METHOD FOR PRODUCING CULTURED CELL, AND METHOD FOR PRODUCING THERAPEUTIC AGENT FOR SPINAL CORD INJURY DISEASE

Abstract

[Problem to Be Solved] The present invention is to provide a method of culturing a cell, which method safely increases GDNF mRNA expression without introducing a gene with a virus.

[Means to Solve the Problem] A method of producing a cultured cell comprising glial cell line-derived neurotrophic factor (GDNF) mRNA, including the step of culturing a human skin-derived stem cell in a serum-free medium containing at least one of SAG, purmorphamine and sonic hedgehog (SHUT) protein. The medium may further contain B-27 supplement, a ROCK inhibitor, EGF and FGF2.

Claims

1. A method of producing a cultured cell comprising glial cell line-derived neurotrophic factor (GDNF) mRNA and CD73 protein, comprising the step of: culturing a human skin-derived stem cell in a serum-free medium comprising SAG.

2. The method according to claim 1, wherein the serum-free medium further comprises one or both of purmorphamine and sonic hedgehog (SHH) protein.

3. The method according to claim 1, wherein the serum-free medium further comprises B-27 supplement.

4. The method according to claim 1, wherein the serum-free medium further comprises a ROCK inhibitor.

5. The method according to claim 1, wherein the serum-free medium further comprises EGF or FGF2.

6. The method according to claim 1, wherein the serum-free medium comprises calcium ion at a concentration of from 0.03 mM to 0.12 mM.

7. The method according to claim 1, wherein the human skin-derived stem cell is obtained by treating a collected human skin with dispase, trypsin, and collagenase in this order.

8. A method of producing a therapeutic agent for spinal cord injury comprising the steps of: producing a cultured cell by the method according to claim 1, and wherein the therapeutic agent comprises at least one of the cultured cell, a medium obtained in the previous step, and a secretion obtained in the previous step.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0079] FIG. 1 is a graph as a drawing, which graph shows an effect of increase in GDNF mRNA expression (Example 2).

[0080] FIG. 2 is a graph as a drawing, which graph shows expression of Nestin mRNA (Example 3).

[0081] FIG. 3 is a graph as a drawing, which graph shows expression of GFAP mRNA (Example 4).

[0082] FIG. 4 is a graph as a drawing, which graph shows expression of CD73 (CD expression profile) (Example 5).

[0083] FIG. 5 is a graph as a drawing, which graph shows effects on rat spinal cord injury models (BBB score) (Example 6).

[0084] FIG. 6 is a graph as a drawing, which graph shows an evaluation of carcinogenicity.

DETAILED DESCRIPTION

[0085] The embodiments for carrying out the present invention are explained below. The present invention is not limited to the embodiments explained below and include embodiments obvious therefrom appropriately modified by a person having ordinary skills in the art based on the following embodiments.

[0086] The present invention presents a method of providing a cell for direct administration by obtaining the cell that is highly effective for spinal cord injury through the steps of: collecting a tissue from human skin and sterilizing the tissue;

[0087] collecting a cell and seeding the cell;

[0088] proliferating the cell;

[0089] subculturing the cell;

[0090] inducing and differentiating the cell;

[0091] transplanting and processing the cell.

[0092] The present invention presents a method of providing a cell combined with other base material for medical instruments. The present invention also presents a method of administering a component of a medium used for culturing in the aforesaid steps.

[0093] Each step will be explained in detail with reference to examples. The explanation is an example and should not be considered to limit the present invention. Embodiments obvious therefrom appropriately modified by a person having ordinary skills in the art based are also encompassed in the invention. In the following, “u” may represent “micro.”

(Step of Collecting Tissue)

[0094] Skin collected in this step is preferably collected from or above the neck and, from the cosmetic view point after the collection, skin from a postauricular region is most preferred. Gender is not limited and age up until 70's is allowed. Subsequent steps are performed with aseptic manipulation. The collected tissue is sterilized with 70% ethanol aqueous solution that has been treated with a sterilizing filter having a pore size of 0.1 um to remove bacterial spores.

(Step of Collecting Cell and Seeding Cell)

[0095] The tissue cut into pieces were placed in a dispase solution (PBS(−)) comprising 10 uM Y-27632 at 4° C. overnight. The tissue is then placed in a Trypsin solution (PBS(−)) comprising 10 uM Y-27632 at 37° C. for 20 minutes. Subsequently, the tissue is soaked in a collagenase solution (DMEM) to digest the skin at 37° C., while stirring for 1 to 2 hours. The suspension thus obtained is then filtered through a 100 um mesh to remove residues. The filtrate is then subjected to centrifugation followed by washing with PBS(−) for 3 times to remove enzymes. The cells thus obtained are placed in Trypsin Inhibitor and are allowed to stand for 10 minutes. After removing the Inhibitor by centrifugation, the cells are suspended in a medium comprising 10 uM Y-27632 and then are seeded in a culture dish.

(Step of Proliferating Cells)

[0096] Until 6 days after seeding, the medium shall only be added, but not be changed. Subsequent medium change is carried out by recovering the cells proliferated and suspended in a conditioned medium by centrifugation, and then returning the cells suspended in a new medium to a culture system.

(Step of Subculturing Cells)

[0097] The cells are subjected to a 10 uM Y-27632 treatment for more than 30 minutes and are recovered from the dish with EDTA and TrypLEx Express. The cells are then placed in Trypsin Inhibitor and are allowed to stand for 10 minutes. After removing the Inhibitor by centrifugation, the cells are suspended in a medium comprise ng 10 uM Y-27632, which is seeded in a dish having an area 4 or 5 times as large as that of the previously used dish. A primary cell culture is performed using 5 dishes each having an area of 100 mm.sup.2. When the culture reaches to a confluence, the cells of 3 dishes may be used for transplantation or be cryopreserved until transplantation. The cells of the remaining 2 dishes are subjected to subculture using 6 dishes each having an area of 100 mm.sup.2 and, when the subculture reaches to a confluence, the cells are subjected to the step of adding factors to induce.

(Step of Adding Factors to Induce)

[0098] The step of adding factor for induction is a step where cells are treated with an agent 3 days before transplantation and cultured by adding necessary factors. Using this step, a cell highly expresses GDNF mRNA, for example, 10 times as high as that of ordinarily cultured cell, can be obtained. Using this step, a CD13 negative cell (CD13(−)) can be obtained. Using this step, CD34 negative cell (CD34(−)) can be obtained. Using this step, CD45 negative cell (CD45(−)) can be obtained. Using this step, CD90 negative cell (CD90(−)) can be obtained. Using this step, CD73 positive cell (CD73(+)) can be obtained. A ratio (number of cells) of CD73 positive cell to cultured cells may vary from 20% to 100%, 40% to 100%, 60% to 99%, or 80% to 99%, for instance. The cells that have undergone the step adding factors to induce are preferably transplanted after 3 days or cryopreserved until transplantation.

(Step of Transplanting or Processing)

[0099] A sufficient number of cells for treatment obtained by the above steps are treated with 10 uM Y-27632 and are recovered from the dish using EDTA and TrypLEx Express. The cells are then placed in Trypsin Inhibitor and are allowed to stand for 10 minutes. After removing the Inhibitor by centrifugation, the cells are suspended at a concentration of 10.sup.7 cell/mL in an infusion solution when they are to be transplanted by spinal puncture. The cells may be subjected to processing with other base materials or other cells.

[0100] The present invention will be explained with reference to the following Examples. The present invention encompasses embodiments which a person having ordinary skills in the art can conceive using known technologies based on the following Examples.

Example 1

(Collection and Culture of Human Skin-Derived Stem Cell)

(Collection of Tissue)

[0101] All layers of about 2-cm.sup.2-wide skin excised from a face of 56-year-old female in her face-lift cosmetic surgery were used. The subsequent steps were all performed with aseptic manipulation. This collected tissue was soaked for 30 seconds in a 70% ethanol aqueous solution that has been sterilized with a filter having a pore size of 0.1 um (micron), and immediately washed with a Phosphate Buffer Saline (PBS(−)) for three times to remove ethanol. From the tissue, subcutaneous fatty tissue and dermal connective tissue were removed as much as possible with a scissor, leaving sites where hair bulbs exist, which was then cut into about 1-mm.sup.2-wide pieces with a scalpel.

(Step 1 of Collecting and Seeding Cells)

[0102] The pieces of the tissue were soaked overnight in 5 mL of a pre-cooled Dispase solution (25 units/ml of PBS(−)) containing 10 uM Y-27635 at 4° C.

(Step 2 of Collecting and Seeding Cells)

[0103] This was centrifuged to remove the supernatant. The remaining tissues were then soaked in a TrypLE Express solution (diluted 5× in PBS(−)) at 37° C. for 20 minutes.

(Step 3 of Collecting and Seeding Cells)

[0104] This tissue was centrifuged to remove the supernatant. The remaining tissues were then soaked in 20 mL of collagenase solution (GIBCO: type I) (1400 units/mL DMEM medium) at 37° C., while stirring for 1.5 hours.

(Step 4 of Collecting and Seeding Cells)

[0105] The suspension after stirred was passed through 100 um mesh to remove undigested residue. The liquid thus obtained was washed with PBS(−) followed by centrifugation to remove enzymes, which process was repeated for three times, and cells were obtained.

(Step 5 of Collecting and Seeding Cells)

[0106] The cells were placed in 5 mL of Soybean Trypsin Inhibitor (0.25% in PBS(−)) and were allowed to stand for 10 minutes.

(Step 6 of Collecting and Seeding Cells)

[0107] After removing the Inhibitor by centrifugation, the cells were suspended in a medium containing 10 uM Y-27632 and then seeded in a culture dish. The cells of starting tissue of 1 to 2-cm.sup.2-wide were seeded in all the wells of a 6-well plate (CellBind: COSTER, trade name).

(Step of Preparing a Medium)

[0108] A medium was prepared as follows. That is, insulin (10 mg/L), holo-transferrin (5.5 mg/L), selenium (6.7 ug/L), ethanolamine (2 mg/L), Vitamin C (L-Ascorbic acid 2-phosphate semimagnesium salt) (50 ug/L), KGF (10 ug/L), lipid (fatty acid mixtures: arachidonic acid (20 ug/L), cholesterol (2.2 mg/L), DL-α-Tocopherol-acetate (700 ug/L), linoleic acid (100 ug/L), linolenic acid (100 ug/L), myristic acid (100 ug/L), oleic acid (100 ug/L), palmitoleic acid (100 ug/L), palmitic acid (100 ug/L), stearic acid (100 ug/L), Tween 80 (22 mg/L), Pluronic F-68 (1000 mg/L), EGF (20 ug/L), FGF (10 ug/L), Y-27632 (1 uM), and 1% B-27 supplement XenoFree CTS (Invitrogen) were added in MCDB 153 medium (Sigma, Stemline Keratinocyte Basal Medium) which is a basal medium.

(Step 1 of Cell Proliferation)

[0109] The primary culture was performed in a conditioned medium by adding a ⅓ of the medium without changing the medium for initial 7 days. Subsequent culture was performed by changing the medium every 2 days. The change of the medium was performed by centrifuging and discarding ⅔ of the used medium, and then adding a fresh medium in an amount of ⅔ volume of the medium to the mixture of the remaining ⅓ of the used medium and floating cells precipitated by the centrifugation, which was placed back in a culture dish. It took 10 days to reach 100% confluence.

(Step of Sub-Culturing Cells)

[0110] Y-27632 was added to the medium, where the cells had been cultured, at a concentration of 10 μM and allowed it to stand at 37° C. for 30 minutes. Then, the medium was entirely removed and 0.05% EDTA/PBS(−) was added in an amount of 2 ml/well, and allowed it to stand at 37° C. for 10 minutes. Subsequently, TrypLEx Express diluted by 5 times with PBS(−) was added in an amount of 0.5 ml/well and allowed it to stand at 37° C. for 5 minutes. The cells were detached from the wells by pipetting. Trypsin Inhibitor (0.05%/PBS(−)) was added in an amount of 2.5 ml/well to the recovered cells and then centrifugated. After removing a supernatant, 2.5 mL of Trypsin Inhibitor (0.25%/PBS(−)) was added to suspend the cells and allowed it to stand for 10 minutes. After removing the Inhibitor by centrifugation, the cells were suspended in a medium containing 10 μM Y-27632 and seeded in 5 sheets of 6-well plate (CellBind: COSTAR) having an area 5 times as large as that of the previously used one. 100% confluence was reached after one week, and the cells thus obtained were used for following experiments.

Example 2

[0111] (A Method of Increasing Expression of Glial Cell-Derived Neurotrophic Factor (GDNF) mRNA)

[0112] To find a compound or cytokine to increase the expression of GDNF in cells, following 6 candidate materials were examined: Valproic Acid (VA), Platelet-Derived Growth Factor (PDGF), SAG (or Purmorphamine or rh-Sonic Hedgehog (PeproTech)), Bone Morphogenic Protein 4 (BMP4). These 6 materials were added to 7 wells, which had reached to confluence in Example 1, in the following combinations: (1) Control (not added) (2) VA (1 uM), (3) VA (1 uM)+PDGF (long/ml), (4) VA (1 uM)+SAG (0.3 uM), (5) PDGF (long/ml), (6) SAG (0.3 uM), (7) MBP-4 (long/ml). 72 hours after the addition, total RNA was extracted from each well by TRIzol method. Using “ReverTra Ace (trade mark) qPCR RT kit”, a cDNA synthesis kit for PCR, 0.5 ug of each total RNA was added to 10 μL of ReverTra Ace (trade mark) qPCR RT kit to synthesize respective cDNA.

[0113] Expression of GDNF mRNA in these cDNA samples was compared by real-time PCR method using a GDNF real-time PCR primer set (Roche 5326257) and by intercalator assay using ABI PRISM (trade mark) 7700 of Applied Biosystems Inc. For a qRT-PCR reaction, SYBR (trade name) Green Realtime PCR Master Mix-Plus-from TOYOBO Co. Ltd. was used to prepare a reaction solution.

Preparation of the Reaction Solution

[0114]

TABLE-US-00001 Distilled water 11 μL  SYBR (trade mark) Green Realtime PCR Master Mix -Plus- 25 μL  Plus solution 5 μL Primer 1(10 μM) 2 μL Primer 2(10 μM) 2 μL Sample solution 5 μL Total volume 50 μL 

[0115] The reaction solution was placed in each well of a 96-well plate where the PCR reaction was carried out.

[0116] PCR was performed by three-step method under the conditions of annealing 60° C./elongation 72° C. and the steps (1) to (2) were repeated for 40 cycles. In the last step, a Melting Curve was analyzed and it was confirmed that no primer dimer was produced. 95° C., 60 seconds

[0117] (1) ↓

[0118] (2) 95° C., 15 seconds

[0119] (3) 60° C., 15 seconds

[0120] (4) 72° C., 45 seconds (data collection)

[0121] Detection of GAPDH mRNA was performed simultaneously, and the expression of GDNF mRNA was corrected to GDNF mRNA/GAPDH mRNA. As the result, (6) SAG only achieved more than 10 times as much expression of GDNF mRNA as that of (1) control. Purmorphamine (1.5 uM) and rh-Sonic Hedgehog (10 ng/ml) used in place of SAG also achieved nearly 10 times as much expression of GDNF mRNA (FIG. 1). GAPDH was synthesized using the following primers:

TABLE-US-00002 Forward primer: (SEQ ID NO: 1) ATCTTCTTTTGCGTCGCC Reverse primer: (SEQ ID NO: 2) GATGACAAGCTTCCCGTTC

[0122] Expression chain length: 250 bp

[0123] FIG. 1 is a graph as a drawing, which shows the results of GDNF mRNA expression in Example 2.

Example 3

[0124] (Change in Expression by Induced Neuronal Differentiation of Nestin mRNA)

[0125] Among 3 wells, which reached to confluence in Example 1, the cells of 2 wells were cultured for 7 days in a medium for NPC differentiation for identifying differentiated neural progenitor cells of Human/Mouse/Rat Neural Progenitor Cell Functional Identification Kit (R&D Systems SC082). The cells of the other one well were cultured in a maintenance medium of the present invention for the same period of time. On the 7th day of the culture, total RNA was extracted, and cDNA was prepared in the same manner as in Example 2. Using the cDNA, expression of Nestin mRNA, which is a marker of the neural stem cell, was measured by RT-PCR and compared with GAPDH mRNA as the basal expression. Primers for Nestin were as follows:

TABLE-US-00003 Forward primer: (SEQ ID NO: 3) CGTTGGAACAGAGGTTGGAG Reverse primer: (SEQ ID NO: 4) TCCTGAAAGCTGAGGGAAG

[0126] Expression chain length: 262 bp

[0127] The same primers as those used in Example 2 were used for GAPDH.

[0128] Results are shown in FIG. 2.

[0129] FIG. 2 is a graph as a drawing, which shows the expression of Nestin mRNA in Example 3. As shown in FIG. 2, the expression of Nestin (Nestin mRNA/GAPDH mRNA) decreased to about 1/7 of the level before the differentiation by changing a culture medium to the differentiation medium. This result indicates that the proliferation medium of the present invention maintains neural stem cells, whereas the differentiation medium decreases neural stem cells.

Example 4

[0130] (Change in Expression by Induced Neuronal Differentiation of GFAP mRNA)

[0131] Among 3 wells, which reached to confluence in Example 1, the cells of 2 wells were cultured for 7 days in a medium for NPC differentiation for identifying differentiated neural progenitor cells of Human/Mouse/Rat Neural Progenitor Cell Functional Identification Kit (R&D Systems SC082). The cells of the other one well were cultured in a maintenance medium of the present invention for the same period of time. On the 7th day of the culture, total RNA was extracted, and cDNA was prepared in the same manner as in Example 2. Using the cDNA, expression of GFAP mRNA, which is a marker of astrocytes or adult neural stem cells, was measured by RT-PCR and compared with GAPDH mRNA as the basal expression. Primers for GFAP were as follows:

TABLE-US-00004 Forward primer: (SEQ ID NO: 5) ACATCGAGATCGCCACCTAC Reverse primer: (SEQ ID NO: 6) ACATCACATCCTTGTGCTCC

[0132] Expression chain length: 219 bp

[0133] The same primers as those used in Example 2 were used for GAPDH.

[0134] Results are shown in FIG. 3.

[0135] FIG. 3 is a graph as a drawing, which shows the expression of GFAP mRNA in Example 4. As shown in FIG. 3, the expression of GFAP (GFAP mRNA/GAPDH mRNA) slightly increased from the level before the differentiation by changing a culture medium to the differentiation medium. This result indicates that the proliferation medium of the present invention maintains neural stem cells and the expression of GFAP therein.

Example 5

[0136] (Study of Expression of CD Antigen with Flow Cytometry)

[0137] The cells cultured to be confluent were detached from the culture dish and isolated by using trypsin-EDTA solution. Then, the cells were blocked by being placed in a 3% BSA/PBS(−) solution for 30 minutes to be prevented from non-specific adsorption. After being fixed with 4% paraformaldehyde for 10 minutes, the cells were then incubated in 0.5% Triton X-100/PBS(−) at 4° C. for 5 minutes. The cells were then incubated at 4° C. overnight with a monoclonal antibody to CD73, CD73-PE (BD 561014). Subsequently, the cells were washed for 5 times to remove unbound antibodies and the expression of the antigen was analyzed with flow cytometry using EC800 cell analyzer from SONY Co. The results are shown in FIG. 4.

[0138] FIG. 4 is a graph as a drawing, which shows the expression of CD73 (CD73 expression profile) in Example 5. As shown in FIG. 4, the cell was CD13-, CD34-, and CD45-negative, indicating that the cell was non-blood cell. The cell was CD90-negative, either, indicating that the cell was not human skin-derived mesenchymal stem cell. The strong expression of CD73 was the most prominent characteristic of CD expression profile of the cell.

Example 6

(Study of an Effect on Rat Spinal Cord Injury Model by BBB Score Method)

[0139] The cultured cells, which had not been treated to increase GDNF with SAG or the like, were detached from the culture dish using the enzyme, Accutase (GIBCO A11105). 1×10.sup.5 of the detached cells were suspended in 200 μL of a culture medium solution and transplanted by injecting into a spinal cord injured site of a rat of which spinal cord had been injured by weight-drop and an immunosuppressant had been administered to the injured site. A rat as a control was subjected to a sham operation of injecting the same amount of the culture medium only. In the experiment, the cell-transplanted group consisted of 5 rats and the control group consisted of 4 rats. An effectiveness of treating spinal injury was measured by BBB Score method where movements of an animal is observed with video equipment and rated. The results are shown in FIG. 5. In the figure, the horizontal axis shows the number of days after the transplantation, and the longitudinal axis shows BBB scores. The full line shows the results of the transplanted group, the broken line shows the results of the control group, and the asterisks show results of a significant difference test by Student's T test with * indicating P<0.05, ** indicating p<0.01 and *** indicating p<0.001. From 3 days after the transplantation, the cell-transplanted group showed a statistically significant effect (p<0.05) compared with the control group by BBB Score difference of 2 points. From 35 days after the transplantation, the cell-transplanted group showed a statistically significant effect (p<0.001) compared with the control group by BBB Score difference of 4 points. In the report on a bone marrow stromal cell transplantation (Non-patent document 23), it took nearly 2 weeks to achieve a significant difference. In the iPS cell-derived neural stem cell transplantation (Non-patent document 1), it took 3 weeks to achieve a significant difference. Compared with these studies, the present result showed dramatically faster effects observed only after 3 days. Further, in the bone marrow stromal cell transplantation, only a significant difference with p<0.05 was observed even after 4 weeks, whereas, in the present invention, a superior significant difference with p<0.001 was observed after the same lapse of time. This result indicates that the cell obtained in the present invention is extremely effective for treating spinal cord injury.

Example 7

(Evaluation of Tumorigenicity)

Animal and Test Method

[0140] For the experiment, NOD/Shi-scid, IL-2Rγnull (trade mark) mice (6 weeks old female from Central Institute for Experimental Animals) were used. After 1-week of acclimatization, the mice were divided into 3 groups using a general-purpose grouping system (Visions Inc.) so that the groups have average body weight as equal as possible. In a right quadrant of the abdomen the mice of each group, cells cultured in the same manner as in Example 1 (hereinafter referred to as “cell A”), the culture medium as a negative control, or HeLa S3 (DS Pharma Biomedical Co. Ltd.) as a positive control was transplanted (each in an amount of 0.2 mL/individual) respectively by injection with a syringe (Myjector (trade mark), 27 G). The groups are referred to as “cell A group (10 mice)”, “culture medium group (10 mice)”, and “HeLa S3 group (5 mice)”, respectively.

[0141] Three lines of the cell A were cultured in the same manner as in Example 1. Each line of cells were suspended in α-MEM medium at 1×10.sup.7 cells/mL and dispensed in 2-mL cryotubes in such a manner that no air is entrapped. About 3 hours after the dispensation, α-MEM medium was removed, and the cells were suspended again in a culture medium. The same number of 3-line cells were mixed and a suspension at a concentration of 5×10.sup.7 cells/mL was prepared, which was kept at 4° C. until the transplantation was performed within 2 hours after the preparation. A survival rate after the transplantation of the specimen, which was the mixture of the 3 lines of the cells, was 75% of that measured just before the transplantation. The mice of each group were bred for 13 weeks and general conditions observations, body weight measurements, observation and size measurements of nodule were performed once a week according to “Standard operation manual for care and management of experimental animals” published from the Central Institute for Experimental Animals. In observing the nodule, a site where the specimen was transplanted was palpated with a finger. Presuming that formation of a nodule was detected in case a hardness to the touch was felt by finger, a major axis (L) and a minor axis (W) thereof were measured with Vernier calipers. A volume of the nodule (V) was calculated by using a simple formula of tumor volume: V=LW2/2 (L and W in mm, V in mm.sup.3) according to “The Nude Mouse and Anticancer Drug Evaluation” (edited by T. Noguchi, Y. Sakurai. and M. Inaba, Kanishobo, June 1991, Kanishobo). The individual bodies of HeLa S3 group were euthanized at 5 to 8 weeks as humane endpoint of the observation because it was confirmed that a weight of nodule (calculated from a volume thereof assuming that a specific gravity being 1) exceeded 1/10 of the body weight during the observation period. The euthanization was performed by exsanguinating the mice under isoflurane anesthesia and the various organs in the chest cavity and the abdominal cavity were observed. Further, the skin at the transplanted site including the subcutaneous tissue was sampled and fixed with a 10% neutral buffered formalin solution. The formalin-fixed specimen was embedded in paraffin, which was sectioned and then stained with HE, and anti-HLA immunostaining followed by observation with an optical microscope.

Result

[0142] The results are shown in FIG. 6. FIG. 6 is a graph as a drawing, which shows an evaluation of carcinogenicity. In HeLa S3 group, a nodule was observed in 100% of the individuals (5/5 cases) 3 weeks after the transplantation while no nodule was observed in the culture medium group and the cell A group until the end of the observation. In all the cases in HeLa S3 group, a nodule was observed. Because the nodule showed continuous increase in its volume and showed poorly differentiated adenocarcinoma histology as well as anti-HLA reaction, it was considered to be a tumor derived from HeLa S3 cell. In the cell A group, a histopathological examination revealed anti-HLA test positive fibroplasia in 6/10 cases, which was considered to be remaining transplanted cells. However, no nodule was observed in all cases over the whole test period, and no hyperplasia or neoplastic change was observed in HE stained histopathological images. These results indicate that the cell A does not show tumorigenicity under this test conditions.

Example 8

[0143] (Study of Effects on Human with Spinal Cord Injury: Effects of GDNF)

[0144] Autologous cells from each patient's skin were cultured without treating SAG or the like and then detached from culture dishes with an enzyme, Accutase (GIBCO A11105). Prior to the transplantation, 1 mL of spinal fluid was taken by lumbar puncture. 1×10.sup.7 detached cells which were suspended in 1 mL of injectable physiological saline were then autologously transplanted at the punctured site. These 7 patients of cases 1-7 consisted of 6 males and 1 female with ages of from 32 to 51. The number of administrations were 2 to 3 with dose interval of from 1 to 3 months. The period from the injury to the administration ranged from 3 to 23 years. The patients were quadriplegic with C4-7 cervical cord injury. Side effects observed were headache and fever on the day of the administration. Among 7 patients, no therapeutic effects were observed in 3 patients. In the other 4 patients, therapeutic effects and subjective symptoms such as sweating in the arm, cutaneous sensation, improved urinary retention, increased grip strength, improved finger movements, or the like were observed. Only in the case 8, the cells with increased GDNF mRNA by SAG treatment were transplanted. the same number of cells as mentioned above were administered 2 times within 1 month. The patient of the case 8 was 47-year old male with Th3 thoracic cord injury with leg paralysis, and the period from the injury to the administration was 2 and a half years. A side effect of headache was observed on the day of the administration. The therapeutic effect became apparent one month after the administration, that is, he became capable of walking in an upright posture with an aid. Although the injury of the patient was milder as leg paralysis and the period to the administration was shorter from the injury with the case 8 compared with cases 1-7, the therapeutic effect was dramatic with a faster recovery.

INDUSTRIAL APPLICABILITY

[0145] The present invention can be utilized in the medical industry.

SEQUENCE LISTING FREE TEXTS

[0146] SEQ ID NO:1: primer

[0147] SEQ ID NO:2: primer

[0148] SEQ ID NO:3: primer

[0149] SEQ ID NO:4: primer

[0150] SEQ ID NO:5: primer

[0151] SEQ ID NO:6: primer

SEQUENCE LISTING

[0152] Sequence Listing: 17-297P_ST25.txt