GCAAGCTGAC-3′ 5 GFP 5′-CCTGAAGTTCATCTG CCCCCCCCCCCC CAGATGAACTTCAGGGTCAGCTTGC TGATAT GCAAGCTGAC-3′ 6 GFP 5′-CCTGAAGTTCATCTG CCATAGGAAGCC CAGATGAACTTCAGGGTCAGCTTGC TGATAT GCAAGCTGAC-3′ p-sh25 GFP 5′-CCTGAAGTTCATCTG TGATAGGAAGTT 2nt CAGATGAACTTCAGGGTCAGCTTGC CCCCCT (FIG. S3) GCAAGCTGAC-3′ p-sh21 GFP 5′-CCTGAAGTTCA TGATAGGAAGTT TGAACTTCAGGGTCAGCTTGC CCCCCC GCAAGCTGAC-3′ p-sh27 GFP 5′-CCTGAAGTTCATCTGCA TGATAGGAAGTT TGCAGATGAACTTCAGGGTCAGCTTGC CCCCCC GCAAGCTGAC-3′ p-sh29 GFP 5′-CCTGAAGTTCATCTGCACC TGATAGGAAGTT GGTGCAGATGAACTTCAGGGTCAGCTTGC CCCCCC GCAAGCTGAC-3′
(200) TABLE-US-00014 TABLE 5 Sequences of siRNAs and standard RNA used in this study. The standard RNA was compared by 15% denaturing polyacrylamide gel electrophoresis to RNase T1-treated p-sh25. For in vitro knockdown studies, GFP-targeting and firefly luciferase- targeting siRNAs (siGFP and siLuc, respectively) were used. RNA Sequence Standard 5′-GCAAGCUGACCCUGAAGUUCAUCUGAACUUCCUAUCA RNA CAGAUGAACUUCAGGGUCAGCUUGCG-3′ siGFP 5′-GCAAGCUGACCCUGAAGUUCAUdTdT-3′ siLuc 5′-GGACGAGGACGAGCACUUCdTdT-3′
(201) To investigate how transcription initiation site and thereby relative p-shRNA loop positions could be controlled to generate op-shRNA, additional templates were designed with various loop sizes and sequences, keeping the stem constant (
(202) To determine whether template loop sequence also plays a role in p-shRNA folding, templates were tested in which the C-containing loop consisted of all Cs and the other loop was of equal size or smaller (templates 4 and 5, respectively). The resulting p-shRNAs retained their polymeric forms after RNase T1 digestion (
(203) Having confirmed RNase T1 cleavage of our p-shRNA structures into an open-ended polymeric form, it was next tested whether the engineered open ends facilitate Dicer processing. Incubation of p-sh25 with recombinant Dicer enzyme led to the gradual appearance of smaller polymeric fragments but very little 21-25 bp product, with the majority of p-sh25 remaining undigested or incompletely digested after 24 hours (
(204) 2. Silencing Efficacy of op-shRNA
(205) To test the silencing activity of op-shRNA, green fluorescent protein (GFP)-expressing HeLa cells were transfected with p-sh25, op-sh25, and a standard siRNA targeting GFP. With Lipofectamine 2000, op-sh25 caused greater knockdown than p-sh25 at each tested concentration (5 and 15 nM, based on effective siRNA repeat units;
(206) It was next investigated whether the stem length of op-shRNA influences its potency. Stem lengths longer than 21 bp have been reported to increase silencing by siRNAs and shRNAs. (Kim, D H et al. (2005) Nat Biotechnol 23: 222-226; Siolas, D et al. (2005) Nat Biotechnol 23: 227-231). With TransIT-X2, op-shRNA structures generated from the same template as op-sh25 but with stem lengths varying from 21 to 29 bp, showed similar silencing efficiencies, with op-sh29 showing slightly less potency (
(207) Since op-shRNA activity requires intracellular processing by Dicer, it was postulated that the gradual breakdown of op-shRNA could yield prolonged knockdown compared to monomeric siRNA. At 5 nM, op-sh25 reduced GFP expression up to nine days in HeLa cells, versus five days using siRNA (
(208) 3. Complexation with Low Molecular Weight Polycation
(209) With its high potency and large molecular weight, op-shRNA can potentially enable more stable and efficacious RNAi delivery (
(210) In conclusion, an open-ended csiRNA has been developed with vastly improved Dicer processing efficiency and silencing potency, which can be generated in high quantities with RCT. Having determined effects of loop size and sequence on transcription initiation and thereby csiRNA folding, open-ended csiRNAs with specific sequences and structures can be designed by manipulating template sequence and loop sizes. The ability of T1-csiRNA to form more stable complexes than siRNA using less cationic polymer, along with its potent silencing and immunostimulatory capabilities that could potentially work synergistically, makes it a promising platform for systemic delivery of RNAi therapeutics.
INCORPORATION BY REFERENCE
(211) All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
(212) Equivalents
(213) Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.