Compounds and methods for reducing SNCA expression

11230712 · 2022-01-25

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SNCA mRNA in a cell or animal, and in certain instances reducing the amount of alpha-synuclein protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and dementia. Such neurodegenerative diseases include Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease and Alzheimer's disease.

Claims

1. A modified oligonucleotide according to the following chemical structure: ##STR00018## ##STR00019## ##STR00020## or a salt thereof.

2. The modified oligonucleotide of claim 1, which is the sodium salt or the potassium salt.

3. A population of modified oligonucleotides of claim 1, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

4. A pharmaceutical composition comprising the modified oligonucleotide of claim 1 and a pharmaceutically acceptable diluent.

5. The pharmaceutical composition of claim 4, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

6. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

7. A method comprising administering to a subject the pharmaceutical composition of claim 4.

8. A method of treating a disease associated with SNCA comprising administering to a subject having or at risk for developing a disease associated with SNCA a therapeutically effective amount of a pharmaceutical composition of claim 4, thereby treating the disease associated with SNCA.

9. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Aes mCeo Aes Ges Aes Tds Ads Tds Tds Tds Tds Tds Gds Tds Tds mCeo Teo Ges mCes mCe (SEQ ID NO: 1703); wherein, A=an adenine nucleobase, .sup.mC=a 5-methyl cytosine nucleobase, G=a guanine nucleobase, T=a thymine nucleobase, e=a 2′-MOE modified sugar, d=a 2′-deoxyribose sugar, s=a phosphorothioate internucleoside linkage, and o=a phosphodiester internucleoside linkage.

10. A pharmaceutical composition comprising the oligomeric compound of claim 9 and a pharmaceutically acceptable diluent.

11. The pharmaceutical composition of claim 10, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

12. The pharmaceutical composition of claim 11, wherein the pharmaceutical composition consists essentially of the oligomeric compound and phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

13. A pharmaceutical composition comprising the population of modified oligonucleotides of claim 3 and a pharmaceutically acceptable diluent.

14. The pharmaceutical composition of claim 13, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

15. The pharmaceutical composition of claim 14, wherein the pharmaceutical composition consists essentially of the population of modified oligonucleotides and phosphate-buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

16. The method of claim 8, wherein the disease associated with SNCA is a neurodegenerative disease.

17. The method of claim 16, wherein the neurodegenerative disease is Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease, or Alzheimer's disease.

18. The method of claim 17, wherein the administration improves motor function, reduces of alpha-synuclein aggregates, reduces neurodegeneration, and/or reduces dementia in the subject.

19. A method comprising administering to a subject the modified oligonucleotide of claim 1.

20. A method of treating a disease associated with SNCA comprising administering to a subject having or at risk for developing a disease associated with SNCA a therapeutically effective amount of the modified oligonucleotide of claim 1, thereby treating the disease associated with SNCA.

21. A method comprising administering to a subject the oligomeric compound of claim 9.

22. A method of treating a disease associated with SNCA comprising administering to a subject having or at risk for developing a disease associated with SNCA a therapeutically effective amount of the oligomeric compound of claim 9, thereby treating the disease associated with SNCA.

23. A method comprising administering to a subject the pharmaceutical composition of claim 10.

24. A method of treating a disease associated with SNCA comprising administering to a subject having or at risk for developing a disease associated with SNCA a therapeutically effective amount of the pharmaceutical composition of claim 10, thereby treating the disease associated with SNCA.

25. A method of treating a disease associated with SNCA comprising administering to a subject having or at risk for developing a disease associated with SNCA a therapeutically effective amount of the pharmaceutical composition of claim 13, thereby treating the disease associated with SNCA.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

(2) The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

(3) Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

(4) Unless otherwise indicated, the following terms have the following meanings:

Definitions

(5) As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosy sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

(6) As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

(7) As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

(8) As used herein, “administering” means providing a pharmaceutical agent to an animal.

(9) As used herein, “animal” means a human or non-human animal.

(10) As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

(11) As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.

(12) As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and/or dementia. In certain embodiments, amelioration of these symptoms results in improved motor function, reduction of alpha-synuclein aggregates, reduced neurodegeneration and/or reduced dementia.

(13) As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

(14) As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

(15) As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

(16) As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

(17) As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

(18) As used herein, “conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

(19) As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

(20) As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

(21) As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH.sub.3)—O−2′, and wherein the methyl group of the bridge is in the S configuration.

(22) As used herein, “cEt nucleoside” means a nucleoside comprising cEt modified sugar.

(23) As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

(24) As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” Unless otherwise indicated, “gapmer” refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2′-deoxyribosyl. Thus, the term “MOE gapmer” indicates a gapmer having a sugar motif of 2′-MOE nucleosides in both wings and a gap of 2′-deoxynucleosides. Unless otherwise indicated, a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

(25) As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

(26) As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

(27) As used herein, the term “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

(28) As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

(29) As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

(30) As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

(31) As used herein, “MOE” means methoxyethyl. “2′-MOE” or “2′-MOE modified sugar” means a 2′-OCH.sub.2CH.sub.2OCH.sub.3 group in place of the 2′—OH group of a ribosyl sugar moiety.

(32) As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE modified sugar As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

(33) As used herein, “mRNA” means an RNA transcript that encodes a protein and includes pre-mRNA and mature mRNA unless otherwise specified.

(34) As used herein, “neurodegenerative disease” means a condition marked by progressive loss of structure or function of neurons, including death of neurons. In certain embodiments, the neurodegenerative disease is Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease and Alzheimer's disease.

(35) As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

(36) As used herein, “nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

(37) As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

(38) As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

(39) As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

(40) As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

(41) As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

(42) As used herein “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within an animal or cells thereof. Typically conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

(43) As used herein, “reducing or inhibiting the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

(44) As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

(45) As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

(46) As used herein, “standard cell assay” means the assay described in Example 10 and reasonable variations thereof.

(47) As used herein, “standard in vivo assay” means the experiment described in Example 22 and reasonable variations thereof.

(48) As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

(49) As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

(50) As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

(51) As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.

(52) As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

(53) As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

(54) As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.

(55) The present disclosure provides the following non-limiting numbered embodiments:

(56) Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 nucleobases of any of SEQ ID NOS: 2193, 1703, 28-1702, 1704-2192, and 2194-2793.

(57) Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of: an equal length portion of nucleobases 50915-50943 of SEQ ID NO: 2;

(58) an equal length portion of nucleobases 19630-19656 of SEQ ID NO: 2;

(59) an equal length portion of nucleobases 28451-28491 of SEQ ID NO: 2;

(60) an equal length portion of nucleobases 48712-48760 of SEQ ID NO: 2;

(61) an equal length portion of nucleobases 23279-23315 of SEQ ID NO: 2;

(62) an equal length portion of nucleobases 20964-21018 of SEQ ID NO: 2;

(63) an equal length portion of nucleobases 22454-22477 of SEQ ID NO: 2;

(64) an equal length portion of nucleobases 72294-72321 of SEQ ID NO: 2;

(65) an equal length portion of nucleobases 20549-20581 of SEQ ID NO: 2; or

(66) an equal length portion of nucleobases 27412-27432 of SEQ ID NO: 2.

(67) Embodiment 3. The oligomeric compound of embodiment 1 or 2, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NO: 1-6, when measured across the entire nucleobase sequence of the modified oligonucleotide.

(68) Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the modified oligonucleotide comprises at least one modified nucleoside.

(69) Embodiment 5. The oligomeric compound of embodiment 4, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

(70) Embodiment 6. The oligomeric compound of embodiment 5, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

(71) Embodiment 7. The oligomeric compound of embodiment 6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.

(72) Embodiment 8. The oligomeric compound of any of embodiments 4-7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

(73) Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2′-MOE modified sugar or 2′-OMe modified sugar.

(74) Embodiment 10. The oligomeric compound of any of embodiments 4-9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

(75) Embodiment 11. The oligomeric compound of embodiment 10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

(76) Embodiment 12. The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide has a sugar motif comprising:

(77) a 5′-region consisting of 1-5 linked 5′-region nucleosides;

(78) a central region consisting of 6-10 linked central region nucleosides; and

(79) a 3′-region consisting of 1-5 linked 3′-region nucleosides; wherein

(80) each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2′-deoxyribosyl sugar moiety.

(81) Embodiment 13. The oligomeric compound of any of embodiments 1-12, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

(82) Embodiment 14. The oligomeric compound of embodiment 13, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

(83) Embodiment 15. The oligomeric compound of embodiment 13 or 14 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

(84) Embodiment 16. The oligomeric compound of embodiment 13 or 15 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

(85) Embodiment 17. The oligomeric compound of any of embodiments 13, 15, or 16, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

(86) Embodiment 18. The oligomeric compound of any of embodiments 1-17, wherein the modified oligonucleotide comprises at least one modified nucleobase.

(87) Embodiment 19. The oligomeric compound of embodiment 18, wherein the modified nucleobase is a 5-methyl cytosine.

(88) Embodiment 20. The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

(89) Embodiment 21. The oligomeric compound of any of embodiments 1-20, wherein the modified oligonucleotide consists of 17 or 20 linked nucleosides.

(90) Embodiment 22. The oligomeric compound of any of embodiments 1-21 consisting of the modified oligonucleotide.

(91) Embodiment 23. The oligomeric compound of any of embodiments 1-21 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

(92) Embodiment 24. The oligomeric compound of embodiment 23, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

(93) Embodiment 25. The oligomeric compound of embodiment 23 or 24, wherein the conjugate linker consists of a single bond.

(94) Embodiment 26. The oligomeric compound of embodiment 24, wherein the conjugate linker is cleavable.

(95) Embodiment 27. The oligomeric compound of embodiment 26, wherein the conjugate linker comprises 1-3 linker-nucleosides.

(96) Embodiment 28. The oligomeric compound of any of embodiments 23-27, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.

(97) Embodiment 29. The oligomeric compound of any of embodiments 23-27, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

(98) Embodiment 30. The oligomeric compound of any of embodiments 1-29 comprising a terminal group.

(99) Embodiment 31. The oligomeric compound of any of embodiments 1-30 wherein the oligomeric compound is a singled-stranded oligomeric compound.

(100) Embodiment 32. The oligomeric compound of any of embodiments 1-26 or 28-30, wherein the oligomeric compound does not comprise linker-nucleosides.

(101) Embodiment 33. An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-30 or 32.

(102) Embodiment 34. An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-32 or an oligomeric duplex of embodiment 33.

(103) Embodiment 35. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-32 or an oligomeric duplex of embodiment 33 and a pharmaceutically acceptable carrier or diluent.

(104) Embodiment 36. A modified oligonucleotide according to the following formula:

(105) ##STR00001##
or a salt thereof.

(106) Consistent with the definitions and disclosure herein, compound of Embodiment 36 may be made by deliberately controlling stereochemistry of any, all or none of the linkages.

(107) Embodiment 37. A modified oligonucleotide according to the following formula:

(108) ##STR00002##
or a salt thereof.

(109) Consistent with the definitions and disclosure herein, compound of Embodiment 37 may be made by deliberately controlling stereochemistry of any, all or none of the linkages.

(110) Embodiment 38. A modified oligonucleotide according to the following formula:

(111) ##STR00003##
or a salt thereof.

(112) Consistent with the definitions and disclosure herein, compound of Embodiment 38 may be made by deliberately controlly stereochemistry of any, all or none of the linkages.

(113) Embodiment 39. A modified oligonucleotide according to the following formula:

(114) ##STR00004##
or a salt thereof.

(115) Consistent with the definitions and disclosure herein, compound of Embodiment 39 may be made by deliberately controlling stereochemistry of any, all or none of the linkages.

(116) Embodiment 40. A modified oligonucleotide according to the following formula:

(117) ##STR00005## ##STR00006## ##STR00007##
or a salt thereof.

(118) Consistent with the definitions and disclosure herein, compound of Embodiment 40 may be made by deliberately controlling stereochemistry of any, all or none of the linkages.

(119) Embodiment 41. The modified oligonucleotide of any of embodiments 36-40, which is a sodium salt of the formula.

(120) Embodiment 42. A chirally enriched population of the modified oligonucleotide of any of embodiments 36-40 wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

(121) Embodiment 43. The chirally enriched population of embodiment 42, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

(122) Embodiment 44. The chirally enriched population of embodiment 42, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

(123) Embodiment 45. The chirally enriched population of embodiment 42, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

(124) Embodiment 46. The chirally enriched population of embodiment 45, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

(125) Embodiment 47. The chirally enriched population of embodiment 45, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

(126) Embodiment 48. The chirally enriched population of embodiment 45, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

(127) Embodiment 48. The chirally enriched population of embodiment 42 or embodiment 45 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

(128) Embodiment 49. The chirally enriched population of embodiment 42 or embodiment 45 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

(129) Embodiment 50. A chirally enriched population of oligomeric compounds of any of embodiments 1-32, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

(130) Embodiment 51. A pharmaceutical composition comprising the modified oligonucleotide of any of embodiments 36-40 and a pharmaceutically acceptable diluent or carrier.

(131) Embodiment 52. The pharmaceutical composition of embodiment 51, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.

(132) Embodiment 53. The pharmaceutical composition of embodiment 50, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

(133) Embodiment 54. A method comprising administering to an animal a pharmaceutical composition of any of embodiments 35 or 51-53.

(134) Embodiment 55. A method of treating a disease associated with SNCA comprising administering to an individual having or at risk for developing a disease associated with SNCA a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 35 or 51-53; and thereby treating the disease associated with SNCA.

(135) Embodiment 56. The method of embodiment 55, wherein the disease associated with SNCA is a neurodegenerative disease.

(136) Embodiment 57. The method of embodiment 56, wherein the neurodegenerative disease is any of Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease and Alzheimer's disease.

(137) Embodiment 58. The method of embodiment 56, wherein at least one symptom or hallmark of the neurodegenerative disease is ameliorated.

(138) Embodiment 59. The method of embodiment 58, wherein the symptom or hallmark is any of motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and dementia.

I. Certain Oligonucleotides

(139) In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

A. Certain Modified Nucleosides

(140) Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

1. Certain Sugar Moieties

(141) In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

(142) In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH.sub.3 (“OMe” or “O-methyl”), and 2′-O(CH.sub.2).sub.2O CH.sub.3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O—C.sub.1-C.sub.10 alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)- alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.).

(143) In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2O N(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.)(R.)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

(144) In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2O N(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).

(145) In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

(146) Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH.sub.2-2′, 4′—(CH.sub.2).sub.2-2′, 4′—(CH.sub.2).sub.3-2′, 4′—CH.sub.2—O-2′ (“LNA”), 4′-CH.sub.2—S-2′, 4′—(CH.sub.2).sub.2—O-2′ (“ENA”), 4′-CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH.sub.2—O—CH.sub.2-2′, 4′—CH.sub.2—N(R)-2′, 4′—CH(CH.sub.2OCH.sub.3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R.sub.aR.sub.b)—N(R)—O-2′, 4′—C(R.sub.aR.sub.b)—O—N(R)-2′, 4′—CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O-2′, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

(147) In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R.sub.a)(R.sub.b)].sub.n—, [C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;

(148) wherein:

(149) x is 0, 1, or 2;

(150) n is 1, 2, 3, or 4;

(151) each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and

(152) each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.

(153) Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 20017, 129, 8362-8379; Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

(154) In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

(155) ##STR00008##
α-L-methyleneoxy (4′-CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

(156) In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

(157) In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

(158) In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(159) ##STR00009##
(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

(160) ##STR00010##
wherein, independently, for each of said modified THP nucleoside:

(161) Bx is a nucleobase moiety;

(162) T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;

(163) q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and

(164) each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

(165) In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.

(166) In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

(167) ##STR00011##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

(168) In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

(169) Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides).

2. Certain Modified Nucleobases

(170) In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

(171) In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp) Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

(172) Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

3. Certain Modified Internucleoside Linkages

(173) In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH.sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

(174) Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

(175) ##STR00012##
Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

(176) Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′-CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′-CH.sub.2—N(H)—C(═O)-5′), formacetal (3′-O—CH.sub.2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

B. Certain Motifs

(177) In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

1. Certain Sugar Motifs

(178) In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

(179) In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

(180) In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.

(181) In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.

(182) In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2′-deoxy nucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

(183) In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

(184) Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]−[# of nucleosides in the gap]−[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleosides sugars. Thus, a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing.

(185) In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

2. Certain Nucleobase Motifs

(186) In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

(187) In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

(188) In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

3. Certain Internucleoside Linkage Motifs

(189) In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

C. Certain Lengths

(190) It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

(191) In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides

D. Certain Modified Oligonucleotides

(192) In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

E. Certain Populations of Modified Oligonucleotides

(193) Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

F. Nucleobase Sequence

(194) In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

II. Certain Oligomeric Compounds

(195) In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

(196) Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

(197) In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

(198) Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

(199) In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

(200) Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

(201) In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

(202) In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

(203) Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

(204) In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

(205) Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

(206) In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

(207) In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

(208) In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

B. Certain Terminal Groups

(209) In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phophate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphanates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

III. Oligomeric Duplexes

(210) In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

IV. Antisense Activity

(211) In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

(212) In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

(213) In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

(214) In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

(215) Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.

V. Certain Target Nucleic Acids

(216) In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

A. Complementarity/Mismatches to the Target Nucleic Acid

(217) It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

(218) In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

(219) In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

B. SNCA

(220) In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is SNCA. In certain embodiments, SNCA nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No: NM_000345.3), SEQ ID NO: 2 (GENBANK Accession No: NT_016354.20 TRUNC 30800000-30919000), SEQ ID NO: 3 (GENBANK Accession No: JN709863.1), SEQ ID NO: 4 (GENBANK Accession No: BC013293.2), SEQ ID NO: 5 (GENBANK Accession No: NM_001146055.1), and SEQ ID NO: 6 (GENBANK Accession No: HQ830269.1).

(221) In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 reduces the amount of SNCA mRNA, and in certain embodiments reduces the amount of alpha-synuclein protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in an animal with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 ameliorates one or more symptom or hallmark of a neurodegenerative disease. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and dementia. In certain embodiments, contacting a cell in an animal with an oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 results in improved motor function, reduction of alpha-synuclein aggregates, reduced neurodegeneration and/or reduced dementia. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide

C. Certain Tart et Nucleic Acids in Certain Tissues

(222) In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS). Such cells and tissues include motor cortex, frontal cortex, caudate, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, dorsal cochlear nucleus (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forbrain nuclei.

VI. Certain Pharmaceutical Compositions

(223) In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

(224) In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

(225) In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

(226) In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

(227) In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

(228) Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

(229) In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

(230) In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

(231) In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

(232) In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain.

VII. Certain Compositions

1. Compound No: 763085

(233) In certain embodiments, Compound No: 763085 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) CAGACTGTAATCTAGGACCC (incorporated herein as SEQ ID NO: 1887), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

(234) In certain embodiments, Compound No: 763085 is characterized by the following chemical notation: mCes Aeo Geo Aeo mCes Tds Gds Tds Ads Ads Tds mCds Tds Ads Gds Geo Aeo mCes mCes mCe; wherein,

(235) A=an adenine nucleobase,

(236) mC=a 5-methyl cytosine nucleobase,

(237) G=a guanine nucleobase,

(238) T=a thymine nucleobase,

(239) e=a 2′-MOE modified sugar,

(240) d=a 2′-deoxyribose sugar,

(241) s=a phosphorothioate internucleoside linkage, and

(242) o=a phosphodiester internucleoside linkage.

(243) In certain embodiments, Compound No: 763085 is represented by the following chemical structure:

(244) ##STR00013##

2. Compound No: 763364

(245) In certain embodiments, Compound No: 763364 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) ACGACATTTTCTTGCCTCTT (incorporated herein as SEQ ID NO: 2166), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

(246) In certain embodiments, Compound No: 763364 is characterized by the following chemical notation: Aes mCeo Geo Aeo mCes Ads Tds Tds Tds Tds mCds Tds Tds Gds mCds mCeo Teo mCes Tes Te; wherein,

(247) A=an adenine nucleobase,

(248) mC=a 5-methyl cytosine nucleobase,

(249) G=a guanine nucleobase,

(250) T=a thymine nucleobase,

(251) e=a 2′-MOE modified sugar,

(252) d=a 2′-deoxyribose sugar,

(253) s=a phosphorothioate internucleoside linkage, and

(254) o=a phosphodiester internucleoside linkage.

(255) In certain embodiments, Compound No: 763364 is represented by the following chemical structure:

(256) ##STR00014##

3. Compound No: 763391

(257) In certain embodiments, Compound No: 763391 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) GTTTTCATCAATATCTGCAA (incorporated herein as SEQ ID NO: 2193), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

(258) In certain embodiments, Compound No: 763391 is characterized by the following chemical notation: Ges Teo Teo Teo Tes mCds Ads Tds mCds Ads Ads Tds Ads Tds mCds Teo Geo mCes Aes Ae; wherein,

(259) A=an adenine nucleobase,

(260) mC=a 5-methyl cytosine nucleobase,

(261) G=a guanine nucleobase,

(262) T=a thymine nucleobase,

(263) e=a 2′-MOE modified sugar,

(264) d=a 2′-deoxyribose sugar,

(265) s=a phosphorothioate internucleoside linkage, and

(266) o=a phosphodiester internucleoside linkage.

(267) In certain embodiments, Compound No: 763391 is represented by the following chemical structure:

(268) ##STR00015##

4. Compound No: 789243

(269) In certain embodiments, Compound No: 789243 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) TGAATTCCTTTACACCACAC (incorporated herein as SEQ ID NO: 1639), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3 and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

(270) In certain embodiments, Compound No: 789243 is characterized by the following chemical notation: Tes Geo Aes Aes Tes Tds mCds mCds Tds Tds Tds Ads mCds Ads mCds mCes Aeo mCes Aes mCe; wherein,

(271) A=an adenine nucleobase,

(272) mC=a 5-methyl cytosine nucleobase,

(273) G=a guanine nucleobase,

(274) T=a thymine nucleobase,

(275) e=a 2′-MOE modified sugar,

(276) d=a 2′-deoxyribose sugar,

(277) s=a phosphorothioate internucleoside linkage, and

(278) o=a phosphodiester internucleoside linkage.

(279) In certain embodiments, Compound No: 789243 is represented by the following chemical structure:

(280) ##STR00016##

5. Compound No: 827599

(281) In certain embodiments, Compound No: 827599 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) ACAGATATTTTTGTTCTGCC (incorporated herein as SEQ ID NO: 1703), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

(282) In certain embodiments, Compound No: 827599 is characterized by the following chemical notation: Aes mCeo Aes Ges Aes Tds Ads Tds Tds Tds Tds Tds Gds Tds Tds mCeo Teo Ges mCes mCe; wherein,

(283) A=an adenine nucleobase,

(284) mC=a 5-methyl cytosine nucleobase,

(285) G=a guanine nucleobase,

(286) T=a thymine nucleobase,

(287) e=a 2′-MOE modified sugar,

(288) d=a 2′-deoxyribose sugar,

(289) s=a phosphorothioate internucleoside linkage, and

(290) o=a phosphodiester internucleoside linkage.

(291) In certain embodiments, Compound No: 827599 is represented by the following chemical structure:

(292) ##STR00017##

VIII. Certain Comparator Compositions

(293) In certain embodiments, Compound No: 387978, a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) TCCTTGGCCTTTGAAAGTCC (incorporated herein as SEQ ID NO: 21), wherein each internucleoside linkage is a phorsphorothioate internucleoside linkage, each cytosine is a 5-methyl cytosine, and each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modified sugar, which was previously described in WO 2012/068405, incorporated herein by reference, is a comparator compound. Compound No. 387978 was selected as a comparator compound because it was potent in multiple dose studies of reducing human SNCA mRNA without overt toxicity in various studies as described in WO 2012/068405. Thus, based on the disclosure of WO 2012/068405, Compound No. 387978 was deemed potent with an acceptable tolerability profile.

(294) In certain embodiments, Compound No: 387985, a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) CCAACATTTGTCACTTGCTC (incorporated herein as SEQ ID NO: 22), wherein each internucleoside linkage is a phorsphorothioate internucleoside linkage, each cytosine is a 5-methyl cytosine, and each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modified sugar, which was previously described in WO 2012/068405, incorporated herein by reference, is a comparator compound. Compound No. 387985 was selected as a comparator compound because it was potent in multiple dose studies of reducing human SNCA mRNA without overt toxicity in various studies as described in WO 2012/068405. Thus, based on the disclosure of WO 2012/068405, Compound No. 387985 was deemed potent with an acceptable tolerability profile.

(295) In certain embodiments, compounds described herein are superior relative to the compounds described in WO 2012/068405 because they demonstrate one or more improved properties, such as, potency and tolerability.

Compound 763085

(296) For example, as provided in Example 10 (hereinbelow), Compound 763085 demonstrated an IC.sub.50 of <0.44 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM and 12.00 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 5.00 μM in the same study. Therefore, Compound 763085 is demonstrably more potent than Comparator Compound 387985 in this assay.

(297) For example, as provided in Example 11 (hereinbelow), Compound 763085 demonstrated an IC.sub.50 of 0.47 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM and 20.000 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 4.20 μM in the same study. Therefore, Compound 763085 is demonstrably more potent than Comparator Compound 387985 in this assay.

(298) For example, as provided in Example 17 (hereinbelow), Compound 763085 demonstrated functional observational battery (FOB) scores of 0.8 and 1.3 whereas Comparator Compound 387985 demonstrated a FOB score of 6.0 in wild-type C57/B16 mice after 3 hours when treated with 700 μg of oligonucleotide by ICV administration. Therefore, Compound 763085 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

Compound 763364

(299) For example, as provided in Example 10 (hereinbelow), Compound 763364 demonstrated an IC.sub.50 of <0.44 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM and 12.00 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 5.00 μM in the same study. Therefore, Compound 763364 is demonstrably more potent than Comparator Compound 387985 in this assay.

(300) For example, as provided in Example 11 (hereinbelow), Compound 763364 demonstrated an IC.sub.50 of 0.86 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM and 20.000 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 4.20 μM in the same study. Therefore, Compound 763364 is demonstrably more potent than Comparator Compound 387985 in this assay.

Compound 763391

(301) For example, as provided in Example 10 (hereinbelow), Compound 763391 demonstrated an IC.sub.50 of 0.94 μM and 2.49 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM and 12.00 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 5.00 μM in the same study. Therefore, Compound 763391 is demonstrably more potent than Comparator Compound 387985 in this assay.

(302) For example, as provided in Example 11 (hereinbelow), Compound 763391 demonstrated an IC.sub.50 of 1.10 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM and 20.000 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 4.20 μM in the same study. Therefore, Compound 763391 is demonstrably more potent than Comparator Compound 387985 in this assay.

(303) For example, as provided in Example 17 (hereinbelow), Compound 763391 demonstrated a FOB score of 0.0 and 2.3 whereas Comparator Compound 387985 demonstrated a FOB score of 6.0 in wild-type C57/B16 mice after 3 hours when treated with 700 μg of oligonucleotide by ICV administration. Therefore, Compound 763391 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

(304) For example, as provided in Example 18 (hereinbelow), Compound 763391 demonstrated FOB scores of 0.0 and 1.3 whereas Comparator Compound 387985 demonstrated a FOB score of 3.8 in Sprague Dawley rats after 3 hours when treated with 3 mg of oligonucleotide by IT administration. Therefore, Compound 763391 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

Compound 789243

(305) For example, as provided in Example 10 (hereinbelow), Compound 789243 demonstrated an IC.sub.50 of 2.40 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM and 12.00 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 5.00 μM in the same study. Therefore, Compound 789243 is demonstrably more potent than Comparator Compound 387985 in this assay.

(306) For example, as provided in Example 11 (hereinbelow), Compound 789243 demonstrated an IC.sub.50 of 2.25 μM and 1.90 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM and 20.000 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 4.20 μM in the same study. Therefore, Compound 789243 is demonstrably more potent than Comparator Compound 387985 in this assay.

(307) For example, as provided in Example 17 (hereinbelow), Compound 789243 demonstrated a FOB score of 0.3 and 0.0 whereas Comparator Compound 387985 demonstrated a FOB score of 6.0 in wild-type C57/B16 mice after 3 hours when treated with 700 μg of oligonucleotide by ICV administration. Therefore, Compound 789243 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

(308) For example, as provided in Example 18 (hereinbelow), Compound 789243 demonstrated FOB scores of 1.8 and 1.5 whereas Comparator Compound 387985 demonstrated a FOB score of 3.8 in Sprague Dawley rats after 3 hours when treated with 3 mg of oligonucleotide by IT administration. Therefore, Compound 789243 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

Compound 827599

(309) For example, as provided in Example 10 (hereinbelow), Compound 827599 demonstrated an IC.sub.50 of 0.40 μM μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM and 12.00 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 5.00 μM in the same study. Therefore, Compound 827599 is demonstrably more potent than Comparator Compound 387985 in this assay.

(310) For example, as provided in Example 11 (hereinbelow), Compound 827599 demonstrated an IC.sub.50 of 0.40 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM and 20.000 μM. Comparator Compound 387985 demonstrated an IC.sub.50 of 4.20 μM in the same study. Therefore, Compound 827599 is demonstrably more potent than Comparator Compound 387985 in this assay.

(311) For example, as provided in Example 17 (hereinbelow), Compound 827599 demonstrated a FOB score of 0.0 whereas Comparator Compound 387985 demonstrated a FOB score of 6.0 in wild-type C57/B16 mice after 3 hours when treated with 700 μg of oligonucleotide by ICV administration. Therefore, Compound 827599 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

(312) For example, as provided in Example 18 (hereinbelow), Compound 827599 demonstrated a FOB score of 2.0 whereas Comparator Compound 387985 demonstrated a FOB score of 3.8 in Sprague Dawley rats after 3 hours when treated with 3 mg of oligonucleotide by IT administration. Therefore, Compound 827599 is demonstrably more tolerable than Comparator Compound 387985 in this assay.

IX. Certain Hotspot Regions

1. Nucleobases 50915-50943 of SEQ ID NO: 2

(313) In certain embodiments, nucleobases 50915-50943 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 50915-50943 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(314) The nucleobase sequences of SEQ ID Nos: 243, 1601-1603, and 2188, 2189, 2190, 2191, 2192, 2193, 2194, 2195, 2196 and 2197 are complementary to nucleobases 50915-50943 of SEQ ID NO: 2.

(315) In certain embodiments, modified oligonucleotides complementary to nucleobases 50915-50943 of SEQ ID NO: 2 achieve at least 45% reduction of SNCA RNA in vitro in the standard cell assay.

2. Nucleobases 19630-19656 of SEQ ID NO: 2

(316) In certain embodiments, nucleobases 19630-19656 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 19630-19656 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(317) The nucleobase sequences of SEQ ID Nos: 1103, 1700, 1701, 1702, 1703, 1704, 1705, 1706 and 1707 are complementary to nucleobases 19630-19656 of SEQ ID NO: 2.

(318) In certain embodiments, modified oligonucleotides complementary to nucleobases 19630-19656 of SEQ ID NO: 2 achieve at least 48% reduction of SNCA RNA in vitro in the standard cell assay.

3. Nucleobases 28451-28491 of SEQ ID NO: 2

(319) In certain embodiments, nucleobases 28451-28491 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 28451-28491 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(320) The nucleobase sequences of SEQ ID Nos: 1168, 1882, 1883, 1884, 1885, 1886, 1887, 1888, 1889, 1890, 1891, 1892 and 1893 are complementary to nucleobases 28451-28491 of SEQ ID NO: 2.

(321) In certain embodiments, modified oligonucleotides complementary to nucleobases 28451-28491 of SEQ ID NO: 2 achieve at least 47% reduction of SNCA RNA in vitro in the standard cell assay.

4. Nucleobases 48712-48760 of SEQ ID NO:2

(322) In certain embodiments, nucleobases 48712-48760 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 48712-48760 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(323) The nucleobase sequences of SEQ ID Nos: 471, 1585-1588, and 2157-2166 are complementary to nucleobases 48712-48760 of SEQ ID NO: 2.

(324) In certain embodiments, modified oligonucleotides complementary to nucleobases 48712-48760 of SEQ ID NO: 2 achieve at least 40% reduction of SNCA RNA in vitro in the standard cell assay.

5. Nucleobases 23279-23315 of SEQ ID NO: 2

(325) In certain embodiments, nucleobases 23279-23315 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 23279-23315 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(326) The nucleobase sequences of SEQ ID Nos: 164, 1130-1133, and 1797-1810 are complementary to nucleobases 23279-23315 of SEQ ID NO: 2.

(327) In certain embodiments, modified oligonucleotides complementary to nucleobases 23279-23315 of SEQ ID NO: 2 achieve at least 57% reduction of SNCA RNA in vitro in the standard cell assay.

6. Nucleobases 20964-21018 of SEQ ID NO: 2

(328) In certain embodiments, nucleobases 20964-21018 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 20964-21018 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(329) The nucleobase sequences of SEQ ID Nos: 391, 468, 1112-1116, and 1723-1741 are complementary to nucleobases 20964-21018 of SEQ ID NO: 2.

(330) In certain embodiments, modified oligonucleotides complementary to nucleobases 20964-21018 of SEQ ID NO: 2 achieve at least 42% reduction of SNCA RNA in vitro in the standard cell assay.

7. Nucleobases 22454-22477 of SEQ ID NO: 2

(331) In certain embodiments, nucleobases 22454-22477 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 22454-22477 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(332) The nucleobase sequences of SEQ ID Nos: 88, 1123-1126, and 1778-1782 are complementary to nucleobases 22454-22477 of SEQ ID NO: 2.

(333) In certain embodiments, modified oligonucleotides complementary to nucleobases 22454-22477 of SEQ ID NO: 2 achieve at least 50% reduction of SNCA RNA in vitro in the standard cell assay.

8. Nucleobases 72294-72321 of SEQ ID NO: 2

(334) In certain embodiments, nucleobases 72294-72321 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 72294-72321 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(335) The nucleobase sequences of SEQ ID Nos: 1323 and 2345-2353 are complementary to nucleobases 72294-72321 of SEQ ID NO: 2.

(336) In certain embodiments, modified oligonucleotides complementary to nucleobases 72294-72321 of SEQ ID NO: 2 achieve at least 58% reduction of SNCA RNA in vitro in the standard cell assay.

9. Nucleobases 20549-20581 of SEQ ID NO: 2

(337) In certain embodiments, nucleobases 20549-20581 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 20549-20581 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(338) The nucleobase sequences of SEQ ID Nos: 314 and 1107-1110 are complementary to nucleobases 20549-20581 of SEQ ID NO: 2.

(339) In certain embodiments, modified oligonucleotides complementary to nucleobases 20549-20581 of SEQ ID NO: 2 achieve at least 58% reduction of SNCA RNA in vitro in the standard cell assay.

10. Nucleobases 27412-27432 of SEQ ID NO: 2

(340) In certain embodiments, nucleobases 27412-27432 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to nucleobases 27412-27432 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 17 or 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers or mixed cEt and MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

(341) The nucleobase sequences of SEQ ID Nos: 468, 1113-1114, and 1163 are complementary to nucleobases 27412-27432 of SEQ ID NO: 2.

(342) In certain embodiments, modified oligonucleotides complementary to nucleobases 27412-27432 of SEQ ID NO: 2 achieve at least 62% reduction of SNCA RNA in vitro in the standard cell assay.

Nonlimiting Disclosure and Incorporation by Reference

(343) Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

(344) While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

(345) Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine(methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

(346) Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (5), as a or such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

(347) The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

(348) The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effect of 5-8-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

(349) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

(350) Cultured SH-SY5Y cells at a density of 20,000 cells per well were transfected using electroporation with 7,000 nM concentration of modified oligonucleotide or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human primer probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT, designated herein as SEQ ID NO: 11; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 12; probe sequence TGCTCCCAAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID: 13) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control cells (these conditions describe a “Standard Cell Assay”). The modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region. Compound No. 387978, previously disclosed in WO 2012/068405 was also tested and is a comparator oligonucleotide. Compound No. 387978 is a 5-10-5 MOE gapmer wherein each internucleoside linkage is a phosphorothioate internucleoside linkage and each cytosine residue is a 5-methyl cytosine.

(351) The modified oligonucleotides in tables 1-7 are 5-8-4 mixed MOE and cEt gapmers. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises eight 2′-deoxynucleosides and is flanked by a wing segment on the 5′ end comprising five 2′-MOE nucleosides and a wing segment on the 3′ end comprising two cEt nucleosides and two 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddkkee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and represents a cEt modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssoss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(352) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(353) TABLE-US-00001 TABLE 1 Percent reduction of human SNCA mRNA with 5-8-4 MOE and  cEt gapmers with mixed internucleoside linkages SEQ ID SEQ SEQ ID SEQ ID Compound No: 1 ID No: No: 2 No: 2 % SEQ No start  1 stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC 64 21 709518 9 25 3191 3207 TAGTCCTCCTCCTTCTC 34 30 709524 102 118 3284 3300 TGCAGCCCGCACGCACC 33 31 709530 232 248 N/A N/A TTACACCACACTGTCGT 43 32 709536 240 256 4691 4707 GAATTCCTTTACACCAC 81 33 709542 256 272 4707 4723 TACATCCATGGCTAATG 53 34 709548 278 294 4729 4745 CCTTTGAAAGTCCTTTC 62 35 709554 288 304 4739 4755 CCCTCCTTGGCCTTTGA 54 36 709560 372 388 N/A N/A GAGCCTACATAGAGAAC 61 37 709566 385 401 12198 12214 CTCCTTGGTTTTGGAGC 22 38 709572 405 421 12218 12234 GCCACACCATGCACCAC 79 39 709578 440 456 18007 18023 TTGTCACTTGCTCTTTG 65 40 709584 450 466 18017 18033 CCTCCAACATTTGTCAC 23 41 709590 470 486 18037 18053 TCACACCCGTCACCACT 58 42 709596 512 528 18079 18095 CAATGCTCCCTGCTCCC 61 43 709602 584 600 111119 111135 GAATTCCTTCCTGTGGG 0 44 709608 650 666 N/A N/A CTTGATACCCTTCCTCA 0 45  709614* 729 745 113797 113813 CTTGTACAGGATGGAAC 1 46 709620 789 805 113857 113873 TTCGAGATACACTGTAA 34 47 709626 798 814 113866 113882 ATGGAAGACTTCGAGAT 0 48 709632 866 882 113934 113950 TCACTTCAGTGAAAGGG 67 49 709638 892 908 113960 113976 CACACAAAGACCCTGCT 0 50 709644 906 922 113974 113990 CACAAAATCCACAGCAC 0 51 709650 934 950 114002 114018 AATTTGTTTTAACATCG 0 52 709656 956 972 114024 114040 TGGTAGTCACTTAGGTG 30 53 709662 1034 1050 114102 114118 TCTTATAATATATGATA 0 54 709668 1133 1149 114201 114217 CATAGTTTCATGCTCAC 66 55 709674 1213 1229 114281 114297 TTCTCACCATTTATATA 9 56 709680 1277 1293 114345 114361 TATTATTAAAGTGAGAT 13 57 709686 1327 1343 114395 114411 TTTGTCCTTTGTGTCAG 22 58 709692 1410 1426 114478 114494 TCCGAGTGTAGGGTTAA 12 59 709698 1476 1492 114544 114560 AATCACAGCCACTTAAG 11 60 709704 1590 1606 114658 114674 ACATCAAACAACAGTTC 0 61 709710 1716 1732 114784 114800 AGGTACAGCATTCACAC 14 62 709716 1744 1760 114812 114828 CATGGTCGAATATTATT 25 63 709722 1816 1832 114884 114900 AAGGAGGGTGTAGTCAA 40 64 709728 1882 1898 114950 114966 AAGTTAACCACATTCTC 5 65 709734 2013 2029 115081 115097 GGTAGTTCCAACGATGT 29 66 709740 2079 2095 115147 115163 CAACATTTAAAGGAGGC 35 67 709746 2165 2181 115233 115249 TTTTCAGCACCCATGGG 2 68 709752 2261 2277 115329 115345 GTGACTTTTAGAAATGA 43 69 709758 2327 2343 115395 115411 CTCATGAATACATATAA 11 70 709764 2400 2416 115468 115484 TTCTATGGTAACCATCC 37 71 709770 2469 2485 115537 115553 TAGTGTAAGATGACACA 11 72 709776 2540 2556 115608 115624 ACTGTTCAATAACAAAT 33 73 709782 2648 2664 115716 115732 TCCTCTATTTCTTAATT 1 74 709788 2714 2730 115782 115798 TAAATTCATGGTCACAA 68 75 709794 2783 2799 115851 115867 AAAATTACCGTCAGATA 36 76 709800 2867 2883 115935 115951 AGGCTTATATGACTTAA 12 77 709806 2933 2949 116001 116017 GATTGATCCTCAGGCCA 41 78 709812 2999 3015 116067 116083 ACCGTGGAGTCATATGA 0 79 709818 3065 3081 116133 116149 ACACATTAGATTGTTCT 16 80 709824 3131 3147 116199 116215 GAAACATGTTTGCATCT 47 81 709836 N/A N/A 3445 3461 GGCGACGCGAGGCTGGG 22 82 709842 N/A N/A 3553 3569 ACAATTCCCAAATAATA 6 83 709854 N/A N/A 2097 2113 GACAGCTGTTCCTGGAT 32 84 709860 N/A N/A 3957 3973 ACCAAGAGAGCGGGCAG 30 85 709866 N/A N/A 8613 8629 AAAGAATGCCACTAGGC 23 86 709872 N/A N/A 17660 17676 TACAGGTGCAGTTATAT 20 87 709878 N/A N/A 22457 22473 GCCTGTGACCTGTGCTT 81 88 709884 N/A N/A 27802 27818 GACATCTCTAACATAAA 56 89 709890 N/A N/A 41133 41149 AACAGATTCCAGCAGAG 74 90 709896 N/A N/A 48867 48883 GATGGATATTGACTCCT 53 91 709902 N/A N/A 54583 54599 TATATGCATTTTTCAGG 48 92 709908 N/A N/A 57557 57573 AGACACTCTTACTTGAG 0 93 709914 N/A N/A 71391 71407 TGAAGGACAACTGTGTA 26 94 709922 N/A N/A 75588 75604 GACATCTGAAGTGTTCA 59 95 709928 N/A N/A 78911 78927 ATAACCACCACTGAATT 12 96 709934 N/A N/A 80751 80767 CCATGCTACATTGCTCA 18 97 709940 N/A N/A 83531 83547 GAAAGAACAATGTCATC 75 98 709946 N/A N/A 89651 89667 ACAAACCCAAAGAGATT 51 99 N/A N/A 88646 88662 709952 N/A N/A 89681 89697 GTCCCCAATCCCCACCC 11 100 N/A N/A 88676 88692 709958 N/A N/A 89722 89738 TCCTATAGAGATGAAGT 40 101 N/A N/A 88717 88733 709964 N/A N/A 89731 89747 TATCCACTCTCCTATAG 0 102 N/A N/A 88726 88742 709970 N/A N/A 89191 89207 TCCTTGAAAACTTCCAT 48 103 709976 N/A N/A 93421 93437 GAGGTCAAATTTTCCAG 30 104 709982 N/A N/A 105440 105456 GAGTGACAGTGGTGGGC 28 105

(354) TABLE-US-00002 TABLE 2 Percent reduction of human SNCA mRNA with 5-8-4 MOE  and cEt gapmers with mixed internucleoside linkages SEQ SEQ ID ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC 60 21 709519 22 38 3204 3220 GTCCTCCTCCTCCTAGT 32 106 709525 168 184 3350 3366 GGCTTGAAGGCAAGGCG 46 107 709531 233 249 N/A N/A TTTACACCACACTGTCG 33 108 709537 242 258 4693 4709 ATGAATTCCTTTACACC 46 109 709543 257 273 4708 4724 ATACATCCATGGCTAAT 62 110 709549 280 296 4731 4747 GGCCTTTGAAAGTCCTT 72 111 709555 301 317 4752 4768 AGCAGCCACAACTCCCT 75 112 709561 377 393 N/A N/A TTTTGGAGCCTACATAG 28 113 709567 387 403 12200 12216 CCCTCCTTGGTTTTGGA 46 114 709573 406 422 12219 12235 TGCCACACCATGCACCA 66 115 709579 442 458 18009 18025 ATTTGTCACTTGCTCTT 69 116 709585 453 469 18020 18036 GCTCCTCCAACATTTGT 57 117 709591 471 487 18038 18054 GTCACACCCGTCACCAC 71 118 709597 523 539 18090 18106 AGTGGCTGCTGCAATGC 68 119 709603 595 611 111130 111146 CATATCTTCCAGAATTC 9 120  709609* 671 687 113739 113755 CTTAGGCTTCAGGTTCG 92 121  709615* 740 756 113808 113824 GGAACTGAGCACTTGTA 67 122 709621 790 806 113858 113874 CTTCGAGATACACTGTA 31 123 709627 800 816 113868 113884 TGATGGAAGACTTCGAG 12 124 709633 877 893 113945 113961 CTACCATGTATTCACTT 53 125 709639 893 909 113961 113977 GCACACAAAGACCCTGC 33 126 709645 908 924 113976 113992 GCCACAAAATCCACAGC 56 127 709651 944 960 114012 114028 AGGTGTTTTTAATTTGT 63 128 709657 967 983 114035 114051 TTAGAAATAAGTGGTAG 28 129 709663 1045 1061 114113 114129 ACACCTAAAAATCTTAT 26 130 709669 1144 1160 114212 114228 ATTTATAGGTGCATAGT 24 131 709675 1217 1233 114285 114301 TTAATTCTCACCATTTA 1 132 709681 1279 1295 114347 114363 TTTATTATTAAAGTGAG 4 133 709687 1347 1363 114415 114431 GCTATTAATAACTTTAT 6 134 709693 1421 1437 114489 114505 CTTCAGGGAATTCCGAG 35 135 709699 1487 1503 114555 114571 TTTCAATAATTAATCAC 16 136 709705 1628 1644 114696 114712 GGCTCAATTAAAAATGT 0 137 709711 1727 1743 114795 114811 TATTGTCAGAAAGGTAC 28 138 709717 1749 1765 114817 114833 TTATTCATGGTCGAATA 0 139 709723 1827 1843 114895 114911 TATGGCTCTCTAAGGAG 17 140 709729 1893 1909 114961 114977 TGAGTTAAACAAAGTTA 6 141 709735 2024 2040 115092 115108 AAGGTGACTCTGGTAGT 35 142 709741 2090 2106 115158 115174 CATATATTTGGCAACAT 27 143 709747 2177 2193 115245 115261 CCATCAAGTTTATTTTC 30 144 709753 2272 2288 115340 115356 ACTTTCTACTAGTGACT 16 145 709759 2338 2354 115406 115422 ATATCACATTACTCATG 22 146 709765 2414 2430 115482 115498 GTAAAAAAGGAAGTTTC 11 147 709771 2480 2496 115548 115564 CCATTTCTCTCTAGTGT 16 148 709777 2551 2567 115619 115635 TCCTGAAATATACTGTT 5 149 709783 2659 2675 115727 115743 GTCTAGTTCTGTCCTCT 34 150 709789 2726 2742 115794 115810 CACATAAATCCTTAAAT 7 151 709795 2794 2810 115862 115878 TTCACTGCTCAAAAATT 8 152 709801 2878 2894 115946 115962 GCTTCCTGAAAAGGCTT 40 153 709807 2944 2960 116012 116028 ACCTAGGACTGGATTGA 1 154 709813 3010 3026 116078 116094 TGGTAAAGCCGACCGTG 29 155 709819 3076 3092 116144 116160 AATACCAAACCACACAT 4 156 709825 3145 3161 116213 116229 GCCAGAAAGATGAGGAA 13 157 709837 N/A N/A 3456 3472 CGCTGTGAGCCGGCGAC 0 158 709843 N/A N/A 3586 3602 CCGCCTCTCTCTTTTTT 26 159 709855 N/A N/A 2112 2128 CTTTCAGAGCTGGAAGA 3 160 709861 N/A N/A 4256 4272 CAGAACTAACTGCTCAC 28 161 709867 N/A N/A 10668 10684 AACATCACATGGGCTCA 9 162 709873 N/A N/A 18297 18313 TCTGGGTTAATGCCTGA 62 163 709879 N/A N/A 23286 23302 ATTGTTCTCAGAGACCA 72 164 709885 N/A N/A 31744 31760 ACAGTAAAGATTTGCAT 29 165 709891 N/A N/A 42838 42854 TGATGCCTCTACCTCCA 70 166 709897 N/A N/A 49481 49497 TTGAAATTTTCCAGCTA 69 167 N/A N/A 80992 81008 709903 N/A N/A 55047 55063 TATACCTAATATGTTTG 15 168 709909 N/A N/A 58992 59008 ATTTCATTAATCTGTGA 63 169 709915 N/A N/A 73191 73207 CAGACTTTCTGTGTGGT 77 170 709923 N/A N/A 76780 76796 AATTTGGAAGCTAATGT 24 171 709929 N/A N/A 79117 79133 AGTTCCCATGAGACCAG 56 172 709935 N/A N/A 81199 81215 TGGCTTGGAGCAAAAGG 42 173 709941 N/A N/A 85498 85514 TTATGCAGTGGAACTAA 20 174 709947 N/A N/A 88649 88665 CATACAAACCCAAAGAG 0 175 N/A N/A 89654 89670 709953 N/A N/A 88708 88724 GATGAAGTTAACTCCCT 62 176 N/A N/A 89713 89729 709959 N/A N/A 88719 88735 TCTCCTATAGAGATGAA 0 177 N/A N/A 89724 89740 709965 N/A N/A 88728 88744 TCTATCCACTCTCCTAT 35 178 N/A N/A 89733 89749 709971 N/A N/A 89219 89235 TCTGTTAACTGAGGTAG 55 179 709977 N/A N/A 93953 93969 GGCTTCTGGCTGACTGA 71 180 709983 N/A N/A 106925 106941 GAACATTAAAATTTGCA 25 181

(355) TABLE-US-00003 TABLE 3 Percent reduction of human SNCA mRNA with 5-8-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978  282  301   4733   4752 TCCTTGGCCTTTGAAAGTCC 72  21 709520   44   60   3226   3242 TGGGCCCCTTCTGGTCG 14 182 709526  179  195   3361   3377 GAAAGGCAGAAGGCTTG 27 183 709532  234  250 N/A N/A CTTTACACCACACTGTC 45 184 709538  244  260   4695   4711 TAATGAATTCCTTTACA 35 185 709544  258  274   4709   4725 AATACATCCATGGCTAA 75 186 709550  282  298   4733   4749 TTGGCCTTTGAAAGTCC 77 187 709556  312  328   4763   4779 GTTTTCTCAGCAGCAGC 72 188 709562  379  395 N/A N/A GGTTTTGGAGCCTACAT 63 189 709568  395  411  12208  12224 GCACCACTCCCTCCTTG 55 190 709574  408  424  12221  12237 GTTGCCACACCATGCAC 49 191 709580  444  460  18011  18027 ACATTTGTCACTTGCTC 77 192 709586  464  480  18031  18047 CCGTCACCACTGCTCCT 83 193 709592  473  489  18040  18056 CTGTCACACCCGTCACC 78 194 709598  534  550  18101  18117 TTGACAAAGCCAGTGGC 31 195 709604  606  622 111141 111157 GGATCCACAGGCATATC 29 196 709610*  682  698 113750 113766 CAAAGATATTTCTTAGG 23 197 709616*  751  767 113819 113835 CTGGGCACATTGGAACT  4 198 709622  792  808 113860 113876 GACTTCGAGATACACTG 57 199 709628  811  827 113879 113895 TCAATCACTGCTGATGG 45 200 709634  887  903 113955 113971 AAAGACCCTGCTACCAT 52 201 709640  895  911 113963 113979 CAGCACACAAAGACCCT 65 202 709646  909  925 113977 113993 AGCCACAAAATCCACAG 56 203 709652  945  961 114013 114029 TAGGTGTTTTTAATTTG 52 204 709658  978  994 114046 114062 ATAGTGAGGATTTAGAA 19 205 709664 1056 1072 114124 114140 ATCATTAAAAGACACCT 37 206 709670 1172 1188 114240 114256 CGCAAAATGGTAAAATT 25 207 709676 1226 1242 114294 114310 CGTTTTATTTTAATTCT 27 208 709682 1294 1310 114362 114378 CTTATAAGCATGATTTT 10 209 709688 1359 1375 114427 114443 CTTCTTCAAATGGCTAT 37 210 709694 1432 1448 114500 114516 TGGCAGTGTTGCTTCAG 63 211 709700 1520 1536 114588 114604 CTACAATAGTAGTTGGG 24 212 709706 1639 1655 114707 114723 TGTTAATAAAAGGCTCA 46 213 709712 1730 1746 114798 114814 ATTTATTGTCAGAAAGG 62 214 709718 1772 1788 114840 114856 GGGAACCCACTTTTTTT 17 215 709724 1838 1854 114906 114922 CTAATGTGTCTTATGGC 39 216 709730 1904 1920 114972 114988 GTGAGGAATGCTGAGTT 25 217 709736 2035 2051 115103 115119 TGATCTCCTTTAAGGTG 10 218 709742 2107 2123 115175 115191 GGAAAAATCCTAGAATT  6 219 709748 2188 2204 115256 115272 AGAGTTTTTCACCATCA 37 220 709754 2283 2299 115351 115367 CTTGAAATTATACTTTC 37 221 709760 2349 2365 115417 115433 GCGCCCAATATATATCA 30 222 709766 2425 2441 115493 115509 TCTTCAATTAGGTAAAA 17 223 709772 2491 2507 115559 115575 CAAGAAACTTACCATTT 11 224 709778 2562 2578 115630 115646 CTTTCTAACCTTCCTGA 21 225 709784 2670 2686 115738 115754 CACTGCTATCAGTCTAG 39 226 709790 2737 2753 115805 115821 GAATTTGTATCCACATA 53 227 709796 2806 2822 115874 115890 TATATAAAGTAATTCAC 12 228 709802 2889 2905 115957 115973 ATATGAGACAAGCTTCC 18 229 709808 2955 2971 116023 116039 CTGCAAAATAAACCTAG 41 230 709814 3021 3037 116089 116105 CTGAACTGTTTTGGTAA 30 231 709820 3087 3103 116155 116171 ACCCCACTTGGAATACC 37 232 709826 3156 3172 116224 116240 ATACTGGATAAGCCAGA 22 233 709832 N/A N/A  18121  18137 CCTTGCCCAACTGGTCC 42 234 709838 N/A N/A   3467   3483 CCAGAGGAGGCCGCTGT 15 235 709844 N/A N/A   3597   3613 CCGACTCCTCCCCGCCT 24 236 709862 N/A N/A   7047   7063 TCTTTCCACTCTATCAG 19 237 709868 N/A N/A  10846  10862 ACTGCATATTTAGAGTC 13 238 709874 N/A N/A  18424  18440 ACATGAAAGCCCTCATT 37 239 709880 N/A N/A  25537  25553 ATGAATTGCCACTATAA 56 240 709886 N/A N/A  32984  33000 TGGATAAAAGAAGTTAC 61 241 709892 N/A N/A  43821  43837 TACTTCTCTGGACCTCT 74 242 709898 N/A N/A  50921  50937 TTTCATCAATATCTGCA 90 243 709904 N/A N/A  55614  55630 AATTTAACCTTAAAGTA 20 244 709910 N/A N/A  59199  59215 GTAGAGGCCCAATAAGT 37 245 709916 N/A N/A  74075  74091 AGTTATTGCTATCAAGA 57 246 709924 N/A N/A  77666  77682 GACTCTAGAAAAGCTCT 70 247 709930 N/A N/A  79403  79419 CTTTTTCACTTGTCTCA 48 248 709936 N/A N/A  81475  81491 AGAGCTGTTTGAAGTGA 71 249 709942 N/A N/A  85512  85528 ACCTATGTTGAAACTTA 48 250 709948 N/A N/A  88651  88667 GACATACAAACCCAAAG 46 251 N/A N/A  89656  89672 709954 N/A N/A  88711  88727 AGAGATGAAGTTAACTC 61 252 N/A N/A  89716  89732 709960 N/A N/A  88720  88736 CTCTCCTATAGAGATGA 44 253 N/A N/A  89725  89741 709966 N/A N/A  88757  88773 CCCTTTTCAAGAGCTTT 82 254 N/A N/A  89762  89778 709972 N/A N/A  89254  89270 TAAGCTCATATTTATAG 23 255 709978 N/A N/A  94005  94021 TAAAAGATCATGAGGGC 47 256 709984 N/A N/A 107602 107618 GAAACATGAGTTTAATA  9 257

(356) TABLE-US-00004 TABLE 4 Percent reduction of human SNCA mRNA with 5-8-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978  282  301   4733   4752 TCCTTGGCCTTTGAAAGTCC 71  21 709521   55   71   3237   3253 GCCCCCTCTCTTGGGCC  8 258 709527  190  206   3372   3388 TCACGAGGGTGGAAAGG  0 259 709533  236  252   4687   4703 TCCTTTACACCACACTG 63 260 709539  252  268   4703   4719 TCCATGGCTAATGAATT 24 261 709545  260  276   4711   4727 TGAATACATCCATGGCT 46 262 709551  283  299   4734   4750 CTTGGCCTTTGAAAGTC 72 263 709557  325  341   4776   4792 CACACCCTGTTTGGTTT 45 264 709563  381  397  12194  12210 TTGGTTTTGGAGCCTAC 69 265 709569  400  416  12213  12229 ACCATGCACCACTCCCT 41 266 709575  410  426  12223  12239 CTGTTGCCACACCATGC 45 267 709581  445  461  18012  18028 AACATTTGTCACTTGCT 65 268 709587  465  481  18032  18048 CCCGTCACCACTGCTCC 24 269 709593  475  491  18042  18058 TGCTGTCACACCCGTCA 55 270 709599  545  561  18112  18128 ACTGGTCCTTTTTGACA 15 271 709605  617  633 111152 111168 CCTCATTGTCAGGATCC 42 272 709611  693  709 113761 113777 GAAACTGGGAGCAAAGA 23 273 709617  762  778 113830 113846 AAATGTCATGACTGGGC 37 274 709623  793  809 113861 113877 AGACTTCGAGATACACT 36 275 709629  822  838 113890 113906 GTACAGATACTTCAATC 34 276 709635  888  904 113956 113972 CAAAGACCCTGCTACCA  8 277 709641  897  913 113965 113981 CACAGCACACAAAGACC 22 278 709647  910  926 113978 113994 AAGCCACAAAATCCACA 41 279 709653  947  963 114015 114031 CTTAGGTGTTTTTAATT 19 280 709659 1001 1017 114069 114085 TTCTGAACAACAGCAAC 41 281 709665 1067 1083 114135 114151 TCTTAGACAGTATCATT 38 282 709671 1183 1199 114251 114267 ATAAAACACATCGCAAA 13 283 709677 1241 1257 114309 114325 TTTGCAATGAGATAACG  8 284 709683 1295 1311 114363 114379 GCTTATAAGCATGATTT 22 285 709689 1370 1386 114438 114454 TAAAATTCCTCCTTCTT  4 286 709695 1443 1459 114511 114527 AAACACACTTCTGGCAG 19 287 709701 1531 1547 114599 114615 AATAGACCACTCTACAA 16 288 709707 1660 1676 114728 114744 CGAGACAAAAATAACAA  0 289 709713 1735 1751 114803 114819 ATATTATTTATTGTCAG  0 290 709719 1783 1799 114851 114867 GCTTAGTTCCCGGGAAC  5 291 709725 1849 1865 114917 114933 GCTAATATGTGCTAATG 29 292 709731 1930 1946 114998 115014 GAATTTCTGATGATTAA  9 293 709737 2046 2062 115114 115130 GTCTAGAGAATTGATCT 23 294 709743 2118 2134 115186 115202 ACCTTTCCTAAGGAAAA  0 295 709749 2200 2216 115268 115284 ATTAATTTATACAGAGT  5 296 709755 2294 2310 115362 115378 GAATATTCTGTCTTGAA 30 297 709761 2362 2378 115430 115446 TCCTTCCTCACCAGCGC 31 298 709767 2436 2452 115504 115520 GTAGTAGTCTCTCTTCA 26 299 709773 2507 2523 115575 115591 CATAACTTAAATAAAAC  0 300 709779 2573 2589 115641 115657 CCTAACCGCCACTTTCT 19 301 709785 2681 2697 115749 115765 TTGTTCTAGGTCACTGC 27 302 709791 2749 2765 115817 115833 CACTTTAAAGGAGAATT  0 303 709797 2827 2843 115895 115911 GTCCCAAATAAACTATT  0 304 709803 2900 2916 115968 115984 CTCGGGAGTGAATATGA 12 305 709809 2966 2982 116034 116050 AGAATGTAAGTCTGCAA 24 306 709815 3032 3048 116100 116116 CAAAGTGCACTCTGAAC 23 307 709821 3098 3114 116166 116182 TTCTGAAAAAGACCCCA  0 308 709827 3167 3183 116235 116251 CAAATAGCTACATACTG  2 309 709839 N/A N/A   3495   3511 CGGAGGCGGCACCCGGG  8 310 709845 N/A N/A   3608   3624 TCTCCACAACTCCGACT 18 311 709863 N/A N/A   7156   7172 TAATCAGGGAAGTGATG  0 312 709869 N/A N/A  14963  14979 CTTCAGAAAATCTCCAG 33 313 709875 N/A N/A  20562  20578 CACAACTATGCTGCAAT 58 314 709881 N/A N/A  25804  25820 ATCATCCAGTAGAGTGA 66 315 709887 N/A N/A  33591  33607 GAGAACACTTAAGTGAA 44 316 709893 N/A N/A  46160  46176 ATTTCCATGAAGCCAAG 88 317 N/A N/A  53645  53661 709899 N/A N/A  51477  51493 CTAGAGACCACCTGAGA 27 318 709905 N/A N/A  56363  56379 CTAATGAACAGAGAAAG  2 319 709911 N/A N/A  68799  68815 CCAAAGTAAGAGGAGAT 37 320 709917 N/A N/A  74219  74235 TGTTGCTAAGCACAAAC 44 321 709925 N/A N/A  78068  78084 TCAAGGTGCCATATCTG 51 322 709931 N/A N/A  80286  80302 AAAGAAAGGCAGTGTTG  1 323 709937 N/A N/A  82460  82476 CCAATATGGATTCAGCA 46 324 709943 N/A N/A  86783  86799 CAATTATTAGCAGTTAC 55 325 709949 N/A N/A  88653  88669 TTGACATACAAACCCAA 60 326 N/A N/A  89658  89674 709955 N/A N/A  88713  88729 ATAGAGATGAAGTTAAC 49 327 N/A N/A  89718  89734 709961 N/A N/A  88722  88738 CACTCTCCTATAGAGAT  0 328 N/A N/A  89727  89743 709967 N/A N/A  88759  88775 TTCCCTTTTCAAGAGCT 77 329 N/A N/A  89764  89780 709973 N/A N/A  91417  91433 AGAAGGAATGCACAATA 37 330 709979 N/A N/A  94055  94071 GCCATAATTCAAGTCAG 63 331 709985 N/A N/A 108049 108065 ACTGACAACTTACAGCA 30 332

(357) TABLE-US-00005 TABLE 5 Percent reduction of human SNCA mRNA with 5-8-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978  282  301   4733   4752 TCCTTGGCCTTTGAAAGTCC 58  21 709522   66   82   3248   3264 CTCGGTCGCTCGCCCCC 36 333 709528  201  217   3383   3399 CAGTTCTCCGCTCACGA 26 334 709534  237  253   4688   4704 TTCCTTTACACCACACT 60 335 709540  254  270   4705   4721 CATCCATGGCTAATGAA 47 336 709546  262  278   4713   4729 CATGAATACATCCATGG 31 337 709552  284  300   4735   4751 CCTTGGCCTTTGAAAGT 41 338 709558  336  352   4787   4803 GCTGCTTCTGCCACACC 61 339 709564  382  398  12195  12211 CTTGGTTTTGGAGCCTA 63 340 709570  402  418  12215  12231 ACACCATGCACCACTCC 56 341 709576  418  434 N/A N/A CTCAGCCACTGTTGCCA 57 342 709582  446  462  18013  18029 CAACATTTGTCACTTGC 72 343 709588  467  483  18034  18050 CACCCGTCACCACTGCT 56 344 709594  486  502  18053  18069 TTCTGGGCTACTGCTGT 11 345 709600  556  572 N/A N/A ATTCTTGCCCAACTGGT  7 346 709606  628  644 111163 111179 CATTTCATAAGCCTCAT 12 347 709612*  704  720 113772 113788 GCAGATCTCAAGAAACT 45 348 709618  778  794 113846 113862 CTGTAAAAACTTTGAGA 27 349 709624  794  810 113862 113878 AAGACTTCGAGATACAC 43 350 709630  844  860 113912 113928 CCGAAATGCTGAGTGGG 29 351 709636  889  905 113957 113973 ACAAAGACCCTGCTACC 14 352 709642  899  915 113967 113983 TCCACAGCACACAAAGA 30 353 709648  912  928 113980 113996 TGAAGCCACAAAATCCA 28 354 709654  949  965 114017 114033 CACTTAGGTGTTTTTAA 26 355 709660 1012 1028 114080 114096 TCACTAACAACTTCTGA 34 356 709666 1091 1107 114159 114175 ACAAATTTCACAATACG 32 357 709672 1198 1214 114266 114282 TACAAACACAAGTGAAT 14 358 709678 1266 1282 114334 114350 TGAGATGGGATAAAAAT  9 359 709684 1305 1321 114373 114389 AATTCATGTTGCTTATA  0 360 709690 1383 1399 114451 114467 TCTCTACCTCTTCTAAA  0 361 709696 1454 1470 114522 114538 AGTGCATACCAAAACAC  9 362 709702 1549 1565 114617 114633 GACAGGATTGAAGGGAG 26 363 709708 1671 1687 114739 114755 AAAAATTATTTCGAGAC  0 364 709714 1738 1754 114806 114822 CGAATATTATTTATTGT  0 365 709720 1794 1810 114862 114878 TCTTCTACACTGCTTAG 14 366 709726 1860 1876 114928 114944 GCCTTGAATGTGCTAAT 38 367 709732 1991 2007 115059 115075 GGCATTTCCTGTAAAAA 21 368 709738 2057 2073 115125 115141 AATTTTTATCAGTCTAG 45 369 709744 2137 2153 115205 115221 TCTTCCCTGAAAGAGAA  6 370 709750 2239 2255 115307 115323 CCCCAGAATAATTAAAA  1 371 709756 2305 2321 115373 115389 TAGCATGTCTAGAATAT 23 372 709762 2378 2394 115446 115462 GTCACTCATTCCTCCTT 24 373 709768 2447 2463 115515 115531 CTTAGCACTCTGTAGTA  9 374 709774 2518 2534 115586 115602 CCTTGCTTAAACATAAC 16 375 709780 2596 2612 115664 115680 CTTTAGGTAGATTTAAA  0 376 709786 2692 2708 115760 115776 CTAATCTCAAATTGTTC 12 377 709792 2761 2777 115829 115845 TAAGGGAAGAAACACTT 11 378 709798 2838 2854 115906 115922 TTAAGTGTTTGGTCCCA 53 379 709804 2911 2927 115979 115995 CAGGTGAATGTCTCGGG 29 380 709810 2977 2993 116045 116061 AATAACTTGGGAGAATG  6 381 709816 3043 3059 116111 116127 CAATTGTGTGCCAAAGT 15 382 709822 3109 3125 116177 116193 TAGTGCAGAGATTCTGA 38 383 709828 3174 3190 116242 116258 TATGTCACAAATAGCTA  3 384 709834 N/A N/A   3415   3431 AACCCGCTAACCTGTCG 16 385 709840 N/A N/A   3506   3522 CACAGGAAGGGCGGAGG 10 386 709846 N/A N/A   3619   3635 GTCCCTCTGCTTCTCCA  4 387 709858 N/A N/A   2166   2182 CATACACACGCGAACTT  4 388 709864 N/A N/A   7240   7256 TCAATTATTCATATGTC 18 389 709870 N/A N/A  15701  15717 CTGCACAGTAAAATGTA  8 390 709876 N/A N/A  20986  21002 AGTGTGAGCAAACATTC 50 391 709876 N/A N/A  27411  27427 AGTGTGAGCAAACATTC 50 391 709882 N/A N/A  25926  25942 AATTGAATACATTGTCT 63 392 709888 N/A N/A  39106  39122 TCCTAAAGTATTGCACT 31 393 709894 N/A N/A  48228  48244 CCTGGTCATGACTCTGA 62 394 709900 N/A N/A  52420  52436 GATCAAATGTATAGAGA 62 395 709906 N/A N/A  56773  56789 AGAGGCAGGGCTAGACA 13 396 709912 N/A N/A  68801  68817 TGCCAAAGTAAGAGGAG 56 397 709919 N/A N/A  74295  74311 ATAGAACTCTGTAGTCA 72 398 709926 N/A N/A  78080  78096 CAAATGAACTTCTCAAG  7 399 709932 N/A N/A  80397  80413 AAATTACACTGTTGAAT 32 400 709938 N/A N/A  82770  82786 GGCAAAGGGCTCTGGTG 34 401 709944 N/A N/A  87946  87962 GTAAGTTGTGACCATGC 76 402 709950 N/A N/A  88655  88671 ACTTGACATACAAACCC 45 403 709950 N/A N/A  89660  89676 ACTTGACATACAAACCC 45 403 709956 N/A N/A  88714  88730 TATAGAGATGAAGTTAA 26 404 N/A N/A  89719  89735 709962 N/A N/A  88723  88739 CCACTCTCCTATAGAGA 18 405 N/A N/A  89728  89744 709968 N/A N/A  88761  88777 ATTTCCCTTTTCAAGAG 19 406 N/A N/A  89766  89782 19 406 709974 N/A N/A  92159  92175 TAACTCCATTTAATTGT 17 407 709980 N/A N/A  99285  99301 ACAGTACACTATTTGTT 25 408 709986 N/A N/A 109588 109604 ACCACCCCAAACTACCT  0 409

(358) TABLE-US-00006 TABLE 6 Percent reduction of human SNCA mRNA with 5-8-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978  282  301   4733   4752 TCCTTGGCCTTTGAAAGTCC 64  21 709523   91  107   3273   3289 CGCACCTCACTTCCGCG 20 410 709529  212  228   3394   3410 ATGGCCACTCCCAGTTC 21 411 709535  238  254   4689   4705 ATTCCTTTACACCACAC 84 412 709541  255  271   4706   4722 ACATCCATGGCTAATGA 43 413 709547  266  282   4717   4733 CTTTCATGAATACATCC 81 414 709553  286  302   4737   4753 CTCCTTGGCCTTTGAAA 31 415 709559  361  377   4812   4828 GAGAACACCCTCTTTTG 15 416 709565  383  399  12196  12212 CCTTGGTTTTGGAGCCT 63 417 709571  404  420  12217  12233 CCACACCATGCACCACT 63 418 709577  431  447  17998  18014 GCTCTTTGGTCTTCTCA 45 419 709583  448  464  18015  18031 TCCAACATTTGTCACTT 22 420 709589  469  485  18036  18052 CACACCCGTCACCACTG 48 421 709595  501  517  18068  18084 GCTCCCTCCACTGTCTT 28 422 709601  567  583 N/A N/A GCTCCTTCTTCATTCTT  5 423 709607  639  655 N/A N/A TCCTCAGAAGGCATTTC  0 424 709613*  715  731 113783 113799 AACATCTGTCAGCAGAT 56 425 709619  788  804 113856 113872 TCGAGATACACTGTAAA 18 426 709625  796  812 113864 113880 GGAAGACTTCGAGATAC 64 427 709631  855  871 113923 113939 AAAGGGAAGCACCGAAA 25 428 709637  891  907 113959 113975 ACACAAAGACCCTGCTA 12 429 709643  904  920 113972 113988 CAAAATCCACAGCACAC 50 430 709649  914  930 113982 113998 ATTGAAGCCACAAAATC 13 431 709655  952  968 114020 114036 AGTCACTTAGGTGTTTT 32 432 709661 1023 1039 114091 114107 ATGATAGCAAATCACTA 22 433 709667 1122 1138 114190 114206 GCTCACATATTTTTAAG 18 434 709673 1209 1225 114277 114293 CACCATTTATATACAAA 20 435 709679 1274 1290 114342 114358 TATTAAAGTGAGATGGG 28 436 709685 1316 1332 114384 114400 TGTCAGTTCTTAATTCA 17 437 709691 1399 1415 114467 114483 GGTTAATGTTCCATTTT 29 438 709697 1465 1481 114533 114549 CTTAAGGAACCAGTGCA 30 439 709703 1579 1595 114647 114663 CAGTTCCCCAAAATACG  0 440 709709 1705 1721 114773 114789 TCACACCAATATCAGAC 36 441 709715 1740 1756 114808 114824 GTCGAATATTATTTATT 11 442 709721 1805 1821 114873 114889 AGTCAAAATCATCTTCT 17 443 709727 1871 1887 114939 114955 ATTCTCTCAGAGCCTTG 72 444 709733 2002 2018 115070 115086 CGATGTTTAAAGGCATT  0 445 709739 2068 2084 115136 115152 GGAGGCCATGAAATTTT 39 446 709745 2148 2164 115216 115232 GAGTTAATAGATCTTCC 36 447 709751 2250 2266 115318 115334 AAATGACTATGCCCCAG 44 448 709757 2316 2332 115384 115400 ATATAAACTGCTAGCAT 23 449 709763 2389 2405 115457 115473 CCATCCTTATAGTCACT 48 450 709769 2458 2474 115526 115542 GACACATGCAGCTTAGC 42 451 709775 2529 2545 115597 115613 ACAAATCCTTTCCTTGC 12 452 709781 2631 2647 115699 115715 TAATACCAATACTTTTA 21 453 709787 2703 2719 115771 115787 TCACAACTTTCCTAATC  0 454 709793 2772 2788 115840 115856 CAGATAAATATTAAGGG  0 455 709799 2856 2872 115924 115940 ACTTAAAGAACTTTTTG 11 456 709805 2922 2938 115990 116006 AGGCCACTTGGCAGGTG 16 457 709811 2988 3004 116056 116072 ATATGAGGCTGAATAAC 16 458 709817 3054 3070 116122 116138 TGTTCTGTTCCCAATTG 48 459 709823 3120 3136 116188 116204 GCATCTCACACTAGTGC 30 460 709829 3180 3196 116248 116264 ATTTATTATGTCACAAA  0 461 709835 N/A N/A   3426   3442 AGTGGGAGGCAAACCCG  8 462 709841 N/A N/A   3517   3533 GAAAAGGAGCGCACAGG 32 463 709853 N/A N/A   2086   2102 CTGGATCACACCAGAAT 16 464 709859 N/A N/A   2500   2516 CTATCACCATTTTCCTT 13 465 N/A N/A 112970 112986 709865 N/A N/A   7406   7422 AGCCATAAGTGAAATTA 48 466 709871 N/A N/A  15993  16009 AGTTCGATTTAAATGCC 27 467 709877 N/A N/A  20988  21004 ACAGTGTGAGCAAACAT 62 468 N/A N/A  27413  27429 709883 N/A N/A  26205  26221 CCCTCTTTGTGTTATAC 74 469 709889 N/A N/A  40203  40219 GAAAGTTTTTATGGAGA 22 470 709895 N/A N/A  48716  48732 TGTATTTTGGATGCTTC 85 471 709901 N/A N/A  52979  52995 GAAGTGACTATGTCTTC 46 472 709907 N/A N/A  57491  57507 GCCAAATGAATGGGCCA 59 473 709913 N/A N/A  68942  68958 ATCAAAAGGAACATCAA 35 474 709921 N/A N/A  75328  75344 TATTCTTCTCCTCCATG 34 475 709927 N/A N/A  78404  78420 AATGTTGGCAAGCTTGA 48 476 709933 N/A N/A  80489  80505 ACTCACACTGCCTAGCT 36 477 709939 N/A N/A  83333  83349 CCTATATATTCAAGATG 22 478 709945 N/A N/A  88047  88063 AGAAGCTATCAAGACAT 60 479 709951 N/A N/A  88657  88673 CCACTTGACATACAAAC 24 480 N/A N/A  89662  89678 709957 N/A N/A  88715  88731 CTATAGAGATGAAGTTA 39 481 709957 N/A N/A  89720  89736 709963 N/A N/A  88725  88741 ATCCACTCTCCTATAGA  6 482 709963 N/A N/A  89730  89746 709969 N/A N/A  89098  89114 AATAGGAGTTCAATGAA 33 483 709975 N/A N/A  93354  93370 GTTAGATAATTATTGAG 20 484 709981 N/A N/A 100015 100031 CTTCAAACCTTTTGACC 15 485 709987 N/A N/A 110359 110375 CCTATTTATGGTATAAT  0 486

(359) TABLE-US-00007 TABLE 7 Percent reduction of human SNCA mRNA with 5-8-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ ID ID ID ID ID ID ID ID SEQ Compound NO: 3 NO: 3 NO: 4 NO: 4 NO: 5 NO: 5 NO: 6 NO: 6 % ID No start stop start stop start stop start stop Sequence (5′ to 3′) Reduction NO 709830 369 385 N/A N/A N/A N/A N/A N/A ACTACATAGAGAACACC 60 487 709831 380 396 N/A N/A N/A N/A N/A N/A TCTTCTCAGCCACTACA 23 488 709833 523 539 N/A N/A N/A N/A N/A N/A TTGATACCCTTCCTTGC  0 489 709847 N/A N/A 388 404 N/A N/A N/A N/A ACCACACTGAGTCCCTC  0 490 709848 N/A N/A 389 405 N/A N/A N/A N/A CACCACACTGAGTCCCT 22 491 709849 N/A N/A 390 406 N/A N/A N/A N/A ACACCACACTGAGTCCC 11 492 709850 N/A N/A 392 408 N/A N/A N/A N/A TTACACCACACTGAGTC 26 493 709851 N/A N/A 393 409 N/A N/A N/A N/A TTTACACCACACTGAGT 23 494 709852 N/A N/A 394 410 N/A N/A N/A N/A CTTTACACCACACTGAG 24 495 709856 N/A N/A N/A N/A 38 54 N/A N/A TACACCACACTCTTTCA 22 496 709857 N/A N/A N/A N/A N/A N/A 89 105 CCACACTCACTTCCGCG 15 497

Example 2: Effect of 4-9-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

(360) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested as described in Example 1 for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

(361) The modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region. Compound No. 387978, previously disclosed in WO 2012/068405 was also tested and is a comparator oligonucleotide. Compound No. 387978 is a 5-10-5 MOE gapmer wherein each internucleoside linkage is a phosphorothioate internucleoside linkage and each cytosine residue is a 5-methyl cytosine.

(362) The modified oligonucleotides in tables 7-13 are 4-9-4 MOE and cEt gapmers. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises nine 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end comprising two 2′-MOE nucleosides and two cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eekkdddddddddkkee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and ‘k’ represents a cEt modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssoss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(363) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(364) TABLE-US-00008 TABLE 8 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC  9  21 740410 240 256 4691 4707 GAATTCCTTTACACCAC 92  33 740316 N/A N/A 3416 3432 AAACCCGCTAACCTGTC 16 498 740317 N/A N/A 3419 3435 GGCAAACCCGCTAACCT 47 499 740318 N/A N/A 3422 3438 GGAGGCAAACCCGCTAA 13 500 740319 N/A N/A 3425 3441 GTGGGAGGCAAACCCGC  2 501 740320 N/A N/A 3428 3444 GGAGTGGGAGGCAAACC 18 502 740321 N/A N/A 3446 3462 CGGCGACGCGAGGCTGG 16 503 740322 N/A N/A 3449 3465 AGCCGGCGACGCGAGGC 25 504 740323 N/A N/A 3452 3468 GTGAGCCGGCGACGCGA 51 505 740324 N/A N/A 3455 3471 GCTGTGAGCCGGCGACG 66 506 740325 N/A N/A 3458 3474 GCCGCTGTGAGCCGGCG  5 507 740326 N/A N/A 3463 3479 AGGAGGCCGCTGTGAGC 45 508 740327 N/A N/A 3466 3482 CAGAGGAGGCCGCTGTG 21 509 740328 N/A N/A 3469 3485 CCCCAGAGGAGGCCGCT 23 510 740329 N/A N/A 3472 3488 TGTCCCCAGAGGAGGCC  0 511 740330 N/A N/A 3475 3491 GACTGTCCCCAGAGGAG 24 512 740331 N/A N/A 3496 3512 GCGGAGGCGGCACCCGG 13 513 740332 N/A N/A 3499 3515 AGGGCGGAGGCGGCACC 25 514 740333 N/A N/A 3502 3518 GGAAGGGCGGAGGCGGC 28 515 740334 N/A N/A 3505 3521 ACAGGAAGGGCGGAGGC  1 516 740335 N/A N/A 3508 3524 CGCACAGGAAGGGCGGA 19 517 740336 N/A N/A 3511 3527 GAGCGCACAGGAAGGGC 33 518 740337 N/A N/A 3514 3530 AAGGAGCGCACAGGAAG 64 519 740338 N/A N/A 3518 3534 GGAAAAGGAGCGCACAG 40 520 740339 N/A N/A 3521 3537 GAAGGAAAAGGAGCGCA 36 521 740340 N/A N/A 3532 3548 ATAGGAAAGAAGAAGGA 42 522 740341 N/A N/A 3536 3552 TTTAATAGGAAAGAAGA  3 523 740342 N/A N/A 3540 3556 AATATTTAATAGGAAAG  0 524 740343 N/A N/A 3548 3564 TCCCAAATAATATTTAA 42 525 740344 N/A N/A 3551 3567 AATTCCCAAATAATATT 28 526 740345 N/A N/A 3554 3570 AACAATTCCCAAATAAT 33 527 740346 N/A N/A 3558 3574 TTTAAACAATTCCCAAA 15 528 740347 N/A N/A 3561 3577 AAATTTAAACAATTCCC 48 529 740348 N/A N/A 3587 3603 CCCGCCTCTCTCTTTTT 20 530 740349 N/A N/A 3590 3606 CTCCCCGCCTCTCTCTT  0 531 740350 N/A N/A 3594 3610 ACTCCTCCCCGCCTCTC  2 532 740351 N/A N/A 3598 3614 TCCGACTCCTCCCCGCC 40 533 740352 N/A N/A 3601 3617 AACTCCGACTCCTCCCC 55 534 740353 N/A N/A 3604 3620 CACAACTCCGACTCCTC 56 535 740354 N/A N/A 3607 3623 CTCCACAACTCCGACTC 31 536 740355 N/A N/A 3610 3626 CTTCTCCACAACTCCGA 41 537 740356 N/A N/A 3613 3629 CTGCTTCTCCACAACTC 27 538 740357 N/A N/A 3616 3632 CCTCTGCTTCTCCACAA 30 539 740358 N/A N/A 3620 3636 AGTCCCTCTGCTTCTCC  0 540 740359 N/A N/A 3623 3639 CTGAGTCCCTCTGCTTC 26 541 740369  10  26 3192 3208 CTAGTCCTCCTCCTTCT 14 542 740370  23  39 3205 3221 CGTCCTCCTCCTCCTAG 27 543 740371  28  44 3210 3226 GTCGCCGTCCTCCTCCT  0 544 740372  45  61 3227 3243 TTGGGCCCCTTCTGGTC  0 545 740373  48  64 3230 3246 CTCTTGGGCCCCTTCTG 42 546 740374  51  67 3233 3249 CCTCTCTTGGGCCCCTT 43 547 740375  54  70 3236 3252 CCCCCTCTCTTGGGCCC 31 548 740376  57  73 3239 3255 TCGCCCCCTCTCTTGGG  0 549 740377  60  76 3242 3258 CGCTCGCCCCCTCTCTT 23 550 740378  63  79 3245 3261 GGTCGCTCGCCCCCTCT 35 551 740379  67  83 3249 3265 GCTCGGTCGCTCGCCCC 53 552 740380  92  108 3274 3290 ACGCACCTCACTTCCGC 58 553 740381  95 111 3277 3293 CGCACGCACCTCACTTC 43 554 740382  98 114 3280 3296 GCCCGCACGCACCTCAC 42 555 740383 101 117 3283 3299 GCAGCCCGCACGCACCT 44 556 740384 104 120 3286 3302 GCTGCAGCCCGCACGCA 19 557 740385 107 123 3289 3305 TGCGCTGCAGCCCGCAC  4 558 740386 110 126 3292 3308 GTCTGCGCTGCAGCCCG 59 559 740387 169 185 3351 3367 AGGCTTGAAGGCAAGGC 69 560 740388 172 188 3354 3370 AGAAGGCTTGAAGGCAA 66 561 740389 175 191 3357 3373 GGCAGAAGGCTTGAAGG 44 562 740390 178 194 3360 3376 AAAGGCAGAAGGCTTGA 44 563 740391 181 197 3363 3379 TGGAAAGGCAGAAGGCT 59 564 740392 184 200 3366 3382 GGGTGGAAAGGCAGAAG 32 565

(365) TABLE-US-00009 TABLE 9 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC  9  21 740410 240 256 4691 4707 GAATTCCTTTACACCAC 86  33 740393 187 203 3369 3385 CGAGGGTGGAAAGGCAG 56 566 740394 191 207 3373 3389 CTCACGAGGGTGGAAAG 30 567 740395 194 210 3376 3392 CCGCTCACGAGGGTGGA 57 568 740396 197 213 3379 3395 TCTCCGCTCACGAGGGT 40 569 740397 200 216 3382 3398 AGTTCTCCGCTCACGAG 52 570 740398 203 219 3385 3401 CCCAGTTCTCCGCTCAC 43 571 740399 206 222 3388 3404 ACTCCCAGTTCTCCGCT 33 572 740400 209 225 3391 3407 GCCACTCCCAGTTCTCC 44 573 740401 213 229 3395 3411 AATGGCCACTCCCAGTT 38 574 740402 216 232 3398 3414 TCGAATGGCCACTCCCA 45 575 740403 233 249 N/A N/A TTTACACCACACTGTCG 50 108 740404 234 250 N/A N/A CTTTACACCACACTGTC 62 577 740405 235 251 N/A N/A CCTTTACACCACACTGT 77 576 740406 236 252 4687 4703 TCCTTTACACCACACTG 85 260 740407 237 253 4688 4704 TTCCTTTACACCACACT 88 335 740408* 238 254 4689 4705 ATTCCTTTACACCACAC 83 412 740409* 239 255 4690 4706 AATTCCTTTACACCACA 89 577 740411 241 257 4692 4708 TGAATTCCTTTACACCA 83 578 740412 242 258 4693 4709 ATGAATTCCTTTACACC 87 584 740413 243 259 4694 4710 AATGAATTCCTTTACAC 78 579 740414 245 261 4696 4712 CTAATGAATTCCTTTAC 82 580 740415 246 262 4697 4713 GCTAATGAATTCCTTTA 80 581 740416 249 265 4700 4716 ATGGCTAATGAATTCCT 89 582 740417 253 269 4704 4720 ATCCATGGCTAATGAAT 64 583 740418 254 270 4705 4721 CATCCATGGCTAATGAA 69 336 740419 255 271 4706 4722 ACATCCATGGCTAATGA 76 413 740420 256 272 4707 4723 TACATCCATGGCTAATG 73  34 740421 257 273 4708 4724 ATACATCCATGGCTAAT 74 593 740422 258 274 4709 4725 AATACATCCATGGCTAA 85 186 740423 259 275 4710 4726 GAATACATCCATGGCTA 76 584 740424 260 276 4711 4727 TGAATACATCCATGGCT 77 262 740425 261 277 4712 4728 ATGAATACATCCATGGC 83 585 740426 263 279 4714 4730 TCATGAATACATCCATG 55 586 740427 265 281 4716 4732 TTTCATGAATACATCCA 88 587 740428 266 282 4717 4733 CTTTCATGAATACATCC 76 414 740429 267 283 4718 4734 CCTTTCATGAATACATC 86 588 740430 268 284 4719 4735 TCCTTTCATGAATACAT 91 589 740431 269 285 4720 4736 GTCCTTTCATGAATACA 82 590 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 92 591 740433 271 287 4722 4738 AAGTCCTTTCATGAATA 68 592 740434 273 289 4724 4740 GAAAGTCCTTTCATGAA 67 593 740435 275 291 4726 4742 TTGAAAGTCCTTTCATG 25 594 740436 276 292 4727 4743 TTTGAAAGTCCTTTCAT  8 595 740437 277 293 4728 4744 CTTTGAAAGTCCTTTCA 66 596 740438 278 294 4729 4745 CCTTTGAAAGTCCTTTC 86  35 740439 279 295 4730 4746 GCCTTTGAAAGTCCTTT 88 597 740440 280 296 4731 4747 GGCCTTTGAAAGTCCTT 88 111 740441 281 297 4732 4748 TGGCCTTTGAAAGTCCT 58 598 740442 282 298 4733 4749 TTGGCCTTTGAAAGTCC 68 187 740443 283 299 4734 4750 CTTGGCCTTTGAAAGTC 75 263 740444 285 301 4736 4752 TCCTTGGCCTTTGAAAG 47 599 740445 286 302 4737 4753 CTCCTTGGCCTTTGAAA 57 415 740446 301 317 4752 4768 AGCAGCCACAACTCCCT 62 112 740447 302 318 4753 4769 CAGCAGCCACAACTCCC 65 600 740448 304 320 4755 4771 AGCAGCAGCCACAACTC 63 601 740449 305 321 4756 4772 CAGCAGCAGCCACAACT 52 602 740450 308 324 4759 4775 TCTCAGCAGCAGCCACA 63 603 740451 309 325 4760 4776 TTCTCAGCAGCAGCCAC 69 604 740452 311 327 4762 4778 TTTTCTCAGCAGCAGCC 75 605 740453 312 328 4763 4779 GTTTTCTCAGCAGCAGC 66 188 740454 313 329 4764 4780 GGTTTTCTCAGCAGCAG 79 606 740455 314 330 4765 4781 TGGTTTTCTCAGCAGCA 78 607 740456 317 333 4768 4784 GTTTGGTTTTCTCAGCA 82 608 740457 326 342 4777 4793 CCACACCCTGTTTGGTT 71 609 740458 329 345 4780 4796 CTGCCACACCCTGTTTG 54 610 740459 332 348 4783 4799 CTTCTGCCACACCCTGT 74 611 740460 333 349 4784 4800 GCTTCTGCCACACCCTG 73 612 740461 335 351 4786 4802 CTGCTTCTGCCACACCC 80 613 740462 336 352 4787 4803 GCTGCTTCTGCCACACC 77 339 740463 338 354 4789 4805 CTGCTGCTTCTGCCACA 64 614 740464 339 355 4790 4806 CCTGCTGCTTCTGCCAC 52 615 740465 342 358 4793 4809 TTTCCTGCTGCTTCTGC 63 616 740466 345 361 4796 4812 GTCTTTCCTGCTGCTTC 69 617 740467 348 364 4799 4815 TTTGTCTTTCCTGCTGC 56 618 740468 362 378 4813 4829 AGAGAACACCCTCTTTT 47 619 740469 365 381 4816 4832 CATAGAGAACACCCTCT 71 620 740470 368 384 4819 4835 CTACATAGAGAACACCC 81 621

(366) TABLE-US-00010 TABLE 10 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301  4733  4752 TCCTTGGCCTTTGAAAGTCC 32  21 740410 240 256  4691  4707 GAATTCCTTTACACCAC 90  33 740471 369 385  4820  4836 CCTACATAGAGAACACC 76 622 740472 371 387 N/A N/A AGCCTACATAGAGAACA 51 623 740473 372 388 N/A N/A GAGCCTACATAGAGAAC 74  37 740474 373 389 N/A N/A GGAGCCTACATAGAGAA 65 624 740475 374 390 N/A N/A TGGAGCCTACATAGAGA 46 625 740476 375 391 N/A N/A TTGGAGCCTACATAGAG 61 626 740477 378 394 N/A N/A GTTTTGGAGCCTACATA 56 627 740478 379 395 N/A N/A GGTTTTGGAGCCTACAT 72 189 740479 380 396 12193 12209 TGGTTTTGGAGCCTACA 78 628 740480 381 397 12194 12210 TTGGTTTTGGAGCCTAC 64 265 740481 382 398 12195 12211 CTTGGTTTTGGAGCCTA 43 340 740482 383 399 12196 12212 CCTTGGTTTTGGAGCCT 81 417 740483 384 400 12197 12213 TCCTTGGTTTTGGAGCC 79 629 740484 385 401 12198 12214 CTCCTTGGTTTTGGAGC 21  38 740485 386 402 12199 12215 CCTCCTTGGTTTTGGAG 19 630 740486 388 404 12201 12217 TCCCTCCTTGGTTTTGG 63 631 740487 391 407 12204 12220 CACTCCCTCCTTGGTTT 71 632 740488 396 412 12209 12225 TGCACCACTCCCTCCTT 62 633 740489 399 415 12212 12228 CCATGCACCACTCCCTC 51 634 740490 400 416 12213 12229 ACCATGCACCACTCCCT 61 266 740491 401 417 12214 12230 CACCATGCACCACTCCC 80 635 740492 402 418 12215 12231 ACACCATGCACCACTCC 69 341 740493 403 419 12216 12232 CACACCATGCACCACTC 69 636 740494 404 420 12217 12233 CCACACCATGCACCACT 78 418 740495 406 422 12219 12235 TGCCACACCATGCACCA 75 646 740496 407 423 12220 12236 TTGCCACACCATGCACC 68 637 740497 408 424 12221 12237 GTTGCCACACCATGCAC 50 191 740498 409 425 12222 12238 TGTTGCCACACCATGCA 81 638 740499 410 426 12223 12239 CTGTTGCCACACCATGC 79 267 740500 411 427 N/A N/A ACTGTTGCCACACCATG 88 639 740501 418 434 N/A N/A CTCAGCCACTGTTGCCA 68 342 740502 419 435 N/A N/A TCTCAGCCACTGTTGCC 66 640 740503 421 437 N/A N/A CTTCTCAGCCACTGTTG 57 641 740504 422 438 N/A N/A TCTTCTCAGCCACTGTT 59 642 740505 427 443 17994 18010 TTTGGTCTTCTCAGCCA 41 643 740506 432 448 17999 18015 TGCTCTTTGGTCTTCTC 27 644 740507 435 451 18002 18018 ACTTGCTCTTTGGTCTT 66 645 740508 437 453 18004 18020 TCACTTGCTCTTTGGTC 83 646 740509 438 454 18005 18021 GTCACTTGCTCTTTGGT 89 647 740510 439 455 18006 18022 TGTCACTTGCTCTTTGG 87 648 740511 440 456 18007 18023 TTGTCACTTGCTCTTTG 79  40 740512 441 457 18008 18024 TTTGTCACTTGCTCTTT 72 649 740513 442 458 18009 18025 ATTTGTCACTTGCTCTT 82 116 740514 443 459 18010 18026 CATTTGTCACTTGCTCT 76 650 740515 444 460 18011 18027 ACATTTGTCACTTGCTC 80 192 740516 445 461 18012 18028 AACATTTGTCACTTGCT 80 268 740517 446 462 18013 18029 CAACATTTGTCACTTGC 86 343 740518 447 463 18014 18030 CCAACATTTGTCACTTG 48 651 740519 448 464 18015 18031 TCCAACATTTGTCACTT 40 420 740520 449 465 18016 18032 CTCCAACATTTGTCACT 56 652 740521 451 467 18018 18034 TCCTCCAACATTTGTCA 17 653 740522 454 470 18021 18037 TGCTCCTCCAACATTTG 49 654 740523 457 473 18024 18040 CACTGCTCCTCCAACAT 60 655 740524 460 476 18027 18043 CACCACTGCTCCTCCAA 81 656 740525 463 479 18030 18046 CGTCACCACTGCTCCTC 55 657 740526 464 480 18031 18047 CCGTCACCACTGCTCCT 69 193 740527 466 482 18033 18049 ACCCGTCACCACTGCTC 87 658 740528 467 483 18034 18050 CACCCGTCACCACTGCT 82 344 740529 468 484 18035 18051 ACACCCGTCACCACTGC 76 659 740530 470 486 18037 18053 TCACACCCGTCACCACT 77 681 740531 471 487 18038 18054 GTCACACCCGTCACCAC 79 118 740532 472 488 18039 18055 TGTCACACCCGTCACCA 72 660 740533 473 489 18040 18056 CTGTCACACCCGTCACC 88 194 740534 474 490 18041 18057 GCTGTCACACCCGTCAC 84 661 740535 476 492 18043 18059 CTGCTGTCACACCCGTC 85 662 740536 479 495 18046 18062 CTACTGCTGTCACACCC 75 663 740537 482 498 18049 18065 GGGCTACTGCTGTCACA 59 664 740538 485 501 18052 18068 TCTGGGCTACTGCTGTC 54 665 740539 488 504 18055 18071 TCTTCTGGGCTACTGCT 48 666 740540 491 507 18058 18074 CTGTCTTCTGGGCTACT 61 667 740541 494 510 18061 18077 CCACTGTCTTCTGGGCT 61 668 740542 498 514 18065 18081 CCCTCCACTGTCTTCTG 26 669 740543 502 518 18069 18085 TGCTCCCTCCACTGTCT 62 670 740544 510 526 18077 18093 ATGCTCCCTGCTCCCTC 70 671 740545 513 529 18080 18096 GCAATGCTCCCTGCTCC 88 672 740546 523 539 18090 18106 AGTGGCTGCTGCAATGC 61 119 740547 526 542 18093 18109 GCCAGTGGCTGCTGCAA 58 673

(367) TABLE-US-00011 TABLE 11 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 387978 282 301   4733   4752 TCCTTGGCCTTTGAAAGTCC 11  21 740410 240 256   4691   4707 GAATTCCTTTACACCAC 89  33 740548 529 545  18096  18112 AAAGCCAGTGGCTGCTG 76 674 740549 532 548  18099  18115 GACAAAGCCAGTGGCTG 72 675 740550 535 551  18102  18118 TTTGACAAAGCCAGTGG 63 676 740551 538 554  18105  18121 CTTTTTGACAAAGCCAG 71 677 740552 541 557  18108  18124 GTCCTTTTTGACAAAGC 31 678 740553 544 560  18111  18127 CTGGTCCTTTTTGACAA 50 679 740554 547 563  18114  18130 CAACTGGTCCTTTTTGA 67 680 740555 550 566  18117  18133 GCCCAACTGGTCCTTTT 73 681 740556 553 569  18120  18136 CTTGCCCAACTGGTCCT 55 682 740557 557 573 N/A N/A CATTCTTGCCCAACTGG 15 683 740558 560 576 N/A N/A CTTCATTCTTGCCCAAC 60 684 740559 563 579 N/A N/A CTTCTTCATTCTTGCCC 72 685 740560 566 582 N/A N/A CTCCTTCTTCATTCTTG 48 686 740561 569 585 111104 111120 GGGCTCCTTCTTCATTC 60 687 740562 585 601 111120 111136 AGAATTCCTTCCTGTGG 38 688 740563 588 604 111123 111139 TCCAGAATTCCTTCCTG 63 689 740564 591 607 111126 111142 TCTTCCAGAATTCCTTC 45 690 740565 594 610 111129 111145 ATATCTTCCAGAATTCC 63 691 740566 597 613 111132 111148 GGCATATCTTCCAGAAT 73 692 740567 600 616 111135 111151 ACAGGCATATCTTCCAG 48 693 740568 603 619 111138 111154 TCCACAGGCATATCTTC 46 694 740569 607 623 111142 111158 AGGATCCACAGGCATAT 34 695 740570 610 626 111145 111161 GTCAGGATCCACAGGCA 72 696 740571 613 629 111148 111164 ATTGTCAGGATCCACAG 21 697 740572 616 632 111151 111167 CTCATTGTCAGGATCCA 75 698 740573 619 635 111154 111170 AGCCTCATTGTCAGGAT 79 699 740574 622 638 111157 111173 ATAAGCCTCATTGTCAG 31 700 740575 625 641 111160 111176 TTCATAAGCCTCATTGT  0 701 740576 627 643 111162 111178 ATTTCATAAGCCTCATT 35 702 740577 629 645 111164 111180 GCATTTCATAAGCCTCA 78 703 740578 632 648 111167 111183 AAGGCATTTCATAAGCC 67 704 740579 635 651 111170 111186 CAGAAGGCATTTCATAA 70 705 740580 638 654 111173 111189 CCTCAGAAGGCATTTCA 31 706 740581 641 657 N/A N/A CTTCCTCAGAAGGCATT 62 707 740582 644 660 N/A N/A ACCCTTCCTCAGAAGGC 60 708 740583 647 663 N/A N/A GATACCCTTCCTCAGAA  4 709 740584 651 667 N/A N/A TCTTGATACCCTTCCTC 29 710 740585 654 670 113722 113738 TAGTCTTGATACCCTTC 70 711 740586 672 688 113740 113756 TCTTAGGCTTCAGGTTC 66 712 740587 675 691 113743 113759 ATTTCTTAGGCTTCAGG 47 713 740588 678 694 113746 113762 GATATTTCTTAGGCTTC 61 714 740589 681 697 113749 113765 AAAGATATTTCTTAGGC 43 715 740590 684 700 113752 113768 AGCAAAGATATTTCTTA 49 716 740591 687 703 113755 113771 GGGAGCAAAGATATTTC 80 717 740592 690 706 113758 113774 ACTGGGAGCAAAGATAT 55 718 740593 694 710 113762 113778 AGAAACTGGGAGCAAAG 86 719 740594 697 713 113765 113781 TCAAGAAACTGGGAGCA 49 720 740595 700 716 113768 113784 ATCTCAAGAAACTGGGA 69 721 740596 703 719 113771 113787 CAGATCTCAAGAAACTG 72 722 740597 706 722 113774 113790 CAGCAGATCTCAAGAAA 72 723 740598 709 725 113777 113793 TGTCAGCAGATCTCAAG 47 724 740599 712 728 113780 113796 ATCTGTCAGCAGATCTC 32 725 740600 716 732 113784 113800 GAACATCTGTCAGCAGA  0 726 740601 719 735 113787 113803 ATGGAACATCTGTCAGC  9 727 740602 722 738 113790 113806 AGGATGGAACATCTGTC 19 728 740603 725 741 113793 113809 TACAGGATGGAACATCT  0 729 740604 730 746 113798 113814 ACTTGTACAGGATGGAA 55 730 740605 733 749 113801 113817 AGCACTTGTACAGGATG 61 731 740606 736 752 113804 113820 CTGAGCACTTGTACAGG 66 732 740607 739 755 113807 113823 GAACTGAGCACTTGTAC 49 733 740608 742 758 113810 113826 TTGGAACTGAGCACTTG 41 734 740609 745 761 113813 113829 ACATTGGAACTGAGCAC 36 735 740610 748 764 113816 113832 GGCACATTGGAACTGAG 47 736 740611 752 768 113820 113836 ACTGGGCACATTGGAAC 51 737 740612 755 771 113823 113839 ATGACTGGGCACATTGG 44 738 740613 758 774 113826 113842 GTCATGACTGGGCACAT 38 739 740614 761 777 113829 113845 AATGTCATGACTGGGCA 32 740 740615 764 780 113832 113848 AGAAATGTCATGACTGG 76 741 740616 767 783 113835 113851 TTGAGAAATGTCATGAC 54 742 740617 770 786 113838 113854 ACTTTGAGAAATGTCAT 34 743 740618 773 789 113841 113857 AAAACTTTGAGAAATGT 30 744 740619 776 792 113844 113860 GTAAAAACTTTGAGAAA 69 745 740620 779 795 113847 113863 ACTGTAAAAACTTTGAG 64 746 740621 782 798 113850 113866 TACACTGTAAAAACTTT 39 747 740622 785 801 113853 113869 AGATACACTGTAAAAAC 27 748 740623 786 802 113854 113870 GAGATACACTGTAAAAA 36 749 740624 787 803 113855 113871 CGAGATACACTGTAAAA 56 750

(368) TABLE-US-00012 TABLE 12  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC 11 21 740410 240 256 4691 4707 GAATTCCTTTACACCAC 89 33 740625 791 807 113859 113875 ACTTCGAGATACACTGT 76 751 740626 793 809 113861 113877 AGACTTCGAGATACACT 72 275 740627 795 811 113863 113879 GAAGACTTCGAGATACA 63 752 740628 796 812 113864 113880 GGAAGACTTCGAGATAC 71 427 740629 797 813 113865 113881 TGGAAGACTTCGAGATA 31 753 740630 799 815 113867 113883 GATGGAAGACTTCGAGA 50 754 740631 802 818 113870 113886 GCTGATGGAAGACTTCG 67 755 740632 805 821 113873 113889 ACTGCTGATGGAAGACT 73 756 740633 808 824 113876 113892 ATCACTGCTGATGGAAG 55 757 740634 812 828 113880 113896 TTCAATCACTGCTGATG 15 758 740635 815 831 113883 113899 TACTTCAATCACTGCTG 60 759 740636 818 834 113886 113902 AGATACTTCAATCACTG 72 760 740637 819 835 113887 113903 CAGATACTTCAATCACT 48 761 740638 820 836 113888 113904 ACAGATACTTCAATCAC 60 762 740639 821 837 113889 113905 TACAGATACTTCAATCA 38 763 740640 824 840 113892 113908 AGGTACAGATACTTCAA 63 764 740641 827 843 113895 113911 GGCAGGTACAGATACTT 45 765 740642 845 861 113913 113929 ACCGAAATGCTGAGTGG 63 766 740643 848 864 113916 113932 AGCACCGAAATGCTGAG 73 767 740644 851 867 113919 113935 GGAAGCACCGAAATGCT 48 768 740645 854 870 113922 113938 AAGGGAAGCACCGAAAT 46 769 740646 857 873 113925 113941 TGAAAGGGAAGCACCGA 34 770 740647 860 876 113928 113944 CAGTGAAAGGGAAGCAC 72 771 740648 863 879 113931 113947 CTTCAGTGAAAGGGAAG 21 772 740649 865 881 113933 113949 CACTTCAGTGAAAGGGA 75 773 740650 866 882 113934 113950 TCACTTCAGTGAAAGGG 79 49 740651 867 883 113935 113951 TTCACTTCAGTGAAAGG 31 774 740652 869 885 113937 113953 TATTCACTTCAGTGAAA 0 775 740653 870 886 113938 113954 GTATTCACTTCAGTGAA 35 776 740654 873 889 113941 113957 CATGTATTCACTTCAGT 78 777 740655 876 892 113944 113960 TACCATGTATTCACTTC 67 778 740656 879 895 113947 113963 TGCTACCATGTATTCAC 70 779 740657 882 898 113950 113966 CCCTGCTACCATGTATT 31 780 740658 885 901 113953 113969 AGACCCTGCTACCATGT 62 781 740659 886 902 113954 113970 AAGACCCTGCTACCATG 60 782 740660 890 906 113958 113974 CACAAAGACCCTGCTAC 4 783 740661 892 908 113960 113976 CACACAAAGACCCTGCT 29 50 740662 894 910 113962 113978 AGCACACAAAGACCCTG 70 784 740663 895 911 113963 113979 CAGCACACAAAGACCCT 66 202 740664 896 912 113964 113980 ACAGCACACAAAGACCC 47 785 740665 898 914 113966 113982 CCACAGCACACAAAGAC 61 786 740666 901 917 113969 113985 AATCCACAGCACACAAA 43 787 740667 905 921 113973 113989 ACAAAATCCACAGCACA 49 788 740668 911 927 113979 113995 GAAGCCACAAAATCCAC 80 789 740669 915 931 113983 113999 GATTGAAGCCACAAAAT 55 790 740670 918 934 113986 114002 GTAGATTGAAGCCACAA 86 791 740671 935 951 114003 114019 TAATTTGTTTTAACATC 49 792 740672 943 959 114011 114027 GGTGTTTTTAATTTGTT 69 793 740673 944 960 114012 114028 AGGTGTTTTTAATTTGT 72 128 740674 945 961 114013 114029 TAGGTGTTTTTAATTTG 72 204 740675 946 962 114014 114030 TTAGGTGTTTTTAATTT 47 794 740676 947 963 114015 114031 CTTAGGTGTTTTTAATT 32 280 740677 950 966 114018 114034 TCACTTAGGTGTTTTTA 0 795 740678 953 969 114021 114037 TAGTCACTTAGGTGTTT 9 796 740679 957 973 114025 114041 GTGGTAGTCACTTAGGT 19 797 740680 960 976 114028 114044 TAAGTGGTAGTCACTTA 0 798 740681 963 979 114031 114047 AAATAAGTGGTAGTCAC 55 799 740682 966 982 114034 114050 TAGAAATAAGTGGTAGT 61 800 740683 969 985 114037 114053 ATTTAGAAATAAGTGGT 66 801 740684 972 988 114040 114056 AGGATTTAGAAATAAGT 49 802 740685 975 991 114043 114059 GTGAGGATTTAGAAATA 41 803 740686 976 992 114044 114060 AGTGAGGATTTAGAAAT 36 804 740687 977 993 114045 114061 TAGTGAGGATTTAGAAA 47 805 740688 979 995 114047 114063 AATAGTGAGGATTTAGA 51 806 740689 982 998 114050 114066 AAAAATAGTGAGGATTT 44 807 740690 985 1001 114053 114069 CAAAAAAATAGTGAGGA 38 808 740691 989 1005 114057 114073 GCAACAAAAAAATAGTG 32 809 740692 1002 1018 114070 114086 CTTCTGAACAACAGCAA 76 810 740693 1005 1021 114073 114089 CAACTTCTGAACAACAG 54 811 740694 1008 1024 114076 114092 TAACAACTTCTGAACAA 34 812 740695 1011 1027 114079 114095 CACTAACAACTTCTGAA 30 813 740696 1014 1030 114082 114098 AATCACTAACAACTTCT 69 814 740697 1017 1033 114085 114101 GCAAATCACTAACAACT 64 815 740698 1020 1036 114088 114104 ATAGCAAATCACTAACA 39 816 740699 1024 1040 114092 114108 TATGATAGCAAATCACT 27 817 740700 1027 1043 114095 114111 ATATATGATAGCAAATC 36 818 740701 1030 1046 114098 114114 ATAATATATGATAGCAA 56 819 740470 368 384 4819 4835 CTACATAGAGAACACCC 81 621

(369) TABLE-US-00013 TABLE 13  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 387978 282 301 4733 4752 TCCTTGGCCTTTGAAAGTCC 18 21 740410 240 256 4691 4707 GAATTCCTTTACACCAC 84 33 740702 1033 1049 114101 114117 CTTATAATATATGATAG 16 820 740703 1036 1052 114104 114120 AATCTTATAATATATGA 27 821 740704 1041 1057 114109 114125 CTAAAAATCTTATAATA 0 822 740705 1044 1060 114112 114128 CACCTAAAAATCTTATA 11 823 740706 1047 1063 114115 114131 AGACACCTAAAAATCTT 49 824 740707 1048 1064 114116 114132 AAGACACCTAAAAATCT 25 825 740708 1049 1065 114117 114133 AAAGACACCTAAAAATC 27 826 740709 1052 1068 114120 114136 TTAAAAGACACCTAAAA 6 827 740710 1055 1071 114123 114139 TCATTAAAAGACACCTA 30 828 740711 1058 1074 114126 114142 GTATCATTAAAAGACAC 30 829 740712 1061 1077 114129 114145 ACAGTATCATTAAAAGA 35 830 740713 1064 1080 114132 114148 TAGACAGTATCATTAAA 54 831 740714 1068 1084 114136 114152 TTCTTAGACAGTATCAT 57 832 740715 1071 1087 114139 114155 TTATTCTTAGACAGTAT 64 833 740716 1074 1090 114142 114158 TCATTATTCTTAGACAG 47 834 740717 1092 1108 114160 114176 AACAAATTTCACAATAC 60 835 740718 1095 1111 114163 114179 ATTAACAAATTTCACAA 34 836 740719 1106 1122 114174 114190 GTATTATATATATTAAC 32 837 740720 1121 1137 114189 114205 CTCACATATTTTTAAGT 44 838 740721 1124 1140 114192 114208 ATGCTCACATATTTTTA 45 839 740722 1127 1143 114195 114211 TTCATGCTCACATATTT 40 840 740723 1130 1146 114198 114214 AGTTTCATGCTCACATA 67 841 740724 1134 1150 114202 114218 GCATAGTTTCATGCTCA 51 842 740725 1137 1153 114205 114221 GGTGCATAGTTTCATGC 46 843 740726 1138 1154 114206 114222 AGGTGCATAGTTTCATG 54 844 740727 1140 1156 114208 114224 ATAGGTGCATAGTTTCA 63 845 740728 1143 1159 114211 114227 TTTATAGGTGCATAGTT 62 846 740729 1146 1162 114214 114230 GTATTTATAGGTGCATA 67 847 740730 1149 1165 114217 114233 TTAGTATTTATAGGTGC 72 848 740731 1152 1168 114220 114236 TATTTAGTATTTATAGG 32 849 740732 1164 1180 114232 114248 GGTAAAATTTCATATTT 33 850 740733 1173 1189 114241 114257 TCGCAAAATGGTAAAAT 49 851 740734 1176 1192 114244 114260 ACATCGCAAAATGGTAA 62 852 740735 1179 1195 114247 114263 AACACATCGCAAAATGG 42 853 740736 1182 1198 114250 114266 TAAAACACATCGCAAAA 28 854 740737 1185 1201 114253 114269 GAATAAAACACATCGCA 62 855 740738 1188 1204 114256 114272 AGTGAATAAAACACATC 16 856 740739 1191 1207 114259 114275 ACAAGTGAATAAAACAC 64 857 740740 1196 1212 114264 114280 CAAACACAAGTGAATAA 16 858 740741 1199 1215 114267 114283 ATACAAACACAAGTGAA 33 859 740742 1203 1219 114271 114287 TTATATACAAACACAAG 31 860 740743 1207 1223 114275 114291 CCATTTATATACAAACA 28 861 740744 1210 1226 114278 114294 TCACCATTTATATACAA 53 862 740745 1214 1230 114282 114298 ATTCTCACCATTTATAT 40 863 740746 1222 1238 114290 114306 TTATTTTAATTCTCACC 46 864 740747 1242 1258 114310 114326 TTTTGCAATGAGATAAC 0 865 740748 1245 1261 114313 114329 TATTTTTGCAATGAGAT 42 866 740749 1265 1281 114333 114349 GAGATGGGATAAAAATA 38 867 740750 1268 1284 114336 114352 AGTGAGATGGGATAAAA 32 868 740751 1271 1287 114339 114355 TAAAGTGAGATGGGATA 30 869 740752 1275 1291 114343 114359 TTATTAAAGTGAGATGG 24 870 740753 1278 1294 114346 114362 TTATTATTAAAGTGAGA 9 871 740754 1288 1304 114356 114372 AGCATGATTTTTATTAT 36 872 740755 1291 1307 114359 114375 ATAAGCATGATTTTTAT 2 873 740756 1292 1308 114360 114376 TATAAGCATGATTTTTA 25 874 740757 1296 1312 114364 114380 TGCTTATAAGCATGATT 20 875 740758 1299 1315 114367 114383 TGTTGCTTATAAGCATG 0 876 740759 1302 1318 114370 114386 TCATGTTGCTTATAAGC 27 877 740760 1306 1322 114374 114390 TAATTCATGTTGCTTAT 55 878 740761 1309 1325 114377 114393 TCTTAATTCATGTTGCT 35 879 740762 1312 1328 114380 114396 AGTTCTTAATTCATGTT 41 880 740763 1315 1331 114383 114399 GTCAGTTCTTAATTCAT 54 881 740764 1318 1334 114386 114402 TGTGTCAGTTCTTAATT 61 882 740765 1321 1337 114389 114405 CTTTGTGTCAGTTCTTA 68 883 740766 1324 1340 114392 114408 GTCCTTTGTGTCAGTTC 64 884 740767 1328 1344 114396 114412 TTTTGTCCTTTGTGTCA 30 885 740768 1331 1347 114399 114415 TATTTTTGTCCTTTGTG 36 886 740769 1336 1352 114404 114420 CTTTATATTTTTGTCCT 13 887 740770 1346 1362 114414 114430 CTATTAATAACTTTATA 15 888 740771 1349 1365 114417 114433 TGGCTATTAATAACTTT 43 889 740772 1352 1368 114420 114436 AAATGGCTATTAATAAC 36 890 740773 1355 1371 114423 114439 TTCAAATGGCTATTAAT 35 891 740774 1358 1374 114426 114442 TTCTTCAAATGGCTATT 40 892 740775 1361 1377 114429 114445 TCCTTCTTCAAATGGCT 45 893 740776 1364 1380 114432 114448 TCCTCCTTCTTCAAATG 8 894 740777 1369 1385 114437 114453 AAAATTCCTCCTTCTTC 39 895 740778 1372 1388 114440 114456 TCTAAAATTCCTCCTTC 33 896

Example 3: Effect of 4-9-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

(370) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested as described in Example 1 for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

(371) The modified oligonucleotides in tables 14-23 are 4-9-4 MOE and cEt gapmers. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises nine 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end comprising two 2′-MOE nucleosides and two cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eekkdddddddddkkee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and ‘k’ represents a cEt modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssoss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(372) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(373) TABLE-US-00014 TABLE 14  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ SEQ ID SEQ ID SEQ ID SEQ Compound ID No: No: 1 No: 2 No: 2 % ID No 1 start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 97 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 95 591 740779 1375 1391 114443 114459 TCTTCTAAAATTCCTCC 51 897 740780 1378 1394 114446 114462 ACCTCTTCTAAAATTCC 45 898 740781 1381 1397 114449 114465 TCTACCTCTTCTAAAAT 7 899 740782 1384 1400 114452 114468 TTCTCTACCTCTTCTAA 41 900 740783 1389 1405 114457 114473 CCATTTTCTCTACCTCT 90 901 740784 1392 1408 114460 114476 GTTCCATTTTCTCTACC 78 902 740785 1396 1412 114464 114480 TAATGTTCCATTTTCTC 62 903 740786 1400 1416 114468 114484 GGGTTAATGTTCCATTT 65 904 740787 1403 1419 114471 114487 GTAGGGTTAATGTTCCA 74 905 740788 1406 1422 114474 114490 AGTGTAGGGTTAATGTT 44 906 740789 1409 1425 114477 114493 CCGAGTGTAGGGTTAAT 70 907 740790 1412 1428 114480 114496 ATTCCGAGTGTAGGGTT 76 908 740791 1415 1431 114483 114499 GGAATTCCGAGTGTAGG 22 909 740792 1418 1434 114486 114502 CAGGGAATTCCGAGTGT 75 910 740793 1422 1438 114490 114506 GCTTCAGGGAATTCCGA 68 911 740794 1425 1441 114493 114509 GTTGCTTCAGGGAATTC 84 912 740795 1428 1444 114496 114512 AGTGTTGCTTCAGGGAA 76 913 740796 1431 1447 114499 114515 GGCAGTGTTGCTTCAGG 82 914 740797 1434 1450 114502 114518 TCTGGCAGTGTTGCTTC 55 915 740798 1437 1453 114505 114521 ACTTCTGGCAGTGTTGC 63 916 740799 1440 1456 114508 114524 CACACTTCTGGCAGTGT 19 917 740800 1444 1460 114512 114528 AAAACACACTTCTGGCA 50 918 740801 1447 1463 114515 114531 ACCAAAACACACTTCTG 87 919 740802 1450 1466 114518 114534 CATACCAAAACACACTT 87 920 740803 1453 1469 114521 114537 GTGCATACCAAAACACA 31 921 740804 1456 1472 114524 114540 CCAGTGCATACCAAAAC 77 922 740805 1459 1475 114527 114543 GAACCAGTGCATACCAA 67 923 740806 1462 1478 114530 114546 AAGGAACCAGTGCATAC 69 924 740807 1466 1482 114534 114550 ACTTAAGGAACCAGTGC 49 925 740808 1469 1485 114537 114553 GCCACTTAAGGAACCAG 82 926 740809 1472 1488 114540 114556 ACAGCCACTTAAGGAAC 64 927 740810 1475 1491 114543 114559 ATCACAGCCACTTAAGG 28 928 740811 1478 1494 114546 114562 TTAATCACAGCCACTTA 62 929 740812 1481 1497 114549 114565 TAATTAATCACAGCCAC 67 930 740813 1484 1500 114552 114568 CAATAATTAATCACAGC 74 931 740814 1488 1504 114556 114572 CTTTCAATAATTAATCA 22 932 740815 1492 1508 114560 114576 CCCACTTTCAATAATTA 20 933 740816 1521 1537 114589 114605 TCTACAATAGTAGTTGG 23 934 740817 1524 1540 114592 114608 CACTCTACAATAGTAGT 37 935 740818 1527 1543 114595 114611 GACCACTCTACAATAGT 62 936 740819 1530 1546 114598 114614 ATAGACCACTCTACAAT 55 937 740820 1533 1549 114601 114617 GAAATAGACCACTCTAC 50 938 740821 1536 1552 114604 114620 GGAGAAATAGACCACTC 64 939 740822 1545 1561 114613 114629 GGATTGAAGGGAGAAAT 49 940 740823 1548 1564 114616 114632 ACAGGATTGAAGGGAGA 71 941 740824 1551 1567 114619 114635 TTGACAGGATTGAAGGG 57 942 740825 1554 1570 114622 114638 ACATTGACAGGATTGAA 58 943 740826 1557 1573 114625 114641 CAAACATTGACAGGATT 62 944 740827 1580 1596 114648 114664 ACAGTTCCCCAAAATAC 50 945 740828 1583 1599 114651 114667 ACAACAGTTCCCCAAAA 6 946 740829 1586 1602 114654 114670 CAAACAACAGTTCCCCA 43 947 740830 1589 1605 114657 114673 CATCAAACAACAGTTCC 48 948 740831 1592 1608 114660 114676 ACACATCAAACAACAGT 68 949 740832 1595 1611 114663 114679 CATACACATCAAACAAC 24 950 740833 1627 1643 114695 114711 GCTCAATTAAAAATGTA 31 951 740834 1630 1646 114698 114714 AAGGCTCAATTAAAAAT 26 952 740835 1637 1653 114705 114721 TTAATAAAAGGCTCAAT 28 953 740836 1640 1656 114708 114724 ATGTTAATAAAAGGCTC 57 954 740837 1647 1663 114715 114731 ACAATATATGTTAATAA 3 955 740838 1661 1677 114729 114745 TCGAGACAAAAATAACA 29 956 740839 1664 1680 114732 114748 ATTTCGAGACAAAAATA 33 957 740840 1667 1683 114735 114751 ATTATTTCGAGACAAAA 34 958 740841 1670 1686 114738 114754 AAAATTATTTCGAGACA 47 959 740842 1673 1689 114741 114757 TAAAAAATTATTTCGAG 11 960 740843 1685 1701 114753 114769 ATAGATTTTAACTAAAA 0 961 740844 1706 1722 114774 114790 TTCACACCAATATCAGA 64 962 740845 1709 1725 114777 114793 GCATTCACACCAATATC 55 963 740846 1712 1728 114780 114796 ACAGCATTCACACCAAT 73 964 740847 1715 1731 114783 114799 GGTACAGCATTCACACC 46 965 740848 1718 1734 114786 114802 AAAGGTACAGCATTCAC 65 966 740849 1721 1737 114789 114805 CAGAAAGGTACAGCATT 56 967 740850 1724 1740 114792 114808 TGTCAGAAAGGTACAGC 49 968 740851 1728 1744 114796 114812 TTATTGTCAGAAAGGTA 79 969 740852 1731 1747 114799 114815 TATTTATTGTCAGAAAG 52 970 740853 1734 1750 114802 114818 TATTATTTATTGTCAGA 79 971 740854 1737 1753 114805 114821 GAATATTATTTATTGTC 54 972 740855 1741 1757 114809 114825 GGTCGAATATTATTTAT 51 973

(374) TABLE-US-00015 TABLE 15  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 91 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 79 591 740856 1745 1761 114813 114829 TCATGGTCGAATATTAT 31 974 740857 1748 1764 114816 114832 TATTCATGGTCGAATAT 24 975 740858 1751 1767 114819 114835 TTTTATTCATGGTCGAA 62 976 740859 1754 1770 114822 114838 TTTTTTTATTCATGGTC 77 977 740860 1771 1787 114839 114855 GGAACCCACTTTTTTTT 14 978 740861 1774 1790 114842 114858 CCGGGAACCCACTTTTT 25 979 740862 1777 1793 114845 114861 TTCCCGGGAACCCACTT 20 980 740863 1780 1796 114848 114864 TAGTTCCCGGGAACCCA 25 981 740864 1784 1800 114852 114868 TGCTTAGTTCCCGGGAA 25 982 740865 1787 1803 114855 114871 CACTGCTTAGTTCCCGG 51 983 740866 1790 1806 114858 114874 CTACACTGCTTAGTTCC 76 984 740867 1793 1809 114861 114877 CTTCTACACTGCTTAGT 37 985 740868 1796 1812 114864 114880 CATCTTCTACACTGCTT 54 986 740869 1799 1815 114867 114883 AATCATCTTCTACACTG 38 987 740870 1802 1818 114870 114886 CAAAATCATCTTCTACA 17 988 740871 1806 1822 114874 114890 TAGTCAAAATCATCTTC 40 989 740872 1809 1825 114877 114893 GTGTAGTCAAAATCATC 58 990 740873 1812 1828 114880 114896 AGGGTGTAGTCAAAATC 61 991 740874 1815 1831 114883 114899 AGGAGGGTGTAGTCAAA 43 992 740875 1818 1834 114886 114902 CTAAGGAGGGTGTAGTC 41 993 740876 1821 1837 114889 114905 TCTCTAAGGAGGGTGTA 43 994 740877 1824 1840 114892 114908 GGCTCTCTAAGGAGGGT 38 995 740878 1828 1844 114896 114912 TTATGGCTCTCTAAGGA 37 996 740879 1831 1847 114899 114915 GTCTTATGGCTCTCTAA 66 997 740880 1834 1850 114902 114918 TGTGTCTTATGGCTCTC 72 998 740881 1837 1853 114905 114921 TAATGTGTCTTATGGCT 67 999 740882 1840 1856 114908 114924 TGCTAATGTGTCTTATG 59 1000 740883 1843 1859 114911 114927 ATGTGCTAATGTGTCTT 66 1001 740884 1846 1862 114914 114930 AATATGTGCTAATGTGT 74 1002 740885 1850 1866 114918 114934 TGCTAATATGTGCTAAT 33 1003 740886 1853 1869 114921 114937 ATGTGCTAATATGTGCT 34 1004 740887 1856 1872 114924 114940 TGAATGTGCTAATATGT 52 1005 740888 1859 1875 114927 114943 CCTTGAATGTGCTAATA 59 1006 740889 1862 1878 114930 114946 GAGCCTTGAATGTGCTA 28 1007 740890 1865 1881 114933 114949 TCAGAGCCTTGAATGTG 52 1008 740891 1868 1884 114936 114952 CTCTCAGAGCCTTGAAT 48 1009 740892 1870 1886 114938 114954 TTCTCTCAGAGCCTTGA 74 1010 740893 1871 1887 114939 114955 ATTCTCTCAGAGCCTTG 83 444 740894 1872 1888 114940 114956 CATTCTCTCAGAGCCTT 80 1011 740895 1874 1890 114942 114958 CACATTCTCTCAGAGCC 57 1012 740896 1875 1891 114943 114959 CCACATTCTCTCAGAGC 57 1013 740897 1995 2011 115063 115079 TAAAGGCATTTCCTGTA 50 1014 740898 2081 2097 115149 115165 GGCAACATTTAAAGGAG 46 1015 740899 2251 2267 115319 115335 GAAATGACTATGCCCCA 61 1016 740900 2312 2328 115380 115396 AAACTGCTAGCATGTCT 62 1017 740901 2437 2453 115505 115521 TGTAGTAGTCTCTCTTC 77 1018 740902 2841 2857 115909 115925 TGTTTAAGTGTTTGGTC 79 1019 740903 2939 2955 116007 116023 GGACTGGATTGATCCTC 48 1020 740904 3158 3174 116226 116242 ACATACTGGATAAGCCA 83 1021 740905 N/A N/A 2087 2103 CCTGGATCACACCAGAA 28 1022 740906 N/A N/A 2090 2106 GTTCCTGGATCACACCA 45 1023 740907 N/A N/A 2093 2109 GCTGTTCCTGGATCACA 41 1024 740908 N/A N/A 2096 2112 ACAGCTGTTCCTGGATC 2 1025 740909 N/A N/A 2099 2115 AAGACAGCTGTTCCTGG 19 1026 740910 N/A N/A 2102 2118 TGGAAGACAGCTGTTCC 7 1027 740911 N/A N/A 2105 2121 AGCTGGAAGACAGCTGT 13 1028 740912 N/A N/A 2108 2124 CAGAGCTGGAAGACAGC 26 1029 740913 N/A N/A 2113 2129 TCTTTCAGAGCTGGAAG 16 1030

(375) TABLE-US-00016 TABLE 16  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 97 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 92 591 740933 N/A N/A 3624 3640 CCTGAGTCCCTCTGCTT 27 1031 740934 N/A N/A 3849 3865 TAATCTCTCAGCCCTTG 55 1032 740935 N/A N/A 4074 4090 CCACCCTAGCGGACCCC 35 1033 740936 N/A N/A 4299 4315 CCAGAAGAAGGCTAACA 35 1034 740937 N/A N/A 4524 4540 GGCATTAAAAATTTAGC 68 1035 740938 N/A N/A 4684 4700 TTTACACCACACTGGAA 65 1036 740939 N/A N/A 4685 4701 CTTTACACCACACTGGA 82 1037 740940 N/A N/A 4686 4702 CCTTTACACCACACTGG 68 1038 740941 N/A N/A 4821 4837 ACCTACATAGAGAACAC 83 1039 740942 N/A N/A 5046 5062 GGCAAAATTAAAAATCT 38 1040 740943 N/A N/A 5275 5291 TTATACACATCACAGGG 59 1041 740944 N/A N/A 5500 5516 AAGGTGGAACTTTAGGA 73 1042 740945 N/A N/A 5725 5741 GACTCTTACTGCTATAG 47 1043 740946 N/A N/A 5984 6000 TGATAGCATCACTGCAG 13 1044 740947 N/A N/A 6209 6225 AACTCATCAATTTTTTC 67 1045 740948 N/A N/A 6439 6455 GTAACCAATAAAAAATT 24 1046 740949 N/A N/A 6715 6731 GTTGTTTGTAGACACAG 54 1047 740950 N/A N/A 6940 6956 TGTTTATGACTACCTTC 62 1048 740951 N/A N/A 7165 7181 ATTTTTTACTAATCAGG 38 1049 740952 N/A N/A 7615 7631 GTCATTTGAAGAAATTT 60 1050 740953 N/A N/A 7840 7856 GTGCATGTTATGTTGAC 36 1051 740954 N/A N/A 8065 8081 TTATGAGTAATCTGTAA 30 1052 740955 N/A N/A 8290 8306 GCCACTAAACCACACCA 65 1053 740956 N/A N/A 8544 8560 GGGATGATGAGATCAGG 40 1054 740957 N/A N/A 8769 8785 TTTTAGCTGCCCTTGCC 25 1055 740958 N/A N/A 8995 9011 TTATCTCACATATATGT 30 1056 740959 N/A N/A 9240 9256 ACACCACTCCATTGCAG 46 1057 740960 N/A N/A 9465 9481 GGAGTGGACATGTTTTT 43 1058 740961 N/A N/A 9691 9707 CAACACAGTGGCTCTTG 24 1059 740962 N/A N/A 9920 9936 GAATGATAAATGTTTCA 32 1060 740963 N/A N/A 10146 10162 AGATAGAAGTAGAGAGT 14 1061 740964 N/A N/A 10371 10387 TTGTTTGTGCTGGAACT 16 1062 740965 N/A N/A 10596 10612 CATAACAGATGTGAAGC 45 1063 740966 N/A N/A 10821 10837 TGCAGCAGTGACAACAT 73 1064 740967 N/A N/A 11046 11062 TTTACAGAATTATCATA 37 1065 740968 N/A N/A 11271 11287 CATTACACATGTAATAA 6 1066 740969 N/A N/A 11729 11745 CATTATGTAAAAAAAAC 0 1067 740970 N/A N/A 11954 11970 TACGATTTTAGCACAAA 68 1068 740971 N/A N/A 12182 12198 CCTACAAAAACAAATTC 0 1069 740972 N/A N/A 12192 12208 GGTTTTGGAGCCTACAA 83 1070 740973 N/A N/A 12421 12437 GCAAGTATATTTTTTAT 62 1071 740974 N/A N/A 12646 12662 CCTGAAATGCACTCTGA 54 1072 740975 N/A N/A 12871 12887 CTCATCTTCCTCAACAT 56 1073 740976 N/A N/A 13098 13114 TCCATTTTAGAAGTCAG 87 1074 740977 N/A N/A 13331 13347 TAACACTTATAAAATAC 44 1075 740978 N/A N/A 13556 13572 GAGGTCCCTAGAAGGCA 38 1076 740979 N/A N/A 13781 13797 TCTCCATTAGATCATCA 43 1077 740980 N/A N/A 14011 14027 GAGAAAATAAAGTATAC 41 1078 740981 N/A N/A 14236 14252 TGGTCCATGGGTGCAAT 52 1079 740982 N/A N/A 14461 14477 ATATGCAAATTATTCTC 40 1080 740983 N/A N/A 14686 14702 TTCCCAGCCCAAGTTTA 1 1081 740984 N/A N/A 14911 14927 AATAGGTAACTTTATAT 19 1082 740985 N/A N/A 15136 15152 TAATATATGGTTTTGAA 28 1083 740986 N/A N/A 15365 15381 GGATTCTGCTTTATTTT 51 1084 740987 N/A N/A 15590 15606 CGACACATTTAAAAACA 36 1085 740988 N/A N/A 15815 15831 AAAGCGAGATTAAAAAT 0 1086 740989 N/A N/A 16040 16056 GGATATGGCTGATGTCT 13 1087 740990 N/A N/A 16265 16281 CCAATATTTAAATGGTG 34 1088 740991 N/A N/A 16591 16607 GCCAATATTTACTTATT 61 1089 740992 N/A N/A 16818 16834 TCATGTGGAATCTAAAG 6 1090 740993 N/A N/A 17043 17059 AGTATGAAAATGAAGAG 38 1091 740994 N/A N/A 17501 17517 ATTCTTGTTGTTCAGGC 73 1092 740995 N/A N/A 17726 17742 GGAATGTAAAGCCATGA 78 1093 740996 N/A N/A 17951 17967 ATTAAAGGGTGGTAGAA 26 1094 740997 N/A N/A 18176 18192 AATGAACCGTAATCTCA 87 1095 740998 N/A N/A 18296 18312 CTGGGTTAATGCCTGAA 60 1096 740999 N/A N/A 18297 18313 TCTGGGTTAATGCCTGA 67 163 741000 N/A N/A 18298 18314 ATCTGGGTTAATGCCTG 86 1097 741001 N/A N/A 18401 18417 GAAATGTCACTGTTCCT 97 1098 741002 N/A N/A 18626 18642 GGTTGGTATGTATTTTA 92 1099 741003 N/A N/A 18851 18867 CAAGGAGGTCATTGTGG 75 1100 741004 N/A N/A 19183 19199 CTTTGGCAAAGAAAGGA 45 1101 741005 N/A N/A 19408 19424 AAATGAAAGTTGTTGTG 85 1102 741006 N/A N/A 19633 19649 GATATTTTTGTTCTGCC 95 1103 741007 N/A N/A 19868 19884 GCTATAAATAGAATTAA 42 1104 741008 N/A N/A 20099 20115 TAGATTTCTGTTTCCTC 94 1105 741009 N/A N/A 20324 20340 AATGCAGGTGAATAAAA 81 1106

(376) TABLE-US-00017 TABLE 17  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 92 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 87 591 741010 N/A N/A 20549 20565 CAATTTCTAGGTTCTAT 86 1107 741011 N/A N/A 20559 20575 AACTATGCTGCAATTTC 74 1108 741012 N/A N/A 20561 20577 ACAACTATGCTGCAATT 86 1109 741013 N/A N/A 20562 20578 CACAACTATGCTGCAAT 88 314 741014 N/A N/A 20565 20581 TTCCACAACTATGCTGC 90 1110 741015 N/A N/A 20774 20790 GACCACAATTGCAGACA 86 1111 741016 N/A N/A 20985 21001 GTGTGAGCAAACATTCT 94 1112 741017 N/A N/A 27412 27428 CAGTGTGAGCAAACATT 90 1113 N/A N/A 20987 21003 741018 N/A N/A 27413 27429 ACAGTGTGAGCAAACAT 85 468 N/A N/A 20988 21004 741019 N/A N/A 27414 27430 CACAGTGTGAGCAAACA 91 1114 N/A N/A 20989 21005 741020 N/A N/A 20991 21007 GGCACAGTGTGAGCAAA 89 1115 741021 N/A N/A 20999 21015 AAGTTTCTGGCACAGTG 89 1116 741022 N/A N/A 21224 21240 GTTCAGAATTATGTCAT 95 1117 741023 N/A N/A 21449 21465 TCTTATGTGCACATGAG 63 1118 741024 N/A N/A 21674 21690 CATAGTAGCATTACAGA 83 1119 741025 N/A N/A 21899 21915 TCAGGCAGTGGCTTCAC 66 1120 741026 N/A N/A 22129 22145 TAAAAAAAGTTGTTCAT 32 1121 741027 N/A N/A 22360 22376 CACTCAAGTGTTTAAAA 87 1122 741028 N/A N/A 22454 22470 TGTGACCTGTGCTTGTT 91 1123 741029 N/A N/A 22456 22472 CCTGTGACCTGTGCTTG 87 1124 741030 N/A N/A 22457 22473 GCCTGTGACCTGTGCTT 86 88 741031 N/A N/A 22458 22474 TGCCTGTGACCTGTGCT 87 1125 741032 N/A N/A 22460 22476 GTTGCCTGTGACCTGTG 82 1126 741033 N/A N/A 22599 22615 TATTAGACACTTAAGGG 82 1127 741034 N/A N/A 22831 22847 TCAATCTTAAATTTTTC 85 1128 741035 N/A N/A 23056 23072 GTACTTTCCCACCTAGA 88 1129 741036 N/A N/A 23281 23297 TCTCAGAGACCACAGCT 88 1130 741037 N/A N/A 23285 23301 TTGTTCTCAGAGACCAC 92 1131 741038 N/A N/A 23286 23302 ATTGTTCTCAGAGACCA 86 164 741039 N/A N/A 23287 23303 TATTGTTCTCAGAGACC 94 1132 741040 N/A N/A 23289 23305 CATATTGTTCTCAGAGA 89 1133 741041 N/A N/A 23506 23522 ACTATTAACCACTGATC 84 1134 741042 N/A N/A 23731 23747 GTTGCAGTCCACAGAAT 79 1135 741043 N/A N/A 23956 23972 TAAAGATAAGTATCTCA 91 1136 741044 N/A N/A 24181 24197 AAAACAAACCTAAGTCA 43 1137 741045 N/A N/A 24406 24422 AAAAGCTAACAGCCTAT 73 1138 741046 N/A N/A 24631 24647 TTAAATTGATGAGATGT 88 1139 741047 N/A N/A 24856 24872 GTATTCTTTGCATTAGT 89 1140 741048 N/A N/A 25081 25097 TAAAAGTGTACATTATT 77 1141 741049 N/A N/A 25306 25322 CTCAAGGCAAAGCTGTA 88 1142 741050 N/A N/A 25531 25547 TGCCACTATAAGCAGTC 94 1143 741051 N/A N/A 25756 25772 TTCAAGCCCATGCCCTC 84 1144 741052 N/A N/A 25801 25817 ATCCAGTAGAGTGAGAG 79 1145 741053 N/A N/A 25803 25819 TCATCCAGTAGAGTGAG 89 1146 741054 N/A N/A 25804 25820 ATCATCCAGTAGAGTGA 85 315 741055 N/A N/A 25807 25823 GACATCATCCAGTAGAG 92 1147 741056 N/A N/A 25923 25939 TGAATACATTGTCTTAA 81 1148 741057 N/A N/A 25925 25941 ATTGAATACATTGTCTT 90 1149 741058 N/A N/A 25926 25942 AATTGAATACATTGTCT 94 392 741059 N/A N/A 25927 25943 TAATTGAATACATTGTC 84 1150 741060 N/A N/A 25929 25945 CATAATTGAATACATTG 80 1151 741061 N/A N/A 25981 25997 TGAGTAGCTATGGTTTA 91 1152 741062 N/A N/A 26202 26218 TCTTTGTGTTATACAAT 58 1153 741063 N/A N/A 26204 26220 CCTCTTTGTGTTATACA 83 1154 741064 N/A N/A 26205 26221 CCCTCTTTGTGTTATAC 87 469 741065 N/A N/A 26206 26222 TCCCTCTTTGTGTTATA 77 1155 741066 N/A N/A 26208 26224 TTTCCCTCTTTGTGTTA 78 1156 741067 N/A N/A 26431 26447 TACATACAATATTAAGG 78 1157 741068 N/A N/A 26656 26672 AAAAGAATGGATTCTGA 75 1158 741069 N/A N/A 26881 26897 AAGGAAAAACTCTGCCC 73 1159 741070 N/A N/A 27106 27122 TCACCCCAAGGCATTTG 56 1160 741071 N/A N/A 27331 27347 ACACCCTGATTCCCAAG 82 1161 741072 N/A N/A 27410 27426 GTGTGAGCAAACATTCA 89 1162 741073 N/A N/A 27416 27432 GTCACAGTGTGAGCAAA 91 1163 741074 N/A N/A 27556 27572 GGGAAGTATTAGTGGAA 86 1164 741075 N/A N/A 27782 27798 GCTGAAAATATGAAACA 76 1165 741076 N/A N/A 28007 28023 ACTTCTAGCACTATTTT 71 1166 741077 N/A N/A 28232 28248 TTGTGCATTTATTCCAC 93 1167 741078 N/A N/A 28457 28473 GACTGTAATCTAGGACC 90 1168 741079 N/A N/A 28682 28698 TGACTTTTGAATCAGTC 59 1169 741080 N/A N/A 29010 29026 GAGCGATTCTCCTGGTT 76 1170 741081 N/A N/A 29235 29251 CACAGTCCATAATATTG 79 1171 741082 N/A N/A 29460 29476 TTTTTGTTAATAGTTCT 80 1172 741083 N/A N/A 29685 29701 GCTTTCTCAGAGCCCAA 89 1173 741084 N/A N/A 29912 29928 ATCTCTCTACCATGTGA 79 1174 741085 N/A N/A 30137 30153 GTGGATAAAGTACATTA 77 1175 741086 N/A N/A 30362 30378 AAATGGTATTCAGAGAT 76 1176

(377) TABLE-US-00018 TABLE 18  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 % SEQ No start stop start stop Sequence (5′ to 3′) Reduction ID NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 91 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 94 591 741087 N/A N/A 30587 30603 TTTTCTCCTAAAGCCTT 85 1177 741088 N/A N/A 31037 31053 CAGATTTCCAGCACACT 81 1178 741089 N/A N/A 31262 31278 CCTTCTTAGTGGTAAGA 64 1179 741090 N/A N/A 31487 31503 AATTACAGTGTAGGTAA 52 1180 741091 N/A N/A 31712 31728 ATAAGAGGTCACTGGAT 91 1181 741092 N/A N/A 31937 31953 AAGGAAACAGTCTACAT 85 1182 741093 N/A N/A 32162 32178 CTATCATGATAAGTATA 84 1183 741094 N/A N/A 32387 32403 TGTGGTTCTGCCCATCT 88 1184 741095 N/A N/A 32624 32640 GCCTAAACATTTTACTT 34 1185 741096 N/A N/A 32858 32874 GAAGTTTCTGAAGAAAT 89 1186 741097 N/A N/A 33083 33099 TTTTCAGTAGATTTGAC 86 1187 741098 N/A N/A 33308 33324 GCTATGACCCTCAAGCC 68 1188 741099 N/A N/A 33533 33549 AATAGAGCAAAATTTCG 87 1189 741100 N/A N/A 33762 33778 ATAATCAAACAAAAGGG 73 1190 741101 N/A N/A 33987 34003 AAAGTTCAATGCTGTGT 94 1191 741102 N/A N/A 34212 34228 GAAATGGGCATGTAAAC 72 1192 741103 N/A N/A 34443 34459 CAAAATACAATGTTCAA 40 1193 741104 N/A N/A 34668 34684 ATTCTTCTATCCTAGAA 12 1194 741105 N/A N/A 34893 34909 ATTATCATGGTTGCCCA 91 1195 741106 N/A N/A 35118 35134 ATGAGATCTTTTTGCAT 87 1196 741107 N/A N/A 35343 35359 AAGCAAGTTGTCCATGG 90 1197 741108 N/A N/A 35568 35584 TGTTGGAGTTTACAATT 76 1198 741109 N/A N/A 35793 35809 CTCACTAGCCCTGTGAC 14 1199 741110 N/A N/A 36018 36034 TCTCTTTCATGGGTATT 92 1200 741111 N/A N/A 36252 36268 GTCATTTTAATAAGTGT 92 1201 741112 N/A N/A 36484 36500 CAATTAAATAAACCTCT 65 1202 741113 N/A N/A 36790 36806 TATGGTGATATGGTTAG 91 1203 741114 N/A N/A 37018 37034 CCATGTGTTTTTGTGGC 84 1204 741115 N/A N/A 37243 37259 CAAAGGTATAAGGTCAT 94 1205 741116 N/A N/A 37468 37484 AGCTTGTATTTTTGAAA 86 1206 741117 N/A N/A 37788 37804 CGCATCTGTCTTTCTTT 78 1207 741118 N/A N/A 38013 38029 TAGGACAGGTGAAATAA 72 1208 741119 N/A N/A 38238 38254 AGTTATTAGAATAACAC 0 1209 741120 N/A N/A 38464 38480 AATAAAATGTCTTAATC 25 1210 741121 N/A N/A 38691 38707 ACTCAAAAAAGAAGAAT 44 1211 741122 N/A N/A 38916 38932 GTTTTCTCTGTATTGGC 93 1212 741123 N/A N/A 39141 39157 TGGCCTAGTGGTTATAA 19 1213 741124 N/A N/A 39366 39382 CACAAAGAGGAAACAGG 80 1214 741125 N/A N/A 39591 39607 ACATTTTTTAACTGGAT 92 1215 741126 N/A N/A 39816 39832 AGGCTAAATTTTAATAA 6 1216 741127 N/A N/A 40041 40057 TAGCCTTTCATAGTACG 90 1217 741128 N/A N/A 40266 40282 AAGAGGAAAAGCTTGGA 43 1218 741129 N/A N/A 40491 40507 AAAAATTCTGGTGCCAA 94 1219 741130 N/A N/A 40716 40732 AAGCTAAACTACCGCTG 58 1220 741131 N/A N/A 40941 40957 GAATTTCCTGGATGCTC 92 1221 741132 N/A N/A 41130 41146 AGATTCCAGCAGAGATT 74 1222 741133 N/A N/A 41132 41148 ACAGATTCCAGCAGAGA 89 1223 741134 N/A N/A 41133 41149 AACAGATTCCAGCAGAG 87 90 741135 N/A N/A 41134 41150 GAACAGATTCCAGCAGA 85 1224 741136 N/A N/A 41136 41152 GTGAACAGATTCCAGCA 86 1225 741137 N/A N/A 41166 41182 ATCTGTAAGAAGTTTAG 52 1226 741138 N/A N/A 41391 41407 TGAGAAATTTTATGGGT 86 1227 741139 N/A N/A 41620 41636 TCATTCAAAACCATCCT 78 1228 741140 N/A N/A 41845 41861 GATCACACTGCTTATAG 84 1229 741141 N/A N/A 42070 42086 CAAGTTGATGGCATATA 89 1230 741142 N/A N/A 42295 42311 GTGTACCAACCTCAAGT 71 1231 741143 N/A N/A 42532 42548 TAAGTAAATACCTAGGG 83 1232 741144 N/A N/A 42757 42773 GATTTGTGCCTGGCATC 91 1233 741145 N/A N/A 42835 42851 TGCCTCTACCTCCAGCA 89 1234 741146 N/A N/A 42837 42853 GATGCCTCTACCTCCAG 87 1235 741147 N/A N/A 42838 42854 TGATGCCTCTACCTCCA 85 166 741148 N/A N/A 42839 42855 CTGATGCCTCTACCTCC 87 1236 741149 N/A N/A 42982 42998 TATCACAACTACATTGT 40 1237 741150 N/A N/A 43208 43224 GGCCTCCTGCTGCAGCA 31 1238 741151 N/A N/A 43440 43456 GCACTCATTTTAAATGT 72 1239 741152 N/A N/A 43665 43681 TGGTAACTTAGGACAAG 93 1240 741153 N/A N/A 43818 43834 TTCTCTGGACCTCTTAA 67 1241 741154 N/A N/A 43820 43836 ACTTCTCTGGACCTCTT 85 1242 741155 N/A N/A 43821 43837 TACTTCTCTGGACCTCT 92 242 741156 N/A N/A 43822 43838 TTACTTCTCTGGACCTC 90 1243 741157 N/A N/A 43890 43906 TCAATACAACTTAATTC 48 1244 741158 N/A N/A 44376 44392 TTGGGCTGGAAGCAGTG 43 1245 741159 N/A N/A 44601 44617 AAGATATGCAGAGGGTT 92 1246 741160 N/A N/A 44828 44844 TGGTCTAACTGTGTTGC 85 1247 741161 N/A N/A 45053 45069 GTTTATGGACTTTTTAA 87 1248 741162 N/A N/A 45278 45294 TTTTGTACTTTATGGAA 89 1249 741163 N/A N/A 45503 45519 ACTTCTCCTTCAATTAA 72 1250

(378) TABLE-US-00019 TABLE 19  Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 90 33 740432 270 286 4721 4737 AGTCCTTTCATGAATAC 90 591 741241 N/A N/A 56397 56413 AAAATTTTTGCACACTT 94 1251 741242 N/A N/A 56622 56638 GCCAAATCAATGGATGA 90 1252 741243 N/A N/A 56847 56863 AGTGACCAAGAGAATGA 53 1253 741244 N/A N/A 57072 57088 TTTTAAAACACTGGCCT 41 1254 741245 N/A N/A 57297 57313 TAGGATTAAACAGTCCA 48 1255 741246 N/A N/A 57522 57538 TTATCTGTTGCTATGTG 91 1256 741247 N/A N/A 57747 57763 AAGAAGGAGAATAGCAG 86 1257 741248 N/A N/A 57981 57997 CGGGCAAACATGTTTTG 47 1258 741249 N/A N/A 58206 58222 ATGACCTACATGCTAAA 73 1259 741250 N/A N/A 58431 58447 AGAAGCAAAATGTCAGT 88 1260 741251 N/A N/A 58656 58672 CCTAACAGCTTTACTTT 50 1261 741252 N/A N/A 58881 58897 CTTTCACACATCTCTAA 64 1262 741253 N/A N/A 58991 59007 TTTCATTAATCTGTGAA 34 1263 741254 N/A N/A 58992 59008 ATTTCATTAATCTGTGA 86 169 741255 N/A N/A 58993 59009 TATTTCATTAATCTGTG 93 1264 741256 N/A N/A 58995 59011 TATATTTCATTAATCTG 87 1265 741257 N/A N/A 59106 59122 CCTTACACAAAATATAA 38 1266 741258 N/A N/A 59354 59370 ACACCAATATATTATTT 67 1267 741259 N/A N/A 59594 59610 TAAAGGATGCAAAGGCA 55 1268 741260 N/A N/A 59948 59964 TTCCAGCGATCCCACTC 80 1269 741261 N/A N/A 60173 60189 CTCAACATCTTTAATGA 35 1270 741262 N/A N/A 60421 60437 GGGACCTAAAACTATAA 25 1271 741263 N/A N/A 60758 60774 AGCAGAATAGAAAATCC 49 1272 741264 N/A N/A 60983 60999 TTCAATGCGACTCCCAT 81 1273 741265 N/A N/A 61216 61232 CAACAAAACTGAGAATC 24 1274 741266 N/A N/A 61474 61490 AATGCCTGCTTTCACCA 76 1275 741267 N/A N/A 61699 61715 TATAAGCAGGAGTAAAA 27 1276 741268 N/A N/A 61969 61985 GTTCCAAAAGATAGAGA 55 1277 741269 N/A N/A 62200 62216 CGTACACAAACTAGAAA 33 1278 741270 N/A N/A 62492 62508 TACTGTTGCATTCCAGC 70 1279 741271 N/A N/A 62729 62745 TCTTAGTGTGGTGGCTC 78 1280 741272 N/A N/A 62955 62971 TCAACAATAATAATGAC 60 1281 741273 N/A N/A 63197 63213 CCTTTTCATCAACACAT 71 1282 741274 N/A N/A 63422 63438 TATGCATCTAACACTTG 52 1283 741275 N/A N/A 63666 63682 CCATCAACCAAGTATCT 26 1284 741276 N/A N/A 63891 63907 CTTGAAACAGTAACTTG 47 1285 741277 N/A N/A 64116 64132 AACATAGCAGATTAATA 37 1286 741278 N/A N/A 64349 64365 TCATGTTATATAGTGGG 97 1287 741279 N/A N/A 64574 64590 TGTAACCTAATGTAAAT 37 1288 741280 N/A N/A 64799 64815 ACAAGTATCTGTACTCA 94 1289 741281 N/A N/A 65024 65040 GTCTCTGTTAATGTTGG 75 1290 741282 N/A N/A 65249 65265 GAACCAGCCTGACTTAA 74 1291 741283 N/A N/A 65474 65490 TTGTATGGGTTACATAA 61 1292 741284 N/A N/A 65801 65817 CAATTAAATGCAATTCC 53 1293 741285 N/A N/A 66026 66042 TGACAGAAGTGTGCATA 59 1294 741286 N/A N/A 66251 66267 CAACACATCCACATTGC 75 1295 741287 N/A N/A 66476 66492 TTCACACCTCTCTCCCT 51 1296 741288 N/A N/A 66701 66717 TGCTGGTCTAAGATGCA 77 1297 741289 N/A N/A 66926 66942 ATGTGTTTTGAGGAAAA 77 1298 741290 N/A N/A 67151 67167 CAGAAGTAAATGTGGAC 85 1299 741291 N/A N/A 67376 67392 TGATTCTTTGGATTCAT 79 1300 741292 N/A N/A 67876 67892 CATTCTTGTTTTTATTC 86 1301 741293 N/A N/A 68101 68117 AATAGTGTCCCAGTGTA 78 1302 741294 N/A N/A 68326 68342 TGAAAGCTGTTCAGTTA 74 1303 741295 N/A N/A 68551 68567 CCCACATATACTACTTG 86 1304 741296 N/A N/A 68776 68792 AGAATTTCAGGAAGTTA 87 1305 741297 N/A N/A 68798 68814 CAAAGTAAGAGGAGATT 62 1306 741298 N/A N/A 68800 68816 GCCAAAGTAAGAGGAGA 90 1307 741299 N/A N/A 68801 68817 TGCCAAAGTAAGAGGAG 61 397 741300 N/A N/A 68804 68820 CAGTGCCAAAGTAAGAG 64 1308 741301 N/A N/A 69001 69017 TGAATCCATTTGTCCAG 91 1309 741302 N/A N/A 69227 69243 CTCTAAAATACAAATGT 72 1310 741303 N/A N/A 69452 69468 GAACAAAGGAATAAGTA 59 1311 741304 N/A N/A 69677 69693 CTAGATGTAGATATCAT 61 1312 741305 N/A N/A 69902 69918 AAGGGAATAAATTGTAG 52 1313 741306 N/A N/A 70127 70143 CAACAGACCCTTTCAAT 60 1314 741307 N/A N/A 70352 70368 GTCTTCCCACTGCCTAC 62 1315 741308 N/A N/A 70577 70593 TTTAGATATACCTCCAA 94 1316 741309 N/A N/A 70880 70896 GCTTCAGTTTCTTGAGT 79 1317 741310 N/A N/A 71105 71121 CTGGTCTTTCTCACAAT N.D. 1318 741311 N/A N/A 71375 71391 ATCATTCTTAACAGAAA 70 1319 741312 N/A N/A 71600 71616 GCTCTTGCTGTGCAGCC 74 1320 741313 N/A N/A 71844 71860 ATTTAAAGCAGCAGTCC 50 1321 741314 N/A N/A 72076 72092 AGGTAATTCTAATTTTA 68 1322 741315 N/A N/A 72301 72317 GGCAAATGACAGGGTCT 93 1323 741316 N/A N/A 72632 72648 TCTCAACTGCCTGAGTA 22 1324 741317 N/A N/A 72857 72873 CATGTCAGCTTTTTAGT 69 1325

(379) TABLE-US-00020 TABLE 20 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 95   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 94  591 741318 N/A N/A 73090 73106 ATACTCAGATATTTAAA 64 1326 741319 N/A N/A 73188 73204 ACTTTCTGTGTGGTATG 91 1327 741320 N/A N/A 73190 73206 AGACTTTCTGTGTGGTA 95 1328 741321 N/A N/A 73191 73207 CAGACTTTCTGTGTGGT 93  170 741322 N/A N/A 73192 73208 ACAGACTTTCTGTGTGG 86 1329 741323 N/A N/A 73194 73210 AGACAGACTTTCTGTGT 46 1330 741324 N/A N/A 73315 73331 GTTGAGAATTTTTCATT 66 1331 741325 N/A N/A 73540 73556 AGTTATGGAGCATCTTT 89 1332 741326 N/A N/A 73765 73781 GACTGAGTTTTTTATTC 74 1333 741327 N/A N/A 73990 74006 TCCTGAATTAAAAATTT 13 1334 741328 N/A N/A 74215 74231 GCTAAGCACAAACAATT 62 1335 741329 N/A N/A 74292 74308 GAACTCTGTAGTCAGAA 92 1336 741330 N/A N/A 74294 74310 TAGAACTCTGTAGTCAG 93 1337 741331 N/A N/A 74295 74311 ATAGAACTCTGTAGTCA 95  398 741332 N/A N/A 74296 74312 AATAGAACTCTGTAGTC 92 1338 741333 N/A N/A 74298 74314 TGAATAGAACTCTGTAG 85 1339 741334 N/A N/A 74440 74456 ACACAGAGCACTTCTTA 70 1340 741335 N/A N/A 74665 74681 GGAGTTACAGAGTTGCC 91 1341 741336 N/A N/A 74890 74906 TATCAGTCTATTAAGAA 82 1342 741337 N/A N/A 75115 75131 AAGTTTCTCAGAGCCTG 82 1343 741338 N/A N/A 75340 75356 AATACAGAAGTCTATTC 68 1344 741339 N/A N/A 75573 75589 CATTGAATAAAAATTTG 18 1345 741340 N/A N/A 75945 75961 CAGGTATAAAATTTTTT 45 1346 741341 N/A N/A 76170 76186 GGTGTTAATCACTTGAA 86 1347 741342 N/A N/A 76398 76414 TCTTGAAGCTAGTTGGG 91 1348 741343 N/A N/A 76623 76639 AGGGCAACTAACCAACA 75 1349 741344 N/A N/A 76848 76864 GTGGATACTTAGTATCA 69 1350 741345 N/A N/A 77073 77089 CTCTCTCAGTTGTAGGT 67 1351 741346 N/A N/A 77298 77314 AAAGTATGCTGTGTTCT 92 1352 741347 N/A N/A 77523 77539 GTACCCGGCACTTTTCC 53 1353 741348 N/A N/A 77663 77679 TCTAGAAAAGCTCTCTT 57 1354 741349 N/A N/A 77665 77681 ACTCTAGAAAAGCTCTC 81 1355 741350 N/A N/A 77666 77682 GACTCTAGAAAAGCTCT 91  247 741351 N/A N/A 77667 77683 AGACTCTAGAAAAGCTC 84 1356 741352 N/A N/A 77748 77764 TGGCACCCAGGAGTAAG 65 1357 741353 N/A N/A 77973 77989 CATACACAAAATCCCCT 83 1358 741354 N/A N/A 78198 78214 CACATGAAGCCAGGGAC 77 1359 741355 N/A N/A 78423 78439 GCAGGCCCTAAACTGTG 39 1360 741356 N/A N/A 78648 78664 AAATTTATCTATCATGC 93 1361 741357 N/A N/A 78873 78889 GCTAAACACTTTATCAA 75 1362 741358 N/A N/A 79098 79114 ACTTCATTCTTTCTGTT 87 1363 741359 N/A N/A 79323 79339 CAATTAAAAGATTACTT  0 1364 741360 N/A N/A 79548 79564 ACATTGTACAGTTAATT 77 1365 741361 N/A N/A 79773 79789 TACAAACCTTACTATGC 51 1366 741362 N/A N/A 79998 80014 AACAGACTTAAACAAAC 88 1367 741363 N/A N/A 80223 80239 CTCAGACATCATGTTTT 91 1368 741364 N/A N/A 80448 80464 AGGCACTCACAAACATT 86 1369 741365 N/A N/A 80673 80689 TCTCGCATCCTAAATGT 50 1370 741366 N/A N/A 80898 80914 TTCATATTTTATGTTAC 89 1371 741367 N/A N/A 80991 81007 TGAAATTTTCCAGCTAA 93 1372 741368 N/A N/A 80993 81009 CTTGAAATTTTCCAGCT 97 1373 741369 N/A N/A 80995 81011 ATCTTGAAATTTTCCAG 86 1374 741370 N/A N/A 81123 81139 CTATAATTACATTCCTA 73 1375 741371 N/A N/A 81348 81364 GCATGAACCTAGATATG 58 1376 741372 N/A N/A 81472 81488 GCTGTTTGAAGTGACAA 70 1377 741373 N/A N/A 81474 81490 GAGCTGTTTGAAGTGAC 90 1378 741374 N/A N/A 81475 81491 AGAGCTGTTTGAAGTGA 82  249 741375 N/A N/A 81476 81492 GAGAGCTGTTTGAAGTG 76 1379 741376 N/A N/A 81478 81494 TGGAGAGCTGTTTGAAG 69 1380 741377 N/A N/A 81575 81591 CTGCCACTATTCACAAT 71 1381 741378 N/A N/A 81800 81816 TTATTGCATTAATGGAA 94 1382 741379 N/A N/A 82107 82123 ATGGTGTTAGCTAGGAT 91 1383 741380 N/A N/A 82332 82348 GTCTTTTTACATTATAA 93 1384 741381 N/A N/A 82557 82573 ATAACCACTATTCAATG 63 1385 741382 N/A N/A 82783 82799 AAAAATCACATTTGGCA 95 1386 741383 N/A N/A 83008 83024 TTCTTTCACCTTATGAG 72 1387 741384 N/A N/A 83233 83249 ATATATGTGTCAGTTCT 90 1388 741385 N/A N/A 83458 83474 GTGTCACTTTTTAAGGT 14 1389 741386 N/A N/A 83528 83544 AGAACAATGTCATCTTT 94 1390 741387 N/A N/A 83530 83546 AAAGAACAATGTCATCT 88 1391 741388 N/A N/A 83531 83547 GAAAGAACAATGTCATC 89   98 741389 N/A N/A 83532 83548 GGAAAGAACAATGTCAT 82 1392 741390 N/A N/A 83534 83550 CAGGAAAGAACAATGTC 88 1393 741391 N/A N/A 83683 83699 CACAGGTATACACACTT 90 1394 741392 N/A N/A 83908 83924 GTACAAAATCTGCATAT 81 1395 741393 N/A N/A 84133 84149 ATAGGTATTTTATGCAT 88 1396 741394 N/A N/A 84616 84632 CAAATTATGCATTTGTT 66 1397

(380) TABLE-US-00021 TABLE 21 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 95   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 93  591 741395 N/A N/A 84845 84861 CTACAAAATTGCTAAAA  9 1398 741396 N/A N/A 85070 85086 ACAATGTTACTTTGTCC 90 1399 741397 N/A N/A 85295 85311 TACAAAAATACCCCCCC 12 1400 741398 N/A N/A 85520 85536 ATTTGTAGACCTATGTT 62 1401 741399 N/A N/A 85745 85761 AAGCATCTCCTGTGGTG 78 1402 741400 N/A N/A 85970 85986 CAACATGTTTTATCATG 68 1403 741401 N/A N/A 86195 86211 AATATGACCACAATTTT 73 1404 741402 N/A N/A 86420 86436 TGGCAATATGAATGTGC 86 1405 741403 N/A N/A 86645 86661 GATAAGGGCACATTGTC 64 1406 741404 N/A N/A 86871 86887 GTGATGGAGGGAAATCG 53 1407 741405 N/A N/A 87096 87112 TGTGGTAATTGGAACAA 34 1408 741406 N/A N/A 87321 87337 ACTGAACCCAAATGGCT 68 1409 741407 N/A N/A 87546 87562 TCACATTCATCATATTC 81 1410 741408 N/A N/A 87772 87788 CATTGCTGTTGTTGTTC 92 1411 741409 N/A N/A 87945 87961 TAAGTTGTGACCATGCA 87 1412 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 95  402 741411 N/A N/A 87947 87963 AGTAAGTTGTGACCATG 96 1413 741412 N/A N/A 87949 87965 TTAGTAAGTTGTGACCA 76 1414 741413 N/A N/A 87997 88013 AATAAAAATGTGCATGC 47 1415 741414 N/A N/A 88222 88238 AACAAAATACAGTCAGA 91 1416 741415 N/A N/A 88447 88463 TTTGTACTGTGTGCTGT 89 1417 741416 N/A N/A 89657 89673 TGACATACAAACCCAAA 78 1418 N/A N/A 88652 88668 741417 N/A N/A 89658 89674 TTGACATACAAACCCAA 87  326 N/A N/A 88653 88669 741418 N/A N/A 89659 89675 CTTGACATACAAACCCA 82 1419 N/A N/A 88654 88670 741419 N/A N/A 89681 89697 GTCCCCAATCCCCACCC 19  100 N/A N/A 88676 88692 741420 N/A N/A 88705 88721 GAAGTTAACTCCCTAGA 83 1420 741421 N/A N/A 88707 88723 ATGAAGTTAACTCCCTA 92 1421 741422 N/A N/A 89713 89729 GATGAAGTTAACTCCCT 92  176 N/A N/A 88708 88724 741423 N/A N/A 89714 89730 AGATGAAGTTAACTCCC 86 1422 N/A N/A 88709 88725 741424 N/A N/A 89716 89732 AGAGATGAAGTTAACTC 78  252 N/A N/A 88711 88727 741425 N/A N/A 88754 88770 TTTTCAAGAGCTTTTCG 67 1423 741426 N/A N/A 89761 89777 CCTTTTCAAGAGCTTTT 90 1424 N/A N/A 88756 88772 741427 N/A N/A 89763 89779 TCCCTTTTCAAGAGCTT 96 1425 N/A N/A 88758 88774 741428 N/A N/A 89765 89781 TTTCCCTTTTCAAGAGC 93 1426 N/A N/A 88760 88776 741429 N/A N/A 89767 89783 TATTTCCCTTTTCAAGA 32 1427 N/A N/A 88762 88778 741430 N/A N/A 88901 88917 ACAAGTAGGTAGGTCAA 83 1428 741431 N/A N/A 89126 89142 TGAGCCATATTCAATAT 66 1429 741432 N/A N/A 89351 89367 AAATTGCTAGGTTCAAC 77 1430 741433 N/A N/A 89579 89595 ATCAAATATTTACTAGA 49 1431 741434 N/A N/A 89655 89671 ACATACAAACCCAAAGA 43 1432 N/A N/A 88650 88666 741435 N/A N/A 89661 89677 CACTTGACATACAAACC 58 1433 N/A N/A 88656 88672 741436 N/A N/A 89710 89726 GAAGTTAACTCCCTTGA 69 1434 741437 N/A N/A 89712 89728 ATGAAGTTAACTCCCTT 92 1435 741438 N/A N/A 89759 89775 TTTTCAAGAGCTTTTCT 66 1436 741439 N/A N/A 89804 89820 TCTACAGGTTATATGTG 46 1437 741440 N/A N/A 90029 90045 TCCCAAAGTGCAAGACT 53 1438 741441 N/A N/A 90321 90337 CTCTATTGTTATATTTT 86 1439 741442 N/A N/A 90546 90562 ATCTAACTCCTAGCACA 37 1440 741443 N/A N/A 90771 90787 ATACTTTCTCTGCATAA 65 1441 741444 N/A N/A 91050 91066 TAGCTATAGTGCAATGG 52 1442 741445 N/A N/A 91277 91293 CTGGAATTCCAGAAAAA 63 1443 741446 N/A N/A 91502 91518 CTTTCAAATCTCATTAC 68 1444 741447 N/A N/A 91727 91743 TCTTCTTTTGCAGAGAT 65 1445 741448 N/A N/A 91952 91968 TAGAGCATTAAGAACAT 68 1446 741449 N/A N/A 92177 92193 GTTACTAAAAAAAACCA 41 1447 741450 N/A N/A 92402 92418 TCCCATTGGACTGAGTT 53 1448 741451 N/A N/A 92627 92643 TATCCATTTTCCAGTTA 83 1449 741452 N/A N/A 92852 92868 CCAGGGTGCTATACAAA 73 1450 741453 N/A N/A 93077 93093 CCTTAACAATCTTATTT 48 1451 741454 N/A N/A 93302 93318 CACCACATTAATTAAAC 52 1452 741455 N/A N/A 93527 93543 ATGTTTTGAGTTCCAGG 97 1453 741456 N/A N/A 93752 93768 TAATTAATAATCATCTT 20 1454 741457 N/A N/A 93950 93966 TTCTGGCTGACTGAATT 48 1455 741458 N/A N/A 93953 93969 GGCTTCTGGCTGACTGA 72  180 741459 N/A N/A 93954 93970 TGGCTTCTGGCTGACTG 83 1456 741460 N/A N/A 93956 93972 TGTGGCTTCTGGCTGAC 66 1457 741461 N/A N/A 93983 93999 GGCTTTTAACAAAACAA 69 1458 741462 N/A N/A 94052 94068 ATAATTCAAGTCAGGGA 67 1459 741463 N/A N/A 94054 94070 CCATAATTCAAGTCAGG 80 1460 741464 N/A N/A 94055 94071 GCCATAATTCAAGTCAG 89  331 741465 N/A N/A 94056 94072 TGCCATAATTCAAGTCA 66 1461 741466 N/A N/A 94058 94074 ACTGCCATAATTCAAGT 64 1462 741467 N/A N/A 94208 94224 TAATATTGTGACCACTT 94 1463 741468 N/A N/A 94433 94449 TAAGACTATTGCTTTGG 74 1464 741469 N/A N/A 94658 94674 CATAATAGATGAGTTAA 62 1465 741470 N/A N/A 94993 95009 TTCAGTTTTGTGGCGGG 72 1466 741471 N/A N/A 95218 95234 ATTACATTAAAAGGTGG 39 1467

(381) TABLE-US-00022 TABLE 22 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256   4691   4707 GAATTCCTTTACACCAC 97   33 740432 270 286   4721   4737 AGTCCTTTCATGAATAC 95  591 741472 N/A N/A  95443  95459 CCACCGTCACTGCATAC 85 1468 741473 N/A N/A  95668  95684 ACTCTGTTGAATTTTCT 80 1469 741474 N/A N/A  95893  95909 TTTCCAGTGCTAGTATT 68 1470 741475 N/A N/A  96118  96134 AATGAGATGAAAATTGA 70 1471 741476 N/A N/A  96343  96359 AGCTAGTTTGTAAACAA 72 1472 741477 N/A N/A  96568  96584 AGAAGCAGTGAATCCAA 84 1473 741478 N/A N/A  96793  96809 CTGTTAATCACCCCTTT 60 1474 741479 N/A N/A  97018  97034 CACAATACAGAGCAGAG 72 1475 741480 N/A N/A  97243  97259 AGAAGTCAGACTTCAGG 33 1476 741481 N/A N/A  97474  97490 ATGGAAGATGAAAAAGG  3 1477 741482 N/A N/A  97699  97715 GTTGAGTCTGAGATGCC 75 1478 741483 N/A N/A  97924  97940 AAGGCTGTTCACTATAT 81 1479 741484 N/A N/A  98149  98165 TCTTGCACTGATTCCTC 61 1480 741485 N/A N/A  98374  98390 AGATAAGAAGCAAATGC 61 1481 741486 N/A N/A  98805  98821 GAATGGGCGGATCACAA 34 1482 741487 N/A N/A  99032  99048 GATTATTTTAAGCACTT 90 1483 741488 N/A N/A  99257  99273 AGAAAAAGGGCATTTAA 26 1484 741489 N/A N/A  99483  99499 TGCAATGTGTAGGTGGG 70 1485 741490 N/A N/A  99708  99724 ACTTTTAAGGCATCCAT 74 1486 741491 N/A N/A  99933  99949 CCCTCCCAACAATTTCA 26 1487 741492 N/A N/A 100158 100174 CTTTCCATTATTGTTCT 67 1488 741493 N/A N/A 100391 100407 GGAAATGTTTATATATA 58 1489 741494 N/A N/A 100625 100641 TAGGAAGTCTGGCTCCA 22 1490 741495 N/A N/A 100850 100866 GATAATGGGCTAGGTGT 69 1491 741496 N/A N/A 101075 101091 TGGAATATCTTTGCTTA 22 1492 741497 N/A N/A 101300 101316 ATAGCTTCAAGATCGGT 72 1493 741498 N/A N/A 101525 101541 GAGATAAAGAGTCTGCT 61 1494 741499 N/A N/A 101803 101819 TCACGGGATCACGCCAT 58 1495 741500 N/A N/A 102028 102044 TGACTGAATAAGACATT 52 1496 741501 N/A N/A 102253 102269 GCAACAACTGCCAGCTT 54 1497 741502 N/A N/A 102478 102494 CAGGTTTAAATACATTC 85 1498 741503 N/A N/A 102703 102719 TTGGATAATCTGTTACT 63 1499 741504 N/A N/A 102968 102984 TAATGCAGTGATACAAT 57 1500 741505 N/A N/A 103193 103209 CTGGATCACTTGGGAAT 69 1501 741506 N/A N/A 103418 103434 TGTTCTAATTAAAAAGT 47 1502 741507 N/A N/A 103643 103659 ACTTTACAACAAGATAA 36 1503 741508 N/A N/A 103868 103884 TGATACATTATAATACA 58 1504 741509 N/A N/A 104093 104109 GGGAAAGTATAGTTATG 63 1505 741510 N/A N/A 104332 104348 GCATAAGAAAGAACAAT 42 1506 741511 N/A N/A 104557 104573 TCTTGAGGTCATAAATC 56 1507 741512 N/A N/A 104782 104798 AAATGAAGGCGATAGAC 76 1508 741513 N/A N/A 105007 105023 CTAAAAAAGAACTTTGA  0 1509 741514 N/A N/A 105232 105248 TGTGTGATCAACTTTCA 88 1510 741515 N/A N/A 105457 105473 AGTAAGCTTCAATTGGT 71 1511 741516 N/A N/A 105682 105698 AGGTTTCATCAATTATC 89 1512 741517 N/A N/A 105907 105923 AGTGTCTTGTTAAGTAT 64 1513 741518 N/A N/A 106134 106150 GAATTTACATAATCTTT 69 1514 741519 N/A N/A 106361 106377 CTTTTTAAATAAACCTG 58 1515 741520 N/A N/A 106586 106602 GAATAGCTGTAGACTTT 67 1516 741521 N/A N/A 106811 106827 TACCAATATAACAAATG 23 1517 741522 N/A N/A 107037 107053 TATTTACTGTTTCATAA 40 1518 741523 N/A N/A 107275 107291 TCAGGTGTCCTAGTGGG 68 1519 741524 N/A N/A 107500 107516 GCAACCCCAAAATACTA 62 1520 741525 N/A N/A 107725 107741 GTGTGATGATATATTGC 85 1521 741526 N/A N/A 107954 107970 ACAAGACAAAGAATACG 47 1522 741527 N/A N/A 108273 108289 GTTCTCCTATAGTCCCA 24 1523 741528 N/A N/A 108498 108514 ACTAGGGATGACAGCAC 74 1524 741529 N/A N/A 108724 108740 TTCTTGCTTATATCAAT 72 1525 741530 N/A N/A 108970 108986 GCAGTAATGGAACAGCG 63 1526 741531 N/A N/A 109195 109211 ATTTTGATATGGACCAG 73 1527 741532 N/A N/A 109420 109436 TGCTGAGAAGTTTCCTA 52 1528 741533 N/A N/A 109645 109661 TGCCCTTTTTATAAACT 18 1529 741534 N/A N/A 109870 109886 AGCCTAAAGGGACTTGG 49 1530 741535 N/A N/A 110095 110111 AGACTGAGACTATACAT 65 1531 741536 N/A N/A 110320 110336 GTCTATATTATAGATAC 16 1532 741537 N/A N/A 110626 110642 TTACAATGAAACCCCAT 38 1533 741538 N/A N/A 110853 110869 TTTACTATTTAGGAAAT 10 1534 741539 N/A N/A 111078 111094 AAGTAAGAAGCACAAAA 20 1535 741540 N/A N/A 111303 111319 AACTTGCAAGTTGTCCA 79 1536 741541 N/A N/A 111528 111544 GATTTCCCTAACTTTCC 61 1537 741542 N/A N/A 111986 112002 ATGTCTCCTCTTCTGTT 43 1538 741543 N/A N/A 112211 112227 GTAACCTGGCCACTTTG 49 1539 741544 N/A N/A 112436 112452 TGTCTGTGTGAGACAGT 31 1540 741545 N/A N/A 112661 112677 ATCATAATGAAGAAATG 12 1541 741546 N/A N/A 112886 112902 TGCCTTTGCTTCTGATA 63 1542 741547 N/A N/A 113111 113127 ATATCAGGATTCTGCTT 52 1543 741548 N/A N/A 113336 113352 GATGCTCTAATTCTCAG 61 1544

(382) TABLE-US-00023 TABLE 23 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ SEQ SEQ SEQ SEQ SEQ ID ID ID ID ID ID SEQ Compound No: 3 No: 3 No: 5 No: 5 No: 6 No: 6 % ID No start stop start stop start stop Sequence (5′ to 3′) Reduction NO 740914 N/A N/A 31  47 N/a N/a CACTCTTTCAGAGCTGG 49 1545 740915 N/A N/A 34  50 N/a N/a CCACACTCTTTCAGAGC 12 1546 740916 N/A N/A 37  53 N/a N/a ACACCACACTCTTTCAG 37 1547 740917 N/A N/A 40  56 N/a N/a TTTACACCACACTCTTT 55 1548 740918 N/A N/A 41  57 N/a N/a CTTTACACCACACTCTT 70 1549 740919 N/A N/A 43  59 98 114 TCCTTTACACCACACTC 89 1550 740920 N/A N/A 90 106 90 106 ACCACACTCACTTCCGC 23 1551 740921 N/A N/A 93 109 93 109 TACACCACACTCACTTC  0 1552 740922 N/A N/A 96 112 96 112 CTTTACACCACACTCAC 86 1553 740923 370 386 N/A N/A N/A N/A CACTACATAGAGAACAC 86 1554 740924 373 389 N/A N/A N/A N/A AGCCACTACATAGAGAA  8 1555 740925 376 392 N/A N/A N/A N/A CTCAGCCACTACATAGA 29 1556 740926 379 395 N/A N/A N/A N/A CTTCTCAGCCACTACAT 52 1557 740927 382 398 N/A N/A N/A N/A GGTCTTCTCAGCCACTA 83 1558 740928 513 529 N/A N/A N/A N/A TCCTTGCCCAACTGGTC 46 1559 740929 516 532 N/A N/A N/A N/A CCTTCCTTGCCCAACTG 19 1560 740930 519 535 N/A N/A N/A N/A TACCCTTCCTTGCCCAA 50 1561 740931 522 538 N/A N/A N/A N/A TGATACCCTTCCTTGCC 16 1562 740932 525 541 N/A N/A N/A N/A TCTTGATACCCTTCCTT 63 1563

Example 4: Effect of 5-8-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

(383) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

(384) Cultured SH-SY5Y cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM concentration of modified oligonucleotide or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR using human primer probe set RTS2621 as described in Example 1. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control cells.

(385) The modified oligonucleotides in tables 24-28 are 4-9-4 MOE and cEt gapmers. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises nine 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end comprising two 2′-MOE nucleosides and two cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eekkdddddddddkkee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and ‘k’ represents a cEt modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssoss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(386) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(387) TABLE-US-00024 TABLE 24 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 61   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 87  591 741010 N/A N/A 20549 20565 CAATTTCTAGGTTCTAT 28 1107 741011 N/A N/A 20559 20575 AACTATGCTGCAATTTC 28 1108 741012 N/A N/A 20561 20577 ACAACTATGCTGCAATT 25 1109 741013 N/A N/A 20562 20578 CACAACTATGCTGCAAT 54  314 741014 N/A N/A 20565 20581 TTCCACAACTATGCTGC 51 1110 741015 N/A N/A 20774 20790 GACCACAATTGCAGACA 55 1111 741016 N/A N/A 20985 21001 GTGTGAGCAAACATTCT 73 1112 741017 N/A N/A 27412 27428 CAGTGTGAGCAAACATT 35 1113 N/A N/A 20987 21003 741018 N/A N/A 27413 27429 ACAGTGTGAGCAAACAT 67  468 N/A N/A 20988 21004 741019 N/A N/A 27414 27430 CACAGTGTGAGCAAACA 61 1114 N/A N/A 20989 21005 741020 N/A N/A 20991 21007 GGCACAGTGTGAGCAAA 53 1115 741021 N/A N/A 20999 21015 AAGTTTCTGGCACAGTG 89 1116 741022 N/A N/A 21224 21240 GTTCAGAATTATGTCAT 81 1117 741023 N/A N/A 21449 21465 TCTTATGTGCACATGAG 16 1118 741024 N/A N/A 21674 21690 CATAGTAGCATTACAGA 47 1119 741025 N/A N/A 21899 21915 TCAGGCAGTGGCTTCAC 43 1120 741026 N/A N/A 22129 22145 TAAAAAAAGTTGTTCAT  0 1121 741027 N/A N/A 22360 22376 CACTCAAGTGTTTAAAA 26 1122 741028 N/A N/A 22454 22470 TGTGACCTGTGCTTGTT 83 1123 741029 N/A N/A 22456 22472 CCTGTGACCTGTGCTTG 87 1124 741030 N/A N/A 22457 22473 GCCTGTGACCTGTGCTT 62   88 741031 N/A N/A 22458 22474 TGCCTGTGACCTGTGCT 54 1125 741032 N/A N/A 22460 22476 GTTGCCTGTGACCTGTG 78 1126 741033 N/A N/A 22599 22615 TATTAGACACTTAAGGG 28 1127 741034 N/A N/A 22831 22847 TCAATCTTAAATTTTTC 56 1128 741035 N/A N/A 23056 23072 GTACTTTCCCACCTAGA 39 1129 741036 N/A N/A 23281 23297 TCTCAGAGACCACAGCT 56 1130 741037 N/A N/A 23285 23301 TTGTTCTCAGAGACCAC 86 1131 741038 N/A N/A 23286 23302 ATTGTTCTCAGAGACCA 72  164 741039 N/A N/A 23287 23303 TATTGTTCTCAGAGACC 67 1132 741040 N/A N/A 23289 23305 CATATTGTTCTCAGAGA 40 1133 741041 N/A N/A 23506 23522 ACTATTAACCACTGATC 25 1134 741042 N/A N/A 23731 23747 GTTGCAGTCCACAGAAT 34 1135 741043 N/A N/A 23956 23972 TAAAGATAAGTATCTCA 70 1136 741044 N/A N/A 24181 24197 AAAACAAACCTAAGTCA  0 1137 741045 N/A N/A 24406 24422 AAAAGCTAACAGCCTAT 14 1138 741046 N/A N/A 24631 24647 TTAAATTGATGAGATGT 49 1139 741047 N/A N/A 24856 24872 GTATTCTTTGCATTAGT 67 1140 741048 N/A N/A 25081 25097 TAAAAGTGTACATTATT 22 1141 741049 N/A N/A 25306 25322 CTCAAGGCAAAGCTGTA 57 1142 741050 N/A N/A 25531 25547 TGCCACTATAAGCAGTC 55 1143 741051 N/A N/A 25756 25772 TTCAAGCCCATGCCCTC 21 1144 741052 N/A N/A 25801 25817 ATCCAGTAGAGTGAGAG 37 1145 741053 N/A N/A 25803 25819 TCATCCAGTAGAGTGAG 41 1146 741054 N/A N/A 25804 25820 ATCATCCAGTAGAGTGA 31  315 741055 N/A N/A 25807 25823 GACATCATCCAGTAGAG 55 1147 741056 N/A N/A 25923 25939 TGAATACATTGTCTTAA 18 1148 741057 N/A N/A 25925 25941 ATTGAATACATTGTCTT 41 1149 741058 N/A N/A 25926 25942 AATTGAATACATTGTCT 50  392 741059 N/A N/A 25927 25943 TAATTGAATACATTGTC 29 1150 741060 N/A N/A 25929 25945 CATAATTGAATACATTG 25 1151 741061 N/A N/A 25981 25997 TGAGTAGCTATGGTTTA 37 1152 741062 N/A N/A 26202 26218 TCTTTGTGTTATACAAT  0 1153 741063 N/A N/A 26204 26220 CCTCTTTGTGTTATACA 53 1154 741064 N/A N/A 26205 26221 CCCTCTTTGTGTTATAC 42  469 741065 N/A N/A 26206 26222 TCCCTCTTTGTGTTATA 20 1155 741066 N/A N/A 26208 26224 TTTCCCTCTTTGTGTTA 30 1156 741067 N/A N/A 26431 26447 TACATACAATATTAAGG  0 1157 741068 N/A N/A 26656 26672 AAAAGAATGGATTCTGA 34 1158 741069 N/A N/A 26881 26897 AAGGAAAAACTCTGCCC 15 1159 741070 N/A N/A 27106 27122 TCACCCCAAGGCATTTG  6 1160 741071 N/A N/A 27331 27347 ACACCCTGATTCCCAAG 31 1161 741072 N/A N/A 27410 27426 GTGTGAGCAAACATTCA 52 1162 741073 N/A N/A 27416 27432 GTCACAGTGTGAGCAAA 72 1163 741074 N/A N/A 27556 27572 GGGAAGTATTAGTGGAA 27 1164 741075 N/A N/A 27782 27798 GCTGAAAATATGAAACA 32 1165 741076 N/A N/A 28007 28023 ACTTCTAGCACTATTTT  9 1166 741077 N/A N/A 28232 28248 TTGTGCATTTATTCCAC 78 1167 741078 N/A N/A 28457 28473 GACTGTAATCTAGGACC 74 1168 741079 N/A N/A 28682 28698 TGACTTTTGAATCAGTC 14 1169 741080 N/A N/A 29010 29026 GAGCGATTCTCCTGGTT 61 1170 741081 N/A N/A 29235 29251 CACAGTCCATAATATTG 34 1171 741082 N/A N/A 29460 29476 TTTTTGTTAATAGTTCT 73 1172 741083 N/A N/A 29685 29701 GCTTTCTCAGAGCCCAA 74 1173 741084 N/A N/A 29912 29928 ATCTCTCTACCATGTGA 34 1174 741085 N/A N/A 30137 30153 GTGGATAAAGTACATTA 16 1175 741086 N/A N/A 30362 30378 AAATGGTATTCAGAGAT 42 1176

(388) TABLE-US-00025 TABLE 25 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 55   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 84  591 741087 N/A N/A 30587 30603 TTTTCTCCTAAAGCCTT 42 1177 741088 N/A N/A 31037 31053 CAGATTTCCAGCACACT 30 1178 741089 N/A N/A 31262 31278 CCTTCTTAGTGGTAAGA  0 1179 741090 N/A N/A 31487 31503 AATTACAGTGTAGGTAA 18 1180 741091 N/A N/A 31712 31728 ATAAGAGGTCACTGGAT 25 1181 741092 N/A N/A 31937 31953 AAGGAAACAGTCTACAT 14 1182 741093 N/A N/A 32162 32178 CTATCATGATAAGTATA 10 1183 741094 N/A N/A 32387 32403 TGTGGTTCTGCCCATCT 54 1184 741095 N/A N/A 32624 32640 GCCTAAACATTTTACTT  5 1185 741096 N/A N/A 32858 32874 GAAGTTTCTGAAGAAAT 40 1186 741097 N/A N/A 33083 33099 TTTTCAGTAGATTTGAC 24 1187 741098 N/A N/A 33308 33324 GCTATGACCCTCAAGCC 11 1188 741099 N/A N/A 33533 33549 AATAGAGCAAAATTTCG 35 1189 741100 N/A N/A 33762 33778 ATAATCAAACAAAAGGG 16 1190 741101 N/A N/A 33987 34003 AAAGTTCAATGCTGTGT 69 1191 741102 N/A N/A 34212 34228 GAAATGGGCATGTAAAC 10 1192 741103 N/A N/A 34443 34459 CAAAATACAATGTTCAA 15 1193 741104 N/A N/A 34668 34684 ATTCTTCTATCCTAGAA  5 1194 741105 N/A N/A 34893 34909 ATTATCATGGTTGCCCA 38 1195 741106 N/A N/A 35118 35134 ATGAGATCTTTTTGCAT 39 1196 741107 N/A N/A 35343 35359 AAGCAAGTTGTCCATGG 47 1197 741108 N/A N/A 35568 35584 TGTTGGAGTTTACAATT 20 1198 741109 N/A N/A 35793 35809 CTCACTAGCCCTGTGAC  0 1199 741110 N/A N/A 36018 36034 TCTCTTTCATGGGTATT 57 1200 741111 N/A N/A 36252 36268 GTCATTTTAATAAGTGT 65 1201 741112 N/A N/A 36484 36500 CAATTAAATAAACCTCT 10 1202 741113 N/A N/A 36790 36806 TATGGTGATATGGTTAG 53 1203 741114 N/A N/A 37018 37034 CCATGTGTTTTTGTGGC 33 1204 741115 N/A N/A 37243 37259 CAAAGGTATAAGGTCAT 49 1205 741116 N/A N/A 37468 37484 AGCTTGTATTTTTGAAA 24 1206 741117 N/A N/A 37788 37804 CGCATCTGTCTTTCTTT 25 1207 741118 N/A N/A 38013 38029 TAGGACAGGTGAAATAA 12 1208 741119 N/A N/A 38238 38254 AGTTATTAGAATAACAC  0 1209 741120 N/A N/A 38464 38480 AATAAAATGTCTTAATC  0 1210 741121 N/A N/A 38691 38707 ACTCAAAAAAGAAGAAT  0 1211 741122 N/A N/A 38916 38932 GTTTTCTCTGTATTGGC 87 1212 741123 N/A N/A 39141 39157 TGGCCTAGTGGTTATAA  0 1213 741124 N/A N/A 39366 39382 CACAAAGAGGAAACAGG 27 1214 741125 N/A N/A 39591 39607 ACATTTTTTAACTGGAT 76 1215 741126 N/A N/A 39816 39832 AGGCTAAATTTTAATAA  0 1216 741127 N/A N/A 40041 40057 TAGCCTTTCATAGTACG 38 1217 741128 N/A N/A 40266 40282 AAGAGGAAAAGCTTGGA  0 1218 741129 N/A N/A 40491 40507 AAAAATTCTGGTGCCAA 57 1219 741130 N/A N/A 40716 40732 AAGCTAAACTACCGCTG  2 1220 741131 N/A N/A 40941 40957 GAATTTCCTGGATGCTC 44 1221 741132 N/A N/A 41130 41146 AGATTCCAGCAGAGATT 20 1222 741133 N/A N/A 41132 41148 ACAGATTCCAGCAGAGA 44 1223 741134 N/A N/A 41133 41149 AACAGATTCCAGCAGAG 40   90 741135 N/A N/A 41134 41150 GAACAGATTCCAGCAGA 24 1224 741136 N/A N/A 41136 41152 GTGAACAGATTCCAGCA 34 1225 741137 N/A N/A 41166 41182 ATCTGTAAGAAGTTTAG 10 1226 741138 N/A N/A 41391 41407 TGAGAAATTTTATGGGT 47 1227 741139 N/A N/A 41620 41636 TCATTCAAAACCATCCT 21 1228 741140 N/A N/A 41845 41861 GATCACACTGCTTATAG 16 1229 741141 N/A N/A 42070 42086 CAAGTTGATGGCATATA 34 1230 741142 N/A N/A 42295 42311 GTGTACCAACCTCAAGT 34 1231 741143 N/A N/A 42532 42548 TAAGTAAATACCTAGGG 20 1232 741144 N/A N/A 42757 42773 GATTTGTGCCTGGCATC 38 1233 741145 N/A N/A 42835 42851 TGCCTCTACCTCCAGCA 39 1234 741146 N/A N/A 42837 42853 GATGCCTCTACCTCCAG 42 1235 741147 N/A N/A 42838 42854 TGATGCCTCTACCTCCA 40  166 741148 N/A N/A 42839 42855 CTGATGCCTCTACCTCC 33 1236 741149 N/A N/A 42982 42998 TATCACAACTACATTGT  0 1237 741150 N/A N/A 43208 43224 GGCCTCCTGCTGCAGCA  0 1238 741151 N/A N/A 43440 43456 GCACTCATTTTAAATGT 20 1239 741152 N/A N/A 43665 43681 TGGTAACTTAGGACAAG 44 1240 741153 N/A N/A 43818 43834 TTCTCTGGACCTCTTAA  6 1241 741154 N/A N/A 43820 43836 ACTTCTCTGGACCTCTT 41 1242 741155 N/A N/A 43821 43837 TACTTCTCTGGACCTCT 49  242 741156 N/A N/A 43822 43838 TTACTTCTCTGGACCTC 44 1243 741157 N/A N/A 43890 43906 TCAATACAACTTAATTC  0 1244 741158 N/A N/A 44376 44392 TTGGGCTGGAAGCAGTG  9 1245 741159 N/A N/A 44601 44617 AAGATATGCAGAGGGTT 49 1246 741160 N/A N/A 44828 44844 TGGTCTAACTGTGTTGC 40 1247 741161 N/A N/A 45053 45069 GTTTATGGACTTTTTAA 29 1248 741162 N/A N/A 45278 45294 TTTTGTACTTTATGGAA 40 1249 741163 N/A N/A 45503 45519 ACTTCTCCTTCAATTAA 11 1250

(389) TABLE-US-00026 TABLE 26 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 64   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 82  591 741164 N/A N/A 45728 45744 GTCAAAATATTCTTACT 30 1564 741165 N/A N/A 45953 45969 CACATAAAATTAAAGCT  2 1565 741166 N/A N/A 46157 46173 TCCATGAAGCCAAGTAA 38 1566 741167 N/A N/A 46159 46175 TTTCCATGAAGCCAAGT 74 1567 741168 N/A N/A 53645 53661 ATTTCCATGAAGCCAAG 67  317 N/A N/A 46160 46176 741169 N/A N/A 46161 46177 GATTTCCATGAAGCCAA 84 1568 741170 N/A N/A 46163 46179 GAGATTTCCATGAAGCC 87 1569 741171 N/A N/A 46178 46194 GGAATTGGAGTGAGAGA 29 1570 741172 N/A N/A 46403 46419 ATCCCTACATACTCACA 20 1571 741173 N/A N/A 46628 46644 TTCTACCACCCACAGCT  0 1572 741174 N/A N/A 46880 46896 GAAAACATTGTATTATT 39 1573 741175 N/A N/A 47105 47121 CCTTAAAATGATGCCTG 43 1574 741176 N/A N/A 47330 47346 CTAAAGTTAAGGTGTCG 25 1575 741177 N/A N/A 47557 47573 GCATGAATTACTTTACG 40 1576 741178 N/A N/A 47952 47968 GGTTGTTCAAGTGATTC 58 1577 741179 N/A N/A 48177 48193 GATCTTTTCATCATGCC 75 1578 741180 N/A N/A 48225 48241 GGTCATGACTCTGACAC 14 1579 741181 N/A N/A 48227 48243 CTGGTCATGACTCTGAC 34 1580 741182 N/A N/A 48228 48244 CCTGGTCATGACTCTGA 39  394 741183 N/A N/A 48229 48245 CCCTGGTCATGACTCTG 46 1581 741184 N/A N/A 48231 48247 TCCCCTGGTCATGACTC 35 1582 741185 N/A N/A 48402 48418 AGGGCCATCCTGTTCAA  9 1583 741186 N/A N/A 48648 48664 AGAATACTTATTTTTTG 14 1584 741187 N/A N/A 48713 48729 ATTTTGGATGCTTCTGA 56 1585 741188 N/A N/A 48715 48731 GTATTTTGGATGCTTCT 70 1586 741189 N/A N/A 48716 48732 TGTATTTTGGATGCTTC 80  471 741190 N/A N/A 48717 48733 TTGTATTTTGGATGCTT 78 1587 741191 N/A N/A 48719 48735 GTTTGTATTTTGGATGC 69 1588 741192 N/A N/A 48873 48889 TTTAAAGATGGATATTG  0 1589 741193 N/A N/A 49111 49127 TAAGGTCCCTCCCTCAA  0 1590 741194 N/A N/A 49373 49389 TTACCTGGCTACCTTTT 31 1591 741195 N/A N/A 49480 49496 TGAAATTTTCCAGCTAT 60 1592 741196 N/A N/A 80992 81008 TTGAAATTTTCCAGCTA 37  167 N/A N/A 49481 49497 741197 N/A N/A 49482 49498 ATTGAAATTTTCCAGCT 60 1593 741198 N/A N/A 49484 49500 TGATTGAAATTTTCCAG 33 1594 741199 N/A N/A 49598 49614 TGGGAATCACCTCCCCT 14 1595 741200 N/A N/A 49825 49841 CATTGAATTAATTTGTT 30 1596 741201 N/A N/A 50050 50066 CACCATTTTATAGCATG 64 1597 741202 N/A N/A 50275 50291 TGGAAAGAGGTATGAGT  0 1598 741203 N/A N/A 50500 50516 ATTAAAATGAGAGGTCC 18 1599 741204 N/A N/A 50725 50741 TTCCACCACACAAGTTA 43 1600 741205 N/A N/A 50920 50936 TTCATCAATATCTGCAA 66 1601 741206 N/A N/A 50921 50937 TTTCATCAATATCTGCA 85  243 741207 N/A N/A 50922 50938 TTTTCATCAATATCTGC 86 1602 741208 N/A N/A 50924 50940 GGTTTTCATCAATATCT 76 1603 741209 N/A N/A 50950 50966 CTTTGATGAATTAAGAG 22 1604 741210 N/A N/A 51175 51191 AGGTATAAGATTCCTGC 31 1605 741211 N/A N/A 51412 51428 ACAAGGCCTTACTTACG  9 1606 741212 N/A N/A 51637 51653 CTGCCCAACTTACAATT  9 1607 741213 N/A N/A 51868 51884 CATGGCAAGAACAAGGG 27 1608 741214 N/A N/A 52093 52109 TATTATGTGCTTATTGG 56 1609 741215 N/A N/A 52318 52334 CCTAACACATGGATGTA  5 1610 741216 N/A N/A 52417 52433 CAAATGTATAGAGAAGT 15 1611 741217 N/A N/A 52419 52435 ATCAAATGTATAGAGAA 41 1612 741218 N/A N/A 52420 52436 GATCAAATGTATAGAGA 36  395 741219 N/A N/A 52421 52437 AGATCAAATGTATAGAG 31 1613 741220 N/A N/A 52423 52439 ACAGATCAAATGTATAG 55 1614 741221 N/A N/A 52543 52559 CTCTACTGTGTTTGAGC 14 1615 741222 N/A N/A 52768 52784 CTATATACTACAATTTT  7 1616 741223 N/A N/A 52993 53009 TGAGCTCACTGACAGAA 13 1617 741224 N/A N/A 53239 53255 CAAGTATAAATATGTTT 10 1618 741225 N/A N/A 53464 53480 CCAAGGAGCATTTGGAT  7 1619 741226 N/A N/A 53642 53658 TCCATGAAGCCAAGATC 52 1620 741227 N/A N/A 53644 53660 TTTCCATGAAGCCAAGA 65 1621 741228 N/A N/A 53646 53662 TATTTCCATGAAGCCAA 79 1622 741229 N/A N/A 53648 53664 ATTATTTCCATGAAGCC 81 1623 741230 N/A N/A 53689 53705 ATCCATAAATGCTTTGT 68 1624 741231 N/A N/A 53914 53930 TATCTTCATCATAGCTC 60 1625 741232 N/A N/A 54139 54155 AGACCACACTCCAACTA 20 1626 741233 N/A N/A 54364 54380 ATGTAAGGATGATCATT 32 1627 741234 N/A N/A 54589 54605 TGACTTTATATGCATTT 54 1628 741235 N/A N/A 54814 54830 CATATATACTTACTTAC  2 1629 741236 N/A N/A 55039 55055 ATATGTTTGATCGAAAG 20 1630 741237 N/A N/A 55269 55285 CAGATGGTTTTTTCTTT 31 1631 741238 N/A N/A 55494 55510 ACAAAAGGGATTGTTCT  8 1632 741239 N/A N/A 55719 55735 ACTTGACTATAACACTT 40 1633 741240 N/A N/A 56172 56188 ATAGAAAACAGATGAAG  2 1634

(390) TABLE-US-00027 TABLE 27 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 57   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 87  591 741241 N/A N/A 56397 56413 AAAATTTTTGCACACTT 46 1251 741242 N/A N/A 56622 56638 GCCAAATCAATGGATGA 33 1252 741243 N/A N/A 56847 56863 AGTGACCAAGAGAATGA  4 1253 741244 N/A N/A 57072 57088 TTTTAAAACACTGGCCT  0 1254 741245 N/A N/A 57297 57313 TAGGATTAAACAGTCCA  0 1255 741246 N/A N/A 57522 57538 TTATCTGTTGCTATGTG 51 1256 741247 N/A N/A 57747 57763 AAGAAGGAGAATAGCAG 14 1257 741248 N/A N/A 57981 57997 CGGGCAAACATGTTTTG  8 1258 741249 N/A N/A 58206 58222 ATGACCTACATGCTAAA 11 1259 741250 N/A N/A 58431 58447 AGAAGCAAAATGTCAGT 40 1260 741251 N/A N/A 58656 58672 CCTAACAGCTTTACTTT  0 1261 741252 N/A N/A 58881 58897 CTTTCACACATCTCTAA  0 1262 741253 N/A N/A 58991 59007 TTTCATTAATCTGTGAA 14 1263 741254 N/A N/A 58992 59008 ATTTCATTAATCTGTGA 20  169 741255 N/A N/A 58993 59009 TATTTCATTAATCTGTG 39 1264 741256 N/A N/A 58995 59011 TATATTTCATTAATCTG 27 1265 741257 N/A N/A 59106 59122 CCTTACACAAAATATAA  0 1266 741258 N/A N/A 59354 59370 ACACCAATATATTATTT 13 1267 741259 N/A N/A 59594 59610 TAAAGGATGCAAAGGCA  0 1268 741260 N/A N/A 59948 59964 TTCCAGCGATCCCACTC 21 1269 741261 N/A N/A 60173 60189 CTCAACATCTTTAATGA  6 1270 741262 N/A N/A 60421 60437 GGGACCTAAAACTATAA  0 1271 741263 N/A N/A 60758 60774 AGCAGAATAGAAAATCC 14 1272 741264 N/A N/A 60983 60999 TTCAATGCGACTCCCAT 23 1273 741265 N/A N/A 61216 61232 CAACAAAACTGAGAATC  0 1274 741266 N/A N/A 61474 61490 AATGCCTGCTTTCACCA 26 1275 741267 N/A N/A 61699 61715 TATAAGCAGGAGTAAAA  2 1276 741268 N/A N/A 61969 61985 GTTCCAAAAGATAGAGA 11 1277 741269 N/A N/A 62200 62216 CGTACACAAACTAGAAA  1 1278 741270 N/A N/A 62492 62508 TACTGTTGCATTCCAGC  6 1279 741271 N/A N/A 62729 62745 TCTTAGTGTGGTGGCTC 15 1280 741272 N/A N/A 62955 62971 TCAACAATAATAATGAC  0 1281 741273 N/A N/A 63197 63213 CCTTTTCATCAACACAT 12 1282 741274 N/A N/A 63422 63438 TATGCATCTAACACTTG  8 1283 741275 N/A N/A 63666 63682 CCATCAACCAAGTATCT  0 1284 741276 N/A N/A 63891 63907 CTTGAAACAGTAACTTG  0 1285 741277 N/A N/A 64116 64132 AACATAGCAGATTAATA 12 1286 741278 N/A N/A 64349 64365 TCATGTTATATAGTGGG 73 1287 741279 N/A N/A 64574 64590 TGTAACCTAATGTAAAT  0 1288 741280 N/A N/A 64799 64815 ACAAGTATCTGTACTCA 59 1289 741281 N/A N/A 65024 65040 GTCTCTGTTAATGTTGG 26 1290 741282 N/A N/A 65249 65265 GAACCAGCCTGACTTAA 21 1291 741283 N/A N/A 65474 65490 TTGTATGGGTTACATAA  3 1292 741284 N/A N/A 65801 65817 CAATTAAATGCAATTCC  0 1293 741285 N/A N/A 66026 66042 TGACAGAAGTGTGCATA 14 1294 741286 N/A N/A 66251 66267 CAACACATCCACATTGC  8 1295 741287 N/A N/A 66476 66492 TTCACACCTCTCTCCCT  0 1296 741288 N/A N/A 66701 66717 TGCTGGTCTAAGATGCA 24 1297 741289 N/A N/A 66926 66942 ATGTGTTTTGAGGAAAA 13 1298 741290 N/A N/A 67151 67167 CAGAAGTAAATGTGGAC 24 1299 741291 N/A N/A 67376 67392 TGATTCTTTGGATTCAT 27 1300 741292 N/A N/A 67876 67892 CATTCTTGTTTTTATTC 37 1301 741293 N/A N/A 68101 68117 AATAGTGTCCCAGTGTA 40 1302 741294 N/A N/A 68326 68342 TGAAAGCTGTTCAGTTA 12 1303 741295 N/A N/A 68551 68567 CCCACATATACTACTTG 32 1304 741296 N/A N/A 68776 68792 AGAATTTCAGGAAGTTA 33 1305 741297 N/A N/A 68798 68814 CAAAGTAAGAGGAGATT 13 1306 741298 N/A N/A 68800 68816 GCCAAAGTAAGAGGAGA 37 1307 741299 N/A N/A 68801 68817 TGCCAAAGTAAGAGGAG 11  397 741300 N/A N/A 68804 68820 CAGTGCCAAAGTAAGAG  0 1308 741301 N/A N/A 69001 69017 TGAATCCATTTGTCCAG 52 1309 741302 N/A N/A 69227 69243 CTCTAAAATACAAATGT 13 1310 741303 N/A N/A 69452 69468 GAACAAAGGAATAAGTA  0 1311 741304 N/A N/A 69677 69693 CTAGATGTAGATATCAT 13 1312 741305 N/A N/A 69902 69918 AAGGGAATAAATTGTAG 28 1313 741306 N/A N/A 70127 70143 CAACAGACCCTTTCAAT  3 1314 741307 N/A N/A 70352 70368 GTCTTCCCACTGCCTAC  7 1315 741308 N/A N/A 70577 70593 TTTAGATATACCTCCAA 37 1316 741309 N/A N/A 70880 70896 GCTTCAGTTTCTTGAGT 18 1317 741310 N/A N/A 71105 71121 CTGGTCTTTCTCACAAT  8 1318 741311 N/A N/A 71375 71391 ATCATTCTTAACAGAAA 15 1319 741312 N/A N/A 71600 71616 GCTCTTGCTGTGCAGCC 11 1320 741313 N/A N/A 71844 71860 ATTTAAAGCAGCAGTCC  4 1321 741314 N/A N/A 72076 72092 AGGTAATTCTAATTTTA 17 1322 741315 N/A N/A 72301 72317 GGCAAATGACAGGGTCT 69 1323 741316 N/A N/A 72632 72648 TCTCAACTGCCTGAGTA  0 1324 741317 N/A N/A 72857 72873 CATGTCAGCTTTTTAGT 19 1325

(391) TABLE-US-00028 TABLE 28 Percent reduction of human SNCA mRNA with 4-9-4 MOE and cEt gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 57   33 740432 270 286  4721  4737 AGTCCTTTCATGAATAC 85  591 741318 N/A N/A 73090 73106 ATACTCAGATATTTAAA  0 1326 741319 N/A N/A 73188 73204 ACTTTCTGTGTGGTATG 42 1327 741320 N/A N/A 73190 73206 AGACTTTCTGTGTGGTA 59 1328 741321 N/A N/A 73191 73207 CAGACTTTCTGTGTGGT 83  170 741322 N/A N/A 73192 73208 ACAGACTTTCTGTGTGG 37 1329 741323 N/A N/A 73194 73210 AGACAGACTTTCTGTGT  0 1330 741324 N/A N/A 73315 73331 GTTGAGAATTTTTCATT 14 1331 741325 N/A N/A 73540 73556 AGTTATGGAGCATCTTT 46 1332 741326 N/A N/A 73765 73781 GACTGAGTTTTTTATTC 16 1333 741327 N/A N/A 73990 74006 TCCTGAATTAAAAATTT  0 1334 741328 N/A N/A 74215 74231 GCTAAGCACAAACAATT 15 1335 741329 N/A N/A 74292 74308 GAACTCTGTAGTCAGAA 58 1336 741330 N/A N/A 74294 74310 TAGAACTCTGTAGTCAG 63 1337 741331 N/A N/A 74295 74311 ATAGAACTCTGTAGTCA 42  398 741332 N/A N/A 74296 74312 AATAGAACTCTGTAGTC 42 1338 741333 N/A N/A 74298 74314 TGAATAGAACTCTGTAG 25 1339 741334 N/A N/A 74440 74456 ACACAGAGCACTTCTTA 15 1340 741335 N/A N/A 74665 74681 GGAGTTACAGAGTTGCC 64 1341 741336 N/A N/A 74890 74906 TATCAGTCTATTAAGAA 11 1342 741337 N/A N/A 75115 75131 AAGTTTCTCAGAGCCTG 24 1343 741338 N/A N/A 75340 75356 AATACAGAAGTCTATTC  0 1344 741339 N/A N/A 75573 75589 CATTGAATAAAAATTTG  0 1345 741340 N/A N/A 75945 75961 CAGGTATAAAATTTTTT  2 1346 741341 N/A N/A 76170 76186 GGTGTTAATCACTTGAA 18 1347 741342 N/A N/A 76398 76414 TCTTGAAGCTAGTTGGG 39 1348 741343 N/A N/A 76623 76639 AGGGCAACTAACCAACA 20 1349 741344 N/A N/A 76848 76864 GTGGATACTTAGTATCA 13 1350 741345 N/A N/A 77073 77089 CTCTCTCAGTTGTAGGT 19 1351 741346 N/A N/A 77298 77314 AAAGTATGCTGTGTTCT 46 1352 741347 N/A N/A 77523 77539 GTACCCGGCACTTTTCC 15 1353 741348 N/A N/A 77663 77679 TCTAGAAAAGCTCTCTT  0 1354 741349 N/A N/A 77665 77681 ACTCTAGAAAAGCTCTC 13 1355 741350 N/A N/A 77666 77682 GACTCTAGAAAAGCTCT 36  247 741351 N/A N/A 77667 77683 AGACTCTAGAAAAGCTC 26 1356 741352 N/A N/A 77748 77764 TGGCACCCAGGAGTAAG  8 1357 741353 N/A N/A 77973 77989 CATACACAAAATCCCCT 28 1358 741354 N/A N/A 78198 78214 CACATGAAGCCAGGGAC 19 1359 741355 N/A N/A 78423 78439 GCAGGCCCTAAACTGTG  5 1360 741356 N/A N/A 78648 78664 AAATTTATCTATCATGC 30 1361 741357 N/A N/A 78873 78889 GCTAAACACTTTATCAA 22 1362 741358 N/A N/A 79098 79114 ACTTCATTCTTTCTGTT 30 1363 741359 N/A N/A 79323 79339 CAATTAAAAGATTACTT  0 1364 741360 N/A N/A 79548 79564 ACATTGTACAGTTAATT  9 1365 741361 N/A N/A 79773 79789 TACAAACCTTACTATGC  9 1366 741362 N/A N/A 79998 80014 AACAGACTTAAACAAAC 40 1367 741363 N/A N/A 80223 80239 CTCAGACATCATGTTTT 52 1368 741364 N/A N/A 80448 80464 AGGCACTCACAAACATT 33 1369 741365 N/A N/A 80673 80689 TCTCGCATCCTAAATGT  0 1370 741366 N/A N/A 80898 80914 TTCATATTTTATGTTAC 23 1371 741367 N/A N/A 80991 81007 TGAAATTTTCCAGCTAA 52 1372 741368 N/A N/A 80993 81009 CTTGAAATTTTCCAGCT 72 1373 741369 N/A N/A 80995 81011 ATCTTGAAATTTTCCAG 33 1374 741370 N/A N/A 81123 81139 CTATAATTACATTCCTA  9 1375 741371 N/A N/A 81348 81364 GCATGAACCTAGATATG  4 1376 741372 N/A N/A 81472 81488 GCTGTTTGAAGTGACAA 21 1377 741373 N/A N/A 81474 81490 GAGCTGTTTGAAGTGAC 54 1378 741374 N/A N/A 81475 81491 AGAGCTGTTTGAAGTGA 52  249 741375 N/A N/A 81476 81492 GAGAGCTGTTTGAAGTG 22 1379 741376 N/A N/A 81478 81494 TGGAGAGCTGTTTGAAG 12 1380 741377 N/A N/A 81575 81591 CTGCCACTATTCACAAT 27 1381 741378 N/A N/A 81800 81816 TTATTGCATTAATGGAA 76 1382 741379 N/A N/A 82107 82123 ATGGTGTTAGCTAGGAT 84 1383 741380 N/A N/A 82332 82348 GTCTTTTTACATTATAA 31 1384 741381 N/A N/A 82557 82573 ATAACCACTATTCAATG  2 1385 741382 N/A N/A 82783 82799 AAAAATCACATTTGGCA 48 1386 741383 N/A N/A 83008 83024 TTCTTTCACCTTATGAG 21 1387 741384 N/A N/A 83233 83249 ATATATGTGTCAGTTCT 22 1388 741385 N/A N/A 83458 83474 GTGTCACTTTTTAAGGT 18 1389 741386 N/A N/A 83528 83544 AGAACAATGTCATCTTT 43 1390 741387 N/A N/A 83530 83546 AAAGAACAATGTCATCT 42 1391 741388 N/A N/A 83531 83547 GAAAGAACAATGTCATC 25   98 741389 N/A N/A 83532 83548 GGAAAGAACAATGTCAT 27 1392 741390 N/A N/A 83534 83550 CAGGAAAGAACAATGTC 47 1393 741391 N/A N/A 83683 83699 CACAGGTATACACACTT 42 1394 741392 N/A N/A 83908 83924 GTACAAAATCTGCATAT  3 1395 741393 N/A N/A 84133 84149 ATAGGTATTTTATGCAT 58 1396 741394 N/A N/A 84616 84632 CAAATTATGCATTTGTT  0 1397

Example 5: Effect of 5-10-5 MOE Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

(392) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

(393) Cultured SH-SY5Y cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM concentration of modified oligonucleotide or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR using human primer probe set RTS2621 as described in Example 1. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control cells.

(394) The modified oligonucleotides in tables 29-44 are 5-10-5 MOE gapmers. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end, each comprising five 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-deoxyribose sugar and ‘e’ represents a 2′-MOE modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssssooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(395) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 1 or SEQ ID NO:2, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(396) TABLE-US-00029 TABLE 29 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 693413 19 38 4687 4706 AATTCCTTTACACCACACTG 53 28 693416 39 58 4707 4726 GAATACATCCATGGCTAATG 38 29 740410 240 256 4691 4707 GAATTCCTTTACACCAC 72 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 64 402 762833 233 252 N/A N/A TCCTTTACACCACACTGTCG 50 1635 762834 234 253 N/A N/A TTCCTTTACACCACACTGTC 49 1636 762835 235 254 N/A N/A ATTCCTTTACACCACACTGT 39 1637 762836 237 256 4688 4707 GAATTCCTTTACACCACACT 50 1638 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 45 1639 762838 239 258 4690 4709 ATGAATTCCTTTACACCACA 47 1640 762839 240 259 4691 4710 AATGAATTCCTTTACACCAC 51 1641 762840 241 260 4692 4711 TAATGAATTCCTTTACACCA 41 1642 762841 242 261 4693 4712 CTAATGAATTCCTTTACACC 44 1643 762842 243 262 4694 4713 GCTAATGAATTCCTTTACAC 51 1644 762843 244 263 4695 4714 GGCTAATGAATTCCTTTACA 50 1645 762844 252 271 4703 4722 ACATCCATGGCTAATGAATT 45 1646 762845 253 272 4704 4723 TACATCCATGGCTAATGAAT 32 1647 762846 254 273 4705 4724 ATACATCCATGGCTAATGAA 34 1648 762847 255 274 4706 4725 AATACATCCATGGCTAATGA 32 1649 762848 257 276 4708 4727 TGAATACATCCATGGCTAAT 47 1650 762849 258 277 4709 4728 ATGAATACATCCATGGCTAA 43 1651 762850 259 278 4710 4729 CATGAATACATCCATGGCTA 41 1652 762851 260 279 4711 4730 TCATGAATACATCCATGGCT 61 1653 762852 261 280 4712 4731 TTCATGAATACATCCATGGC 48 1654 762853 262 281 4713 4732 TTTCATGAATACATCCATGG 42 1655 762854 263 282 4714 4733 CTTTCATGAATACATCCATG 56 1656 762855 265 284 4716 4735 TCCTTTCATGAATACATCCA 61 1657 762856 49 68 4717 4736 GTCCTTTCATGAATACATCC 52 1658 762857 267 286 4718 4737 AGTCCTTTCATGAATACATC 38 1659 762858 268 287 4719 4738 AAGTCCTTTCATGAATACAT 60 1660 762859 269 288 4720 4739 AAAGTCCTTTCATGAATACA 51 1661 762860 270 289 4721 4740 GAAAGTCCTTTCATGAATAC 55 1662 762861 271 290 4722 4741 TGAAAGTCCTTTCATGAATA 44 1663 762862 272 291 4723 4742 TTGAAAGTCCTTTCATGAAT 34 1664 762863 56 75 4724 4743 TTTGAAAGTCCTTTCATGAA 28 1665 762864 432 451 17999 18018 ACTTGCTCTTTGGTCTTCTC 36 1666 762865 433 452 18000 18019 CACTTGCTCTTTGGTCTTCT 36 1667 762866 434 453 18001 18020 TCACTTGCTCTTTGGTCTTC 40 1668 762867 435 454 18002 18021 GTCACTTGCTCTTTGGTCTT 50 1669 762868 436 455 18003 18022 TGTCACTTGCTCTTTGGTCT 45 1670 762869 437 456 18004 18023 TTGTCACTTGCTCTTTGGTC 36 1671 762870 438 457 18005 18024 TTTGTCACTTGCTCTTTGGT 28 1672 762871 439 458 18006 18025 ATTTGTCACTTGCTCTTTGG 34 1673 762872 440 459 18007 18026 CATTTGTCACTTGCTCTTTG 41 1674 762873 441 460 18008 18027 ACATTTGTCACTTGCTCTTT 7 1675 762874 442 461 18009 18028 AACATTTGTCACTTGCTCTT 22 1676 762875 N/A N/A 4681 4700 TTTACACCACACTGGAAAAC 13 1677 762876 N/A N/A 4682 4701 CTTTACACCACACTGGAAAA 22 1678 762877 N/A N/A 4683 4702 CCTTTACACCACACTGGAAA 44 1679 762878 N/A N/A 4684 4703 TCCTTTACACCACACTGGAA 44 1680 762879 N/A N/A 4685 4704 TTCCTTTACACCACACTGGA 45 1681 762880 N/A N/A 4686 4705 ATTCCTTTACACCACACTGG 59 1682 762881 N/A N/A 18150 18169 TATAAATGTAACACAAAACG 0 1683 762882 N/A N/A 18255 18274 GTAGCACTTTTTCACAAGGG 67 1684 762883 N/A N/A 18349 18368 CTTTCTTCCAGAAATTGAAA 49 1685 762884 N/A N/A 18442 18461 AAATTCCAAGACTTACAATT 28 1686 762885 N/A N/A 18535 18554 AGAGATGATGTCACTATAAA 50 1687 762886 N/A N/A 18628 18647 TCTCTGGTTGGTATGTATTT 62 1688 762887 N/A N/A 18721 18740 TATCTTTGGTATAATCTTAT 41 1689 762888 N/A N/A 18814 18833 TTATTTTGCTGTTGTAGTGG 35 1690 762889 N/A N/A 18907 18926 GGCAGGCCTCCCCAAGAACG 35 1691 762890 N/A N/A 19176 19195 GGCAAAGAAAGGAAAAAGAA 5 1692 762891 N/A N/A 19269 19288 ATGGTGCCTACATTCTAGAA 69 1693 762892 N/A N/A 19368 19387 CTTAATTTAATAAATGTTTG 7 1694 762893 N/A N/A 19461 19480 TTGGATAGCTGAATAGCACT 58 1695 762894 N/A N/A 19556 19575 TGAAGTGGAAACAACCCAGA 46 1696 762895 N/A N/A 19627 19646 ATTTTTGTTCTGCCTTTTTA 39 1697 762896 N/A N/A 19628 19647 TATTTTTGTTCTGCCTTTTT 49 1698 762897 N/A N/A 19629 19648 ATATTTTTGTTCTGCCTTTT 34 1699 762898 N/A N/A 19630 19649 GATATTTTTGTTCTGCCTTT 57 1700 762899 N/A N/A 19631 19650 AGATATTTTTGTTCTGCCTT 60 1701 762900 N/A N/A 19632 19651 CAGATATTTTTGTTCTGCCT 74 1702 762901 N/A N/A 19633 19652 ACAGATATTTTTGTTCTGCC 70 1703 762902 N/A N/A 19634 19653 CACAGATATTTTTGTTCTGC 48 1704 762903 N/A N/A 19635 19654 TCACAGATATTTTTGTTCTG 58 1705 762904 N/A N/A 19636 19655 ATCACAGATATTTTTGTTCT 55 1706 762905 N/A N/A 19637 19656 TATCACAGATATTTTTGTTC 56 1707 762906 N/A N/A 19649 19668 TAAATCTAAATATATCACAG 15 1708 762907 N/A N/A 19742 19761 AACATTAGCTGAAGAACTTC 36 1709 762908 N/A N/A 19835 19854 AACCAGGAATTAATATAATT 33 1710

(397) TABLE-US-00030 TABLE 30 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 60 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 72 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 49 1639 762909 N/A N/A 19928 19947 CTGATTAATTGCCTGTGTAC 48 1711 762910 N/A N/A 20026 20045 ATTAAGCTCTTTGATGTGCG 65 1712 762911 N/A N/A 20119 20138 TCTTGGACTACCCACTTCCT 45 1713 762912 N/A N/A 20212 20231 AAGGAAGGTAAGTTTTGAGG 0 1714 762913 N/A N/A 20305 20324 AGACGGTACATGTTTCCCTG 47 1715 762914 N/A N/A 20332 20351 TGTATGCCTTAAATGCAGGT 69 1716 762915 N/A N/A 20398 20417 TGGGTGGAAAGCAAACCCAG 16 1717 762916 N/A N/A 20491 20510 CTACCTATAAGGGAAATATC 20 1718 762917 N/A N/A 20584 20603 TCACTCTCAGTCCAATGTTT 55 1719 762918 N/A N/A 20677 20696 GAGCTTCCTCATTTTATGAG 41 1720 762919 N/A N/A 20770 20789 ACCACAATTGCAGACATTTA 41 1721 762920 N/A N/A 20871 20890 TCAAAGTTTAAAAAATGAAA 6 1722 762921 N/A N/A 20964 20983 TCTTGAATGATGAATGAGTG 59 1723 762922 N/A N/A 20979 20998 TGAGCAAACATTCTTTCTTG 59 1724 762923 N/A N/A 20980 20999 GTGAGCAAACATTCTTTCTT 62 1725 762924 N/A N/A 20981 21000 TGTGAGCAAACATTCTTTCT 74 1726 762925 N/A N/A 20982 21001 GTGTGAGCAAACATTCTTTC 52 1727 762926 N/A N/A 20983 21002 AGTGTGAGCAAACATTCTTT 75 1728 762927 N/A N/A 20984 21003 CAGTGTGAGCAAACATTCTT 50 1729 762928 N/A N/A 20985 21004 ACAGTGTGAGCAAACATTCT 57 1730 762929 N/A N/A 20986 21005 CACAGTGTGAGCAAACATTC 63 1731 762929 N/A N/A 27411 27430 CACAGTGTGAGCAAACATTC 63 1731 762930 N/A N/A 20987 21006 GCACAGTGTGAGCAAACATT 75 1732 762931 N/A N/A 20988 21007 GGCACAGTGTGAGCAAACAT 51 1733 762932 N/A N/A 20989 21008 TGGCACAGTGTGAGCAAACA 72 1734 762933 N/A N/A 20993 21012 TTTCTGGCACAGTGTGAGCA 43 1735 762934 N/A N/A 20994 21013 GTTTCTGGCACAGTGTGAGC 59 1736 762935 N/A N/A 20995 21014 AGTTTCTGGCACAGTGTGAG 53 1737 762936 N/A N/A 20996 21015 AAGTTTCTGGCACAGTGTGA 44 1738 762937 N/A N/A 20997 21016 CAAGTTTCTGGCACAGTGTG 50 1739 762938 N/A N/A 20998 21017 CCAAGTTTCTGGCACAGTGT 42 1740 762939 N/A N/A 20999 21018 TCCAAGTTTCTGGCACAGTG 51 1741 762940 N/A N/A 21000 21019 CTCCAAGTTTCTGGCACAGT 40 1742 762941 N/A N/A 21001 21020 CCTCCAAGTTTCTGGCACAG 51 1743 762942 N/A N/A 21002 21021 TCCTCCAAGTTTCTGGCACA 57 1744 762943 N/A N/A 21003 21022 TTCCTCCAAGTTTCTGGCAC 32 1745 762944 N/A N/A 21057 21076 ATTAATCCACTTCTACAAGC 30 1746 762945 N/A N/A 21150 21169 GAGGGTGATGGACCAGATAC 51 1747 762946 N/A N/A 21218 21237 CAGAATTATGTCATTTAATT 40 1748 762947 N/A N/A 21219 21238 TCAGAATTATGTCATTTAAT 58 1749 762948 N/A N/A 21220 21239 TTCAGAATTATGTCATTTAA 59 1750 762949 N/A N/A 21221 21240 GTTCAGAATTATGTCATTTA 56 1751 762950 N/A N/A 21222 21241 TGTTCAGAATTATGTCATTT 66 1752 762951 N/A N/A 21223 21242 TTGTTCAGAATTATGTCATT 61 1753 762952 N/A N/A 21224 21243 GTTGTTCAGAATTATGTCAT 68 1754 762953 N/A N/A 21225 21244 GGTTGTTCAGAATTATGTCA 75 1755 762954 N/A N/A 21226 21245 TGGTTGTTCAGAATTATGTC 51 1756 762955 N/A N/A 21227 21246 TTGGTTGTTCAGAATTATGT 67 1757 762956 N/A N/A 21228 21247 ATTGGTTGTTCAGAATTATG 57 1758 762957 N/A N/A 21243 21262 ATTTACTCTCGATTTATTGG 65 1759 762958 N/A N/A 21336 21355 TCATTTGTCCTTTAACTAGT 55 1760 762959 N/A N/A 21429 21448 TAAAAATATGGATCAAAAGA 0 1761 762960 N/A N/A 21522 21541 TGTGCACTTTTAACCTGTTT 69 1762 762961 N/A N/A 21616 21635 TTAGAACAAGCAGATCTTTC 63 1763 762962 N/A N/A 21709 21728 ATAGACCAAGTGTTCTAGTG 68 1764 762963 N/A N/A 21802 21821 GAGCATTCCATGTGGCATGA 62 1765 762964 N/A N/A 21895 21914 CAGGCAGTGGCTTCACAGTT 40 1766 762965 N/A N/A 21993 22012 TTTCAAGCTTATTTCTTGCG 69 1767 762966 N/A N/A 22086 22105 AAATGGCATTGCTTAGGAAC 39 1768 762967 N/A N/A 22179 22198 AAGTCAGGATTATTACAGAA 51 1769 762968 N/A N/A 22273 22292 GATATTATATTCACAATGTC 34 1770 762969 N/A N/A 22366 22385 GGTCCATAACACTCAAGTGT 79 1771 762970 N/A N/A 22448 22467 GACCTGTGCTTGTTTGTGAA 60 1772 762971 N/A N/A 22449 22468 TGACCTGTGCTTGTTTGTGA 58 1773 762972 N/A N/A 22450 22469 GTGACCTGTGCTTGTTTGTG 56 1774 762973 N/A N/A 22451 22470 TGTGACCTGTGCTTGTTTGT 48 1775 762974 N/A N/A 22452 22471 CTGTGACCTGTGCTTGTTTG 61 1776 762975 N/A N/A 22453 22472 CCTGTGACCTGTGCTTGTTT 47 1777 762976 N/A N/A 22454 22473 GCCTGTGACCTGTGCTTGTT 50 1778 762977 N/A N/A 22455 22474 TGCCTGTGACCTGTGCTTGT 54 1779 762978 N/A N/A 22456 22475 TTGCCTGTGACCTGTGCTTG 59 1780 762979 N/A N/A 22457 22476 GTTGCCTGTGACCTGTGCTT 68 1781 762980 N/A N/A 22458 22477 TGTTGCCTGTGACCTGTGCT 54 1782 762981 N/A N/A 22459 22478 ATGTTGCCTGTGACCTGTGC 40 1783 762982 N/A N/A 22460 22479 AATGTTGCCTGTGACCTGTG 28 1784 762983 N/A N/A 22461 22480 AAATGTTGCCTGTGACCTGT 49 1785 762984 N/A N/A 22462 22481 GAAATGTTGCCTGTGACCTG 30 1786 762985 N/A N/A 22463 22482 TGAAATGTTGCCTGTGACCT 49 1787

(398) TABLE-US-00031 TABLE 31 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 83 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 94 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 52 1639 762986 N/A N/A 22464 22483 CTGAAATGTTGCCTGTGACC 58 1788 762987 N/A N/A 22552 22571 CTCCAGTCCTGACATCTCTT 77 1789 762988 N/A N/A 22645 22664 ACAAGAACCAAACTTTTAAT 57 1790 762989 N/A N/A 22738 22757 CAAATCAGGCAATTCATTGT 57 1791 762990 N/A N/A 22831 22850 AAATCAATCTTAAATTTTTC 0 1792 762991 N/A N/A 22924 22943 TTTATGTACCATTAGTGGGC 63 1793 762992 N/A N/A 23017 23036 CATTAGAATTCACTATTCAT 54 1794 762993 N/A N/A 23110 23129 TTAATGAAAACATAGCAGTA 37 1795 762994 N/A N/A 23203 23222 AAGGCAGGAGCCACCCATAT 56 1796 762995 N/A N/A 23279 23298 TTCTCAGAGACCACAGCTGC 70 1797 762996 N/A N/A 23280 23299 GTTCTCAGAGACCACAGCTG 70 1798 762997 N/A N/A 23281 23300 TGTTCTCAGAGACCACAGCT 64 1799 762998 N/A N/A 23282 23301 TTGTTCTCAGAGACCACAGC 68 1800 762999 N/A N/A 23283 23302 ATTGTTCTCAGAGACCACAG 67 1801 763000 N/A N/A 23284 23303 TATTGTTCTCAGAGACCACA 57 1802 763001 N/A N/A 23285 23304 ATATTGTTCTCAGAGACCAC 71 1803 763002 N/A N/A 23286 23305 CATATTGTTCTCAGAGACCA 81 1804 763003 N/A N/A 23287 23306 CCATATTGTTCTCAGAGACC 67 1805 763004 N/A N/A 23288 23307 ACCATATTGTTCTCAGAGAC 69 1806 763005 N/A N/A 23289 23308 AACCATATTGTTCTCAGAGA 65 1807 763006 N/A N/A 23290 23309 AAACCATATTGTTCTCAGAG 68 1808 763007 N/A N/A 23291 23310 CAAACCATATTGTTCTCAGA 64 1809 763008 N/A N/A 23296 23315 TGTAACAAACCATATTGTTC 73 1810 763009 N/A N/A 23389 23408 CAAAAACACAATTTAATGTA 14 1811 763010 N/A N/A 23482 23501 GATTTGGGTGGAAGTATTTG 47 1812 763011 N/A N/A 23575 23594 CGCAATCAGTTCTTTGAATA 73 1813 763012 N/A N/A 23668 23687 CAAATATGATTTAAACCTAT 4 1814 763013 N/A N/A 23761 23780 ATGGGTTCACAGAAGTGTGG 65 1815 763014 N/A N/A 23854 23873 ACAGTATCTCATTAATGAAA 45 1816 763015 N/A N/A 23948 23967 ATAAGTATCTCAAAACATCA 52 1817 763016 N/A N/A 24041 24060 AAGATAACCATATGATGATG 42 1818 763017 N/A N/A 24160 24179 GTAAGATGAGTAAGTCTAAA 59 1819 763018 N/A N/A 24253 24272 ACATATAAGTGCTATTTTTC 42 1820 763019 N/A N/A 24346 24365 AGGGACAAACAGGTTGTTTA 83 1821 763020 N/A N/A 24439 24458 AAAGCAAATAGCATCATCAA 44 1822 763021 N/A N/A 24539 24558 CTGTACCCTTGAATATCACG 69 1823 763022 N/A N/A 24632 24651 ACAATTAAATTGATGAGATG 18 1824 763023 N/A N/A 24731 24750 CTTAAAAATCCAAATGTTGT 51 1825 763024 N/A N/A 24825 24844 CATTAATAAGAATTAAATGC 6 1826 763025 N/A N/A 24850 24869 TTCTTTGCATTAGTATTCAC 53 1827 763026 N/A N/A 24851 24870 ATTCTTTGCATTAGTATTCA 48 1828 763027 N/A N/A 24852 24871 TATTCTTTGCATTAGTATTC 48 1829 763028 N/A N/A 24853 24872 GTATTCTTTGCATTAGTATT 60 1830 763029 N/A N/A 24854 24873 AGTATTCTTTGCATTAGTAT 72 1831 763030 N/A N/A 24855 24874 CAGTATTCTTTGCATTAGTA 69 1832 763031 N/A N/A 24856 24875 TCAGTATTCTTTGCATTAGT 70 1833 763032 N/A N/A 24857 24876 CTCAGTATTCTTTGCATTAG 77 1834 763033 N/A N/A 24858 24877 GCTCAGTATTCTTTGCATTA 79 1835 763034 N/A N/A 24859 24878 GGCTCAGTATTCTTTGCATT 69 1836 763035 N/A N/A 24860 24879 TGGCTCAGTATTCTTTGCAT 77 1837 763036 N/A N/A 24918 24937 TCCATTTTTTCACTTACTTG 75 1838 763037 N/A N/A 25011 25030 TTAGATTTATCATATTGTTG 50 1839 763038 N/A N/A 25104 25123 TTAAAATCTATTTGATTTCA 32 1840 763039 N/A N/A 25198 25217 CCAAATAGAAAAAAAGTGTG 18 1841 763040 N/A N/A 25291 25310 CTGTATGTACAACCTCAGAA 82 1842 763041 N/A N/A 25384 25403 CCTGACATAAGTAGGAAGCA 63 1843 763042 N/A N/A 25477 25496 CCTACTTTAGATATGTCATA 69 1844 763043 N/A N/A 25570 25589 TGTTAGTATACCTTTGTAGG 72 1845 763044 N/A N/A 25663 25682 GAGGGCCAGCTGGCCATCAT 15 1846 763045 N/A N/A 25756 25775 GAATTCAAGCCCATGCCCTC 44 1847 763046 N/A N/A 25854 25873 CAACATTTTTATTTCACAGA 54 1848 763047 N/A N/A 25947 25966 GTTGCCAGGGATCTGGCAAC 15 1849 763048 N/A N/A 26040 26059 TGTCTGCATTATCTTATTTC 67 1850 763049 N/A N/A 26133 26152 TGTGATCATGTATCGACACA 78 1851 763050 N/A N/A 26226 26245 AACGGCATGTTCAGTGATGC 82 1852 763051 N/A N/A 26319 26338 ATTATACCATGTGCATAATA 54 1853 763052 N/A N/A 26412 26431 GCCTTTGAGATTTGCTTCAG 91 1854 763053 N/A N/A 26505 26524 TTTTACTGAACACCTAGAAC 54 1855 763054 N/A N/A 26598 26617 TTCATCTAGGACCTGCAATC 39 1856 763055 N/A N/A 26691 26710 TTGGTGTTGTCCCAAGAAAT 63 1857 763056 N/A N/A 26784 26803 CTGCAATCTACTTAGACCTG 71 1858 763057 N/A N/A 26877 26896 AGGAAAAACTCTGCCCTCCT 46 1859 763058 N/A N/A 26978 26997 CAAATGAACTTGGGAGGAGG 14 1860 763059 N/A N/A 27071 27090 AGTGCAGGATGAAACCAGAC 76 1861 763060 N/A N/A 27164 27183 TGAAGTATTAGAGAGGATCA 46 1862 763061 N/A N/A 27257 27276 CTCGGACGGAAGTGAAGGCA 57 1863 763062 N/A N/A 27350 27369 GCTCACTTCCTGTCACCCCC 49 1864

(399) TABLE-US-00032 TABLE 32 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 76 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 64 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 61 1639 763063 N/A N/A 27443 27462 TAGGATGCAGCCTGAGGAGC 29 1865 763064 N/A N/A 27536 27555 CATTAGAGTTTGTCTCTGGT 58 1866 763065 N/A N/A 27629 27648 GACCCTTTCATTACCTTTCA 81 1867 763066 N/A N/A 27722 27741 TCCTAGCCCACATCTTAGTA 19 1868 763067 N/A N/A 27815 27834 ATTGTTCTGATTGATGGACA 59 1869 763068 N/A N/A 27908 27927 TGCGACTGGTCAGAGCATGC 63 1870 763069 N/A N/A 28001 28020 TCTAGCACTATTTTTTTCAA 31 1871 763070 N/A N/A 28094 28113 TTAATAATTATTCTACAACA 0 1872 763071 N/A N/A 28192 28211 CACATACAGGTTTTTAAAAA 21 1873 763072 N/A N/A 28231 28250 CCTTGTGCATTTATTCCACG 84 1874 763073 N/A N/A 28232 28251 ACCTTGTGCATTTATTCCAC 67 1875 763074 N/A N/A 28233 28252 TACCTTGTGCATTTATTCCA 64 1876 763075 N/A N/A 28234 28253 GTACCTTGTGCATTTATTCC 70 1877 763076 N/A N/A 28235 28254 AGTACCTTGTGCATTTATTC 68 1878 763077 N/A N/A 28236 28255 GAGTACCTTGTGCATTTATT 67 1879 763078 N/A N/A 28286 28305 CGAAGAATTACCCAGCCCAA 28 1880 763079 N/A N/A 28379 28398 GTGCTTGTTGCCATGCTGGG 78 1881 763080 N/A N/A 28451 28470 TGTAATCTAGGACCCAGTAA 56 1882 763081 N/A N/A 28452 28471 CTGTAATCTAGGACCCAGTA 70 1883 763082 N/A N/A 28453 28472 ACTGTAATCTAGGACCCAGT 63 1884 763083 N/A N/A 28454 28473 GACTGTAATCTAGGACCCAG 69 1885 763084 N/A N/A 28455 28474 AGACTGTAATCTAGGACCCA 72 1886 763085 N/A N/A 28456 28475 CAGACTGTAATCTAGGACCC 70 1887 763086 N/A N/A 28457 28476 CCAGACTGTAATCTAGGACC 64 1888 763087 N/A N/A 28458 28477 TCCAGACTGTAATCTAGGAC 92 1889 763088 N/A N/A 28459 28478 ATCCAGACTGTAATCTAGGA 83 1890 763089 N/A N/A 28460 28479 AATCCAGACTGTAATCTAGG 51 1891 763090 N/A N/A 28461 28480 TAATCCAGACTGTAATCTAG 49 1892 763091 N/A N/A 28472 28491 AAGGAACGCAATAATCCAGA 47 1893 763092 N/A N/A 28565 28584 ACCAGTGCGGAATATTGTAA 64 1894 763093 N/A N/A 28669 28688 ATCAGTCGAATGAATGTACG 36 1895 763094 N/A N/A 28765 28784 CAGATGGATGGGTGGACAAA 52 1896 763095 N/A N/A 29117 29136 TTGGCATTGTATTTTTTTTG 60 1897 763096 N/A N/A 29210 29229 TAGACTCCTACACATATTAA 32 1898 763097 N/A N/A 29303 29322 GATACTTCACTCAGAAAACC 34 1899 763098 N/A N/A 29396 29415 AAAATGGTTTGATAGTTGGG 55 1900 763099 N/A N/A 29454 29473 TTGTTAATAGTTCTCTGTTT 62 1901 763100 N/A N/A 29455 29474 TTTGTTAATAGTTCTCTGTT 45 1902 763101 N/A N/A 29456 29475 TTTTGTTAATAGTTCTCTGT 54 1903 763102 N/A N/A 29457 29476 TTTTTGTTAATAGTTCTCTG 70 1904 763103 N/A N/A 29489 29508 GGATACCATACAACCAATTA 57 1905 763104 N/A N/A 29582 29601 ACAACTAAATCACTCAATTC 8 1906 763105 N/A N/A 29675 29694 CAGAGCCCAAAACATTTATA 33 1907 763106 N/A N/A 29801 29820 CAAATGCCTTGATCTTGGAG 42 1908 763107 N/A N/A 29894 29913 GAGAACACAGCATTTGGCCC 68 1909 763108 N/A N/A 29997 30016 AGAGGTAATAAAGTCACGGG 46 1910 763109 N/A N/A 30090 30109 ATATGAAAATGAAAGGATGG 28 1911 763110 N/A N/A 30193 30212 TTACAGTTTCCTATATATCG 25 1912 763111 N/A N/A 30287 30306 TCATACACAAAATAAACACA 33 1913 763112 N/A N/A 30380 30399 GAATAGCAGTATGTACTAAT 40 1914 763113 N/A N/A 30473 30492 ACCTTTCAATAAACTGTTAA 33 1915 763114 N/A N/A 30566 30585 ATTTTTTCATATATAGTGAG 49 1916 763115 N/A N/A 30659 30678 CTGTAACAAATATACATTTT 36 1917 763116 N/A N/A 30752 30771 ACCAATTAGTTTCTAATAAG 38 1918 763117 N/A N/A 30885 30904 TTATATACACACACAGCTAC 14 1919 763118 N/A N/A 30978 30997 CCAAAAATAGAGATCAATGT 31 1920 763119 N/A N/A 31078 31097 AAACCACTGGCTAATTTTTT 57 1921 763120 N/A N/A 31171 31190 TGAGAGCTATATGGCTGAAA 47 1922 763121 N/A N/A 31264 31283 AAAAGCCTTCTTAGTGGTAA 53 1923 763122 N/A N/A 31357 31376 ATTACTGTGTTTCAGCAGTT 51 1924 763123 N/A N/A 31450 31469 TTAGATATAAAAGGTATGAA 0 1925 763124 N/A N/A 31543 31562 CTAGCCTAGGGTGGTAACAG 17 1926 763125 N/A N/A 31636 31655 TGCTCAAGAATGGACTAGGT 57 1927 763126 N/A N/A 31729 31748 TGCATTTCATTCTATGTATG 62 1928 763127 N/A N/A 31822 31841 AGTTGGAGGGTGGCATACAA 25 1929 763128 N/A N/A 31915 31934 AACAAACAATTCATTTTCTA 0 1930 763129 N/A N/A 32011 32030 GTCTTTTTAAAATTAAAATC 0 1931 763130 N/A N/A 32104 32123 TATAATATACAAAATTACTA 0 1932 763131 N/A N/A 32197 32216 CAATAAGTAGTGCTGTTATA 51 1933 763132 N/A N/A 32290 32309 AGTAGTTTTTAAATCTTCAA 51 1934 763133 N/A N/A 32383 32402 GTGGTTCTGCCCATCTGTCC 64 1935 763134 N/A N/A 32476 32495 TGTTTTCAAGAGCGATCGGA 58 1936 763135 N/A N/A 32569 32588 GAGTAAGTTTAGATATAAAA 36 1937 763136 N/A N/A 32662 32681 GCATAAAAGGCAGAGGGAGG 35 1938 763137 N/A N/A 32755 32774 GCAACCTTTCTCTCCCTCTC 65 1939 763138 N/A N/A 32848 32867 CTGAAGAAATAAATAAAGAA 0 1940 763139 N/A N/A 32941 32960 TCAATATTCAGAGATGACTA 27 1941

(400) TABLE-US-00033 TABLE 33 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No:2  % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 78 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 72 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 46 1639 763140 N/A N/A 33034 33053 CACACCCGAAATACCACCTG 49 1942 763141 N/A N/A 33127 33146 TAAGCTAAAATGGTTTCAAC 45 1943 763142 N/A N/A 33220 33239 GGCAAAATTTGCATTGGATG 79 1944 763143 N/A N/A 33313 33332 TGAAAAAAGCTATGACCCTC 30 1945 763144 N/A N/A 33406 33425 TTACTTCTACTTTTGTGAGG 46 1946 763145 N/A N/A 33499 33518 CCAACATTTTAAGGAAGGTA 73 1947 763146 N/A N/A 33592 33611 GGTAGAGAACACTTAAGTGA 67 1948 763147 N/A N/A 33689 33708 CAAATTTTAAAAGTTAACTT 0 1949 763148 N/A N/A 33785 33804 AATTTCTACAAGAAAAATAT 0 1950 763149 N/A N/A 33878 33897 CCAGAAAGAAACATTTAGAA 39 1951 763150 N/A N/A 33971 33990 GTGTTAACTGGCAATTCCAT 82 1952 763151 N/A N/A 33981 34000 GTTCAATGCTGTGTTAACTG 74 1953 763152 N/A N/A 33982 34001 AGTTCAATGCTGTGTTAACT 63 1954 763153 N/A N/A 33983 34002 AAGTTCAATGCTGTGTTAAC 50 1955 763154 N/A N/A 33984 34003 AAAGTTCAATGCTGTGTTAA 38 1956 763155 N/A N/A 33985 34004 AAAAGTTCAATGCTGTGTTA 49 1957 763156 N/A N/A 33986 34005 AAAAAGTTCAATGCTGTGTT 63 1958 763157 N/A N/A 33987 34006 GAAAAAGTTCAATGCTGTGT 56 1959 763158 N/A N/A 33988 34007 AGAAAAAGTTCAATGCTGTG 62 1960 763159 N/A N/A 33989 34008 AAGAAAAAGTTCAATGCTGT 42 1961 763160 N/A N/A 33990 34009 CAAGAAAAAGTTCAATGCTG 52 1962 763161 N/A N/A 33991 34010 ACAAGAAAAAGTTCAATGCT 28 1963 763162 N/A N/A 34064 34083 TAATATCAGCCAAAGACATT 34 1964 763163 N/A N/A 34157 34176 TTGAAAAAAGTATTGACTCT 16 1965 763164 N/A N/A 34250 34269 CTGTTAAAATGCATTTCTAG 64 1966 763165 N/A N/A 34383 34402 GTATCCCAGCACTGTTGGGA 25 1967 763166 N/A N/A 34476 34495 CTGGTTGCTATCTAGGGATC 82 1968 763167 N/A N/A 34569 34588 AATAGAACCTAATATAATTT 0 1969 763168 N/A N/A 34662 34681 CTTCTATCCTAGAATTCATA 40 1970 763169 N/A N/A 34755 34774 ATGGGAATGAGGTGTAAAAG 56 1971 763170 N/A N/A 34848 34867 CAGTCTGATAAGGAGAACAA 45 1972 763171 N/A N/A 34941 34960 GGATAGAATATCAAGATAAA 38 1973 763172 N/A N/A 35034 35053 TCACAGTGTTCTTTTCTCTT 71 1974 763173 N/A N/A 35127 35146 TTGTGCTAGAATATGAGATC 0 1975 763174 N/A N/A 35220 35239 TCTAGAATTCAAGCCACACC 41 1976 763175 N/A N/A 35313 35332 AATAATGATAGTATTTTCCT 15 1977 763176 N/A N/A 35406 35425 CCATCACACCTTGCAGATGT 70 1978 763177 N/A N/A 35499 35518 ACTTCCTTTAGAGTATACGG 79 1979 763178 N/A N/A 35594 35613 GCACTATATAAAATGTAACG 68 1980 763179 N/A N/A 35687 35706 GTTGTAATAATAATATTGAC 51 1981 763180 N/A N/A 35780 35799 CTGTGACTTTGGTCTATTTG 34 1982 763181 N/A N/A 35873 35892 GGATTGTGTAATAGCCTTTA 60 1983 763182 N/A N/A 35966 35985 TGACTATCAGTATCTGTTGA 75 1984 763183 N/A N/A 36059 36078 AAGTTGACTTGTGACATACA 45 1985 763184 N/A N/A 36152 36171 TTCTACCGAAGGAAATATGT 27 1986 763185 N/A N/A 36250 36269 AGTCATTTTAATAAGTGTTT 72 1987 763186 N/A N/A 36360 36379 ATCTTCCAAAGTTACTGTAC 49 1988 763187 N/A N/A 36453 36472 ATTTCCCAGTCTCGGGAACT 17 1989 763188 N/A N/A 36625 36644 GCTAATGGTTTTATGTGTTT 73 1990 763189 N/A N/A 36789 36808 CATATGGTGATATGGTTAGG 55 1991 763190 N/A N/A 36933 36952 TCATTCACCTATTGAGGAAC 50 1992 763191 N/A N/A 37026 37045 CTAAGTTTTCTCCATGTGTT 52 1993 763192 N/A N/A 37135 37154 GAGCCCCAGGCAATCACTGA 0 1994 763193 N/A N/A 37229 37248 GGTCATGTATCCACCATGAC 44 1995 763194 N/A N/A 37322 37341 AAATAACATTGATACCTTAT 40 1996 763195 N/A N/A 37415 37434 ATTACAGTGCATTCCCATAT 41 1997 763196 N/A N/A 37523 37542 GGGTCTTGACTTCCCAAAGT 74 1998 763197 N/A N/A 37649 37668 TCTTTTATTTCTTCTGTTCT 34 1999 763198 N/A N/A 37785 37804 CGCATCTGTCTTTCTTTTCT 31 2000 763199 N/A N/A 37878 37897 GTAATCTCACCCTACTGCAA 4 2001 763200 N/A N/A 37971 37990 TATCTAGACTGAGCTTTACA 39 2002 763201 N/A N/A 38064 38083 CATTCACATATTTGGATTCT 60 2003 763202 N/A N/A 38157 38176 TGAAACATTAACTGCTTTAT 51 2004 763203 N/A N/A 38250 38269 ACAATGCTATGTGGAAGTTA 44 2005 763204 N/A N/A 38343 38362 CCTCAGTGCTAGCGAAGGAC 67 2006 763205 N/A N/A 38436 38455 AATTTACAATCTACACAGGC 53 2007 763206 N/A N/A 38529 38548 TCAATTCTTGAGGCCAATTG 27 2008 763207 N/A N/A 38622 38641 TCAGTATTTCATTGTCATAC 89 2009 763208 N/A N/A 38715 38734 GTTAGTGGAATTGTAAAATA 54 2010 763209 N/A N/A 38808 38827 CTAGTTATAAAAAACAAGAT 34 2011 763210 N/A N/A 38901 38920 TTGGCCCCAATCATTGGAAT 43 2012 763211 N/A N/A 38910 38929 TTCTCTGTATTGGCCCCAAT 52 2013 763212 N/A N/A 38911 38930 TTTCTCTGTATTGGCCCCAA 59 2014 763213 N/A N/A 38912 38931 TTTTCTCTGTATTGGCCCCA 51 2015 763214 N/A N/A 38913 38932 GTTTTCTCTGTATTGGCCCC 60 2016 763215 N/A N/A 38914 38933 TGTTTTCTCTGTATTGGCCC 70 2017 763216 N/A N/A 38915 38934 ATGTTTTCTCTGTATTGGCC 74 2018

(401) TABLE-US-00034 TABLE 34 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 67 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 95 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 47 1639 763217 N/A N/A 38916 38935 GATGTTTTCTCTGTATTGGC 54 2019 763218 N/A N/A 38917 38936 AGATGTTTTCTCTGTATTGG 61 2020 763219 N/A N/A 38918 38937 GAGATGTTTTCTCTGTATTG 61 2021 763220 N/A N/A 38919 38938 TGAGATGTTTTCTCTGTATT 48 2022 763221 N/A N/A 38920 38939 TTGAGATGTTTTCTCTGTAT 52 2023 763222 N/A N/A 38994 39013 TTTTCAGCAGGAGTTATAAT 43 2024 763223 N/A N/A 39087 39106 TATTCCGTGTGTTTTTCCTA 31 2025 763224 N/A N/A 39180 39199 TTTTCTGATAAATGGTAATC 12 2026 763225 N/A N/A 39273 39292 CAGGTGGTATCAGTCCAAAG 69 2027 763226 N/A N/A 39366 39385 CACCACAAAGAGGAAACAGG 41 2028 763227 N/A N/A 39459 39478 AATGTTCCCTGGGAGCACAA 58 2029 763228 N/A N/A 39555 39574 ATGTCCTGTGCATTGTAGAT 64 2030 763229 N/A N/A 39585 39604 TTTTTTAACTGGATACTTTG 27 2031 763230 N/A N/A 39586 39605 ATTTTTTAACTGGATACTTT 26 2032 763231 N/A N/A 39587 39606 CATTTTTTAACTGGATACTT 44 2033 763232 N/A N/A 39588 39607 ACATTTTTTAACTGGATACT 48 2034 763233 N/A N/A 39589 39608 GACATTTTTTAACTGGATAC 66 2035 763234 N/A N/A 39590 39609 TGACATTTTTTAACTGGATA 55 2036 763235 N/A N/A 39591 39610 ATGACATTTTTTAACTGGAT 51 2037 763236 N/A N/A 39592 39611 AATGACATTTTTTAACTGGA 64 2038 763237 N/A N/A 39593 39612 TAATGACATTTTTTAACTGG 38 2039 763238 N/A N/A 39594 39613 GTAATGACATTTTTTAACTG 53 2040 763239 N/A N/A 39595 39614 AGTAATGACATTTTTTAACT 38 2041 763240 N/A N/A 39648 39667 GTGCCTGGAGAAGATGAATT 44 2042 763241 N/A N/A 39741 39760 CTTTTCCTATTTGGTATTTG 53 2043 763242 N/A N/A 39834 39853 TTGCTAAATATTACTCACTC 40 2044 763243 N/A N/A 39927 39946 ACCAGACTGACTGTAATATG 60 2045 763244 N/A N/A 40020 40039 AAGTGAAAGCATTAGAGGAT 54 2046 763245 N/A N/A 40113 40132 TGGTGTGTGCAAACATGTAT 27 2047 763246 N/A N/A 40206 40225 TTGTGAGAAAGTTTTTATGG 17 2048 763247 N/A N/A 40299 40318 ATAAATAGTCATAAGACTAT 5 2049 763248 N/A N/A 40392 40411 AGTGTGATATCTAAATAAAA 11 2050 763249 N/A N/A 40485 40504 AATTCTGGTGCCAATGGTGA 70 2051 763250 N/A N/A 40578 40597 ATCATCTTATGGCTAAATTT 42 2052 763251 N/A N/A 40671 40690 ATCTAGGCATGAGTTGTGTC 39 2053 763252 N/A N/A 40775 40794 CGTTTGAATGAAAAATGACG 37 2054 763253 N/A N/A 40868 40887 ATTAGAACGAGGATGGAGAA 32 2055 763254 N/A N/A 40961 40980 AGAGAATTCACATGATAGAT 44 2056 763255 N/A N/A 41054 41073 TAAGAAAGAATTTTAGGCAT 35 2057 763256 N/A N/A 41147 41166 GCAGGAGCAACACAGTGAAC 40 2058 763257 N/A N/A 41241 41260 GATCAACAGGAAACATTTAT 45 2059 763258 N/A N/A 41334 41353 TACCCCTATATCTCAACTCA 43 2060 763259 N/A N/A 41427 41446 AATGTTATAGTTTCTACATG 34 2061 763260 N/A N/A 41521 41540 CCAATTATGTAATTTTAAAT 0 2062 763261 N/A N/A 41619 41638 TCTCATTCAAAACCATCCTG 59 2063 763262 N/A N/A 41740 41759 TAATTGTCTTGAGCCATGCA 48 2064 763263 N/A N/A 41833 41852 GCTTATAGTACACATTAACT 56 2065 763264 N/A N/A 41933 41952 GCCCTCTCTCATTACCGTCG 44 2066 763265 N/A N/A 42026 42045 AATACAAATTAGTTGAGTTA 22 2067 763266 N/A N/A 42119 42138 ATACCACATACTCATTTTAA 46 2068 763267 N/A N/A 42212 42231 TAGTTACATGTAGAATGCAT 41 2069 763268 N/A N/A 42305 42324 TCTGGGATACAAGGTGTACC 54 2070 763269 N/A N/A 42398 42417 CTTCATGGGAAGAAAAGCTA 33 2071 763270 N/A N/A 42491 42510 ACAGAAGTACAGCATGTAAG 51 2072 763271 N/A N/A 42598 42617 TATTAAGAGTAATGCTATCG 48 2073 763272 N/A N/A 42691 42710 AGTAGTCCATTCCATTTTTG 76 2074 763273 N/A N/A 42785 42804 ATTTGTCTTTTCTGGAATTA 47 2075 763274 N/A N/A 42878 42897 AATTCTAACACCATCTTGGA 22 2076 763275 N/A N/A 42971 42990 CTACATTGTGGTTTTTCCTT 31 2077 763276 N/A N/A 43064 43083 GGAAGCCAAGACTTTCTTGT 55 2078 763277 N/A N/A 43157 43176 GACTGGCCTCCAGCCAATGA 45 2079 763278 N/A N/A 43250 43269 ACCTCTTGGATCTTTTCTCT 41 2080 763279 N/A N/A 43343 43362 TTCCCCAATTTTCCTTTGTG 37 2081 763280 N/A N/A 43436 43455 CACTCATTTTAAATGTACAT 49 2082 763281 N/A N/A 43529 43548 GTCTTAGGTTTATGTTCATG 73 2083 763282 N/A N/A 43622 43641 AATGTCACAAGACTTCATCT 59 2084 763283 N/A N/A 43715 43734 CCCCTTGAAAATGTATGTTA 47 2085 763284 N/A N/A 43808 43827 GACCTCTTAATGTTTCTTTG 53 2086 763285 N/A N/A 43901 43920 AGATCAGATCATAATCAATA 42 2087 763286 N/A N/A 43994 44013 ACTAGAACTGAGGGACAAGG 13 2088 763287 N/A N/A 44376 44395 ATTTTGGGCTGGAAGCAGTG 6 2089 763288 N/A N/A 44469 44488 GGCAGGAACAACTCTGTCAG 62 2090 763289 N/A N/A 44574 44593 AGCACCAACCAACCAGAGGG 51 2091 763290 N/A N/A 44667 44686 CCCTGTCAAATTTTAGAAAT 25 2092 763291 N/A N/A 44826 44845 TTGGTCTAACTGTGTTGCCC 65 2093 763292 N/A N/A 45028 45047 GAGGATTCACTAATTTTTTT 43 2094 763293 N/A N/A 45121 45140 AAAACAAAAGAGAAGCAACC 40 2095

(402) TABLE-US-00035 TABLE 35 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 62 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 72 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 34 1639 763294 N/A N/A 45214 45233 GTCTCTAGTTTTCCTAAAAT 53 2096 763295 N/A N/A 45307 45326 AGGATACTCAATCTCTTAAT 63 2097 763296 N/A N/A 45400 45419 CGAATAGAAAAATTTAACTT 0 2098 763297 N/A N/A 45493 45512 CTTCAATTAATATTCCAAGA 54 2099 763298 N/A N/A 45586 45605 CACTGTGGATGAAGGTTACT 47 2100 763299 N/A N/A 45679 45698 GGACTACTTGATGTCTAGAT 68 2101 763300 N/A N/A 45773 45792 TTTAATAATACAGTATTATT 0 2102 763301 N/A N/A 45866 45885 AACCTACAGAGAGTGGACTT 34 2103 763302 N/A N/A 45959 45978 TTTATTTCCCACATAAAATT 4 2104 763303 N/A N/A 46052 46071 TACTTAAGAGAAAAAATAGT 0 2105 763304 N/A N/A 46145 46164 CCAAGTAAATAGTATTTTGG 28 2106 763305 N/A N/A 46155 46174 TTCCATGAAGCCAAGTAAAT 63 2107 763306 N/A N/A 46156 46175 TTTCCATGAAGCCAAGTAAA 44 2108 763307 N/A N/A 46157 46176 ATTTCCATGAAGCCAAGTAA 48 2109 763308 N/A N/A 46158 46177 GATTTCCATGAAGCCAAGTA 50 2110 763309 N/A N/A 46159 46178 AGATTTCCATGAAGCCAAGT 66 2111 763310 N/A N/A 46160 46179 GAGATTTCCATGAAGCCAAG 50 2112 763311 N/A N/A 46161 46180 AGAGATTTCCATGAAGCCAA 34 2113 763312 N/A N/A 46162 46181 GAGAGATTTCCATGAAGCCA 65 2114 763313 N/A N/A 46163 46182 AGAGAGATTTCCATGAAGCC 41 2115 763314 N/A N/A 46164 46183 GAGAGAGATTTCCATGAAGC 61 2116 763315 N/A N/A 46165 46184 TGAGAGAGATTTCCATGAAG 30 2117 763316 N/A N/A 46166 46185 GTGAGAGAGATTTCCATGAA 47 2118 763317 N/A N/A 46167 46186 AGTGAGAGAGATTTCCATGA 44 2119 763318 N/A N/A 46238 46257 GGATTTATGTAACAGGAATA 53 2120 763319 N/A N/A 46331 46350 TGATTTAATACATATTTGCA 33 2121 763320 N/A N/A 46424 46443 TCCACACTTCCCTCGATACT 18 2122 763321 N/A N/A 46529 46548 GTGGTGGTGCCAGCAGTGGG 39 2123 763322 N/A N/A 46622 46641 TACCACCCACAGCTGTGCCC 43 2124 763323 N/A N/A 46715 46734 TAGAATAGTGCCTGTTTAAA 19 2125 763324 N/A N/A 46808 46827 AATTGCCTTTTCTGTTTCTT 48 2126 763325 N/A N/A 46905 46924 TACTAGCATAGTGTCTAGCA 43 2127 763326 N/A N/A 46998 47017 ATACTCAGACATCTTAAGTC 52 2128 763327 N/A N/A 47093 47112 GATGCCTGACACAAAATAGG 54 2129 763328 N/A N/A 47186 47205 ATTATATTTTGCCTAACCTC 0 2130 763329 N/A N/A 47279 47298 GAGAAAATCTGTCTCCTTGC 27 2131 763330 N/A N/A 47372 47391 CATTGTGGGATTGTAAGTCT 31 2132 763331 N/A N/A 47465 47484 TCACAATTACATTTTCTTGT 53 2133 763332 N/A N/A 47558 47577 TATAGCATGAATTACTTTAC 44 2134 763333 N/A N/A 47651 47670 TACCTCCTCTTCAGCAAGGA 78 2135 763334 N/A N/A 47744 47763 CCTCTTGTAGTTTTTAAAAT 27 2136 763335 N/A N/A 47951 47970 TTGGTTGTTCAAGTGATTCT 33 2137 763336 N/A N/A 48081 48100 TCTCACAGTTTTGTTGTTGT 57 2138 763337 N/A N/A 48171 48190 CTTTTCATCATGCCTTTATT 40 2139 763338 N/A N/A 48172 48191 TCTTTTCATCATGCCTTTAT 40 2140 763339 N/A N/A 48173 48192 ATCTTTTCATCATGCCTTTA 37 2141 763340 N/A N/A 48174 48193 GATCTTTTCATCATGCCTTT 55 2142 763341 N/A N/A 48175 48194 TGATCTTTTCATCATGCCTT 70 2143 763342 N/A N/A 48176 48195 TTGATCTTTTCATCATGCCT 51 2144 763343 N/A N/A 48177 48196 CTTGATCTTTTCATCATGCC 59 2145 763344 N/A N/A 48178 48197 TCTTGATCTTTTCATCATGC 60 2146 763345 N/A N/A 48179 48198 CTCTTGATCTTTTCATCATG 38 2147 763346 N/A N/A 48180 48199 TCTCTTGATCTTTTCATCAT 43 2148 763347 N/A N/A 48181 48200 ATCTCTTGATCTTTTCATCA 36 2149 763348 N/A N/A 48267 48286 GGATTACTCCTGGCACAGCT 62 2150 763349 N/A N/A 48360 48379 CGATGGAGTACCTACCAACT 36 2151 763350 N/A N/A 48453 48472 TACGAGTAGAAGTGACTTGC 53 2152 763351 N/A N/A 48546 48565 TCAGTGGAGAGCTATGCAAT 5 2153 763352 N/A N/A 48648 48667 TGTAGAATACTTATTTTTTG 28 2154 763353 N/A N/A 48710 48729 ATTTTGGATGCTTCTGAAGA 24 2155 763354 N/A N/A 48711 48730 TATTTTGGATGCTTCTGAAG 17 2156 763355 N/A N/A 48712 48731 GTATTTTGGATGCTTCTGAA 63 2157 763356 N/A N/A 48713 48732 TGTATTTTGGATGCTTCTGA 59 2158 763357 N/A N/A 48714 48733 TTGTATTTTGGATGCTTCTG 54 2159 763358 N/A N/A 48715 48734 TTTGTATTTTGGATGCTTCT 61 2160 763359 N/A N/A 48716 48735 GTTTGTATTTTGGATGCTTC 63 2161 763360 N/A N/A 48717 48736 GGTTTGTATTTTGGATGCTT 61 2162 763361 N/A N/A 48718 48737 TGGTTTGTATTTTGGATGCT 40 2163 763362 N/A N/A 48719 48738 ATGGTTTGTATTTTGGATGC 41 2164 763363 N/A N/A 48720 48739 GATGGTTTGTATTTTGGATG 55 2165 763364 N/A N/A 48741 48760 ACGACATTTTCTTGCCTCTT 74 2166 763365 N/A N/A 48842 48861 ATGCTTTCACTTGAAAAAAA 25 2167 763366 N/A N/A 48975 48994 CTTTTTTTATTTAAATTCTT 1 2168 763367 N/A N/A 49144 49163 ATGGAGAAACTACCCCCATG 27 2169 763368 N/A N/A 49239 49258 ACCTCACATGGCAGGAGAAA 32 2170 763369 N/A N/A 49341 49360 TTTTTATAAAGAAAGAAGTT 0 2171 763370 N/A N/A 49434 49453 TCTTGCTTCTATGTTATATG 65 2172

(403) TABLE-US-00036 TABLE 36 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound No: 1 No: 1 No: 2 No: 2 % ID No start stop start stop Sequence (5′ to 3′) Reduction NO 740410 240 256 4691 4707 GAATTCCTTTACACCAC 79 33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 82 402 762837 238 257 4689 4708 TGAATTCCTTTACACCACAC 57 1639 763371 N/A N/A 49527 49546 CACCCACCATAAAAGGTGAT 10 2173 763372 N/A N/A 49620 49639 TGCCTCTGTTTACAAAGCAA 58 2174 763373 N/A N/A 49713 49732 TGGTTTCCTTTGGTGGCTTT 74 2175 763374 N/A N/A 49806 49825 TTTCCTTAAGAGGAGCTCTC 53 2176 763375 N/A N/A 49899 49918 GATGTAAGTGAGACAGCTCA 56 2177 763376 N/A N/A 49992 50011 TTTAGGTAATGGTTTGGTAT 47 2178 763377 N/A N/A 50085 50104 ATAGAGGTTATTATTCAGTA 49 2179 763378 N/A N/A 50178 50197 AGGAAAACCATCTCTGCTAT 36 2180 763379 N/A N/A 50271 50290 GGAAAGAGGTATGAGTGATG 24 2181 763380 N/A N/A 50364 50383 GAGTGCTGCCTAAGTCTTGG 50 2182 763381 N/A N/A 50457 50476 TTGCTAGCTAAAAGGAGGGT 9 2183 763382 N/A N/A 50550 50569 CCAGTTCTAGTTGTACTAGT 52 2184 763383 N/A N/A 50660 50679 AAAATGAACTTTTTTATTCG 14 2185 763384 N/A N/A 50753 50772 TGCACATCTTTTGCCTGAAA 70 2186 763385 N/A N/A 50846 50865 AACTAATCATTATTTTAGAC 0 2187 763386 N/A N/A 50915 50934 CATCAATATCTGCAATAATA 63 2188 763387 N/A N/A 50916 50935 TCATCAATATCTGCAATAAT 64 2189 763388 N/A N/A 50917 50936 TTCATCAATATCTGCAATAA 45 2190 763389 N/A N/A 50918 50937 TTTCATCAATATCTGCAATA 64 2191 763390 N/A N/A 50919 50938 TTTTCATCAATATCTGCAAT 49 2192 763391 N/A N/A 50920 50939 GTTTTCATCAATATCTGCAA 76 2193 763392 N/A N/A 50921 50940 GGTTTTCATCAATATCTGCA 60 2194 763393 N/A N/A 50922 50941 AGGTTTTCATCAATATCTGC 73 2195 763394 N/A N/A 50923 50942 AAGGTTTTCATCAATATCTG 77 2196 763395 N/A N/A 50924 50943 AAAGGTTTTCATCAATATCT 65 2197 763396 N/A N/A 50925 50944 TAAAGGTTTTCATCAATATC 36 2198 763397 N/A N/A 50926 50945 GTAAAGGTTTTCATCAATAT 54 2199 763398 N/A N/A 50939 50958 AATTAAGAGGAAGGTAAAGG 2 2200 763399 N/A N/A 51032 51051 AAATAATTTCAACATCAGTT 20 2201 763400 N/A N/A 51125 51144 CAATAGCTTGCCAAAAATTC 38 2202 763401 N/A N/A 51218 51237 ATTTTGTTTCATGGATGTTT 53 2203 763402 N/A N/A 51318 51337 AGTCAACATAATTTTTTTTG 34 2204 763403 N/A N/A 51412 51431 TCAACAAGGCCTTACTTACG 55 2205 763404 N/A N/A 51505 51524 TTATAAAATATCTTCCTAGG 3 2206 763405 N/A N/A 51598 51617 TTTTGGCTGCCTCTCAAAAT 21 2207 763406 N/A N/A 51691 51710 TTCATTAAAAATTCTGAGTT 3 2208 763407 N/A N/A 51792 51811 ATTTTTAATATAATGCTACG 0 2209 763408 N/A N/A 51885 51904 CACCAGTGTTTGCATGTCCC 67 2210 763409 N/A N/A 51978 51997 CCTCCTACTTCCTAGGCTGC 7 2211 763410 N/A N/A 52071 52090 GCTCAATTGGGTGTTCAGCA 62 2212 763411 N/A N/A 52164 52183 ACACTGTAAAACTGTCACAA 52 2213 763412 N/A N/A 52310 52329 CACATGGATGTATTTGTGCG 49 2214 763413 N/A N/A 52403 52422 AGAAGTTTCAAGAACAGTCA 45 2215 763414 N/A N/A 52496 52515 TTTAATATACAGATGTTCAG 11 2216 763415 N/A N/A 52589 52608 CCCACCTGCCAAAAACACCT 36 2217 763416 N/A N/A 52682 52701 TCGAAGTGGGTATGGATGCA 50 2218 763417 N/A N/A 52775 52794 GGGCATATGGCTATATACTA 51 2219 763418 N/A N/A 52868 52887 TCTAGTTAGCATCTATCCAC 73 2220 763419 N/A N/A 52961 52980 TCTTATAAAATTTCTATACT 13 2221 763420 N/A N/A 53054 53073 TCATTTTACTTAAGTGGCAC 51 2222 763421 N/A N/A 53147 53166 GTCTTTTTCCCATCCTTGAC 53 2223 763422 N/A N/A 53240 53259 TTAGCAAGTATAAATATGTT 4 2224 763423 N/A N/A 53333 53352 TAGTTGATTGTAGGAAATGT 48 2225 763424 N/A N/A 53426 53445 TTGCAAAACAGATGGACTTC 43 2226 763425 N/A N/A 53519 53538 TGATGATCTAGCCAAGAGGG 27 2227 763426 N/A N/A 53612 53631 ACAAGCTGTACATTAATTAC 42 2228 763427 N/A N/A 53640 53659 TTCCATGAAGCCAAGATCAA 46 2229 763428 N/A N/A 53641 53660 TTTCCATGAAGCCAAGATCA 62 2230 763429 N/A N/A 53642 53661 ATTTCCATGAAGCCAAGATC 63 2231 763430 N/A N/A 53643 53662 TATTTCCATGAAGCCAAGAT 66 2232 763431 N/A N/A 53644 53663 TTATTTCCATGAAGCCAAGA 61 2233 763432 N/A N/A 53645 53664 ATTATTTCCATGAAGCCAAG 53 2234 763433 N/A N/A 53646 53665 AATTATTTCCATGAAGCCAA 67 2235 763434 N/A N/A 53647 53666 GAATTATTTCCATGAAGCCA 77 2236 763435 N/A N/A 53648 53667 TGAATTATTTCCATGAAGCC 66 2237 763436 N/A N/A 53649 53668 GTGAATTATTTCCATGAAGC 68 2238 763437 N/A N/A 53650 53669 AGTGAATTATTTCCATGAAG 69 2239 763438 N/A N/A 53705 53724 AAGTAAGTTCTGAGCTGACA 34 2240 763439 N/A N/A 53798 53817 TATTAAGTCTGTTAAGAGGT 54 2241 763440 N/A N/A 53891 53910 ATGTTGTATGATGCTCTGGC 74 2242 763441 N/A N/A 53984 54003 GTAGATTGCTATTTTGCCAC 55 2243 763442 N/A N/A 54080 54099 AATGGGTTTATGTATAATCG 58 2244 763443 N/A N/A 54173 54192 CTCCAGACATAGATCTCTCT 63 2245 763444 N/A N/A 54266 54285 ACAAGTAAACTGAAACCAGA 23 2246 763445 N/A N/A 54359 54378 GTAAGGATGATCATTATAAC 55 2247 763446 N/A N/A 54452 54471 ATTAAACATTTTTAATAGCC 27 2248 763447 N/A N/A 54545 54564 AGGTGAATAAACTTCGAAAT 51 2249

(404) TABLE-US-00037 TABLE 37 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 86   33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 93  402 762837 238 257  4689  4708 TGAATTCCTTTACACCACAC 68 1639 763448 N/A N/A 54638 54657 TATCAAAAGATTATATATAG  0 2250 763449 N/A N/A 54731 54750 TAAATAACATGAATAAGACC 21 2251 763450 N/A N/A 54824 54843 TTTTACACATAAGCATATAT 18 2252 763451 N/A N/A 54917 54936 AATGAATGTTACCATTTTAT 45 2253 763452 N/A N/A 55011 55030 CAATATATTTATTAGGAGAA 30 2254 763453 N/A N/A 55104 55123 TCATAAATCAGTCCTCTATA 36 2255 763454 N/A N/A 55197 55216 AAAAAGAAGTCAGATATTTC 26 2256 763455 N/A N/A 55290 55309 TTTCGGCAGAATTCCAGAGA 56 2257 763456 N/A N/A 55383 55402 TGGTTTTCTTTTTCTAGTCA 73 2258 763457 N/A N/A 55476 55495 CTCACAAATCATAGGTTTGT 25 2259 763458 N/A N/A 55569 55588 GACTATCAATCGGTACTTAT 67 2260 763459 N/A N/A 55663 55682 ATTTTATTTGAAATATGTGA 12 2261 763460 N/A N/A 55756 55775 GATCTTAGAAATTCATTTAG 42 2262 763461 N/A N/A 55849 55868 TTCTCTAAGTACAACACTGC 33 2263 763462 N/A N/A 55942 55961 CCACAGTTACATCTGGAAAC 46 2264 763463 N/A N/A 56051 56070 AAGTTGTGCGACTTTGGGCA 66 2265 763464 N/A N/A 56144 56163 TATCATCAGCAGAACATAGA 36 2266 763465 N/A N/A 56237 56256 TAAATATTGTTTTTTCTAAG  1 2267 763466 N/A N/A 56330 56349 GACACATTTATATTAGATGT 79 2268 763467 N/A N/A 56423 56442 AAGGAGGGAAACAAAGCTCC 22 2269 763468 N/A N/A 56516 56535 TACTATATGACATGCTTTCT 31 2270 763469 N/A N/A 56612 56631 CAATGGATGAATAGGTGGAT 45 2271 763470 N/A N/A 56705 56724 ATGTTGTGGCTTAACCCCAT 54 2272 763471 N/A N/A 56798 56817 AAAAAACCTGAAGTACAACA 16 2273 763472 N/A N/A 56891 56910 TACTGTGGGTCATTTTTTCT 44 2274 763473 N/A N/A 56987 57006 ATAATATCTATATTTAAAAC  0 2275 763474 N/A N/A 57082 57101 TATAAAGATGGATTTTTAAA  0 2276 763475 N/A N/A 57175 57194 AAATGGATGCTAAGACAATT 35 2277 763476 N/A N/A 57268 57287 CCTTCTCTAACTGCCTTTAC 24 2278 763477 N/A N/A 57361 57380 GTATAGTTAAAGCTACATTT 59 2279 763478 N/A N/A 57454 57473 CAAATTTTGCTTTTACACCC 63 2280 763479 N/A N/A 57547 57566 CTTACTTGAGCTAGGTGATC 54 2281 763480 N/A N/A 57640 57659 TTCCTCTATTTAATGTATTT 69 2282 763481 N/A N/A 57733 57752 TAGCAGTTCCAGGTTCCACA 84 2283 763482 N/A N/A 57826 57845 ATCACTTTGGTGTGAGAAGA 14 2284 763483 N/A N/A 57919 57938 ATTCCATAGACTTCCAAGTC 60 2285 763484 N/A N/A 58012 58031 AGCATCCACATGAAATTGGT 48 2286 763485 N/A N/A 58105 58124 GATGTCTTGATACCTTCAGA 79 2287 763486 N/A N/A 58198 58217 CTACATGCTAAACTTGTTTT 11 2288 763487 N/A N/A 58291 58310 GTGAGAATAAATGTGATCTA 41 2289 763488 N/A N/A 58384 58403 CTGTTTCATTAGGAATTTTT 68 2290 763489 N/A N/A 58477 58496 TTTATGTACATGGCCAGAAA 32 2291 763490 N/A N/A 58571 58590 ACAAAAAATTTCCTAACATT  2 2292 763491 N/A N/A 58664 58683 TGTAGCATTTACCTAACAGC 83 2293 763492 N/A N/A 58757 58776 AGTGCAGAATCCTGATTGCA 75 2294 763493 N/A N/A 58850 58869 CACATTGTAACATAAGCTGT 48 2295 763494 N/A N/A 58943 58962 AGTTTGAACTCCGCCCAAGA 32 2296 763495 N/A N/A 59036 59055 ACAAGGTTTGCACAAATAAA 48 2297 763496 N/A N/A 59129 59148 CCTCATATATAGGGCCTCAC 46 2298 763497 N/A N/A 59222 59241 AATTATAAAGCCCTGAAGGC  1 2299 763498 N/A N/A 59315 59334 AATGTATTGTTATTTGTCAT 68 2300 763499 N/A N/A 59439 59458 CAACTTCTCCATATAACCAA 52 2301 763500 N/A N/A 59592 59611 CTAAAGGATGCAAAGGCATA 23 2302 763501 N/A N/A 59685 59704 CGTAGATAGAGTTGGAGACC 76 2303 763502 N/A N/A 59788 59807 GTGATATATTTACATATATA 60 2304 763503 N/A N/A 59945 59964 TTCCAGCGATCCCACTCCTA 26 2305 763504 N/A N/A 60040 60059 TTTTTTTACACTGCTGGTAG 31 2306 763505 N/A N/A 60161 60180 TTTAATGACCAGGGAAATGC 19 2307 763506 N/A N/A 60418 60437 GGGACCTAAAACTATAAAGC 40 2308 763507 N/A N/A 60540 60559 CAAAACCTTAAAAATTATAG  0 2309 763508 N/A N/A 60744 60763 AAATCCAGAAATAAAGCTAA 18 2310 763509 N/A N/A 60844 60863 CTAGATTACCCAACTTCAAA  4 2311 763510 N/A N/A 60972 60991 GACTCCCATCAAAATGCCAC 37 2312 763511 N/A N/A 61069 61088 ACAGAAACTAATGAAAACAC  0 2313 763512 N/A N/A 61183 61202 GAGCCTTTTTACAACAGCTG 61 2314 763513 N/A N/A 61282 61301 TTAATTCAGTAAAGTTTCCA 11 2315 763514 N/A N/A 61391 61410 AGCATCCAAACTGCTAAAGA 35 2316 763515 N/A N/A 61499 61518 TTTCCCCCGAGAACTGGAAT  0 2317 763516 N/A N/A 61592 61611 CTGGCATATAAGATACACAC 45 2318 763517 N/A N/A 61691 61710 GCAGGAGTAAAAACAAAAAT 29 2319 763518 N/A N/A 61966 61985 GTTCCAAAAGATAGAGACAG 37 2320 763519 N/A N/A 62059 62078 GTCAGGAAACAAAAAAAGTC 15 2321 763520 N/A N/A 62154 62173 CATATATACAAACCTCCTAG 14 2322 763521 N/A N/A 62296 62315 AAAGATCTAAACAAGCTCAA 16 2323 763522 N/A N/A 62399 62418 CACAAAATACAATACAAAAG  0 2324 763523 N/A N/A 62496 62515 AAGATCATACTGTTGCATTC 14 2325 763524 N/A N/A 62674 62693 AGGCGGATCACCATAAGTCA  0 2326

(405) TABLE-US-00038 TABLE 38 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 80   33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 83  402 762837 238 257  4689  4708 TGAATTCCTTTACACCACAC 69 1639 763604 N/A N/A 70405 70424 TCATTTCCTTAGTTCCATAT 45 2327 763605 N/A N/A 70498 70517 TCTGCCTTGTTTTTTCTTTC 65 2328 763606 N/A N/A 70594 70613 TATATAGTTATATATTTACG  0 2329 763607 N/A N/A 70687 70706 TTTATATTATATTAACTCTA 13 2330 763608 N/A N/A 70780 70799 GGCTTGTCTCTATCCCCTGT 65 2331 763609 N/A N/A 70908 70927 GCCCCAGCTTCCGGGTTCAA 24 2332 763610 N/A N/A 71001 71020 GAAATATTATTTATACTATT  0 2333 763611 N/A N/A 71094 71113 TCTCACAATCACAGAAAACA 31 2334 763612 N/A N/A 71187 71206 GACTGCATTTGTATTTCATC 89 2335 763613 N/A N/A 71280 71299 AGATTAACAAAATATTAATT 10 2336 763614 N/A N/A 71373 71392 TATCATTCTTAACAGAAAAA 20 2337 763615 N/A N/A 71471 71490 CTAAGCCATTTTATAACAGG 33 2338 763616 N/A N/A 71568 71587 GCCTAACAGGCTATGGACCA 47 2339 763617 N/A N/A 71778 71797 CACGGACAGGGATGGTGAGG 52 2340 763618 N/A N/A 71871 71890 GTATTGGGCATTATCAGTAA 65 2341 763619 N/A N/A 71964 71983 ACTTATCAACACTTAAACTG 23 2342 763620 N/A N/A 72074 72093 TAGGTAATTCTAATTTTAAT  6 2343 763621 N/A N/A 72201 72220 TACCTAGGTGGTTTCCATAT 46 2344 763622 N/A N/A 72294 72313 AATGACAGGGTCTTCTCCTT 58 2345 763623 N/A N/A 72295 72314 AAATGACAGGGTCTTCTCCT 66 2346 763624 N/A N/A 72296 72315 CAAATGACAGGGTCTTCTCC 60 2347 763625 N/A N/A 72297 72316 GCAAATGACAGGGTCTTCTC 76 2348 763626 N/A N/A 72298 72317 GGCAAATGACAGGGTCTTCT 68 2349 763627 N/A N/A 72299 72318 TGGCAAATGACAGGGTCTTC 83 2350 763628 N/A N/A 72300 72319 GTGGCAAATGACAGGGTCTT 77 2351 763629 N/A N/A 72301 72320 TGTGGCAAATGACAGGGTCT 89 2352 763630 N/A N/A 72302 72321 TTGTGGCAAATGACAGGGTC 73 2353 763631 N/A N/A 72408 72427 ACTTTTTCTTTTTAGATTCC 67 2354 763632 N/A N/A 72630 72649 TTCTCAACTGCCTGAGTAGC 41 2355 763633 N/A N/A 72756 72775 TGTGTGGACTGTGTTTTTTG 70 2356 763634 N/A N/A 72849 72868 CAGCTTTTTAGTTCCTCCTA 84 2357 763635 N/A N/A 72942 72961 TTCCCCTGTGGCAAGAGCAG 47 2358 763636 N/A N/A 73035 73054 ATGCTGTTATAAGATGAATG 58 2359 763637 N/A N/A 73128 73147 AAATTATTATAATTCACTCT  5 2360 763638 N/A N/A 73185 73204 ACTTTCTGTGTGGTATGTTC 74 2361 763639 N/A N/A 73186 73205 GACTTTCTGTGTGGTATGTT 76 2362 763640 N/A N/A 73187 73206 AGACTTTCTGTGTGGTATGT 88 2363 763641 N/A N/A 73188 73207 CAGACTTTCTGTGTGGTATG 86 2364 763642 N/A N/A 73189 73208 ACAGACTTTCTGTGTGGTAT 70 2365 763643 N/A N/A 73190 73209 GACAGACTTTCTGTGTGGTA 78 2366 763644 N/A N/A 73191 73210 AGACAGACTTTCTGTGTGGT 65 2367 763645 N/A N/A 73192 73211 CAGACAGACTTTCTGTGTGG 81 2368 763646 N/A N/A 73193 73212 TCAGACAGACTTTCTGTGTG 51 2369 763647 N/A N/A 73194 73213 TTCAGACAGACTTTCTGTGT 58 2370 763648 N/A N/A 73195 73214 CTTCAGACAGACTTTCTGTG 60 2371 763649 N/A N/A 73221 73240 TTGTATTGGTGGAGAAAACA 20 2372 763650 N/A N/A 73314 73333 GTGTTGAGAATTTTTCATTG 82 2373 763651 N/A N/A 73407 73426 TAGCATCTCTAATGTAGTCT 85 2374 763652 N/A N/A 73500 73519 GTAGCTGAATTTCTTCAGCA 22 2375 763653 N/A N/A 73593 73612 ATTACAGTGAAATGAAACAT  4 2376 763654 N/A N/A 73686 73705 AAATACATTTTGCCTCTGTC 55 2377 763655 N/A N/A 73779 73798 CTTTAAGACTTTCCTTAGAC 54 2378 763656 N/A N/A 73872 73891 TTTGTTTTAAAACTAGACTT 27 2379 763657 N/A N/A 73965 73984 AAAAAGAGATGAAAAGTGTG 22 2380 763658 N/A N/A 74058 74077 AGATATGGAGGAGAGTGAAA 28 2381 763659 N/A N/A 74159 74178 CTTCCCTCAGCAACAGGCGC 51 2382 763660 N/A N/A 74252 74271 GGTCTAGAATCATTCTGAAG 55 2383 763661 N/A N/A 74345 74364 AAGGACCTTTCTTCTGAAAG 66 2384 763662 N/A N/A 74438 74457 TACACAGAGCACTTCTTATT 41 2385 763663 N/A N/A 74531 74550 CTCCCTTTTTCCCACATCTA 48 2386 763664 N/A N/A 74624 74643 AAATTAAGTGTTAAGCACAC 60 2387 763665 N/A N/A 74717 74736 AAATATTTGCTCAGAGACAC 59 2388 763666 N/A N/A 74810 74829 GAATAAAAATGTATAACTAT  6 2389 763667 N/A N/A 75104 75123 CAGAGCCTGGCCAAAATGGC 33 2390 763668 N/A N/A 75197 75216 AGCACTTAAACAGAAAAAAT 27 2391 763669 N/A N/A 75290 75309 TCTATTGTATATTAGGTTGA 67 2392 763670 N/A N/A 75383 75402 GATGAAGGAAGAATGATTTT 49 2393 763671 N/A N/A 75476 75495 GCTAGTTCATTGTATGTGTC 81 2394 763672 N/A N/A 75569 75588 ATTGAATAAAAATTTGTATT  0 2395 763673 N/A N/A 75943 75962 CCAGGTATAAAATTTTTTTT 35 2396 763674 N/A N/A 76036 76055 GATCTAAGAATACCCCTAGT 25 2397 763675 N/A N/A 76129 76148 TTAGATAAAAAGTATACTGT  8 2398 763676 N/A N/A 76222 76241 GACAGTTTTCTAATTTTACA 64 2399 763677 N/A N/A 76315 76334 GGGTTGGAAATAATACAGAG 43 2400 763678 N/A N/A 76408 76427 TTGACCTGCAGTATCTTGAA 28 2401 763679 N/A N/A 76501 76520 TACATATTCTTATTCAACTC 46 2402 763680 N/A N/A 76594 76613 ATATTATTGATTGTTCTAAA 14 2403

(406) TABLE-US-00039 TABLE 39 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SERQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 57   33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 73  402 762837 238 257  4689  4708 TGAATTCCTTTACACCACAC 65 1639 763681 N/A N/A 76687 76706 GGATATTCGATTCAAGAACA 56 2404 763682 N/A N/A 76780 76799 ATAAATTTGGAAGCTAATGT  2 2405 763683 N/A N/A 76873 76892 ACCACATTTTGAAAATAAAG 40 2406 763684 N/A N/A 76966 76985 AGCACAGGAAATTAACATAT 62 2407 763685 N/A N/A 77059 77078 GTAGGTGTGTTTATTTCTAT 66 2408 763686 N/A N/A 77164 77183 CTTTTCATCAGAGATTTTTT 60 2409 763687 N/A N/A 77257 77276 GAAATCTAAAAACAGCAAAG  3 2410 763688 N/A N/A 77350 77369 GACTATTGTTTTAATGTGTT 48 2411 763689 N/A N/A 77443 77462 GGGAGATTTGAGAGAGAGGC 44 2412 763690 N/A N/A 77536 77555 ATAGTGGGCTTATGGTGTAC 51 2413 763691 N/A N/A 77630 77649 ATTTCTCCATTTCTGTCACT 41 2414 763692 N/A N/A 77738 77757 CAGGAGTAAGGACACAGACG 42 2415 763693 N/A N/A 77831 77850 CCTCCAGAAAAGGTTTTTAG 62 2416 763694 N/A N/A 77924 77943 GAATTGAAACTGCTTAGAAG 28 2417 763695 N/A N/A 78027 78046 CCTGACTTTGAATTATTTTG 55 2418 763696 N/A N/A 78120 78139 AAAATCAGATAGCAGTGGTG 36 2419 763697 N/A N/A 78213 78232 AGGGTACAGAAGGAAAGACA 37 2420 763698 N/A N/A 78306 78325 TGAGAGGTGTTTGTTTTGAA 15 2421 763699 N/A N/A 78399 78418 TGTTGGCAAGCTTGAAGGGA 44 2422 763700 N/A N/A 78495 78514 AATTGAAGGGTTGTAACAGG 29 2423 763701 N/A N/A 78588 78607 GCTGGAAAATTAGTCTGTAG 75 2424 763702 N/A N/A 78681 78700 CATGGCATGGTCTATACATT 62 2425 763703 N/A N/A 78774 78793 AGGTCTCATGGCTGGCAAGT 27 2426 763704 N/A N/A 78867 78886 AAACACTTTATCAAATCTTA 41 2427 763705 N/A N/A 78960 78979 ATCAGAACAAGTTAAACATT 34 2428 763706 N/A N/A 79053 79072 TCTTTTATTCTTGTATCACT 70 2429 763707 N/A N/A 79146 79165 TAGCCTTTTGATCTGTTTTT 56 2430 763708 N/A N/A 79239 79258 TAAGAATTATGTTAAAACCA 16 2431 763709 N/A N/A 79332 79351 CTTAAATTTTAACAATTAAA  0 2432 763710 N/A N/A 79425 79444 AATTTACCCCCTAGTAGGCT 57 2433 763711 N/A N/A 79518 79537 AGTAACATTTTGAAATGATG 57 2434 763712 N/A N/A 79611 79630 CCTGTAGTTCAGTTTTACTG 63 2435 763713 N/A N/A 79704 79723 AGATATGAAAATTTTCACTT 25 2436 763714 N/A N/A 79797 79816 CTTTTAACTTTAGCTAAATA  0 2437 763715 N/A N/A 79890 79909 AGGACCAAAGCTATGGTTAG 52 2438 763716 N/A N/A 79983 80002 CAAACAAATAACAGCTTTCA 58 2439 763717 N/A N/A 80076 80095 ATAACAAAATTCAGTGCAAC 56 2440 763718 N/A N/A 80169 80188 ACATTTAAAGTTTTAACACT 12 2441 763719 N/A N/A 80262 80281 GTTTTATAGTTGACAGATGA 53 2442 763720 N/A N/A 80355 80374 TCTCTAAATTTGTTGATTTA 26 2443 763721 N/A N/A 80448 80467 TGCAGGCACTCACAAACATT 68 2444 763722 N/A N/A 80555 80574 ACACCTTTTCTCTTCTTTTT 48 2445 763723 N/A N/A 80648 80667 ATCTACTGTTTGAAAGGGTG 61 2446 763724 N/A N/A 80741 80760 ACATTGCTCAGAGTTCATGT 44 2447 763725 N/A N/A 80834 80853 TAGGTACCATCAGAATTTCA 57 2448 763726 N/A N/A 80927 80946 TCATTCTCTGCTACAATAAA 43 2449 763727 N/A N/A 80987 81006 GAAATTTTCCAGCTAAAAAA 19 2450 763728 N/A N/A 80988 81007 TGAAATTTTCCAGCTAAAAA  0 2451 763729 N/A N/A 80989 81008 TTGAAATTTTCCAGCTAAAA 47 2452 763730 N/A N/A 80990 81009 CTTGAAATTTTCCAGCTAAA 51 2453 763731 N/A N/A 80991 81010 TCTTGAAATTTTCCAGCTAA 47 2454 763732 N/A N/A 80992 81011 ATCTTGAAATTTTCCAGCTA 45 2455 763733 N/A N/A 80993 81012 AATCTTGAAATTTTCCAGCT 59 2456 763734 N/A N/A 80994 81013 AAATCTTGAAATTTTCCAGC 60 2457 763735 N/A N/A 80995 81014 TAAATCTTGAAATTTTCCAG 23 2458 763736 N/A N/A 80996 81015 ATAAATCTTGAAATTTTCCA 24 2459 763737 N/A N/A 80997 81016 CATAAATCTTGAAATTTTCC 40 2460 763738 N/A N/A 81020 81039 ATTTCTTTCTCAAGCCCAAA 53 2461 763739 N/A N/A 81113 81132 TACATTCCTACTGTATTTAC 38 2462 763740 N/A N/A 81206 81225 TGCTTTGATATGGCTTGGAG 64 2463 763741 N/A N/A 81299 81318 TGGTATGAGTCACATAAGTA 76 2464 763742 N/A N/A 81392 81411 CCTAGAAATTTTGCCTTTTC 40 2465 763743 N/A N/A 81485 81504 CTGCAGGTTCTGGAGAGCTG 56 2466 763744 N/A N/A 81578 81597 TGTTTACTGCCACTATTCAC 53 2467 763745 N/A N/A 81681 81700 CTAACTGAACTTTTAAAAAT  4 2468 763746 N/A N/A 81774 81793 AATACAATCTATCAGCATTA 53 2469 763747 N/A N/A 81868 81887 AATTTTGGAGGAATTTATTT  0 2470 763748 N/A N/A 81961 81980 TTGTGCTTCAATAATACCAA 37 2471 763749 N/A N/A 82112 82131 TGGGTTTCATGGTGTTAGCT 69 2472 763750 N/A N/A 82237 82256 GTAGGCTCAGTGCAAACTCT 57 2473 763751 N/A N/A 82330 82349 AGTCTTTTTACATTATAATA 28 2474 763752 N/A N/A 82423 82442 TAACAGATTTGTGGTGAAAA 52 2475 763753 N/A N/A 82516 82535 AACCATAAGAGAGGACAAAC 39 2476 763754 N/A N/A 82609 82628 AATGATCTTTAAAACATTCA  9 2477 763755 N/A N/A 82702 82721 GAGGACAATAAAATGACCTT 70 2478 763756 N/A N/A 82810 82829 CTCCTCTCAACTGCCAGCGC 52 2479 763757 N/A N/A 82903 82922 TTTACTAAGTCATCTGTGAA 19 2480

(407) TABLE-US-00040 TABLE 40 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 75   33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 84  402 762837 238 257  4689  4708 TGAATTCCTTTACACCACAC 63 1639 763758 N/A N/A 82996 83015 CTTATGAGCTGTTTAGGAAG 45 2481 763759 N/A N/A 83089 83108 TGTCAACTCTGCCAATGTGA 56 2482 763760 N/A N/A 83183 83202 AATAAATGCTATGTAATTTA  3 2483 763761 N/A N/A 83276 83295 GAAGGGTTGCTATGATAGTT 56 2484 763762 N/A N/A 83369 83388 TGAATTCTAACCAAAAGCTT 33 2485 763763 N/A N/A 83462 83481 GACAAATGTGTCACTTTTTA 11 2486 763764 N/A N/A 83555 83574 AAATTCATGAGGAATGCAAT 41 2487 763765 N/A N/A 83648 83667 CATACAATATTTTTGACAGA 50 2488 763766 N/A N/A 83741 83760 GTGACGCACATTTACACCAG 61 2489 763767 N/A N/A 83834 83853 AAAGATTTTTATCTTAGCCT 42 2490 763768 N/A N/A 83927 83946 CCATTTACAAAGATGACCAG 22 2491 763769 N/A N/A 84020 84039 TCAAAGTAGTGAATTACATC 51 2492 763770 N/A N/A 84113 84132 TGTTTGGACTTATAAACTAT 55 2493 763771 N/A N/A 84206 84225 TAATGGGCAAGCAAAAAATT  0 2494 763772 N/A N/A 84552 84571 TCATGTTGCCTAGGCTAGAA 58 2495 763773 N/A N/A 84645 84664 CTAGATAACATACAATATAA  0 2496 763774 N/A N/A 84752 84771 GAGAAATTATTATATTTTAT  0 2497 763775 N/A N/A 84845 84864 AGACTACAAAATTGCTAAAA 32 2498 763776 N/A N/A 84938 84957 CAAAAAGATTTTTATGGAGT  3 2499 763777 N/A N/A 85031 85050 AATTTAAGTTTAAATATTCT  0 2500 763778 N/A N/A 85124 85143 CCTCATTTTGCCAGTATTAA 76 2501 763779 N/A N/A 85217 85236 ATGGGAAAATTGTGACTGTT 59 2502 763780 N/A N/A 85315 85334 GCAAATATATGAATTTTTTA 12 2503 763781 N/A N/A 85424 85443 TCATTGGAAAATCTTGAACG 61 2504 763782 N/A N/A 85517 85536 ATTTGTAGACCTATGTTGAA 10 2505 763783 N/A N/A 85610 85629 GAATAATAAGATTCAGTCAT 56 2506 763784 N/A N/A 85703 85722 GAAACCATTAAAATATTTAT  0 2507 763785 N/A N/A 85797 85816 TCTAAGTTTTTATTAATTAA  0 2508 763786 N/A N/A 85891 85910 ATGATTAGGATTTTTATTTC  1 2509 763787 N/A N/A 85984 86003 TTTATATTTAAATCACACAA  0 2510 763788 N/A N/A 86077 86096 AATTGCTGTTTTAATCATGA 54 2511 763789 N/A N/A 86170 86189 CAGATTTATCTACTTGAAAC 46 2512 763790 N/A N/A 86263 86282 GTAGAGTTTTTGGTCAGTGG 63 2513 763791 N/A N/A 86356 86375 TTTTTGTTCTTGGGATGTTG 53 2514 763792 N/A N/A 86449 86468 TAACTTTCAACCGTGAAAAA 15 2515 763793 N/A N/A 86542 86561 GTCTGTTTTCTAACTAGCTT 76 2516 763794 N/A N/A 86635 86654 GCACATTGTCAAATAAACAA 61 2517 763795 N/A N/A 86728 86747 CAGGAATTATCCAAAGTCAC 70 2518 763796 N/A N/A 86821 86840 ACCTGGGTTAAGTAAATGGC 38 2519 763797 N/A N/A 86914 86933 CACTGGAGAGACTGTGAAGG 53 2520 763798 N/A N/A 87007 87026 AGCAGCAGATTTCAAAAGGG 69 2521 763799 N/A N/A 87100 87119 TTTTGATTGTGGTAATTGGA 36 2522 763800 N/A N/A 87193 87212 TACAAGAGTGGAAATGGCTG 27 2523 763801 N/A N/A 87286 87305 CCGTTACATGCTCTCTAATT 46 2524 763802 N/A N/A 87379 87398 CTCCTGATCTCAATTGAAAT 10 2525 763803 N/A N/A 87472 87491 AAGCCTTCATATACGAGTTT 60 2526 763804 N/A N/A 87565 87584 TATCTCCAGCCTTCACCTCT 13 2527 763805 N/A N/A 87658 87677 TCTCCTTCTTACAAAATCCA 53 2528 763806 N/A N/A 87759 87778 GTTGTTCTTCTTCTTATTAT 58 2529 763807 N/A N/A 87854 87873 GTTAAAATTTGAAATAATGA  0 2530 763808 N/A N/A 87940 87959 AGTTGTGACCATGCAATAAA 50 2531 763809 N/A N/A 87941 87960 AAGTTGTGACCATGCAATAA 51 2532 763810 N/A N/A 87942 87961 TAAGTTGTGACCATGCAATA 44 2533 763811 N/A N/A 87943 87962 GTAAGTTGTGACCATGCAAT 65 2534 763812 N/A N/A 87944 87963 AGTAAGTTGTGACCATGCAA 69 2535 763813 N/A N/A 87945 87964 TAGTAAGTTGTGACCATGCA 68 2536 763814 N/A N/A 87946 87965 TTAGTAAGTTGTGACCATGC 55 2537 763815 N/A N/A 87947 87966 ATTAGTAAGTTGTGACCATG 44 2538 763816 N/A N/A 87948 87967 CATTAGTAAGTTGTGACCAT 42 2539 763817 N/A N/A 87949 87968 CCATTAGTAAGTTGTGACCA 71 2540 763818 N/A N/A 87950 87969 CCCATTAGTAAGTTGTGACC 71 2541 763819 N/A N/A 88040 88059 GCTATCAAGACATTATGTAG 58 2542 763820 N/A N/A 88133 88152 ATCTATGAAAGCAAATGTTT 35 2543 763821 N/A N/A 88227 88246 CTTTTTTAAACAAAATACAG  0 2544 763822 N/A N/A 88320 88339 ATGCTACAAGCAGGCACTTA 22 2545 763823 N/A N/A 88413 88432 TCTGTTATCTTAAGAGGCTT 76 2546 763824 N/A N/A 88506 88525 TGGACTTTATTGCTCAAAGC 65 2547 763825 N/A N/A 88599 88618 CAGACAAAAACATCCGATAT 28 2548 763826 N/A N/A 88692 88711 CCCTAGACAACTATCACCTG  9 2549 763827 N/A N/A 88785 88804 TGGAAGCCCTGAGGAAGTGG 59 2550 763828 N/A N/A 88878 88897 AACAGCAAGGACAATGTCTA 53 2551 763829 N/A N/A 88971 88990 GCCATGTGTTATATACTTTG 73 2552 763830 N/A N/A 89075 89094 ATTAGGTAGATTTTTTTTAA  0 2553 763831 N/A N/A 89169 89188 ATGATGGTGAATAAATTAAA 11 2554 763832 N/A N/A 89262 89281 AGAAAATGCTTTAAGCTCAT 57 2555 763833 N/A N/A 89355 89374 AAAAGATAAATTGCTAGGTT 16 2556 763834 N/A N/A 89452 89471 ACTAATTAATTAGTTGAATA  8 2557

(408) TABLE-US-00041 TABLE 41 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256  4691  4707 GAATTCCTTTACACCAC 67   33 741410 N/A N/A 87946 87962 GTAAGTTGTGACCATGC 83  402 762837 238 257  4689  4708 TGAATTCCTTTACACCACAC 76 1639 763835 N/A N/A 89545 89564 TCAATTCTCTTTAGAATTTC 27 2558 763836 N/A N/A 89638 89657 AGAGATTCATGCTCATTTAT 45 2559 763837 N/A N/A 89731 89750 ATCTATCCACTCTCCTATAG  0 2560 763838 N/A N/A 89824 89843 ACTTTTTTATTAGAGCCCCC 14 2561 763839 N/A N/A 89917 89936 GACTACATGTCCTTTAAATG 64 2562 763840 N/A N/A 90015 90034 AAGACTGCAGGCTTGAGCCA 23 2563 763841 N/A N/A 90141 90160 ATGCCACCACATCCCACTTT 21 2564 763842 N/A N/A 90312 90331 TGTTATATTTTAAAAGTTTC  0 2565 763843 N/A N/A 90439 90458 ATATACACAAAAGCAGATAT 19 2566 N/A N/A 90405 90424 763844 N/A N/A 90500 90519 AAATATATGTGTAAATACAC  0 2567 763845 N/A N/A 90593 90612 CTCCCATTCTCTCTCTCTAC 35 2568 763846 N/A N/A 90686 90705 CCCAGAAACTAACATCTTCT 48 2569 763847 N/A N/A 90779 90798 CAGGAAAAAGAATACTTTCT 34 2570 763848 N/A N/A 90945 90964 TCCTGCCACCACACCCACTA 11 2571 763849 N/A N/A 91047 91066 TAGCTATAGTGCAATGGCGC  7 2572 763850 N/A N/A 91140 91159 TTTCATAACTGTATGATTTG 33 2573 763851 N/A N/A 91233 91252 ACCATTAAAAGTTTAGTGGA 43 2574 763852 N/A N/A 91326 91345 ATGTGCATGCCAGTGTGTTA 34 2575 763853 N/A N/A 91419 91438 GATAAAGAAGGAATGCACAA 34 2576 763854 N/A N/A 91520 91539 CTTACTTTCTTGCAAAAGGG 43 2577 763855 N/A N/A 91614 91633 GAAAATAAAAAGGCAGCTTT 13 2578 763856 N/A N/A 91707 91726 TAATAGTGAATGTTGTTTTA 21 2579 763857 N/A N/A 91800 91819 CATGCATCTAAAGATAACTG 33 2580 763858 N/A N/A 91893 91912 TCCTAGGCTTTGTCTCTTAA 38 2581 763859 N/A N/A 91986 92005 TTTAAAACTTTATCTTCCTT 35 2582 763860 N/A N/A 92079 92098 AGATACTGTTGCCCCAAGTA 48 2583 763861 N/A N/A 92172 92191 TACTAAAAAAAACCACTAAC  0 2584 763862 N/A N/A 92265 92284 CCACTGTCTAACAAATAATG 32 2585 763863 N/A N/A 92358 92377 ATGATTGGTGTAAGCGAATG 24 2586 763864 N/A N/A 92451 92470 ATTATCCTTCAACAGAGCTA 21 2587 763865 N/A N/A 92544 92563 GCCCATCCTTAGATCTTAGT 46 2588 763866 N/A N/A 92642 92661 CGAGTGACTCAGTTTCCTTA 64 2589 763867 N/A N/A 92735 92754 CCTTCACTTTGGAGGATGCG 37 2590 763868 N/A N/A 92828 92847 CCTAGAGGGTGCCTTCCCAG 28 2591 763869 N/A N/A 92921 92940 ATATTTACACTGCTTCATAA  3 2592 763870 N/A N/A 93014 93033 TTATGACCTGTAATGTACTT 25 2593 763871 N/A N/A 93151 93170 CAAAAGACAAGCACACACAC  0 2594 763872 N/A N/A 93244 93263 TAAGTATTTTTAGTACTTTA 14 2595 763873 N/A N/A 93337 93356 GAGGGACTTTTGCAATTGTC 15 2596 763874 N/A N/A 93430 93449 GAATCAAAATAAGAGGTCAA 35 2597 763875 N/A N/A 93521 93540 TTTTGAGTTCCAGGGATTCA 54 2598 763876 N/A N/A 93522 93541 GTTTTGAGTTCCAGGGATTC 70 2599 763877 N/A N/A 93523 93542 TGTTTTGAGTTCCAGGGATT 74 2600 763878 N/A N/A 93524 93543 ATGTTTTGAGTTCCAGGGAT 50 2601 763879 N/A N/A 93525 93544 AATGTTTTGAGTTCCAGGGA 57 2602 763880 N/A N/A 93526 93545 CAATGTTTTGAGTTCCAGGG 57 2603 763881 N/A N/A 93527 93546 GCAATGTTTTGAGTTCCAGG 61 2604 763882 N/A N/A 93528 93547 AGCAATGTTTTGAGTTCCAG 68 2605 763883 N/A N/A 93529 93548 CAGCAATGTTTTGAGTTCCA 70 2606 763884 N/A N/A 93530 93549 TCAGCAATGTTTTGAGTTCC 66 2607 763885 N/A N/A 93531 93550 TTCAGCAATGTTTTGAGTTC 33 2608 763886 N/A N/A 93621 93640 GCATTTCTTAATTTTTTTAT  6 2609 763887 N/A N/A 93714 93733 TTGTCTGCTACTATTTTTTC 25 2610 763888 N/A N/A 93807 93826 TTTAATATTTATGAATGTGA 15 2611 763889 N/A N/A 93900 93919 AAGCCTTTATTTTTTATTGC  8 2612 763890 N/A N/A 93993 94012 ATGAGGGCAAGCTGGCTTTT 40 2613 763891 N/A N/A 94086 94105 CAAGGAGATTGAGTTTACCA 51 2614 763892 N/A N/A 94179 94198 CAAAGCATTCTTGCTTGCTC 50 2615 763893 N/A N/A 94272 94291 TAATTTATGTCAGTCATTAA  0 2616 763894 N/A N/A 94365 94384 GGCTGCCGAAAGCAGGAAAA 32 2617 763895 N/A N/A 94458 94477 TTTAAATGTCACAGCTATTT 15 2618 763896 N/A N/A 94551 94570 CTTCCCCTAAATCTCTCTGT 20 2619 763897 N/A N/A 94644 94663 AGTTAACAAATTAATGAAAC 10 2620 763898 N/A N/A 94993 95012 AACTTCAGTTTTGTGGCGGG 15 2621 763899 N/A N/A 95086 95105 CCTGGAAAATGAGGACTTTC 44 2622 763900 N/A N/A 95179 95198 ACTGATTAAGAAATGTGAGG 31 2623 763901 N/A N/A 95272 95291 TGAAAGCCACCGTGATGAAC  4 2624 763902 N/A N/A 95365 95384 AGATTAAAGCGATTCCTGCT 12 2625 763903 N/A N/A 95459 95478 CTTAGTATCATCATCATCAC 39 2626 763904 N/A N/A 95552 95571 CCCAGAAAATAAGCAGACTG 45 2627 763905 N/A N/A 95645 95664 GCAAATACAATATTTGAAAG  0 2628 763906 N/A N/A 95738 95757 GATCAGAATGACCAGTGCAC 43 2629 763907 N/A N/A 95831 95850 TCAAACTATAATTTGGTGTC 61 2630 763908 N/A N/A 95924 95943 TCTAGAGAATGATTCATCTT 39 2631 763909 N/A N/A 96017 96036 TACCCTCTTGCTATACAAAC 30 2632 763910 N/A N/A 96110 96129 GATGAAAATTGAAATTTGAT 13 2633 763911 N/A N/A 96203 96222 TTAAAAATAACTGTATTTGG  0 2634

(409) TABLE-US-00042 TABLE 42 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256   4691   4707 GAATTCCTTTACACCAC 74   33 741410 N/A N/A  87946  87962 GTAAGTTGTGACCATGC 80  402 762837 238 257   4689   4708 TGAATTCCTTTACACCACAC 67 1639 763912 N/A N/A  96296  96315 ATTAACTAAAAACCAAGTCT  7 2635 763913 N/A N/A  96391  96410 CAAAGCTGCAGACCATTTTG 25 2636 763914 N/A N/A  96484  96503 ACAGGCAAAGAATTTTTGAG 35 2637 763915 N/A N/A  96577  96596 AAACAACTGCTGAGAAGCAG  0 2638 763916 N/A N/A  96670  96689 TTTAATTGCTGTTGTGTGGT 45 2639 763917 N/A N/A  96763  96782 TAAGACATAAATGTCAGAGG 25 2640 763918 N/A N/A  96858  96877 TGAAGATGAAGAAAGGAAAG  2 2641 763919 N/A N/A  96951  96970 GAGCCAATAACAGAGATGAT 36 2642 763920 N/A N/A  97044  97063 AGACTGTTAATGTAGTAGGA 29 2643 763921 N/A N/A  97137  97156 GGACAATTAATTTTGAGGGT 48 2644 763922 N/A N/A  97230  97249 CTTCAGGAGATAAAGGAACC  7 2645 763923 N/A N/A  97323  97342 TTATGCTTCAGGGATGCATA 36 2646 763924 N/A N/A  97416  97435 TTTACTAAGTAATTGGTACT 26 2647 763925 N/A N/A  97509  97528 AAGGCAGCAAAGAGGTAAAA  2 2648 763926 N/A N/A  97602  97621 GGTAAGTCATCAGAGTTCAT 27 2649 763927 N/A N/A  97695  97714 TTGAGTCTGAGATGCCTCCA 34 2650 763928 N/A N/A  97788  97807 TTTGAGCTTGACCAACTAGG 45 2651 763929 N/A N/A  97881  97900 GCAGTTACTGACTTGCTTGA 38 2652 763930 N/A N/A  97974  97993 GCTGCAAGCACACCTGCCTT 36 2653 763931 N/A N/A  98067  98086 AAGAGGAACGCAGAGCTCAG  8 2654 763932 N/A N/A  98160  98179 GAGTATCATGATTTTCTTGC 57 2655 763933 N/A N/A  98253  98272 CAAGCCTGCCAGTCTTTTGA 43 2656 763934 N/A N/A  98346  98365 TATAGGTGCAAACTACAAGT 35 2657 763935 N/A N/A  98439  98458 GGAATACAGCCAAAAACTTG 13 2658 763936 N/A N/A  98532  98551 AGCTACATTCAAGTCTGCAA 57 2659 763937 N/A N/A  98803  98822 CGAATGGGCGGATCACAAGG  7 2660 763938 N/A N/A  98896  98915 AAGAATCGAAACTAAAAACC  9 2661 763939 N/A N/A  98989  99008 AATGTATATCATATATTGTC 57 2662 763940 N/A N/A  99082  99101 GACCCATGCACAGTCATAAT 36 2663 763941 N/A N/A  99175  99194 CGTAAATGTTTCAACTGAAA 45 2664 763942 N/A N/A  99268  99287 GTTGGAAGCTCAGGAGAAAA 56 2665 763943 N/A N/A  99361  99380 TTGTTGAGGAACTGAAATTG 20 2666 763944 N/A N/A  99454  99473 AGTGGGCTTGTGGTATTTGT  7 2667 763945 N/A N/A  99547  99566 GCAAAGGGAGAACAAACAAA  0 2668 763946 N/A N/A  99641  99660 CTGTATATAATTTTTTCAAC 35 2669 763947 N/A N/A  99734  99753 ACTAAATGTTTATTTGCATT 44 2670 763948 N/A N/A  99827  99846 GAATTTAAAGAGGAATAAAA  0 2671 763949 N/A N/A  99920  99939 AATTTCATTATGATTATCGC 64 2672 763950 N/A N/A 100013 100032 TCTTCAAACCTTTTGACCAA 41 2673 763951 N/A N/A 100111 100130 GAAATAAATTGTTCATTTTG  7 2674 763952 N/A N/A 100205 100224 GAAAAAATAGTTTATTATAA  0 2675 763953 N/A N/A 100298 100317 TATATGATTTTTTGCAAGGG 41 2676 763954 N/A N/A 100394 100413 GTTAAAGGAAATGTTTATAT 12 2677 763955 N/A N/A 100487 100506 AAATTAATCCTTTCCAAATG  0 2678 763956 N/A N/A 100580 100599 AATATTAGTTGTCAAATGTC 42 2679 763957 N/A N/A 100673 100692 CTCTTTGAGGAAGTTACTAC 23 2680 763958 N/A N/A 100766 100785 AATAACAATAACAGTTAATG  0 2681 763959 N/A N/A 100860 100879 GATTATCAAGAAAGATAATG  0 2682 763960 N/A N/A 100953 100972 GCTACTTTCTTTCAGTTACC 49 2683 763961 N/A N/A 101046 101065 GCCAGAGGACCATAGTGGTT 45 2684 763962 N/A N/A 101143 101162 TACTAAGTGAAGTTTGAGGG 18 2685 763963 N/A N/A 101236 101255 AGAAAGGCTTTAAGATAGCT  9 2686 763964 N/A N/A 101329 101348 AAGGATGGGCTCTGAAGCAG 13 2687 763965 N/A N/A 101422 101441 CCCAGGAGTTTGCTCTCAAA 36 2688 763966 N/A N/A 101515 101534 AGAGTCTGCTTTCATATTTT 36 2689 763967 N/A N/A 101914 101933 TGGAGGCAGGTCTTTTTTTT 32 2690 763968 N/A N/A 102007 102026 ACGATGTGAAGATGGGTCAA 45 2691 763969 N/A N/A 102100 102119 TTAAACTATATTCAAATTTG  0 2692 763970 N/A N/A 102193 102212 AATGCACAAAGGGAAATCTG 38 2693 763971 N/A N/A 102286 102305 AATTAGCTGACTCACCTAAT  4 2694 763972 N/A N/A 102379 102398 AGCAAAGAGGTAGTATGCTG 61 2695 763973 N/A N/A 102472 102491 GTTTAAATACATTCAACCAT 46 2696 763974 N/A N/A 102565 102584 GGTTTGGCAGTGGAGGAGAG 28 2697 763975 N/A N/A 102658 102677 CCCTTCTAGCTGTTTCTTTA 40 2698 763976 N/A N/A 102831 102850 TATAGAGATGAAGTTTCATT 29 2699 763977 N/A N/A 102982 103001 CCCTATTGCCCAGGCTGTAA 21 2700 763978 N/A N/A 103075 103094 CTTTAGAGAACCCAGTCTTA 38 2701 763979 N/A N/A 103175 103194 ATAGTCACATTGGTGAACGC 33 2702 763980 N/A N/A 103268 103287 TTGCTCTCCCTCAGTTATGT 52 2703 763981 N/A N/A 103361 103380 TGCTATTATATATGCTAAGC 54 2704 763982 N/A N/A 103454 103473 CTGATGATCTCTGGTGCCAC 35 2705 763983 N/A N/A 103547 103566 CTACTAACCTGTAAAAGACA  1 2706 763984 N/A N/A 103640 103659 ACTTTACAACAAGATAAAAA  0 2707 763985 N/A N/A 103733 103752 TCTGGTACAGTCCTACTACC 61 2708 763986 N/A N/A 103826 103845 AATATAATTTATAGCATTAC  0 2709 763987 N/A N/A 103919 103938 TGAGGCAATATGCAGACGAA 51 2710 763988 N/A N/A 104012 104031 TTTAGAAATGCATCAAAGTG 18 2711

(410) TABLE-US-00043 TABLE 43 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 1 No: 1 No: 2 No: 2 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410 240 256   4691   4707 GAATTCCTTTACACCAC 89   33 741410 N/A N/A  87946  87962 GTAAGTTGTGACCATGC 90  402 762837 238 257   4689   4708 TGAATTCCTTTACACCACAC 79 1639 763989 N/A N/A 104105 104124 CAAACTTTAATTTTTGGGAA 31 2712 763990 N/A N/A 104198 104217 TGTATCCAATGCCCAAAGGA 49 2713 763991 N/A N/A 104291 104310 CATTTATTGTTTACATACTC 29 2714 763992 N/A N/A 104384 104403 GCAAAACAATATGCATATTT 63 2715 763993 N/A N/A 104477 104496 GAGGTCTTGTTTTGGAAAGG 54 2716 763994 N/A N/A 104570 104589 TGGATACTCTGATTTCTCTT 76 2717 763995 N/A N/A 104663 104682 AGCAAAGGGCATCTGATTCA 46 2718 763996 N/A N/A 104756 104775 ACCTTGTTAAAAAGCAAGGT  2 2719 763997 N/A N/A 104849 104868 GGAGTGTGTACATAGTGTAG 46 2720 763998 N/A N/A 104942 104961 AAAATGAAATCAAGCCCAGA 23 2721 763999 N/A N/A 105035 105054 GAGATAGTAGCCAAAAAGAT 22 2722 764000 N/A N/A 105128 105147 TTGTTTTGCTGCATTATTGA 42 2723 764001 N/A N/A 105221 105240 CAACTTTCACAGCCTTAAAC 38 2724 764002 N/A N/A 105314 105333 TTTGGAGCAATGTGATGTTT 40 2725 764003 N/A N/A 105407 105426 GAGCTGCAGCAAGTTTTTTC 56 2726 764004 N/A N/A 105502 105521 GCTGCTCTTTGAGAAAGTTC 64 2727 764005 N/A N/A 105595 105614 AAGAAAAATTGAAATTCAAG  9 2728 764006 N/A N/A 105688 105707 AAAATAGCAAGGTTTCATCA 17 2729 764007 N/A N/A 105781 105800 TTAAAAAAGATATGCTCATT 12 2730 764008 N/A N/A 105874 105893 CACTGCCCGACATCACCAAT 20 2731 764009 N/A N/A 105967 105986 AACCACACTCTTCTAGAATC 41 2732 764010 N/A N/A 106060 106079 TAAGGAAATTATCTTTATTC 27 2733 764011 N/A N/A 106153 106172 TGTCTTTAGGAATACAACTA 55 2734 764012 N/A N/A 106246 106265 GCTAATAGCTTATTGGGAAG 47 2735 764013 N/A N/A 106339 106358 GGGTTGAATAGCTGATATAA 65 2736 764014 N/A N/A 106432 106451 AGACTTAAAAGCTATATTAG  6 2737 764015 N/A N/A 106525 106544 TCAGTTCAGTATCTTATATC 68 2738 764016 N/A N/A 106618 106637 ACCTTTTATTCTCTCTCTAC 60 2739 764017 N/A N/A 106713 106732 TAAAATAAATGAGAAAAACG  2 2740 764018 N/A N/A 106806 106825 CCAATATAACAAATGTTAAA 24 2741 764019 N/A N/A 106899 106918 GAGTATTCATGACTTGTTTT 53 2742 764020 N/A N/A 106999 107018 TGTTATCTATAAAGAAATAT 17 2743 764021 N/A N/A 107092 107111 AATATAACAACAAACACTTC  2 2744 764022 N/A N/A 107185 107204 TATGTTTTTCTGAATATGTG 36 2745 764023 N/A N/A 107278 107297 GCAATTTCAGGTGTCCTAGT 79 2746 764024 N/A N/A 107434 107453 CCCACATAACTTTTATTACA 42 2747 764025 N/A N/A 107539 107558 CGTGGTTTTGTTTTCCATGG 70 2748 764026 N/A N/A 107641 107660 ATCTATCTAGGTTTGGGTGG 57 2749 764027 N/A N/A 107734 107753 TTATTTCTTTAGGTGTGATG 49 2750 764028 N/A N/A 107827 107846 ATTCTCATTGGGAACCCTAC 40 2751 764029 N/A N/A 107920 107939 GTAAATTGCAACTAAAAAGA  8 2752 764030 N/A N/A 108013 108032 AAACATGTTCATTGCTTACA 57 2753 764031 N/A N/A 108271 108290 GGTTCTCCTATAGTCCCAGC 58 2754 764032 N/A N/A 108364 108383 ACATGATCGGTGAGGTCAGG 40 2755 764033 N/A N/A 108457 108476 TCGACAATAGGGTTTACGAC 56 2756 764034 N/A N/A 108550 108569 TTAAGTGGGCTATTGTTCAC 39 2757 764035 N/A N/A 108643 108662 ACTATTGATGAAGTTAAGTG 14 2758 764036 N/A N/A 108736 108755 TGCCATAGGACTTAATTCTT 69 2759 764037 N/A N/A 108857 108876 TTGACTTGTTTGTATTAATC 62 2760 764038 N/A N/A 108970 108989 CCTGCAGTAATGGAACAGCG 67 2761 764039 N/A N/A 109063 109082 TGAACTTTGAAGGATGTACA 40 2762 764040 N/A N/A 109156 109175 CTACCCTGTTTGTTGTTTGA 15 2763 764041 N/A N/A 109249 109268 TTTTCCATGATTTTGAAACT 30 2764 764042 N/A N/A 109342 109361 ACAACAGGGAGAAGGAAACG 17 2765 764043 N/A N/A 109435 109454 ATGACAGAGCTTTTGTGATG 35 2766 764044 N/A N/A 109528 109547 TTCACTTCTTGGTAGATACG 45 2767 764045 N/A N/A 109627 109646 CTAAAAAAAATCCAAATAAT 14 2768 764046 N/A N/A 109720 109739 AGTAAGAAAAGGTCACACTA 34 2769 764047 N/A N/A 109813 109832 ATTTTCAACAACATGTCTGA 14 2770 764048 N/A N/A 109906 109925 AAAGGTAAGTGAAAATTCAA 29 2771 764049 N/A N/A 109999 110018 CTCAGCCTGAAATGGTCATG 39 2772 764050 N/A N/A 110092 110111 AGACTGAGACTATACATATT 29 2773 764051 N/A N/A 110185 110204 AACTTTTATAACCACTTATA 31 2774 764052 N/A N/A 110278 110297 AAAGGTAAAAAGTTTGGAAG  6 2775 764053 N/A N/A 110371 110390 ATTATGTAACAACTACCTAT  8 2776 764054 N/A N/A 110624 110643 GTTACAATGAAACCCCATCT 29 2777 764055 N/A N/A 110724 110743 TTATTGCTGGGTGCAGTGGT 24 2778 764056 N/A N/A 110817 110836 CCAAAGATATTTTTCACAAG 65 2779 764057 N/A N/A 110910 110929 AAACATTGCGGCAACATGGG 22 2780 764058 N/A N/A 111003 111022 AAATCTTACATATAGGGATG 39 2781 764059 N/A N/A 111097 111116 TCCTTCTTCATTCTAATATT  7 2782

(411) TABLE-US-00044 TABLE 44 Percent reduction of human SNCA mRNA with 5-10-5 MOE gapmers with mixed internucleoside linkages Com- SEQ ID SEQ ID SEQ ID SEQ ID % SEQ pound No: 2 No: 2 No: 5 No: 5 Reduc- ID No start stop start stop Sequence (5′ to 3′) tion NO 740410  4691  4707 N/A N/A GAATTCCTTTACACCAC 89   33 741410 87946 87962 N/A N/A GTAAGTTGTGACCATGC 90  402 762837  4689  4708 N/A N/A TGAATTCCTTTACACCACAC 79 1639 764060 N/A N/A 38 57 CTTTACACCACACTCTTTCA 23 2783 764061 N/A N/A 39 58 CCTTTACACCACACTCTTTC 45 2784 764062 N/A N/A 40 59 TCCTTTACACCACACTCTTT 56 2785 764063 N/A N/A 41 60 TTCCTTTACACCACACTCTT 52 2786 764064 N/A N/A 42 61 ATTCCTTTACACCACACTCT 70 2787 764065 N/A N/A 43 62 AATTCCTTTACACCACACTC 67 2788

Example 6: Design of Gapmers with Mixed Internucleoside Linkages Complementary to Human SNCA

(412) Modified oligonucleotides complementary to a human SNCA nucleic acid were designed. The modified oligonucleotides in Table 45 are gapmers. The gapmers have a central gap segment that comprises 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end comprising 2′-MOE nucleosides and cEt nucleosides. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages. The sequence and chemical notation column specifies the sequence, including 5′-methy cytosines, sugar chemistry, and the internucleoside linkage chemistry, wherein subscript ‘d’ represents a 2′-deoxyribose sugar; subscript ‘e’ represents a 2′-MOE modified sugar; subscript ‘k’ represents a cEt modified sugar; subscript ‘o’ represents a phosphodiester internucleoside linkage; subscript ‘s’ represents a phosphorothioate internucleoside linkage; and a ‘m’ superscript before the cytosine residue indicates a 5-methyl cytosine. “Start Site” indicates the 5′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. “Stop Site” indicates the 3′-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

(413) Each modified oligonucleotide listed in the Tables below is complementary to human SNCA nucleic acid sequences SEQ ID NO: 2 or SEQ ID NO:5, as indicated. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity.

(414) TABLE-US-00045 TABLE 45 Modified oligonucleotides complementary to human SNCA mRNA Com- SEQ ID SEQ ID SEQ ID SEQ ID SEQ pound No: 2 No: 2 No: 5 No: 5 Sequence and chemical notation ID No start stop start stop (5′ to 3′) NO: 788813 N/A N/A 4686 4702 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds 1038 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.koT.sub.esG.sub.esG.sub.e 788814 236 252 4687 4703 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 260 A.sub.ds.sup.mC.sub.dsA.sub.ko.sup.mC.sub.esT.sub.esG.sub.e 788815 237 253 4688 4704 T.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 335 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esT.sub.e 788816 238 254 4689 4705 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 412 .sup.mC.sub.ds.sup.mC.sub.dsA.sub.ko.sup.mC.sub.esA.sub.es.sup.mC.sub.e 788817 239 255 4690 4706 A.sub.esA.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 577 .sup.mC.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esA.sub.e 788818 240 256 4691 4707 G.sub.esA.sub.eoA.sub.eoT.sub.eoT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 33 A.sub.ds.sup.mC.sub.ko.sup.mC.sub.esA.sub.es.sup.mC.sub.e 788819 N/A N/A 4686 4702 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds 1038 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.koT.sub.esG.sub.esG.sub.e 788820 236 252 4687 4703 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 260 A.sub.ds.sup.mC.sub.dsA.sub.ko.sup.mC.sub.esT.sub.esG.sub.e 788821 237 253 4688 4704 T.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 335 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esT.sub.e 788822 238 254 4689 4705 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 412 .sup.mC.sub.ds.sup.mC.sub.dsA.sub.ko.sup.mC.sub.esA.sub.es.sup.mC.sub.e 788823 239 255 4690 4706 A.sub.esA.sub.eoT.sub.eoT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 577 .sup.mC.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esA.sub.e 788824 240 256 4691 4707 G.sub.esA.sub.eoA.sub.eoT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 33 A.sub.ds.sup.mC.sub.ko.sup.mC.sub.esA.sub.es.sup.mC.sub.e 788830 236 252 4687 4703 T.sub.es.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 260 A.sub.ds.sup.mC.sub.dsA.sub.ko.sup.mC.sub.esT.sub.esG.sub.e 788831 237 253 4688 4704 T.sub.esT.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 335 A.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esT.sub.e 788832 238 254 4689 4705 A.sub.esT.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 412 .sup.mC.sub.dsA.sub.ko.sup.mC.sub.esA.sub.es.sup.mC.sub.e 788833 239 255 4690 4706 A.sub.esA.sub.eoT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 577 .sup.mC.sub.ds.sup.mC.sub.koA.sub.es.sup.mC.sub.esA.sub.e 788855 N/A N/A 29458 29474 T.sub.esT.sub.eoT.sub.eoG.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 2789 .sup.mC.sub.koT.sub.ks.sup.mC.sub.esT.sub.e 788856 N/A N/A 29459 29475 T.sub.esT.sub.eoT.sub.eoT.sub.esG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.ds 2790 T.sub.ko.sup.mC.sub.ksT.sub.es.sup.mC.sub.e 788889 N/A N/A 29458 29474 T.sub.esT.sub.eoT.sub.eoG.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 2789 .sup.mC.sub.koT.sub.es.sup.mC.sub.esT.sub.e 788890 N/A N/A 29459 29475 T.sub.esT.sub.eoT.sub.eoT.sub.esG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.ds 2790 T.sub.ko.sup.mC.sub.esT.sub.es.sup.mC.sub.e 789229 N/A N/A 4686 4705 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 1682 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esG.sub.e 789230 237 256 4688 4707 G.sub.esA.sub.eoA.sub.eoT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 1638 A.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 789231 238 257 4689 4708 T.sub.esG.sub.eoA.sub.eoA.sub.esT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1639 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789232 239 258 4690 4709 A.sub.esT.sub.eoG.sub.eoA.sub.esA.sub.esT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1640 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 789233 240 259 4691 4710 A.sub.esA.sub.eoT.sub.eoG.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 1641 A.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789234 N/A N/A 29457 29476 T.sub.esT.sub.eoT.sub.eoT.sub.esT.sub.esG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 1904 T.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 789235 N/A N/A 4686 4705 A.sub.esT.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 1682 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esG.sub.e 789236 237 256 4688 4707 G.sub.esA.sub.eoA.sub.esT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 1638 A.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 789237 238 257 4689 4708 T.sub.esG.sub.eoA.sub.esA.sub.esT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1639 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789238 239 258 4690 4709 A.sub.esT.sub.eoG.sub.esA.sub.esA.sub.esT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1640 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 789239 240 259 4691 4710 A.sub.esA.sub.eoT.sub.esG.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 1641 A.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789240 N/A N/A 29457 29476 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 1904 T.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 789241 N/A N/A 4686 4705 A.sub.esT.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 1682 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.es.sup.mC.sub.eoT.sub.esG.sub.esG.sub.e 789242 237 256 4688 4707 G.sub.esA.sub.eoA.sub.esT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 1638 A.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.es.sup.mC.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 789243 238 257 4689 4708 T.sub.esG.sub.eoA.sub.esA.sub.esT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1639 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.esA.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789244 239 258 4690 4709 A.sub.esT.sub.eoG.sub.esA.sub.esA.sub.esT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 1640 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.es.sup.mC.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 789245 240 259 4691 4710 A.sub.esA.sub.eoT.sub.esG.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 1641 A.sub.ds.sup.mC.sub.dsA.sub.es.sup.mC.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 789246 N/A N/A 29457 29476 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 1904 T.sub.dsT.sub.ds.sup.mC.sub.esT.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 806693 N/A N/A 29458 29477 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 2791 T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806694 N/A N/A 29459 29478 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 2792 G.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esT.sub.es.sup.mC.sub.e 806695 N/A N/A 29460 29479 A.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 2793 A.sub.dsG.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806696 N/A N/A 29454 29473 T.sub.esT.sub.eoG.sub.esT.sub.esT.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 1901 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.eoT.sub.esT.sub.esT.sub.e 806697 N/A N/A 29455 29474 T.sub.esT.sub.eoT.sub.esG.sub.esT.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1902 .sup.mC.sub.dsT.sub.ds.sup.mC.sub.esT.sub.eoG.sub.esT.sub.esT.sub.e 806698 N/A N/A 29456 29475 T.sub.esT.sub.eoT.sub.esT.sub.esG.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1903 .sup.mC.sub.dsT.sub.es.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 806699 N/A N/A 29458 29477 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 2791 T.sub.dsT.sub.es.sup.mC.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806700 N/A N/A 29459 29478 T.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 2792 G.sub.dsT.sub.esT.sub.eo.sup.mC.sub.esT.sub.es.sup.mC.sub.e 806701 N/A N/A 29460 29479 A.sub.esT.sub.eoT.sub.esT.sub.esT.sub.esT.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 2793 A.sub.dsG.sub.esT.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806708 N/A N/A 29454 29473 T.sub.esT.sub.eoG.sub.eoT.sub.esT.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 1901 T.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.esT.sub.e 806709 N/A N/A 29455 29474 T.sub.esT.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1902 .sup.mC.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 806710 N/A N/A 29456 29475 T.sub.esT.sub.eoT.sub.eoT.sub.esG.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1903 .sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 806711 N/A N/A 29458 29477 T.sub.esT.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds 2791 T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806712 N/A N/A 29459 29478 T.sub.esT.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 2792 G.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esT.sub.es.sup.mC.sub.e 806713 N/A N/A 29460 29479 A.sub.esT.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 2793 A.sub.dsG.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 806714 N/A N/A 29454 29473 T.sub.esT.sub.eoG.sub.esT.sub.esT.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 1901 T.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.esT.sub.e 806715 N/A N/A 29455 29474 T.sub.esT.sub.eoT.sub.esG.sub.esT.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1902 .sup.mC.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 806716 N/A N/A 29456 29475 T.sub.esT.sub.eoT.sub.esT.sub.esG.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds 1903 .sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 827592 N/A N/A 19633 19652 A.sub.es.sup.mC.sub.eoA.sub.eoG.sub.esA.sub.esT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 1703 T.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 827599 N/A N/A 19633 19652 A.sub.es.sup.mC.sub.eoA.sub.esG.sub.esA.sub.esT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 1703 T.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 827606 N/A N/A 19633 19652 A.sub.es.sup.mC.sub.eoA.sub.esG.sub.esA.sub.esT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 1703 T.sub.dsT.sub.ds.sup.mC.sub.esT.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 827607 N/A N/A 21224 21243 G.sub.esT.sub.eoT.sub.esG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds 1754 A.sub.dsT.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 827611 N/A N/A 23286 23305 .sup.mC.sub.esA.sub.eoT.sub.esA.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 1804 A.sub.dsG.sub.dsA.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 827617 N/A N/A 28456 28475 .sup.mC.sub.esA.sub.eoG.sub.esA.sub.es.sup.mC.sub.esT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 1887 T.sub.dsA.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 827630 N/A N/A 50920 50939 G.sub.esT.sub.eoT.sub.esT.sub.esT.sub.es.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 2193 T.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esA.sub.esA.sub.e 827649 N/A N/A 21224 21243 G.sub.esT.sub.eoT.sub.esG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds 1754 A.sub.dsT.sub.dsG.sub.esT.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 827653 N/A N/A 23286 23305 .sup.mC.sub.esA.sub.eoT.sub.esA.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 1804 A.sub.dsG.sub.dsA.sub.dsG.sub.esA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 827691 N/A N/A 21224 21243 G.sub.esT.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds 1754 A.sub.dsT.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 827695 N/A N/A 23286 23305 .sup.mC.sub.esA.sub.eoT.sub.eoA.sub.esT.sub.esT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 1804 A.sub.dsG.sub.dsA.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 827701 N/A N/A 28456 28475 .sup.mC.sub.esA.sub.eoG.sub.eoA.sub.es.sup.mC.sub.esT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 1887 T.sub.dsA.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 827714 N/A N/A 50920 50939 G.sub.esT.sub.eoT.sub.eoT.sub.esT.sub.es.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 2193 T.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esA.sub.esA.sub.e

Example 7: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(415) Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Comparator oligonucleotide 387978 was also tested. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.55 μM, 1.67 μM, 5.00 μM and 15.00 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC.sub.50 was calculated using the “log(inhibitor) vs. response—variable slope (4 parameters)” formula using Prism6 software.

(416) TABLE-US-00046 TABLE 46 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.55 μM 1.67 μM 5.00 μM 15.00 μM (μM) 387978 20 44 50 75 3.49 709533 19 51 59 87 2.27 709551 20 41 61 75 2.97 709556 16 30 62 82 3.34 709654 16 47 64 83 2.42 709581 12 31 61 83 3.41 709582 10 34 57 76 3.86 709640 3 22 54 80 4.62 709875 22 45 58 82 2.60 709882 33 41 50 86 2.57 709893 43 70 87 92 0.72 709900 28 50 58 75 2.31 709919 26 55 52 88 2.07 709924 12 36 56 76 3.77 709936 16 39 60 80 3.06 709944 42 72 81 90 0.71 709949 23 35 55 84 3.16 709967 35 65 62 81 1.17 709979 30 56 67 76 1.62

(417) TABLE-US-00047 TABLE 47 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.55 μM 1.67 μM 5.00 μM 15.00 μM (μM) 387978 14 19 57 76 4.58 709543 15 37 61 75 3.35 709544 33 47 71 87 1.61 709550 33 51 53 78 2.12 709573 26 48 64 82 2.08 709579 0 29 67 90 3.19 709580 19 8 58 86 4.49 709856 0 21 48 62 7.15 709592 1 24 51 73 5.29 709597 7 40 62 86 2.96 709651 17 26 45 71 5.65 709873 7 24 74 73 3.40 709891 19 40 62 80 2.82 709892 19 33 67 77 3.01 709897 27 40 55 86 2.67 709898 32 64 87 90 1.04 709909 0 23 59 72 4.70 709953 0 34 55 75 4.29 709966 23 56 78 87 1.51

(418) TABLE-US-00048 TABLE 48 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.55 μM 1.67 μM 5.00 μM 15.00 μM (μM) 387978 6 42 65 72 3.23 709536 50 68 83 86 <0.55 709548 18 37 59 76 3.33 709549 41 66 82 89 0.81 709555 20 45 53 58 4.93 709560 5 37 60 66 4.28 709572 43 54 64 79 1.12 709578 16 37 56 79 3.44 709591 0 23 50 86 4.64 709596 0 19 51 70 5.83 709632 14 39 65 77 2.97 709668 0 0 8 27 29.96 709788 0 12 40 72 7.11 709878 26 71 78 93 1.09 709879 17 50 84 93 1.66 709890 41 53 72 87 1.13 709915 37 64 65 86 1.07 709940 14 36 67 84 2.80 709977 37 34 49 68 4.04

(419) TABLE-US-00049 TABLE 49 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.55 μM 1.67 μM 5.00 μM 15.00 μM (μM) 387978 11 30 62 72 3.92 709534 23 48 67 81 2.11 709535 44 80 74 79 <0.55 709547 37 55 61 83 1.42 709558 27 56 56 56 3.29 709563 12 49 64 77 2.61 709565 25 60 68 78 1.62 709571 9 47 59 69 3.45 709576 12 37 69 68 3.28 709588 9 53 84 84 1.73 709625 0 24 47 76 5.44 709727 0 34 49 71 5.14 709751 0 8 27 57 11.73 709877 27 52 75 88 1.56 709881 18 29 58 72 4.10 709883 21 56 76 83 1.63 709894 25 37 76 90 2.08 709895 24 49 77 91 1.67 709912 4 36 54 73 4.32

Example 8: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(420) Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.48 μM, 1.44 μM, 4.33 μM, and 13.00 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(421) TABLE-US-00050 TABLE 50 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.48 μM 1.44 μM 4.33 μM 13.00 μM (μM) 740363 7 37 64 89 2.53 740364 28 35 63 83 2.3 740406 45 66 85 83 0.59 740407 46 79 84 93 0.51 740408 68 81 93 95 <0.48 740409 49 70 92 93 0.52 740410 43 70 80 90 0.62 740411 19 63 86 91 1.14 740412 31 68 75 93 0.92 740416 41 63 84 94 0.74 740422 51 69 86 86 0.43 740425 62 75 78 93 n/a 740427 45 75 87 63 <0.48 740429 33 56 72 86 1.16 740430 42 70 90 95 0.65 740432 0 0 0 17 >13 740438 32 54 67 89 1.29 740439 39 61 79 96 0.84 740440 36 55 79 94 1.01

(422) TABLE-US-00051 TABLE 51 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA Inhibition (% reduction) IC.sub.50 Number 0.48 μM 1.44 μM 4.33 μM 13.00 μM (μM) 740410 43 59 76 68 0.68 740414 29 44 69 71 1.91 740431 51 63 68 72 <0.48 740456 39 51 47 70 2.02 740482 30 44 63 70 2.14 740498 47 45 68 74 1.02 740500 46 53 79 78 0.74 740508 10 38 55 70 3.63 740509 44 67 80 85 0.6 740510 24 54 69 83 1.56 740513 19 35 66 44 6.31 740517 5 38 73 61 3.07 740527 0 47 65 80 2.43 740528 11 45 77 83 1.88 740533 12 29 76 81 2.43 740534 21 56 40 5 n/a 740535 7 37 24 62 9.22 740545 32 58 69 81 1.2 740612 0 16 69 65 4.02

(423) TABLE-US-00052 TABLE 52 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.48 μM 1.44 μM 4.33 μM 13.00 μM (μM) 740140 45 58 69 82 0.75 740585 19 46 66 62 2.70 740601 15 47 61 63 3.05 740604 16 34 45 62 5.64 740608 2 15 59 63 5.13 740610 8 43 58 56 4.49 740615 32 50 59 76 1.81 740625 7 33 49 78 3.88 740649 7 25 54 41 11.78 740650 25 34 54 66 3.80 740654 27 32 50 75 3.45 740668 36 41 53 44 >13 740670 0 40 45 32 >13 740692 21 28 52 65 4.64 740730 42 47 62 78 1.30 740783 36 48 48 74 2.23 740794 33 35 53 37 >13 740801 10 38 58 67 3.62 740802 19 12 55 63 5.73

(424) TABLE-US-00053 TABLE 53 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.48 μM 1.44 μM 4.33 μM 13.00 μM (μM) 740140 41 52 71 68 1.04 740796 3 28 51 54 6.89 740808 9 32 47 73 4.40 740851 2 21 46 74 5.05 740893 4 24 63 72 3.71 740894 0 20 46 33 >13 740904 6 19 51 72 4.81 740919 23 43 68 90 1.84 740922 0 23 49 63 5.89 740923 0 29 52 79 3.93 740927 8 29 58 82 3.30 740976 16 44 65 72 2.52 740997 0 26 61 74 3.69 741000 25 52 43 68 3.43 741001 34 52 65 78 1.41 741002 14 37 62 69 3.19 741005 6 19 45 65 6.14 741006 54 76 71 78 <0.48 741008 42 54 72 80 0.92

(425) TABLE-US-00054 TABLE 54 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.48 μM 1.44 μM 4.33 μM 13.00 μM (μM) 740140 35 60 71 81 1.03 740939 13 28 60 80 3.21 740941 8 30 38 83 4.55 740972 0 29 64 73 3.43 741009 0 32 52 83 3.62 741321 59 69 79 89 <0.48 741378 21 49 84 86 1.43 741410 57 79 85 92 <0.48 741455 53 69 88 87 <0.48 741472 11 40 61 60 3.83 741473 9 29 53 65 4.76 741477 32 32 50 49 10.65 741483 11 23 53 62 5.42 741487 19 39 72 70 2.36 741502 14 26 51 61 5.58 741514 0 27 41 73 5.34 741516 8 13 63 70 4.29 741525 9 32 58 61 4.70 741540 0 25 41 26 <0.48

Example 9: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(426) Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Comparator oligonucleotide 397978 was also tested. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.11 μM, 0.33 μM, 1.00 μM, and 3.00 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR. Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(427) TABLE-US-00055 TABLE 55 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.11 μM 0.33 μM 1.00 μM 3.00 μM (μM) 740140 16 43 62 90 0.51 741021 19 56 81 93 0.30 741022 28 62 83 87 0.24 741028 28 54 78 94 0.28 741029 36 57 87 83 0.22 741032 23 56 86 93 0.28 741037 26 64 88 89 0.23 741077 34 53 84 89 0.24 741122 30 69 88 87 0.20 741125 25 57 83 91 0.27 741169 34 66 94 96 0.19 741170 34 71 92 93 0.18 741189 35 56 81 95 0.23 741206 32 57 81 94 0.24 741207 26 63 91 96 0.23 741228 23 49 78 90 0.34 741229 10 58 81 95 0.31 741278 28 49 76 92 0.31 741379 22 70 86 93 0.22

(428) TABLE-US-00056 TABLE 56 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.11 μM 0.33 μM 1.00 μM 3.00 μM (μM) 740140 13 38 70 87 0.50 741016 30 42 74 91 0.36 741018 10 32 65 88 0.61 741019 14 20 56 86 0.82 741030 17 27 64 89 0.63 741034 12 28 47 80 0.93 741038 14 42 72 91 0.46 741039 63 42 70 93 0.11 741043 13 33 66 83 0.60 741047 29 45 72 94 0.35 741049 18 34 58 84 0.65 741073 4 46 75 93 0.43 741078 23 52 72 92 0.33 741080 15 37 66 78 0.59 741082 18 48 75 95 0.37 741083 17 36 72 82 0.51 741101 18 44 79 92 0.38 741111 0 29 68 88 0.64 741129 5 38 54 77 0.79

(429) TABLE-US-00057 TABLE 57 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.11 μM 0.33 μM 1.00 μM 3.00 μM (μM) 740140 39 34 69 81 0.39 741094 3 13 56 78 0.99 741110 5 26 47 66 1.26 741113 27 26 69 76 0.60 741167 16 37 70 79 0.54 741168 23 39 63 84 0.52 741178 29 34 58 77 0.62 741179 22 54 71 89 0.34 741188 0 25 70 77 0.70 741190 18 51 70 78 0.41 741191 23 37 63 82 0.55 741195 0 20 58 81 0.88 741197 20 34 69 76 0.58 741201 6 25 46 81 1.01 741205 14 34 66 87 0.57 741208 13 51 72 82 0.42 741227 8 30 61 78 0.74 741230 10 27 45 73 1.10 741231 0 20 33 82 1.31

(430) TABLE-US-00058 TABLE 58 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.11 μM 0.33 μM 1.00 μM 3.00 μM (μM) 387978 11 0 7 39 >3.0 740140 26 35 52 80 0.67 740432 19 36 53 74 0.77 741187 18 30 60 78 0.72 741214 7 18 52 79 1.00 741220 16 35 49 73 0.91 741234 20 41 71 85 0.45 741241 15 25 53 78 0.88 741246 3 26 54 68 1.06 741280 21 44 62 78 0.52 741301 22 46 66 84 0.44 741315 25 46 68 83 0.40 741320 17 36 65 85 0.55 741329 24 40 61 82 0.53 741330 13 36 69 85 0.55 741335 12 35 60 76 0.72 741368 18 46 72 87 0.42 741373 10 31 58 73 0.83 741393 17 37 67 82 0.54

Example 10: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(431) Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Compound No. 387985, previously disclosed in WO 2012/068405 was also tested and is comparator oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(432) TABLE-US-00059 TABLE 59 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 42 76 86 93 0.56 741140 77 74 96 86 <0.44 762851 24 45 76 93 1.45 762855 16 45 85 90 1.46 762858 25 55 84 96 1.11 762880 9 33 55 85 2.93 762882 75 92 94 90 0.07 762886 39 67 82 84 0.66 762891 25 61 88 93 0.97 762893 31 63 86 95 0.87 762899 42 74 88 82 0.53 762900 69 93 96 97 <0.44 762901 63 86 90 93 <0.44 762924 30 59 82 84 0.97 762926 40 63 80 92 0.72 762930 37 73 85 80 0.62 762932 42 72 94 93 0.58 762953 39 61 85 91 0.76 762969 60 72 86 92 <0.44

(433) TABLE-US-00060 TABLE 60 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 58 79 70 75 <0.44 741140 84 93 89 79 >12 762914 80 87 91 95 <0.44 762952 42 74 85 94 0.57 762960 34 54 79 82 1.01 762962 52 81 84 94 <0.44 762965 48 72 91 93 0.48 762987 37 69 86 75 0.65 763002 37 54 79 88 0.94 763019 30 51 77 91 1.19 763032 47 70 84 78 <0.44 763033 68 84 89 86 <0.44 763035 40 69 85 91 0.64 763040 36 67 85 94 0.73 763049 34 68 82 88 0.77 763050 54 87 87 84 <0.44 763052 54 75 85 91 <0.44 763059 4 67 83 89 1.08 763087 51 93 91 94 <0.44

(434) TABLE-US-00061 TABLE 61 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 48 60 61 75 n/a 741140 80 84 77 93 n/a 763065 22 55 73 89 1.32 763072 45 66 76 91 0.57 763075 39 58 86 89 0.78 763079 49 74 86 83 <0.44 763081 39 69 70 83 0.68 763084 50 73 75 89 <0.44 763085 57 81 88 83 <0.44 763088 73 72 79 89 <0.44 763102 20 55 77 68 1.51 763142 58 70 79 87 <0.44 763150 44 60 74 84 0.68 763151 39 71 68 82 0.64 763166 52 77 75 84 <0.44 763177 60 64 89 72 <0.44 763182 22 57 67 76 1.49 763196 52 68 86 83 <0.44 763207 49 73 79 82 <0.44

(435) TABLE-US-00062 TABLE 62 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 48 66 84 82 0.45 741140 77 88 89 97 <0.44 763145 79 81 74 92 <0.44 763185 31 64 79 86 0.90 763188 36 70 85 90 0.69 763216 41 72 68 94 0.61 763225 54 74 84 93 <0.44 763228 18 53 79 93 1.32 763233 45 68 83 94 0.56 763249 25 48 65 89 1.56 763272 38 60 89 95 0.77 763281 58 74 92 96 <0.44 763291 27 35 67 86 1.92 763299 52 71 83 87 <0.44 763309 43 43 72 76 1.11 763312 45 68 82 94 0.56 763333 12 55 85 81 1.32 763341 34 61 67 89 0.96 763364 51 74 72 90 <0.44

(436) TABLE-US-00063 TABLE 63 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 27 47 55 55 3.65 741140 48 56 56 49 <0.44 763295 22 51 64 71 1.88 763305 28 52 54 71 2.05 763348 27 40 51 68 3.12 763355 43 49 51 62 1.77 763359 35 57 61 68 1.32 763360 49 55 71 74 0.55 763370 18 54 61 75 1.93 763373 44 45 69 70 1.09 763384 23 52 40 69 3.43 763391 28 48 55 66 2.49 763393 49 36 50 71 1.96 763394 25 41 71 86 1.68 763418 0 31 57 41 9.00 763434 38 66 50 65 1.04 763440 25 46 49 51 <0.44 763481 34 51 57 69 1.74 763491 32 47 54 64 2.53

(437) TABLE-US-00064 TABLE 64 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 47 59 54 50 <0.44 741140 62 58 74 68 <0.44 763466 19 47 55 66 2.87 763485 34 49 71 70 1.33 763492 7 44 40 62 5.24 763501 25 36 59 62 3.35 763612 33 44 45 71 2.76 763627 39 62 60 68 0.91 763628 22 48 42 57 <0.44 763629 31 48 53 76 2.00 763634 26 41 44 57 5.83 763640 12 44 31 74 4.70 763641 6 33 51 76 3.58 763643 16 32 49 57 5.74 763645 18 36 55 71 3.22 763650 45 61 46 65 0.83 763651 43 60 64 59 0.62 763671 17 47 43 59 5.08 763741 23 37 61 71 2.64

(438) TABLE-US-00065 TABLE 65 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 42 61 84 75 0.65 741140 72 79 92 94 <0.44  762837* 20 37 62 81 2.4 763684 13 44 75 92 1.69 763685 27 64 83 90 0.95 763693 3 15 58 76 3.88 763701 1 38 74 77 2.26 763702 16 37 68 84 2.15 763706 12 48 57 86 2.17 763712 18 50 56 89 1.90 763721 1 37 61 60 3.90 763723 19 42 65 77 2.16 763734 0 22 56 77 3.78 763740 32 47 77 88 1.23 763749 24 61 81 71 1.16 763755 8 45 57 72 2.82 763778 25 59 78 76 1.18 763793 41 71 81 93 0.61 763823 23 60 82 71 1.17 *Values represent the average of three experiments

(439) TABLE-US-00066 TABLE 66 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides in SH-SY5Y cells Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 50 59 68 93 0.58 741140 75 64 83 88 n/a 762837 12 37 64 82 2.43 762837 27 33 51 86 2.64 763795 17 42 62 79 2.26 763798 25 43 63 78 2.00 763817 10 38 57 88 2.55 763818 24 53 52 92 1.72 763829 41 68 66 94 0.68 763876 33 65 83 84 0.81 763877 25 49 47 83 2.23 763882 27 57 67 86 1.27 763883 44 63 71 92 0.67 763884 25 42 64 78 2.00 763936 19 31 56 80 2.92 763939 18 27 54 65 4.27 763949 12 28 58 67 3.83 763972 0 36 46 67 4.60 763985 6 28 60 65 3.86

(440) TABLE-US-00067 TABLE 67 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 41 60 74 82 0.73 741140 79 89 91 87 <0.44 763295 8 38 77 91 1.88 763305 19 52 75 89 1.41 763348 28 62 78 93 0.97 763355 25 61 86 85 0.99 763359 49 76 90 94 0.45 763360 60 86 94 94 <0.44 763370 28 68 89 90 0.83 763373 51 59 79 90 0.51 763384 37 67 85 92 0.70 763391 30 64 79 82 0.94 763393 35 76 84 93 0.67 763394 36 76 83 96 0.65 763418 0 26 54 81 3.52 763434 40 73 91 92 0.60 763440 15 51 74 83 1.57 763481 35 73 84 88 0.68 763491 31 53 80 83 1.11

(441) TABLE-US-00068 TABLE 68 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 740140 36 53 69 87 1.08 741140 60 70 87 88 <0.44 763466 27 52 74 80 1.34 763485 36 66 80 87 0.75 763492 9 41 71 87 1.97 763501 24 48 71 79 1.58 763612 37 63 82 90 0.76 763627 41 63 84 82 0.66 763628 44 72 85 86 0.53 763629 29 59 80 85 1.02 763634 22 55 81 92 1.18 763640 34 48 80 88 1.13 763641 21 53 79 82 1.33 763643 35 53 82 82 0.97 763645 0 55 65 84 1.93 763650 46 71 81 92 0.51 763651 40 57 82 86 0.79 763671 0 31 54 76 3.55 763741 32 40 71 73 1.71

(442) TABLE-US-00069 TABLE 69 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides Compound SNCA inhibition (% reduction) IC.sub.50 Number 0.44 μM 1.33 μM 4.00 μM 12.00 μM (μM) 387985 0 22 48 67 5.00 789243 9 38 66 79 2.40 827599 52 71 86 91 0.40

Example 11: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(443) Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Compound No. 387985, previously disclosed in WO 2012/068405 was also tested and is comparator oligonucleotide. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(444) TABLE-US-00070 TABLE 70 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides SNCA inhibition (% reduction) Compound 0.032 0.160 0.800 4.000 20.000 IC.sub.50 Number μM μM μM μM μM (μM) 762837 0 7 33 76.1 91 1.72 762901 8 33 73 91 93 0.32 762952 0 15 67 81 95 0.57 763002 0 8 47 75 94 1.10 763032 11 35 71 77 96 0.36 763085 0 31 63 83 94 0.47 763364 0 16 51 81 89 0.86 763391 0 14 48 71 91 1.10 788833 0 8 39 77 90 1.31 789239 0 0 14 61 87 3.02 789242 0 1 27 60 85 2.67 789243 0 1 27 64 90 2.25

(445) TABLE-US-00071 TABLE 71 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides SNCA inhibition (% reduction) Compound 0.032 0.160 0.800 4.000 20.000 IC.sub.50 Number μM μM μM μM μM (μM) 387985 0 0 13 54 77 4.20 789243 0 7 31 69 85 1.90 827599 10 34 65 84 91 0.40

Example 12: Effect of Modified Oligonucleotides on Human SNCA In Vitro, Multiple Doses

(446) Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells. Cells were plated at a density of 5,000 cells per well and transfected by free uptake with 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(447) TABLE-US-00072 TABLE 72 Dose-dependent percent reduction of human SNCA mRNA by modified oligonucleotides SNCA inhibition (% reduction) Compound 0.032 0.160 0.800 4.000 20.000 IC.sub.50 Number μM μM μM μM μM (μM) 762837 0 6 7 33 51 16.95 762901 1 28 53 60 81 1.20 762952 16 38 59 81 93 0.41 763002 0 6 41 71 87 1.49 763032 12 60 89 96 97 0.13 763085 2 19 75 90 96 0.40 763364 38 57 77 93 97 0.09 763391 5 28 71 92 95 0.37 788833 8 23 53 71 93 0.82 789239 6 0 32 32 45 0.00 789242 0 0 4 32 66 9.78 789243 0 3 13 39 66 8.02

Example 13: Effect of Modified Oligonucleotides on Rhesus Monkey SNCA In Vitro, Multiple Doses

(448) Several of the modified oligonucleotides described hereinabove are complementary to rhesus monkey Human-monkey cross reactive modified oligonucleotides selected from the examples above were tested at various doses in LLC-MK2 monkey cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 6.9 nM, 20.5 nM, 61.8 nM, 185.2 nM, 500.0 nM, 1700.0 nM, 5000.0 nM, and 15,000.0 nM concentrations of modified oligonucleotide, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is also presented in the table below. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(449) TABLE-US-00073 TABLE 73 Dose-dependent percent reduction of rhesus monkey SNCA mRNA by modified oligonucleotides SNCA Inhibition (% Reduction) Compound 6.9 20.5 61.8 185.2 500.0 1700.0 5000.0 15,000.0 IC.sub.50 No. nM nM nM nM nM nM nM nM (μM) 709534 0 0 0 0 8 46 66 79 2.8 709535 0 0 0 7 28 59 84 90 1.4 709536 0 0 0 16 44 66 78 90 1.1 709883 0 0 0 0 36 61 76 88 1.5 709967 0 0 0 0 8 35 73 90 2.5  741082* 0 0 0 0 0 0 36 78 7.0 *one mismatch to rhesus monkey

Example 14: Effect of Modified Oligonucleotides on Monkey SNCA In Vitro, Multiple Doses

(450) Several of the modified oligonucleotides described hereinabove are complementary to rhesus monkeys. Human-monkey cross reactive modified oligonucleotides selected from the examples above were tested at various doses in LLC-MK2 monkey cells. Modified oligonucleotides with 1-3 mismatches to rhesus monkey sequence are marked in the table below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μN concentrations of modified oligonucleotide, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA, relative to untreated control. As illustrated in the tables below, SNCA mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells.

(451) TABLE-US-00074 TABLE 74 Dose-dependent percent reduction of rhesus monkey SNCA mRNA by modified oligonucleotides SNCA inhibition (% reduction) Compound 0.032 0.160 0.800 4.000 20.000 IC.sub.50 Number μM μM μM μM μM (μM) 762837 0 0 5 57 84 3.67 762901 0 18 47 88 98 0.80  762952** 0 0 0 14 53 17.90 763002 12 0 36 85 93 1.23 763032 6 29 63 85 94 0.47  763085* 0 0 28 60 81 2.75  763364* 0 0 28 58 85 2.77 763391 0 3 50 65 87 1.46 788833 0 0 15 59 84 3.30 789239 0 0 3 45 78 5.61 789242 0 0 5 41 78 6.05 789243 0 0 19 56 85 3.28 *one mismatch to monkey; **two mismatches to monkey

Example 15: Effect of Modified Oligonucleotides on Human SNCA in Human Neurons by Free Uptake, Single Dose

(452) Selected modified oligonucleotides complementary to human SNCA were tested for their effects on SCNA mRNA levels in human neurons in vitro by free uptake. Human IPS-cell derived neurons were plated at a density of 35,000 cells per well. After approximately 24 hours, 20 μM modified oligonucleotide was added and incubated with the cultured cells for 7 days. After 7 days, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA relative to untreated control cells. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(453) TABLE-US-00075 TABLE 75 Percent reduction of human SNCA mRNA in human neurons by free uptake Compound No % Reduction 709897 53 740425 58 741082 98 762836 80 762837 79 762838 75 762839 64 762840 54 762895 60 762896 63 762898 82 762899 86 762900 85 762901 41 762914 74 762948 33 762949 96 762951 45 762952 77 763001 84 763002 82 763003 86 763004 82 763032 88 763033 82 763035 68 763040 71 763050 78 763084 89 763085 95 763087 78 763102 66 763196 56 763207 90 763216 65 763233 68 763364 83 763391 95 763393 81 763813 57 763817 51 763818 61 788815 63 788816 67 788820 63 788821 69 788822 76 788823 81 788824 73 788830 64 788831 67 788832 73 788833 79 788855 83 788856 85 788889 70 788890 47 789235 36 789236 80 789237 61 789239 56 789240 44 789242 81 789243 77 789244 66 789245 59 789246 46

Example 16: Effect of Modified Oligonucleotides on Human SNCA in Human Neurons by Free Uptake, Multiple Dose

(454) Selected modified oligonucleotides complementary to human SNCA were tested for their effects on SCNA mRNA levels in human neurons in vitro by free uptake Human IPS-cell derived neurons were plated at a density of 35,000 cells per well and incubated with 247.00 nM, 740.70 nM, 2.22 μM, 6.66 μM, or 20.00 μM oligonucleotide. After a treatment period of 5 days total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human SNCA primer probe set RTS2621 (described hereinabove in Example 1) was used to measure mRNA levels. SNCA mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SNCA mRNA relative to untreated control cells. A value of 0% reduction indicates that the compound had no effect or increased mRNA concentrations in the cell. As shown below, modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

(455) TABLE-US-00076 TABLE 76 Dose-dependent percent reduction of human SNCA mRNA in human neurons by free uptake SNCA inhibition (% reduction) Compound 0.247 0.741 2.220 6.660 20.000 IC.sub.50 Number μM μM μM μM μM (μM) 709534 0 0 0 3 11 >20 709535 0 0 20 35 51 16.97 709536 0 12 21 55 68 7.01 709883 19 0 22 15 22 >20 709967 0 0 0 0 42 >20 741082 25 25 63 87 95 1.37

Example 17: Tolerability of Modified Oligonucleotides Complementary to Human SNCA in Mice, 700 μg Dose

(456) Modified oligonucleotides described above were tested in mice to assess the tolerability of the oligonucleotides. Compound No. 387985, previously disclosed in WO 2012/068405 was also tested and is comparator oligonucleotide. Wild type C57/B16 mice each received a single ICV dose of 700 μg of oligonucleotide listed in the table below. Each treatment group consisted of 4 mice. A group of four mice received PBS as a negative control. At 3 hours post-injection, mice were evaluated according to 7 different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing. For each of the 7 criteria, a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below.

(457) TABLE-US-00077 TABLE 77 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hour PBS 0.0 762836 0.0 762838 0.5 762839 0.8 762840 0.0 762880 5.8 762899 1.8 762900 1.8 762901 0.0 762932 4.5 762952 0.0 762953 2.0 763004 0.0 763052 6.5 763102 3.5 763391 0.0 763392 3.0 763393 4.0 763394 0.8 763811 7.0 763812 5.5 763813 3.8 763814 3.5 763815 6.8 763817 2.0 763818 3.8

(458) TABLE-US-00078 TABLE 78 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hour 709897 0.0 709940 1.8 740416 1.3 741073 2.5 741168 5.8 741205 0.0 741229 1.0 741301 2.5 741330 3.3 762898 4.5 762949 3.8 762951 1.8 762955 2.3 763035 0.8 763040 2.8 763050 1.5 763079 6.5 763084 2.0 763085 0.8 763087 2.8 763088 4.5 763150 7.0 763151 6.8 763188 6.3 763196 2.0 763216 3.0 763225 6.8 763281 7.0 763299 5.0 763312 2.3 763359 7.0 763384 2.3 763481 5.3 763485 0.0 763650 6.8 762954 6.3

(459) TABLE-US-00079 TABLE 79 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hour PBS 0.0 709548 0.0 709632 6.3 740439 3.5 741018 6.8 741038 0.0 762895 3.0 762896 5.0 762897 6.0 762926 3.8 762946 2.0 762947 2.8 762948 1.3 762950 1.3 762956 6.0 763033 0.0

(460) TABLE-US-00080 TABLE 80 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hour PBS 0.0 788813 2.8 788814 0.8 788815 0.0 788816 0.0 788817 0.0 788818 0.0 788819 4.8 788820 2.3 789229 0.5 789230 0.0 789232 0.0 789233 0.0 789234 4.3 789235 4.3 789236 0.0 789237 0.0 789238 0.0 789239 0.0 789240 6.0 789241 5.0 789242 0.3 789243 0.3 789244 0.0 789245 0.0

(461) TABLE-US-00081 TABLE 81 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hr PBS 0.0 762837 0.0 762901 0.0 762952 0.3 763002 0.3 763032 5.0 763085 1.3 763364 1.3 763391 2.3 788833 0.0 789239 0.0 789242 0.0 789243 0.0

(462) TABLE-US-00082 TABLE 82 Tolerability scores in mice at 700 μg dose PBS 0.0 387985 6.0 827592 0.0 827599 0.0 827606 0.0 827607 1.0 827611 0.5 827617 5.5 827630 0.0 827649 3.8 827653 3.3 827691 1.5 827695 0.0 827701 1.0 827714 0.0

Example 18: Tolerability of Modified Oligonucleotides Complementary to Human SNCA in Rats, 3 mg Dose

(463) Modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Compound No. 387985, previously disclosed in WO 2012/068405 was also tested and is comparator oligonucleotide. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of oligonucleotide listed in the table below. Each treatment group consisted of 4 rats. A group of four rats received PBS as a negative control. At 3 hours post-injection, movement in 7 different parts of the body were evaluated for each rat. The 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. Results are presented as the average score for each treatment group.

(464) TABLE-US-00083 TABLE 83 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.0 762948 2.3 762949 2.0 762951 0.8 763001 1.3 763002 2.5 763003 2.5 763040 1.0 763050 3.0 763084 4.0 763085 2.0 763087 2.8 763196 3.0 763233 3.3 763391 0.0

(465) TABLE-US-00084 TABLE 87 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.3 762946 1.5 762969 0.3 763394 3.5 763813 1.8 763817 4.5 763818 3.0 789235 3.3 789236 0.8  789237* 2.0 789239 0.0 789242 1.0 789243 1.8 789244 0.8 789245 0.5 *789237 group had 5 rats

(466) TABLE-US-00085 TABLE 85 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.0 762932 5.0 762962 6.0 763485 3.0 789231 2.5 806693 4.5 806694 3.0 806695 5.0 806697 1.3 806698 4.3 806700 5.3 806701 4.0 806714 3.5 806715 2.3 806716 3.5

(467) TABLE-US-00086 TABLE 86 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.0 806708 2.8 806709 2.0 806710 3.3 806711 3.8 806712 3.5 806713 2.8

(468) TABLE-US-00087 TABLE 87 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.0 762836 2.3 762837 1.0 762838 0.5 762839 0.0 762840 0.0 762895 3.5 762896 2.5 762899 2.8 763032 4.8 763364 3.3 788833 1.0 788890 3.0 763207 2.8  806716* 3.0 *806716 group only contained 2 mice

(469) TABLE-US-00088 TABLE 88 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.0 762837 1.0 762901 2.8 762952 4.0 763002 3.3 763032 4.5 763085 4.0 763364 4.0 763391 1.3 788833 0.8 789239 0.5 789242 3.0 789243 1.5

(470) TABLE-US-00089 TABLE 89 Tolerability scores in rats at 3 mg dose Compound No. FOB 3 hr PBS 0.25 387985 3.8 827592 3.5 827599 2.0 827606 4.0 827607 1.0 827611 2.5 827617 3.0 827630 1.0 827649 5.5 827653 2.4 827691 3.3 827695 1.8 827701 2.5 827714 0.3

Example 19: Potency of Modified Oligonucleotides Complementary to Human SNCA in Transgenic Mice

(471) Modified oligonucleotides described above were tested in the SNCA PAC transgenic mouse model which uses bacterial P1 artificial chromosome (PAC) containing the entire wild-type human SNCA gene.

(472) Treatment

(473) The SNCA PAC mice were divided into groups of 4-8 mice each. Two groups were tested with each compound. Groups were given a single ICV bolus of oligonucleotide at a dose of 10, 30, 100, 300, or 700 μg and sacrificed two weeks later. The PBS-injected group served as the control group to which oligonucleotide-treated groups were compared.

(474) RNA Analysis

(475) After two weeks, mice were sacrificed and RNA was extracted from cortical brain tissue for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA LTS00672 (forward sequence TGGCAGAAGCAGCAGGAAA, designated herein as SEQ ID NO: 14; reverse sequence TCCTTGGTTTTGGAGCCTACA, designated herein as SEQ ID NO: 15; probe sequence 5′-FAM-CAAAAGAGGGTGTTCTC-3′MGB, designated herein as SEQ ID NO: 16.). Results are presented as percent change of mRNA, relative to PBS control, normalized with cyclophilin A.

(476) As shown in the table below, treatment with modified oligonucleotides resulted in significant reduction of SNCA mRNA in comparison to the PBS control. Results are a combination of two individual studies Animals were removed from analysis using ROUT at 1% to remove outliers. 763085 had 3 animals removed with ROUT analysis and 1 animal did not survive surgery. 763364 had 2 animals removed with ROUT analysis. 763391 had one animal removed with a value of 253% of control and 3 animals did not survive surgery. 789243 had 1 animal removed with ROUT analysis. 827599 had 4 animals removed with ROUT analysis.

(477) TABLE-US-00090 TABLE 90 Dose-dependent percent reduction of human SNCA mRNAin transgenic mice Cortex ED50 Compound No. Dose (μg) % Reduction (μg) PBS — — 763085 10 0 35 30 47 100 72 300 96 700 94 763364 10 35 21 30 55 100 87 300 90 700 97 763391 10 17 19 30 67 100 68 300 93 700 94 789243 10 35 61 30 20 100 60 300 85 700 92 827599 10 1 56 30 25 100 81 300 87 700 95

Example 20: Potency of Modified Oligonucleotides Complementary to Human SNCA in Transgenic Mice

(478) Modified oligonucleotides described above were tested in the SNCA PAC transgenic mouse model which uses bacterial P1 artificial chromosome (PAC) containing the entire wild-type human SNCA gene.

(479) Treatment

(480) The SNCA PAC mice were divided into groups of 10 mice each. Two groups were tested with each compound. Groups were given a single ICV bolus of oligonucleotide at a dose of 10, 30, 100, 300, or 700 μg and sacrificed two weeks later. The PBS-injected group served as the control group to which oligonucleotide-treated groups were compared.

(481) RNA Analysis

(482) After two weeks, mice were sacrificed and RNA was extracted from cortical brain tissue for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA LTS00672 (forward sequence TGGCAGAAGCAGCAGGAAA, designated herein as SEQ ID NO: 14; reverse sequence TCCTTGGTTTTGGAGCCTACA, designated herein as SEQ ID NO: 15; probe sequence 5′-FAM-CAAAAGAGGGTGTTCTC-3′MGB, designated herein as SEQ ID NO: 16.). Results are presented as percent change of mRNA, relative to PBS control, normalized with cyclophilin A.

(483) As shown in the table below, treatment with modified oligonucleotides resulted in significant reduction of SNCA mRNA in comparison to the PBS control Animals were removed from analysis using ROUT at 1% to remove outliers. The values in the table below are the average of 10 animals for all groups except the 700 μg dose, which is the average of 7 animals

(484) TABLE-US-00091 TABLE 91 Dose-dependent percent reduction of human SNCA mRNAin transgenic mice Dose modified oligonucleotide Compound 10 30 100 300 700 ED50 No. PBS μg μg μg μg μg (μg) 763391 0 36 51 92 94 97 21

Example 21: Potency of Modified Oligonucleotides Targeting Human SNCA in Non-Human Primates, 2 Week Study

(485) Modified oligonucleotides described above were further evaluated for potency in non-human primates (NHP).

(486) Treatment

(487) Female cynomolgus monkeys were divided into groups of 4 NHP each. Groups received a single IT bolus of 35 mg of modified oligonucleotide 789243, 763391, 763364, 763085, or 827599. One group of NHP received a dose of artificial cerebrospinal fluid (aCSF). The aCSF-injected group served as the control group to which oligonucleotide-treated groups were compared. After two weeks, NHP were sacrificed and tissues were collected for analysis.

(488) RNA Analysis

(489) RNA was extracted from various neural tissues for real-time PCR analysis of mRNA expression of SNCA as in the previous example. Results are presented as percent change of mRNA, relative to aCSF control, normalized with NHP Cyclophylin A. As shown in the table below, treatment with modified oligonucleotides resulted in reduction of SNCA mRNA in comparison to the PBS control with some of the treatment groups. The lumbar cord is an average of 3 NHP for 763391 because one lumbar sample was only able to obtain cauda aquina, and thus not from the lumbar region.

(490) TABLE-US-00092 TABLE 92 Reduction of human SNCA mRNA in Non-Human Primates % Reduction Lumbar Spinal Frontal Thoracic Temporal Compound No Cord Cortex cord cortex aCSF 0 0 0 0  763085* 22 9 9 5  763364* 0 10 0 10 763391 85 50 59 45 789243 38 34 26 3 827599 51 29 32 28 *These two oligos each contain single mismatch to cynomolgus SNCA

Example 22: Potency of Modified Oligonucleotides Targeting Human SNCA in Non-Human Primates, 13 Week Study

(491) Modified oligonucleotides described above were further evaluated for potency and tolerability in non-human primates (NHP).

(492) Treatment

(493) Female cynomolgus monkeys were divided into groups of 4 NHP each. Groups received an IT bolus dose of 35 mg of Compund 763391 or Compund 827599 on day one, on day 14, and then monthly for a total of 5 doses. One group of NHP received doses of aCSF rather than oligonucleotide. The aCSF-injected group served as the control group to which oligonucleotide-treated groups were compared. A week after the final dose, NHP were sacrificed and tissues were collected for analysis.

(494) RNA Analysis

(495) RNA was extracted from various neural tissues for real-time PCR analysis of mRNA expression of SNCA as in examples above. Results are presented as percent change of mRNA, relative to aCSF control, normalized with monkey Cyclophylin A.

(496) As shown in the table below, treatment with modified oligonucleotides resulted in reduction of SNCA mRNA in comparison to the PBS control.

(497) TABLE-US-00093 TABLE 93 Reduction of human SNCA mRNA in Non-Human Primates % Reduction Midbrain Cervical Thoracic Lumbar (level of Comp Spinal Spinal Spinal Motor Frontal Substantia No Cord Cord Cord Cortex Cortex Caudate Amygdala Pons nigra) Putamen aCSF 0 0 0 0 0 0 0 0 0 0 763391 96 96 97 98 98 57 98 77 83 9 827599 68 80 95 61 72 27 70 41 31 0

(498) TABLE-US-00094 TABLE 94 Reduction of human SNCA mRNA in Cynomolgus Monkeys % Reduction Medulla Comp. Cerebellar Corpus Ent Hippo Insular (rostral and Caudal Central No Peduncle Collosum DCN Cortex campus Hypo Cortex dorsal) Medulla Gray aCSF 0 0 0 0 0 0 0 0 0 0 763391 90 91 47 97 90 78 97 74 90 68 827599 61 67 37 71 25 25 68 38 54 9

(499) TABLE-US-00095 TABLE 95 Reduction of human SNCA mRNA in Cynomolgus Monkeys % Reduction Dorsal Rostral Comp VPM/ Occipital Cerebral Temporal Medial Globus VA/ Ventral Superior No VPL Pulvinar cortex cortex Cortex Thalamus Pallidus VL Medulla Colliculi aCSF 0 0 0 0 0 0 0 0 0 0 763391 63 96 96 58 97 12 56 45 84 68 827599 26 59 58 0 72 0 0 13 52 9

Example 23: Treatment of SNCA Pathology in Pre-Formed Fibril (PFF) Model in Wild-Type Mouse, Prophylactic Treatment

(500) Experimental Model

(501) The PFF (pre-formed fibril) model in mouse is an experimental model that has been used to investigate treatments for Parkinson's disease, as described in Luk, et. al., Science. 2012 Nov. 16; 338(6109):949-53. A single intrastriatal injection of pre-formed SNCA fibrils generates Lewy body pathology characteristic of Parkinson's disease.

(502) Modified Oligonucleotide

(503) Compound No: 678363 is a 4-8-5 MOE and cEt gapmer that is 100% complementary to mouse SNCA, having a sequence of (from 5′ to 3′) TTTAATTACTTCCACCA (incorporated herein as SEQ ID NO:23), having a sugar motif of (from 5′ to 3′): eeekddddddddkeeee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and ‘k’ represents a cEt modified sugar; and an internucleoside linkage motif of (from 5′ to 3′) soosssssssssooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.

(504) Experimental Protocol

(505) Three groups of twelve mice wild-type B6C3F1 mice were treated according to the table below. 700 μg modified oligonucleotide or PBS was administered via ICV (intracerebroventricial) injection on day 0, and pre-formed fibrils were administered into the striatum on day 14. On day 56, a wirehang test was performed to measure motor function, and mice were sacrificed for mRNA and histological analysis. P-α-Syn aggregates in the substantia nigra were stained and quantified. Mouse SNCA mRNA was measured with RT-PCR as described above, using mouse primer probe set RTS2956 (forward sequence GTCATTGCACCCAATCTCCTAAG, designated herein as SEQ ID NO: 17; reverse sequence GACTGGGCACATTGGAACTGA, designated herein as SEQ ID NO: 18; probe sequence CGGCTGCTCTTCCATGGCGTACAA, designated herein as SEQ ID: 19). SNCA mRNA levels were normalized to cyclophilin A and are presented as % of mRNA level in PBS-treated mice. As shown in the table below, modified oligonucleotide treated mice had reduced SNCA mRNA, fewer aggregates in substantia nigra and improved performance on the wirehang test as compared to PBS treated mice.

(506) TABLE-US-00096 TABLE 96 Pre-formed fibril (PFF) model in wild- type mouse, prophylactic treatment Avg. # aggregates Treatment SNCA mRNA in Treatment Day Day Mid- stri- substantia Wirehang group 0 14 brain atum nigra (seconds) Naïve (Naïve) PBS none 90 98 0 192 ± 82 PBS + PFF PBS PFF 100 100 42  94 ± 69 (PBS) 678363 + PFF 678363 PFF 51 47 0.64 154 ± 64 (Treatment)

Example 24: Treatment of SNCA Pathology in Pre-Formed Fibril (PFF) Model in Mouse, Post-Symptomatic Treatment

(507) Experimental Protocol

(508) Three groups of twelve wild-type B6C3F1 mice were treated according to the table below. Pre-formed fibrils were administered into the striatum on day 0 and 700 μg modified oligonucleotide or PBS was administered via ICV (intracerebroventricial) injection on day 14. On day 56, a wirehang test was performed to measure motor function, and mice were sacrificed for mRNA and histological analysis. Phosphorylated-α-Syn aggregates in the substantia nigra were stained and quantified. Mouse SNCA mRNA was measured as in the previous example and normalized to PBS treated mice. As shown in the table below, modified oligonucleotide treated mice had reduced SNCA mRNA and fewer aggregates in substantia nigra and improved performance on the wirehang test as compared to PBS treated mice.

(509) TABLE-US-00097 TABLE 97 Pre-formed fibril (PFF) model in wild- type mouse, post-symptomatic treatment Avg. # Treatment SNCA mRNA p-αSyn Treatment Day Day Mid- stri- aggregates Wirehang group 0 14 brain atum in SN (s) Naïve (Naïve) PBS none 102 85 0 226 ± 88 PFF + PBS PFF PBS 100 100 49.4  58 ± 63 (PBS) PFF + 678363 PFF 678363 32 32 1.9 132 ± 77 (Treatment)

Example 25: Treatment of SNCA Pathology in Pre-Formed Fibril (PFF) Model in Mouse, Long-Term Prophylactic Treatment

(510) Experimental Protocol

(511) Three groups of twelve mice wild-type B6C.sub.3F1 mice were treated according to the table below. 700 μg modified oligonucleotide (control or treatment) or PBS was administered via ICV (intracerebroventricial) injection on day 0, pre-formed fibrils were administered into the striatum on day 14, and an additional 700 μg modified oligonucleotide or PBS was administered via ICV on day 90.

(512) Control groups included a PBS-treated group and Compound No. 676630-treated group. Compound No: 676630 is a 5-10-5 MOE gapmer that is not complementary to mouse SNCA, having a sequence of (from 5′ to 3′) CCTATAGGACTATCCAGGAA (incorporated herein as SEQ ID NO: 2795) and having an internucleoside linkage motif of (from 5′ to 3′) sooosssssssssssoos, wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.

(513) On day 180, mice were sacrificed for mRNA and histological analysis. Phosphorylated-α-Syn aggregates and neurtic pathology in the substantia nigra were stained and quantified for 6 mice in each group. Additionally, the number of TH (tyrosine hydroxylase)+cells in the substantia nigra pars compacta (SNpc), which is measure of death of dopaminergic neurons, were quantified for 6 mice in each group. Results are presented relative to the PBS-treated group. As shown in the table below, Compound No. 677363-treated mice had reduced SNCA mRNA, fewer aggregates in substantia nigra, and reduced neuritic pathology in substantia nigra as compared to PBS and 676630-treated mice.

(514) TABLE-US-00098 TABLE 98 Pre-formed fibril (PFF) model in wild-type mouse, long-term prophylactic treatment Avg. # Avg. # Treatment p-αSyn neuritic TH cells Treatment Day Day Day SNCA mRNA aggregates pathology (% PBS) group 0 14 90 Midbrain striatum in SN in SN in SNpc PFF + PBS PBS PFF PBS 100 100 271 1002  100 676630 676630 PFF 676630 95 107  160* 580* 99 (Control) 678363 678363 PFF 678363 59 70    0.7 51 139 (Treatment) *number represents the average from 4 mice.

Example 26: Tolerability of Modified Oligonucleotides Complementary to Human SNCA in Mice, 700 μg Dose

(515) Modified oligonucleotides described above were tested against Compound Nos. 1233344 and 1233345 (described herein below) to assess the tolerability of the oligonucleotides.

(516) Compound No. 1233344 is a 15-mer gapmer, that is complementary to SNCA (wherein the 5′-most nucleoside to which the gapmer targets SEQ ID NO: 1 is at position 370), having a sequence of (from 5′ to 3′) CTACATAGAGAACAC (incorporated herein as SEQ m No. 2796), wherein each of the nucleosides 1-3, nucleoside 13 and nucleoside 14 (from 5′ to 3′) comprise an LNA sugar modification, and each of the nucleosides 442 and nucleoside 15 are deoxynucleosides, wherein the internucleoside linkages between the nucleosides are phosphorothioate internucleoside linkages, Compound. No. 1233344 is characterized by the following chemical notation: C.sub.lnasT.sub.lnasA.sub.lnasC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsC.sub.lnasC.sub.d wherein,

(517) A=an adenine nucleobase.

(518) C=a cytosine nucleobase.

(519) G=a guanine nucleobase,

(520) T=a thymine nucleobase,

(521) d=a 2′-deoxyribose sugar,

(522) s=a phosphorothioate internucleoside linkage, and

(523) lna=an LNA modified sugar.

(524) Compound No. 1233345 is a 15-mer gapmer, that is complementary to SNCA (wherein the 5′-most nucleoside to which the gapmer targets SEQ ID NO: 1 is at position 372), having a sequence of (from 5′ to 3′) GCCTACATAGAGAAC (incorporated herein as SEQ m No.: 2797), wherein each of the nucleosides 1-3, nucleoside 13 and nucleoside 14 (from 5′ to 3′) comprise an LNA sugar modification, and each of the nucleosides 442 and nucleoside 15 are deoxynucleosides, wherein the internucleoside linkages between the nucleosides are phosphorothioate internucleoside linkages. Compound. No, 1233345 is characterized by the following chemical notation: G.sub.lnasC.sub.lnasC.sub.lnasT.sub.dsA.sub.dsC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.lnasA.sub.lnasC.sub.d wherein,

(525) A=an adenine nucleobase.

(526) C=a cytosine nucleobase,

(527) G=a guanine nucleobase,

(528) T=a thymine nucleobase,

(529) d a 2′-deoxyribose sugar,

(530) s=a phosphorothioate internucleoside linkage, and

(531) lna=an LNA modified sugar.

(532) Treatment

(533) Wildtype C57BL/6 mice each received a single ICV dose of 700 μg of modified oligonucleotide listed in the table below. Each treatment group consisted of 4 mice. A group of four mice received PBS as a negative control. At 3 hours post-injection, mice were evaluated according to 7 different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching, (7) regular breathing. For each of the 7 criteria, a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all the 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below.

(534) TABLE-US-00099 TABLE 99 Tolerability scores in mice at 700 μg dose Compound No. FOB 3 hour PBS 0.0 763085 2.3 763364 2.8 763391 0.0 789243 1.0 827599 1.0 1233345  6.8 1233344  2.3