MYO1A for predicting conversion of acute pain into chronic pain and use of MYO1A for therapy of pain

11180791 · 2021-11-23

Assignee

Inventors

Cpc classification

International classification

Abstract

Products and methods for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain are provided. More specifically, methods for the assessment of the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain using the MYO1A gene as a biomarker and methods of treating selected subjects are provided.

Claims

1. An in vitro method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain and treating said subject comprising: a) analyzing a biological sample comprising DNA, RNA, or protein for the presence or absence of Myosin 1A (Myo1a) DNA or an alteration in the Myo1a DNA sequence that causes reduced expression of Myo1a or Myo1a loss of function, Myo1a RNA or Myosin 1A (Myo1a) protein; and b) selecting and treating a subject that lacks Myo1a DNA or has an alteration in the Myo1a DNA sequence that causes reduced expression of Myo1a or Myo1a loss of function, does not express Myo1a RNA, does not express Myo1a protein or that expresses reduced amounts of Myo1a RNA or Myo1a protein, as compared to a Myo1a homozygote (Myo1a.sup.+/+) reference subject expressing a functional Myo1a gene or Myo1a protein, with an amount of an opioid, baclofen, pregabalin, TAFA4 or taurine that improves pain tolerance of the subject.

2. The method according to claim 1, wherein the biological sample is a blood, plasma or serum sample that is analyzed for the presence of Myo1a protein.

3. The method according to claim 2, wherein the biological sample comprises DNA and said method comprises sequencing the DNA in said biological sample and analyzing the DNA sequence for the presence or absence of Myo1a DNA or an alteration in the Myo1a DNA sequence that causes reduced expression of Myo1a or Myo1a loss of function.

4. The method according to claim 2, wherein the biological sample is a blood, plasma or serum sample from the subject and said method comprises performing an immunoassay on the biological sample for the presence or amount of Myo1a protein present in said biological sample.

5. The method according to claim 4, wherein the method comprises analyzing a blood sample from the subject.

6. The method according to claim 4, wherein the method comprises analyzing a plasma sample from the subject.

7. The method according to claim 4, wherein the method comprises analyzing a serum sample from the subject.

8. The method according to claim 2, wherein the biological sample comprises RNA and said method comprises performing a polymerase chain reaction (PCR) assay on the biological sample comprising RNA from the subject for the absence or reduced levels of Myo1A RNA.

9. The method according to claim 1, wherein the injury-induced chronic mechanical pain is an inflammatory, a neuropathic or a post-operative chronic mechanical pain.

10. The method according to claim 1, wherein the subject is a mammal or a human being.

Description

FIGURES

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication, with color drawing(s), will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1. Loss of LTMRs-enriched Myo1a converts injury induced acute mechanical pain into chronic pain.

(3) (A-C) Characterization of Myo1a-expressing neurons in adult lumbar Dorsal Root Ganglion (DRG). ISH using Myo1a antisense probe (red) followed by double immunolabeling with anti-GINIP (blue) antibody and IB4 (green) (A) or anti-Ret antibody (blue) (C). (B) Double-ISH using Myo1a (red) and TrkB antisense probes (green). Scale bars: 100 μm.

(4) (D-E) Analysis of Myo1a expression by ISH (red) in E15 and new-born (P0) DRG and SC tissues. Scale bars: 50 μm (D) and 100 μm (E).

(5) (F) ISH using Myo1a probe (in white, left panel) or no probe (right panel) on adult SC tissue. Dashed area delimitates laminae I-IIo of SC.

(6) (G) Quantification of Myo1a transcripts in adult DRG and SC (relative to β-actin). Data represent the mean±SEM of 3 independent experiments.

(7) (H-J) Mechanical responses of WT and KO mice following carrageenan-induced inflammation (n=11 for WT and n=13 for KO) (H), CCI surgery (n=9 for WT and n=10 for KO) (I) and paw incision surgery (n=10 for WT and n=10 for KO) (J). Data are presented as mean±SEM for each group (*p<0.05; **p<0.01; ***p<0.001). (See also FIGS. 5-7).

(8) FIG. 2. Muscimol—and Diazepam-mediated analgesia is impaired in Myo1a KO mice.

(9) (A-D) Mechanical responses of WT and KO mice following SNI surgery and i.t administration at indicated time-points of 10 nmol of SNC80, 0.2 nmol of DAMGO (A), 0.1 μg of baclofen, 2 μg of TAFA4 (n=6 mice per genotype) (B), 40 μg of taurine, i.p administration of 3 mg/kg of pregabalin (n=8 mice per genotype) (C) and i.t administration of 0.15 μg of muscimol (n=8 mice per genotype) (D).

(10) (E-G) Mechanical responses of WT and KO mice following zymosan-induced inflammation (n=9 mice per genotype) (E) and i.t administration at indicated time-points of 0.15 μg of muscimol, 10 nmol of SNC80 (n=9 mice per genotype) (F) and 0.09 mg/kg of DZP (G) (n=7 mice per genotype). Data are presented as mean±SEM for each group (*p<0.05; **p<0.01; ***p<0.001; ns: non-significant).

(11) FIG. 3. Transcriptional analysis of DRG and SC tissue from WT and Myo1a KO mice reveals an increased Gabra2 expression.

(12) (A) Venn diagram representing the number of differentially expressed (DE) genes (5% false discover rate) in KO mice with respect to WT in DRG (97 DE genes) and SC (31 DE genes) neurons. Genes differentially expressed only in DRG are represented in red (84 genes), only in SC in blue (18 genes) or in both DRG and SC neurons in yellow (13 genes).

(13) (B) Heatmap representation of DE genes in both DRG and SC neurons, where genes showing increased expression are shown in red and those showing decreased expression in green. Scale represents the Log 2 fold change in expression observed in KO mice with respect to WT.

(14) (C) Quantification of Wdfy1, Gabra2 and Nnt transcripts in DRG and SC tissues from WT and KO mice. Data represent the mean fold-change of KO vs WT±SEM (n=3 independent experiments).

(15) (D) Gabra2 transcripts expression assessed by ISH (red) in L5 DRG (upper panels) and in lumbar SC (lower panels) from WT (left) and KO (right) mice. Scale bars: 100 μm.

(16) (E) Immunostaining showing GABRA2 protein expression (green) in the dorsal horn of lumbar SC from WT (left) and KO (right) mice. Scale bars: 50 μm.

(17) (F) Quantification of GABRA2 immunofluorescence intensity in the laminae I-III of SC from WT and KO mice. Data represent the mean fold change of KO vs WT±SEM (n=3 independent experiments).

(18) (G) Immunostaining showing GABRA1 protein expression (red) in lumbar SC dorsal horn of WT (left) and KO (right) mice. Scale bars: 50 μm. (See also Tables 1-4).

(19) FIG. 4: Muscimol-induced increase in EPSC frequency is lost in Myo1a KO mice after zymosan inflammation.

(20) (A) Representative traces of whole-cell recordings of musicmol-induced currents (Musc) in dissociated C-LTMRs.

(21) (B) Current amplitude (mean±SEM) after bath application of indicated doses of Musc, recorded in C-LTMRs from WT:Tafa4.sup.+/Venus and KO:Tafa4.sup.+/Venus s mice. The number of recorded cells is indicated on the histograms.

(22) (C-F) Whole cell recordings of spontaneous EPSC in laminae II interneurons after Musc application in naïve (C-D) and in zymosan-inflamed WT and KO mice (E-F).

(23) Left panels: representative traces of EPSC obtained under ACSF (black traces), following superfusion of 5 μM Musc (blue traces) and during wash (brown traces).

(24) Middle panels: Cumulative distribution of EPSC intervals (in seconds) for the experiments shown in the left panels. Note the shift of the Musc/blue curves towards the left (C, D, E middle panels), indicating a reversible increase in EPSC frequency.

(25) Right panels: Normalized EPSC frequency (mean±SEM) under ACSF, following superfusion of 5 μM Musc and during wash. Note the absence of effect of Musc in slices from zymosan inflamed mice. The number of recorded cells is indicated in the right panels (*p<0.05; **p<0.01; ns: non-significant). (See also FIG. 8).

(26) FIG. 5: Adult DRG neurons survival, specification, central and peripheral innervation are not impaired in absence of MYO1A.

(27) (A-B) Cell counts of total PGP9.5.sup.+ (A) and of indicated subsets (B) realized on adult lumbar L4 DRG sections from WT and KO mice. Data represent the mean absolute values (A) or the mean % of PGP9.5 neurons (B)±SEM of three independent experiments. No statistically significant differences were observed between genotypes.

(28) (C-E) Sensory neurons innervation of the SC is preserved in Myo1a KO mice.

(29) Immunostainings of SC transversal sections from WT (upper panels) and KO (lower panels) mice with anti-CGRP (red, C), GINIP (blue C-E), IB4 (green, D) and anti-PKCy (red, E). Scale bars: 100 μm.

(30) (F-G) Sensory neurons innervation of the hairy skin is preserved in Myo1a KO mice.

(31) Immunostainings of hairy skin sections from WT (upper panels) and KO (lower panels) mice with anti-PGP9.5 (red, F) and anti-S100 (red, G). Scale bars: PGP9.5 and S100 showing hairy skin innervation: 50 μm. PGP9.5 showing epidermis innervation: 15 μm. (Related to FIG. 1).

(32) FIG. 6: C-LTMRs and Aδ-LTMRs electrophysiological properties are preserved in absence of MYO1A.

(33) (A-D) Electrophysiological properties of C-LTMRs.

(34) (A-B) The graphs show the capacitance and the resting membrane potential of WT and KO C-LTMRs.

(35) (C) Representative traces illustrating the response of WT and KO C-LTMRs to depolarizing current pulse (50 pA, 1000 ms).

(36) (D) The graph represents the number of Action Potentials (AP) evoked by depolarizing current steps of increasing amplitude (Δ10 pA, 1000 ms) of WT (black) and KO C-LTMRs (grey).

(37) (E-I) Electrophysiological properties of Aδ-LTMRs.

(38) The cell capacitance (upper panel) and resting membrane potential (lower panel) of WT and KO Aδ-LTMRs are shown in E. APs were evoked by depolarizing (F-G upper panels) or hyperpolarizing (F-G lower panels) current injection (1000 ms, Δ0.1 nA or Δ−0.1 nA, respectively). (F) The figure shows representative traces obtained for WT (black) and KO (red) Aδ-LTMRs. (G) The curves represent the probability of AP firing as function of the injected current during depolarizing (upper panels) or following hyperpolarizing (lower panels) current injection, respectively. The AP rebound observed at the termination of the hyperpolarizing pulse is a characteristic of Aδ-LTMRs.

(39) (H) Representative mechano-activated (MA) currents in WT (black) and KO (red) Aδ-LTMRs elicited by incremented mechanical stimulations of the soma at a holding potential of −60 mV.

(40) (I) Peak amplitude (I-peak) was normalized to obtain the current/probe displacement curve. The curves show the normalized peak current (I-peak) as function of the probe displacement.

(41) Mean normalized amplitudes do not differ between WT and KO Aδ-LTMRs.

(42) No statistically significant differences were observed between genotypes in C-LTMRs and Aδ-LTMRs. Data are expressed as mean±SEM. (Related to FIG. 1).

(43) FIG. 7: Behavioral characterization of naive Myo1a KO mice and Myo1a.sup.+/− mice and thermal and mechanical hypersensitivity post-injury.

(44) Behavior of WT and KO in the open field (A) and rotarod (B: time and C: speed) tests. Thermal sensitivity to paw cooling (D: acetone test) and noxioux heat (E: hotplate test) show no difference between genotypes.

(45) (F) The graph illustrates WT and KO mice pain behavior in formalin test. The histograms represent the response duration during the 1.sup.st and the 2.sup.nd phase. Note that KO mice exhibit increased response duration in this test (***p<0.001).

(46) (G-H) Thermal hypersensitivity of WT and KO mice following carrageenan-induced inflammation (G) and paw incision surgery (H) was determined in Hargreaves test (***p<0.001, ns: non significant).

(47) (I) Mechanical responses of WT, Myo1a.sup.+/− and KO mice following carrageenan-induced inflammation (***p<0.001, Myo1a.sup.+/− versus WT).

(48) (J) Mechanical responses of WT and KO mice after i.t injection of bicuculline (0.01 μg in 10 μL) (ns: non significant).

(49) Data are presented as mean±SEM for each group. (Related to FIG. 1).

(50) FIG. 8: Electrophysiological characterization of SC lamina II neurons passive, active and synaptic properties in Myo1a KO naive or inflamed mice.

(51) (A-F) The graphs represent the average membrane potential (A), the membrane resistance (B), the capacitance (C), the Sag ratio in response to −25 pA hyperpolarizing pulse (D), the number of rebound AP in response to −25 current pulses (E) and the number of AP in response of +25 pA current pulses (F) of SC lamina II interneurons from WT and KO mice under naive and in carrageenan—(Carra.) and zymosan—(Zymo.) —induced inflammation. The numbers of recorded cells are: Naive: 16 WT and 26 KO, Carra.: 29 WT and 23 KO and Zymo.: 10 WT and 12 KO.

(52) (G) The graph illustrates the paired pulse ratio recorded in SC lamina II interneurons of WT and KO mice under naive and in Carra. and Zymo—induced inflammation. The numbers of recorded cells are: Naive: 19 WT and 33 KO, Carra.: 9 WT and 13 KO and Zymo.: 9 WT and 9 KO.

(53) Data are presented as mean±SEM for each group. No significant differences were observed between genotypes. (Related to FIG. 4).

(54) FIGS. 1A, B, C, D, E, FIGS. 3D, E, G and FIGS. 5C, D, E, F, G are each shown twice (identical figures showing colors with different contrasts).

EXPERIMENTAL PART

(55) Materials & Methods

(56) Mice

(57) Mice were maintained under standard housing conditions (23° C., 40% humidity, 12 h light cycles, and free access to food and water). Special effort was made to minimize the number as well as the stress and suffering of mice used in this study. All protocols are in agreement with European Union recommendations for animal experimentation.

(58) Myo1a KO mice were generated by Tyska et al., 2005 (Tyska et al., 2005). Control wild-type (WT) C57BL/6 mice were bred in-house. WT: Tafa4.sup.+/Venus and Myo1a KO: Tafa4.sup.+/Venus mice were generated by crossing WT and Myo1a KO mice respectively with Tafa4.sup.Venus/Venus(Delfini et al., 2013) and Myo1a.sup.+/−: Tafa4.sup.+/Venus mice.

(59) Histology

(60) To obtain adult Dorsal Root Ganglia (DRGs) and Spinal Cord (SC) specimens for in situ hybridization (ISH) and immunostainings, mice were deeply anesthetized with a mix of ketamine/xylazine and then transcardially perfused with an ice-cold solution of paraformaldehyde 4% in 0.1 M phosphate buffer (4% PFA). Tissues were further fixed for 24 h in ice-cold 4% PFA. Newborn P0 mice were sacrificed, rapidly washed in ice-cold PBS, eviscerated and fixed for 24 h in ice-cold 4% PFA. E15 embryos were collected in ice-cold PBS and fixed for 24 h in ice-cold 4% PFA. Adult back hairy skin was excised and fixed for 2 h in ice-cold 4% PFA. For GABRA1 and GABRA2 immunostainings, lumbar SC (L1-L3) was rapidly dissected and fixed for 30 min in ice-cold 4% PFA. Specimens were transferred into a 30% (w/v) sucrose solution for cryoprotection before being frozen in OCT mounting medium. 12 μm cryosections (DRGs) and 18-20 μm cryosections (SC, E15 and P0) were obtained using a standard cryostat (Leica).

(61) In Situ Hybridization

(62) Digoxigenin-labeled Myo1a and Gabra2 antisense probes and Fluorescein-labeled TrkB probe were synthetized using gene-specific PCR primers and cDNA templates from adult mouse DRG and in situ hybridization or double in situ hybridization was carried as described in (Reynders et al., 2015). The primers used for probe synthesis are listed below:

(63) TABLE-US-00001 Myola F1:  (SEQ ID NO: 7) GAAAATACTTCCGGTCAGGTG, Myola R1:  (SEQ ID NO: 8) CAAGGGTTCTTCATCTCTGAGT, Myola F2:  (SEQ ID NO: 9) TACCAGTGGAAGTGCAAGAAGT, Myola R2 + T7: (SEQ ID NO: 10) TAATACGACTCACTATAGGGACACTACGAAGTTCTGCTCCAG, Gabra2 F1/F2:  (SEQ ID NO: 11) ACTTGGTTACTTTTGGGCTGT, Gabra2 R1:  (SEQ ID NO: 12) TGATTGAAGTGAGCTGAAAGGT, Gabra2 R2 + T7: (SEQ ID NO: 13) TAATACGACTCACTATAGGGAACATCCTTTCATGGTGACTCA, TrkB-F1:  (SEQ ID NO: 14) CTGAGAGGGCCAGTCACTTC, TrkB-R1:  (SEQ ID NO: 15) CATGGCAGGTCAACAAGCTA, TrkB-F2:  (SEQ ID NO: 16) CAGTGGGTCTCAGCACAGAA, TrkB-R2 + T7: (SEQ ID NO: 17) TAATACGACTCACTATAGGGCTAGGACCAGGATGGCTCTG.
Immunostaining

(64) Immunostainings were done with rat anti-GINIP (1:500, Moqrich laboratory), goat anti-Ret (1:500, R&D Systems), rabbit anti-TrkA (1:1000, generous gift from Dr. L. Reichardt, University of California), goat anti-TrkC (1:500, R&D Systems), rabbit anti-CGRP (1:1000, ImmunoStar), rabbit anti-PKCγ (1:500, Santa Cruz), rabbit anti-PGP9.5 (1:200, Thermo Scientific), rabbit-anti S100 (1:1000, Darko), rabbit anti-GABRA2 (1:2000, Synaptic Systems) and guinea pig anti-GABRA1 (1:1000, Synaptic Systems). IB4 labelling was performed with Alexa Fluor 488-conjugated IB4 from Invitrogen. Slides were mounted with ImmuMount (Thermo Scientific) prior to observation under Axiolmager Z1 (Zeiss) fluorescence microscope. Contrast was adjusted using Photoshop software. For the comparison of Gabra2 expression between WT and Myo1a KO, images were acquired using the same exposure parameters and contrast was adjusted equivalently.

(65) For SC and skin innervation as well as GABRA staining, image acquisition was performed using an LSM-780 confocal microscope (Zeiss) and same pinhole aperture, lasers intensities as well as gain parameters were respected between WT and Myo1a KO specimens.

(66) Cell Counts and Statistical Analysis

(67) Total and subsets of DRG neurons were counted on lumbar L4 DRG from adult WT and Myo1a KO mice, as described in Gaillard et al., 2014. Briefly, 12 μm serial sections of L4 DRG were distributed on 6 slides which were subjected to different markers, including the pan-neuronal marker PGP9.5. This approach allowed us to refer all countings to the total number of neurons (PGP9.5). For each genotype, three independent experiments were performed. Data are presented as the mean±standard error of the mean (SEM).

(68) GABRA2 Fluorescence Intensity

(69) The intensity of fluorescence (mean florescence of pixels in the region of interest) per mm.sup.2 related to GABRA2 expression was determined in the laminae I-III of WT and Myo1a KO SC sections using ImageJ software. For each genotype, three independent experiments were performed and 5-10 SC sections were analyzed and the fold change in the intensity of fluorescence of Myo1a KO versus WT specimens was calculated.

(70) Drugs

(71) SNC80 (Tocris Bioscience) was dissolved in a 100 mM HCl solution, DAMGO (Sigma Aldrich) was dissolved in saline (0.9% NaCl), Baclofen (Sigma Aldrich) was dissolved in H.sub.2O (pH7.6), recombinant human TAFA4 (R&D Systems) was dissolved in saline, Diazepam (DZP, Roche) was dissolved in 10% dimethyl sulfoxide (DMSO)/90% saline, Muscimol (Tocris Bioscience), Taurine (Sigma Aldrich), Bicuculline (Sigma Aldrich) and Pregabalin (Sigma Aldrich) were dissolved in Phosphate Buffer (PB, 50 mM, pH 7.4).

(72) Except for pregabalin, all drugs were administrated via intratechal (i.t) injection. The dosages are indicated in the figure legends. Pregabalin was injected intra-peritoneally (i.p). Response to mechanical stimulations was recorded 30 min up to 6 h after drug administration as indicated in the figure legends.

(73) Behavioral Tests and Statistical Analysis

(74) All behavioral analyses were conducted on 8-12 weeks old Myo1a KO and WT males. All experiments were carried at room temperature (˜22° C.). Animals were acclimated for one hour to their testing environment prior to all experiments. Experimenters were blind to the genotype of the mice during testing. The number of tested animals is indicated in the figure legends section. All error bars represent SEM. All statistical analysis was carried using Two Way Repeated Measures ANOVA followed by Bonferroni's post-hoc test. Openfield, Rotarod, Hot plate and Formalin tests were carried as described in Gaillard et al., 2014 (Gaillard et al., 2014).

(75) Acetone Test

(76) Acetone drop evaporation assay (Hulse et al., 2012) was used to assess naïve mice sensitivity to innocuous skin cooling. A drop of acetone was applied on the left hind paw using a 1 ml syringe. The duration of flinching/pain like behavior (seconds) was recorded immediately following acetone application for a total period of 2 minutes. The test was repeated twice and the mean duration of flinching/pain behavior was calculated.

(77) Heat Hypersensitivity

(78) Hind paw heat hypersensitivity was determined prior and after carrageenan inflammation as well as after paw incision surgery, using Hargreaves test, as described in Gaillard et al., 2014. For the carrageenan inflammatory pain model, the test was performed at several time points (see legend) starting from one day and up to 60 days after inflammation. For the paw incision pain model, the test was performed at several time points (see legend) starting from one day and up to 30 days after inflammation.

(79) Mechanical Thresholds

(80) Mechanical thresholds of the plantar surface were determined using Von Frey's filaments with the up-down method (Chaplan et al., 1994), previously as described (Gaillard et al., 2014) prior to and at several time-points after inflammation, neuropathy and paw-incision surgery.

(81) Injury-Induced Pain Models

(82) Carrageenan and Zymosan-A Induced Inflammation

(83) 20 μl of a solution containing 1% carrageenan in H.sub.2O (weight/vol, Sigma) or 20 μl of a solution containing 0.06 mg Zymosan-A in 0.9% NaCl (weight/vol, Sigma), were injected subcutaneously into the plantar side of the left hindpaw, using a 30 G needled syringe.

(84) For carrageenan-induced inflammation, mechanical thresholds were determined prior to inflammation and at several time-points (see legend) starting from 1 hour and up to 60 days after inflammation. For zymosan inflammation, mechanical thresholds were measured prior to injection, at day 1 and at several time-points (see legend) up day 60. In addition, mechanical thresholds in the zymosan model were measured before inflammation, at day 1 and day 2, before and after drug administration.

(85) Chronic Constriction Injury (CCI)

(86) Unilateral peripheral mono-neuropathy was induced in ketamin/xylasin-anesthetized mice by performing three loosely tied ligatures (with about 1 mm spacing) around the common sciatic nerve (Bennett and Xie, 1988) using monocryl resorbable suture filaments (6-0, Ethicon, Piscataway, N.J., USA). The nerve was constricted to a barely discernable degree, so that circulation through the epineurial vasculature was not interrupted. After surgery, the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were measured before CCI and at several time-points (see legend) starting from 3 day and up to 60 days after surgery.

(87) Paw Incision

(88) The paw incision pain model was performed as described in Brennan (1999). Briefly, mice were anesthetised with ketamin/xylasin and a 5 mm longitudinal incision of the plantar face of the right hindpaw, starting from 2-5 mm from the proximal edge of the heel was performed. The plantar muscle was then carefully elevated with forceps and incised longitudinally with a blade, while leaving muscle's origins intact. The wound was closed with one horizontal mattress suture using 6.0 silk monofilament (Ethicon, Piscataway, N.J., USA) and the wound site was covered with betadine ointment. After surgery, the animals were allowed to recover in a warming chamber, and returned to their home cages. Mechanical thresholds were determined prior to and up to 60 days after surgery (see legend) starting from 6 hours post-injury.

(89) Spared-Nerve Injury (SNI)

(90) Spared nerve injury surgery was performed as described (Shields et al., 2003). Briefly, mice were anesthetized with a mix of ketamine/xylazine and an incision was made through the skin and thigh muscle at the level of the trifurcation of the sciatic nerve. The common sural and peroneal nerves were ligated using a 6.0 silk filament (Ethicon, Piscataway, N.J., USA) and transected, while leaving the tibial nerve intact. After surgery, the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were determined at days 7, 9 and 14 post-surgery, before and after drug administration.

(91) RNA Extraction

(92) Mice were deeply anesthetized with a mix of ketamine/xylazine and transcardially perfused with 5-10 mL RNA Later (Qiagen). L3 to L5 DRGs and SC were rapidly dissected and RNA was extracted by using RNeasy Micro Kit (Qiagen), according to manufacturer's instructions. For quality control, RNAs were loaded on a RNA NanoChip (Agilent) and processed with 2100 Bioanalyzer system (Agilent technology).

(93) High-Throughput Sequencing and Analyses

(94) WT and Myo1a KO DRG and SC RNAs were extracted in experimental duplicates from 2-3 mice each. RNA-seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). All libraries were validated for concentration and fragment size using Agilent DNA1000 chips. Sequencing was performed on a HiSeq 2000 (Illumina), base calling performed using RTA (Illumina) and quality control performed using FastQC (FASTQC, 2010) and RSeQC (Wang et al., 2012). Sequences were uniquely mapped to the mm10 genome using Subread (Liao et al., 2013) (C version 1.4.6-p2) using default values. Reads mapping to gene exons (GRCm38.p4 gene assembly) were counted using featureCounts (Liao et al., 2014) (C version 1.4.6-p2). Differential gene expression was performed using exon counts from biological replicates using the DESeq2 BioConductor R package (Love et al., 2014), using a 5% false discovery rate (FDR) cutoff.

(95) qRT-PCR

(96) RNA obtained from each sample was converted into cDNA using Superscript III Reverse Transcriptase (Invitrogen). Gene expression was assessed by quantitative PCR (qPCR), using qPCR Sybr-Green master mix (ThermoFisher). Samples were run for 40 cycles on a StepOne qPCR apparatus (Applied Biosystems). The relative quantity of transcripts encoding each gene was determined by normalization to β-actin using the standard ΔCt or ΔΔCt method.

(97) All experiments were performed in triplicates and data represent the fold change (mean±SEM) in transcript expression level of Myo1a KO versus WT. The primers sequences used for qPCR are:

(98) TABLE-US-00002 Myola F:  (SEQ ID NO: 18) CTACGAGCAGCTTCCCATCT, Myola R:  (SEQ ID NO: 19) CCACATTTGCCAAAGCATAG, Gabra2 F:  (SEQ ID NO: 20) ACAAAAAGAGGATGGGCTTG, Gabra2 R:  (SEQ ID NO: 21) TCATGACGGAGCCTTTCTCT, Wfdy1 F:  (SEQ ID NO: 22) AAAGGCCGGACACTCCTC, Wdfy1 R:  (SEQ ID NO: 23) TGAGCTGCAGGTAGCACAGT, Nnt F:  (SEQ ID NO: 24) CCTGGTGGCACCTTCGTA, Nnt R:  (SEQ ID NO: 25) CTGAGCCCAGGTACATGATTT.
DRG Neuron Dissociation and Culture

(99) Adult WT, Myo1a KO, WT:Tafa4.sup.+/Venus and Myo1a KO: Tafa4.sup.+/Venus mice were deeply anesthetized (ketamine/xylazine) and DRGs were rapidly dissected, collected in ice-cold HBSS-glu (HBSS 1× (Gibco), 0.1M D-glucose (Sigma), 50 mM HEPES (Gibco), ph7,4) and subjected twice to enzymatic digestion using 2 mg/ml type 1 collagenase (Gibco) and 5 mg/ml dispase (both from Gibco) for 20 min at 37° C. DRGs were washed twice with HBSS-glu and resuspended in NBc medium (NBc: Neurobasal (Gibco), 1% (v/v) B27 (Gibco), 1000 U/ml penicillin (Invitrogen), 1000 μg/ml streptomycin (Invitrogen)). Single cell suspensions were obtained by passages through 3 needle tips of decreasing diameter (gauge 18, 21, 26). Cells were plated on polyornithin-laminin coated dishes and kept at 37° C. for 1-2 hours before adding 10 ng/ml Neurotrophin 4 (NT4, Peprotech) and 2 ng/ml glial cell line-derived neurotrophic factor (GDNF, Invitrogen). C-LTMRs were identified through to live Venus fluorescence and Ad-LTMRs were identified thanks to their “rosette”-like morphology (Dubreuil et al, 2004). Patch-Clamp recordings were performed 18-30 h after plating.

(100) Electrophysiology on Cultured DRGs

(101) Electrophysiological recordings were performed using an Axopatch 200B amplifier. Data were analyzed by pCLAMP 10.5 (Molecular Devices).

(102) Whole Cell Recordings of C-LTMRs and Aδ-LTMRs

(103) Patch-clamp recordings of cultured C-LTMRs were performed with 1 to 2 MΩ pipettes filled with a KCl-based solution containing (in mM): 134 KCl, 1 MgCl.sub.2, 4.8 CaCl.sub.2, 10 HEPES, 4 Mg-ATP, 0.4 Na-GTP and 10 EGTA (pH 7.3). Patch clamp recordings of cultured Aδ-LTMRs were performed with 1 to 3 MΩ pipettes filled with a KCl-based solution containing (in mM): 105 K Aspartate, 10 NaCl, 27 KCl, 4 Mg-ATP, 0.4 Na-GTP, 5 Creatine-Phosphate (sodium salt), 1 CaCl.sub.2, 10 EGTA, 1 MgCl.sub.2, 10 HEPES (pH 7.2 with KOH, ≈329 mOsm).

(104) Neurons were perfused at a flow rate of 2-3 ml/min with standard external solution containing (in mM): 140 NaCl, 4 KCl, 2 MgCl.sub.2, 2 CaCl.sub.2, 10 HEPES and 10 glucose (pH 7.4).

(105) Stock solution of the GABA.sub.A receptor agonist, Muscimol (Tocris Bioscience) was prepared in water and dissolved in the external solution at the desired concentration. Muscimol was applied in the bath for 10 s.

(106) Mechanical-Activated Currents

(107) Mechanical stimulation has been realized with a sealed, fire-polished glass micropipette attached to a piezo-electric actuator (Step Driver PZ-150 M; Burleigh) that was positioned at an angle of 45 degrees from horizontal and used as mechanical probe. Downward movement of the probe toward the cell was driven by pClamp software (Molecular Devices). Voltage-clamped mechano-activated currents were recorded at a holding potential of −60 mV with the same solutions as for whole patch clamp recordings of Aδ-LTMRs. Baseline for mechanical stimulation was defined in μm as the distance of probe displacement inducing a mechano-activated current minus 0.5 μm.

(108) Whole-Cell Patch-Clamp Recording from Spinal Cord Slices with Attached Dorsal Root

(109) Transverse spinal cord slices with attached dorsal roots from juvenile (P24 to P45) Myo1a KO and WT mice were prepared for whole-cell recording. Briefly, the animals were anesthetized using Pentobarbital (200 mg/kg), perfused with ice cold oxygenated low calcium artificial cerebrospinal fluid (ACSF; in mM: NaCl 101; KCl 3.8; MgCl.sub.2 18.7, MgSO.sub.4 1.3; KH.sub.2PO.sub.4 1.2; HEPES 10; CaCl.sub.2 1; Glucose 1), and then beheaded. The vertebral column and surrounding muscles were quickly removed and immersed in ice cold oxygenated ACSF. Following laminectomy, the spinal cord was gently removed and its lumbar part was placed into a small 3% agarose block. Spinal slices (300 μm thick) were cut using a Leica VTS1000 vibratome, and transferred in warm (31° C.) ACSF (in mM: NaCl 130.5; KCl 2.4; CaCl2 2.4; NaHCO.sub.3 19.5; MgSO.sub.4 1.3; KH.sub.2PO.sub.4 1.2; HEPES 1.25; glucose 10; pH 7.4) equilibrated with 95%02-5% CO2 for at least one hour before starting patch clamp recordings. Spinal slices were placed in a recoding chamber bathed with warmed (31° C.) ACSF Electrophysiological measurements were performed under the control of an Olympus BX51 microscope using a multiclamp 2B (Molecular devices). Patch pipettes (7-11Ω) were filled with C-based pipette solution (in mM: CsMethaneSulfonate 120; CsCl 20; CaCl2 0.1; MgCl2 1.3; EGTA 1; HEPES 10; GTP 0.1; cAMP 0.2; Leupeptin 0.1; Na2ATP 3; D-Manitol 77; pH 7.3). A glass suction electrode connected to a Master 8 (A.M.P. Instrument Ltd) stimulator was used to stimulate dorsal roots. Typically, a pair of high duration (500 μs) high intensity stimulations (350 μA) was used to recruit most primary afferent fibers in the recorded slice. All drugs were purchased from Sigma. Statistical comparison of EPSC frequencies was assessed for each cell using Kolmogorov-Smirnov test.

(110) Results

(111) Injury-Induced Acute Mechanical Pain is Converted into Chronic Pain in Myo1a KO Mice.

(112) In a recent study, inventors identified Myo1a to be highly enriched in adult C-LTMRs (Reynders et al., 2015). Co-expression analysis showed that Myo1a was indeed expressed in GINIP.sup.+/IB4.sup.− C-LTMRs (FIG. 1A), but its expression also occurred in Aδ LTMRs marked by TrkB and in a subset of Aβ Ret.sup.+ LTMRs (FIGS. 1B and 1C), and totally excluded from peptidergic TrkA.sup.+ and proprioceptive TrkC.sup.+ neurons (data not shown). At the developmental level, Myo1a is expressed in a subset of large DRG neurons at E15 (FIG. 1D) and its expression extends to the majority of DRG neurons at birth (FIG. 1E). Myo1a level of expression in SC during development and in adult is almost undetectable as confirmed by in situ hybridization and q-RT-PCR (FIGS. 1D-G).

(113) To gain insights into the role of MYO1A in sensory physiology, inventors sought to analyze Myo1a KO mice (Tyska et al., 2005). These mice are viable, fertile and most of the perturbations described were related to the intestine biology where this atypical myosin protein is highly expressed (Kravtsov et al., 2012; Mazzolini et al., 2012). However nothing was known about the role of MYO1A in the somatosensory system.

(114) To test whether loss of MYO1A altered DRG neurons development, inventors performed a series of quantitative and qualitative analyses. They found no difference in the total number of lumbar DRG neurons or in the number of TrkA.sup.+, TrkB.sup.+, TrkC.sup.+, Ret.sup.+ and TH.sup.+ neurons between WT and Myo1a KO mice (FIGS. 5A and 5B). At the anatomical level, double and triple staining experiments on SC sections showed that peptidergic CGRP and the subset of nonpeptidergic GINIP.sup.+ afferents displayed normal central projections to their respective laminae in the dorsal horn of the SC (FIGS. 5C-E). Peripherally, PGP9.5 and S100 staining revealed normal peripheral target innervation of all DRG neurons and hair follicles-innervating LTMRs (FIGS. 5F and 1G). Finally, to test whether loss of MYO1A affected neuronal excitability of DRG neurons, inventors performed patch-clam recordings on cultured C-LTMRs and D-hair Aδ mechanoreceptors. The C-LTMRs were visualized by crossing Myo1a KO mice with Tafa4.sup.Venus mice and the D-hair neurons were identified by their rosette-like shape. In both types of neurons, there were no differences between the two genotypes in passive and intrinsic electrical properties (FIGS. 6A-G). Furthermore, they found no difference in the sensitivity of cultured D-hair neurons from WT and Myo1a KO mice to a piezo-driven mechanical stimulation (FIGS. 6H and 6I). Together these data demonstrate that MYO1A is dispensable for the survival, the molecular maturation, the anatomical organization and the electrophysiological properties of DRG neurons.

(115) To gain insights into the role of MYO1A in somatosensation, inventors subjected Myo1a KO mice to a large battery of somatosensory tests under acute and injury conditions. Myo1a KO mice had normal behavior in the open filed and rotarod tests (FIGS. 7A-C), they exhibited no difference in their ability to sense noxious heat stimuli in the hot plate test and displayed normal response to the acetone test (FIGS. 7D and 7E). They then tested the mechanical sensitivity of their mice under acute and 3 different pathological conditions: Carrageenan-induced inflammation, the chronic constriction injury model (CCI) (Bennett and Xie, 1988), and the Brennan test (Brennan, 1999). Mechanical sensitivity was tested using the up-down method at basal conditions and at several time points after injury (FIGS. 1F-H). In all three paradigms mechanical thresholds at baseline levels were similar between the two genotypes (FIGS. 1F-H). Intraplantar injection of carrageenan induced a massive drop in mechanical thresholds in both genotypes starting at one hour post-inflammation (FIG. 1F). Impressively, three days post-inflammation, WT mice returned to baseline levels, whereas mechanical hypersensitivity was prolonged as long as 60 days post-inflammation in Myo1a KO mice, demonstrating that an acute and reversible inflammation-induced mechanical pain is converted into a long lasting and irreversible chronic pain. The same behavioral responses were observed in the nerve injury and in the postoperative models. Significant reversal of CCI-induced mechanical hypersensitivity started at day 30 and returned to baseline levels around day 40 in the WT mice, whereas, as in the Carrageenan-induced inflammation, mechanical hypersensitivity in the Myo1a KO mice persisted for as long as 60 days post-CCI (FIG. 1G). Finally, in the Brenan test, incision-induced mechanical hypersensitivity was irreversible in the Myo1a KO mice, whereas it lasted for less than 10 days in the WT mice (FIG. 1H). Thermal hypersensitivity was assessed in the Carrageenan and in the Brenan paradigms using the Hargreaves test. In the Carrageenan model, thermal hypersensitivity was prolonged in Myo1a KO mice but returned to baseline levels at day 60 post-inflammation (FIG. 7G). However, in the Brenan model there was no difference between WT and Myo1a KO mice in the postsurgical-induced thermal hypersensitivity (FIG. 7H). Finally, Myo1a KO mice exhibited a significant enhancement of formalin-evoked nocifensive behavior during both phases (FIG. 7F). Together, these data demonstrate that Myo1a KO mice are predisposed to develop injury-induced chronic mechanical pain and suggest that these mice can be used as an excellent model system to decipher the mechanisms that trigger the transition from acute to chronic pain.

(116) Loss of MYO1A Specifically Alters the Ionotropic GABAergic Signaling

(117) It is well established that injury-induced chronic pain is caused by an imbalance between the excitatory and inhibitory neurotransmission in the SC, and that the concurrent exaggerated pain can be transiently reversed by a variety of compounds such as opioid, GABA and glycine receptors agonists, calcium channels antagonists and inventors' recently identified TAFA4. To unravel which of these signaling pathways are dysfunctional in Myo1a KO mice, inventors tested the analgesic effect of these compounds using the spared nerved injury (SNI) neuropathic pain model (Decosterd and Woolf, 2000). The SNI model was chosen because it's highly reproducible and also induces a long lasting and irreversible mechanical pain. Using this paradigm, they showed that intrathecal (IT) administration of delta and mu opioid receptors agonists SNC80 and DAMGO (FIG. 2A), GABA.sub.B receptor agonist baclofen and TAFA4 (FIG. 2B), α2δ voltage gated calcium channel inhibitor pregabalin and the glycine receptor agonist taurine (FIG. 3C) significantly reversed SNI-induced mechanical hypersensitivity in both genotypes. However, in contrast to WT mice, IT administration of the GABA.sub.A agonist muscimol completely failed to reverse SNI-induced mechanical pain in Myo1a KO mice (FIG. 2D). Myo1a KO mice resistance to the analgesic effect of muscimol was also confirmed in the zymosan A-induced inflammatory pain model (Witschi et al., 2011). Inventors first showed that zymosan-induced inflammation also resulted in a prolonged and irreversible mechanical hypersensitivity in Myo1a KO mice (FIG. 2E). IT administration of muscimol or the GABA.sub.A-Rs positive allosteric modulator diazepam (DZP) strongly reversed zymosan-induced mechanical hypersensitivity in WT mice but had no effect on Myo1a KO mice (FIGS. 2F and 2G). Importantly, injection of SNC80 strongly reversed the mechanical pain in both genotypes (FIG. 2H). Together, these data demonstrate that Myo1a KO mice predisposition to develop injury-induced chronic mechanical pain is due to a selective impairment of the ionotropic GABAergic inhibitory neurotransmission.

(118) Loss of MOY1A Resulted in a Selective Upregulation of GABRA2 Both in DRG and SC Neurons

(119) It is well established that loss of GABAergic inhibition may be altered by several means both in peripheral and central nervous systems. These include altered subunit composition of GABA.sub.A-Rs, altered levels of GABA, GABA release probability and the speed of its removal from the synaptic cleft, and change in chloride gradient that switches GABA-mediated inhibition into excitation (Sandkuhler, 2009). In order to unravel which of these mechanisms are affected in Myo1a KO mice we used an unbiased RNA deep sequencing screen. Biological replicates of polyA mRNA prepared from DRG and SC neurons of WT and Myo1a KO mice were subjected to high-throughput sequencing to very high sequencing depth (an average of 112×10.sup.6 exome-mapped reads per replicate), representing an average 250× whole-exome coverage (Table 1).

(120) TABLE-US-00003 TABLE 1 Summary of read mappings from RNA-seq of polyA mRNA prepared from DRG and SC of WT and Myo1a KO mice. Number of Number of mm10- GRCm38 Sample mapped reads exome reads Exome coverage DRG WT Rep1 122510851 106555838 245 DRG WT Rep2 140298326 123170138 283 SC WT Rep1 135383211 101181431 269 SC WT Rep2 144363915 111158063 270 DRG KO Rep1 135001904 117077396 232 DRG KO Rep2 134291994 117408042 255 SC KO Rep1 114549363 85518826 196 SC KO Rep2 172249718 134362629 309

(121) Highly significant differentially expressed (DE) genes upon loss of Myo1a expression were called (<5% FDR; <p 0.00025), resulting in the identification of 98 DE genes in DRG neurons (FIG. 3A and Table 2), and 32 DE genes (FIG. 3A and Table 3) in SC neurons.

(122) TABLE-US-00004 TABLE 2 Differentially expressed genes in DRG of Myo1a KO vs WT mice. Base Fold Mean Change ENSEMBL ID Gene Symbol Counts (log2) P value FDR ENSMUSG00000073643 Wdfy1 5136 1.4483 1.50E−100 2.83E−96 ENSMUSG00000025401 Myo1a 5484 1.0095 1.23E−52 1.16E−48 ENSMUSG00000000560 Gabra2 7946 0.9382 2.66E−39 1.67E−35 ENSMUSG00000097971 2742 0.8108 2.95E−25 7.95E−22 ENSMUSG00000106106 148956 0.8048 1.19E−26 4.49E−23 ENSMUSG00000025453 Nnt 2624 0.7605 1.98E−24 4.15E−21 ENSMUSG00000030218 Mgp 5295 0.7179 1.54E−21 2.91E−18 ENSMUSG00000029994 Anxa4 3385 0.6051 2.34E−16 3.40E−13 ENSMUSG00000096768 Erdr1 1546 0.5945 5.44E−15 6.42E−12 ENSMUSG00000063796 Slc22a8 924 0.5634 2.67E−15 3.36E−12 ENSMUSG00000068735 Trp53i11 2239 0.5412 2.84E−12 2.82E−09 ENSMUSG00000076258 91347 0.5395 4.55E−26 1.43E−22 ENSMUSG00000026051 1500015O10Rik 1291 0.5024 6.81E−11 5.36E−08 ENSMUSG00000039323 Igfbp2 1958 0.4813 8.38E−10 6.33E−07 ENSMUSG00000025479 Cyp2e1 683 0.4812 1.80E−11 1.54E−08 ENSMUSG00000035299 Mid1 1810 0.4674 2.01E−09 1.46E−06 ENSMUSG00000033174 Mg11 16530 0.4672 9.92E−19 1.56E−15 ENSMUSG00000067786 Nnat 3299 0.4433 1.55E−08 9.73E−06 ENSMUSG00000035202 Lars2 73887 0.4406 1.58E−24 3.72E−21 ENSMUSG00000096887 Gm20594 2825 0.4329 8.18E−09 5.51E−06 ENSMUSG00000052957 Gas1 2350 0.4325 3.22E−08 1.84E−05 ENSMUSG00000086324 10780 0.3914 8.20E−12 7.37E−09 ENSMUSG00000050010 Shisa3 3037 0.3892 6.50E−07 0.000306659 ENSMUSG00000030310 Slc6a1 2324 0.3826 1.06E−06 0.00047432 ENSMUSG00000076281 11261 0.3769 9.76E−09 6.35E−06 ENSMUSG00000024990 Rbp4 925 0.3703 6.33E−08 3.51E−05 ENSMUSG00000024610 Cd74 16282 0.3662 4.00E−11 3.28E−08 ENSMUSG00000095304 P1ac9a 2818 0.3574 3.65E−06 0.001437537 ENSMUSG00000034353 Ramp1 353 0.3540 7.15E−08 3.86E−05 ENSMUSG00000003949 H1f 2753 0.3461 1.01E−05 0.003815587 ENSMUSG00000070867 Trabd2b 670 0.3439 6.03E−07 0.000292135 ENSMUSG00000026062 Slc9a2 691 0.3367 1.47E−06 0.00062906 ENSMUSG00000024650 Slc22a6 533 0.3353 2.51E−08 21.53E−05 ENSMUSG00000021136 Smoc1 2669 0.3300 2.58E−05 0.008398485 ENSMUSG00000018459 Slc13a3 1856 0.3298 1.99E−05 0.006818336 ENSMUSG00000046402 Rbp1 1715 0.3195 2.10E−05 0.007083368 ENSMUSG00000026904 Slc4a10 1783 0.3177 3.36E−05 0.010570455 ENSMUSG00000088609 1505 0.3136 6.23E−05 0.016789981 ENSMUSG00000053279 Aldh1a1 1808 0.3118 6.94E−05 0.018120573 ENSMUSG00000045573 Penk 1389 0.3107 7.10E−05 0.018120573 ENSMUSG00000037820 Tgm2 2261 0.3101 5.00E−05 0.01392036 ENSMUSG00000009687 Fxyd5 2354 0.3098 6.50E−05 0.017271687 ENSMUSG00000030862 Cpxm2 986 0.3098 3.83E−05 0.11660881 ENSMUSG00000035000 Dpp4 537 0.3094 7.29E−07 0.000335707 ENSMUSG00000040055 Gjb6 917 0.3094 3.65E−06 0.001437537 ENSMUSG00000030351 Tspan11 1267 0.3076 3.96E−05 0.011853792 ENSMUSG00000017897 Eya2 1715 0.3068 9.01E−05 0.021259308 ENSMUSG00000042436 Mfap4 782 0.3040 3.51E−05 0.010876582 ENSMUSG00000030717 Nupr1 958 0.2989 9.87E−05 0.022729069 ENSMUSG00000095079 473 0.2989 3.15E−08 1.84E−05 ENSMUSG00000040569 Slc26a7 992 0.2974 5.01E−05 0.01392036 ENSMUSG00000033152 Podx12 4785 0.2956 1.38E−0.5 0.004833264 ENSMUSG00000037166 Ppp1r14a 1716 0.2954 0.000149427 0.032427353 ENSMUSG00000074634 Gm7120 1731 0.2919 0.000192622 0.038281175 ENSMUSG00000029163 Emi1in1 928 0.2901 0.000139094 0.03053603 ENSMUSG00000056174 Co18a2 1923 0.2885 0.000179303 0.036013163 ENSMUSG00000032334 Lox11 1376 0.2869 0.000153495 0.03256157 ENSMUSG00000040170 Fmo2 1928 0.2863 0.00024733 0.047348949 ENSMUSG00000004885 Crabp2 688 0.2843 2.88E−05 0.00921269 ENSMUSG00000042190 Cmk1r1 542 0.2839 8.89E−05 0.021259308 ENSMUSG00000062515 Fabp4 836 0.2773 2.22E−05 0.007350468 ENSMUSG00000040938 Slc16a11 249 0.2724 3.57E−06 0.001437537 ENSMUSG00000025784 Clec3b 748 0.2704 8.47E−05 0.020760793 ENSMUSG00000022595 Lypd2 551 0.2658 0.000246368 0.047648949 ENSMUSG00000039004 Bmp6 1187 0.2634 0.000161683 0.033837805 ENSMUSG00000066687 Zbtb16 822 0.2630 4.37E−05 0.12694785 ENSMUSG00000041598 Cdc42ep4 7427 0.2581 8.96E−05 0.021259308 ENSMUSG00000021943 Gdf10 518 0.2573 0.000115563 0.025974121 ENSMUSG00000030278 Cidec 367 0.2471 1.15E−05 0.004174341 ENSMUSG00000033152 Podx12 4785 0.2956 1.38E−05 0.004833264 ENSMUSG00000037166 Ppp1r14a 1716 0.2954 0.000149427 0.032427353 ENSMUSG00000074634 Gm7120 1731 0.2919 0.000192622 0.038281175 ENSMUSG00000029163 Emi1in1 928 0.2901 0.000139094 0.03053603 ENSMUSG00000056174 Col8a2 1923 0.2885 0.000179303 0.036013163 ENSMUSG00000032334 Loxl1 1376 0.2869 0.000153495 0.03256157 ENSMUSG00000040170 Fmo2 1928 0.2863 0.00024733 0.047648949 ENSMUSG00000004885 Crabp2 688 0.2843 2.88E−05 0.00921269 ENSMUSG00000042190 Cmk1r1 542 0.2839 8.89E−05 0.021259308 ENSMUSG00000062515 Fabp4 836 0.2773 2.22E−05 0.007350468 ENSMUSG00000040938 Slc16a11 249 0.2724 3.57E−06 0.001437537 ENSMUSG00000025784 Clec3b 748 0.2704 8.47E−05 0.020760793 ENSMUSG00000022595 Lypd2 551 0.2658 0.000246368 0.047648949 ENSMUSG00000039004 Bmp6 1187 0.2634 0.000161683 0.033837805 ENSMUSG00000066687 Zbtb16 822 0.2630 4.37E−05 0.12694785 ENSMUSG00000041598 Cdc42ep4 7427 0.2581 8.96E−05 0.021259308 ENSMUSG00000021943 Gdf10 518 0.2573 0.000115563 0.25974121 ENSMUSG00000030278 Cidec 367 0.2471 1.15E−05 0.004174341 ENSMUSG00000048373 Fgfbp1 344 0.2441 1.37E−05 0.004833264 ENSMUSG00000065037 Rn7sk 263 0.2439 2.69E−06 0.001128964 ENSMUSG00000036256 Igfbp7 12145 0.2434 7.10E−05 0.018120573 ENSMUSG00000027447 Cst3 35343 0.2354 5.12E−07 0.000261486 ENSMUSG00000079507 H2-Q1 249 0.2312 4.37E−05 0.012694785 ENSMUSG00000026879 Gsn 56839 0.2300 3.81E−06 0.001466965 ENSMUSG00000025417 Pip4k2c 10331 0.2280 7.92E−05 0.19666363 ENSMUSG00000065911 199 0.2206 1.09E−05 0.004034884 ENSMUSG00000027656 Wisp2 241 0.2017 5.61E−05 0.15352478 ENSMUSG00000037185 Krt80 281 0.2002 0.000169408 0.034765482 ENSMUSG00000065824 148 0.1683 0.000163095 0.033837805 ENSMUSG00000045532 Clq11 210 0.1552 0.000106576 0.024242748 ENSMUSG00000007877 Tcap 148 −0.1666 0.000226999 0.044643191 ENSMUSG00000038670 Mybpc2 306 −0.2179 7.50E−05 0.018874355 ENSMUSG00000040621 Gemin8 460 −0.2428 0.000172846 0.0353089631 ENSMUSG00000026950 Neb 633 −0.2461 0.000153087 0.03256157 ENSMUSG00000029361 Nos1 8545 −0.2462 0.000131891 0.02929533 ENSMUSG00000061816 My11 304 −0.2927 5.37E−07 0.000267047 ENSMUSG00000074217 2210011C24Rik 1767 −0.3002 9.12E−05 0.021259308 ENSMUSG00000079316 Rab9 4067 −0.3168 4.63E−05 0.13245887 ENSMUSG00000040586 Ofd1 1418 −0.3790 1.09E−06 0.000480185 ENSMUSG00000044377 4354 −0.3974 2.42E−07 0.00012671 ENSMUSG00000090015 Gm15446 839 −0.4313 3.89E−09 2.72E−06 ENSMUSG00000061723 Tnnt3 964 −0.4816 5.81E−13 6.45E−10 ENSMUSG00000079317 Trappc2 7140 −0.4942 6.99E−12 6.60E−09 ENSMUSG00000025373 Rnf41 11954 −0.5169 1.00E−15 1.35E−12 ENSMUSG00000082286 3866 −0.5219 1.19E−12 1.24E−09 ENSMUSG00000040565 Btaf1 4110 −0.6499 4.26E−19 7.31E−16 ENSMUSG00000056999 Ide 13039 −0.6774 1.37E−32 6.46E−29

(123) TABLE-US-00005 TABLE 3 Differentially expressed genes in SC of Myo1a KO vs WT mice. Base Gene Mean Fold Change ENSEMBL ID Symbol Counts (log2) P value FDR ENSMUSG00000073643 Wdfy1 6789 1.8765 2.26E−100 6.80E−96 ENSMUSG00000039253 Fn3krp 992 1.3973 1.48E−38 1.49E−34 ENSMUSG00000000560 Gabra2 14817 1.2075 4.81E−40 7.24E−36 ENSMUSG00000025401 Myo1a 197 0.8047 6.00E−17 3.01E−13 ENSMUSG00000025453 Nnt 3738 0.7752 4.79E−16 1.86E−12 ENSMUSG00000095562 1577 0.6142 1.28E−08 3.51E−05 ENSMUSG00000090691 879 0.5521 2.12E−07 0.00042566 ENSMUSG00000025436 Xrcc6bp1 1357 0.5228 4.04E−07 0.000715195 ENSMUSG00000096768 Erdr1 657 0.4864 3.27E−06 0.004691284 ENSMUSG00000090546 Cdr1 29092 0.4828 4.22E−08 9.78E−05 ENSMUSG00000091754 781 0.4448 3.45E−05 0.034653432 ENSMUSG00000096904 1088 0.4284 4.22E−05 0.040987861 ENSMUSG00000041773 Enc1 3722 0.4158 5.83E−06 0.007634036 ENSMUSG00000044676 Zfp612 13786 0.3611 1.04E−05 0.12508737 ENSMUSG00000022995 Enah 14357 0.3407 3.20E−05 0.033173553 ENSMUSG00000025373 Rnf41 8435 −0.4051 1.14E−05 0.013223275 ENSMUSG00000024011 Pi16 2591 −0.4148 5.20E−05 0.048885646 ENSMUSG00000000711 Rab5b 9824 −0.4175 1.21E−06 0.002024553 ENSMUSG00000063681 Crb1 165 −0.4385 1.51E−06 0.002400311 ENSMUSG00000025044 Msr1 283 −0.4410 1.22E−05 0.013604768 ENSMUSG00000025400 Tac2 1034 −0.4635 1.85E−05 0.019871035 ENSMUSG00000044377 4306 −0.4653 4.67E−06 0.00638975 ENSMUSG00000040586 Ofd1 1271 −0.4771 1.04E−05 0.012508737 ENSMUSG00000023764 Sfi1 2276 −0.4851 1.70E−06 0.002555659 ENSMUSG00000079316 Rab9 3373 −0.5152 2.99E−07 0.000563214 ENSMUSG00000031342 Gpm6b 193529 −0.5227 1.91E−07 0.00041017 ENSMUSG00000079317 Trappc2 11463 −0.5444 1.61E−08 4.05E−05 ENSMUSG00000040565 Btaf1 3689 −0.6525 2.85E−12 8.59E−09 ENSMUSG00000056999 Ide 9557 −0.6808 4.93E−16 1.86E−12 ENSMUSG00000023795 1367 −0.7991 3.97E−14 1.33E−10 ENSMUSG00000090015 Gm15446 1500 −0.8872 3.91E−18 2.35E−14 ENSMUSG00000082286 5152 −1.2830 2.63E−38 1.98E−34

(124) While not surprising that the majority of DE genes were unique to DRG neurons where Myo1a is normally expressed (FIGS. 1A-G), a small number (14) of DE genes were deregulated in both DRG and SC neurons and 18 DE genes were unique to SC neurons (FIGS. 3A and 3B). To confirm the RNA seq data inventors focused on few genes that were differentially expressed in both tissues using quantitative reverse transcription polymerase chain reaction (qRT-PCR). In both tissues, Nnt, Gabra2 and Wdfy1 displayed a highly significant increase in Myo1a KO mice (FIG. 3C). However, inventors were unable to confirm the differential expression of the downregulated genes (data not shown). Myo1a KO mice selective alteration of the ionotropic GABAergic neurotransmission revealed by inventors' behavioral experiments prompted them to focus on Gabra2 gene. Gabra2 was the only GABA receptor subunit that displayed altered expression in Myo1a KO mice (Table 4).

(125) TABLE-US-00006 TABLE 4 Mean expression level (FPKM) GABA.sub.A DRG Spinal cord Subunit WT KO WT KO GABRA1 3707 3710 3761 3445 GABRA2 2271 5867 4131 12799 GABRA3 817 835 7977 8092 GABRA4 85 72 2620 2589 GABRA5 381 391 5615 6421 GABRA6 0 0 8 2 GABRB1 359 417 4383 4562 GABRB2 692 601 1574 1736 GABRB3 6225 6225 14167 15023 GABRG1 2227 2082 2613 2827 GABRG2 4193 4227 8822 9244 GABRG3 136 187 656 689 GABRD 34 29 35 48 GABRE 44 38 50 36 GABRP 1 1 6 2 GABRQ 12 22 365 365

(126) To complement the qRT-PCR results, they used in situ hybridization and immunohistochemistry. Using in situ hybridization they found that Gabra2 upregulation is much evident in DRG, with a very strong upregulation in large size neurons, than in SC (FIG. 3D). Using immunohistochemistry, they confirmed that Gabra2 upregulation was accompanied by a significant increase in GABRA2 protein in the dorsal horn of SC where primary afferent endings and local interneurons are intermingled (FIGS. 3E and 3F). Importantly, in line with the selective upregulation of GABRA2 (Table 4), they found no difference in the immunoreactivity of GABRA1 (α1 subunit) between the two genotypes (FIG. 3G). Finally, to test whether GABRA2 upregulation impacted GABA.sub.A-Rs function, they performed whole-cell patch clamp recordings on cultured WT and Myo1a KO Venus-expressing C-LTMRs. They found that bath application of increasing concentrations of muscimol triggered similar current amplitudes in both genotypes (FIGS. 4A and 4B), demonstrating that GABRA2 upregulation did not alter GABA.sub.A-Rs response to its selective agonist muscimol.

(127) Muscimol-Evoked Increase in Excitatory Glutamatergic Activity of Lamina II Interneurons is Severely Impaired in Inflamed Myo1a KO Mice.

(128) In an attempt to provide a rational explanation to the insensitivity of Myo1a KO mice to the analgesic effect of muscimol, inventors used whole cell patch-clamp recordings on SC slices. First, a thorough characterization of a large panel of electrophysiological properties of inner lamina II neurons under acute conditions and after inflammation (Carrageenan and Zymozan) revealed no difference between WT and Myo1a KO mice (FIG. 8). They then investigated the incidence of bath application of muscimol on spontaneous excitatory post-synaptic currents (sEPSC) in laminae II neurons in WT and Myo1a KO mice, under acute conditions and after zymosan inflammation. Under these conditions the overall average amplitude of sEPSC was similar between the two genotypes (data not shown). In naïve WT mice, bath application of 5 μM muscimol induced a significant increase in sEPSC frequency, as indicated by the shift of the sEPSC interval cumulative distribution curve towards the left (FIG. 4C). This effect was almost doubled in slices from WT mice inflamed with zymosan (FIG. 4E). Interestingly, in naïve slices from Myo1a KO mice, muscimol induced a drastic 544% increase in sEPSC frequency (FIG. 4D). However, this effect was completely lost in slices obtained from zymosan inflamed KO mice as bath application of muscimol had no effect on sEPSC frequency (FIG. 4F), further supporting inventors observed insensitivity of Myo1a KO mice to the analgesic effect of muscimol after injury (FIGS. 2D and 2F).

CONCLUSIONS

(129) In these experiments, inventors showed that loss of MYO1A converted an injury-induced acute and reversible pain into a long lasting and irreversible pain. This pain chronicity was selective to mechanical sensitivity in two inflammatory, one neuropathic and one post-operative pain models, suggesting that loss of MYO1A predisposes an individual to develop injury-induced chronic pain and revealing these mice as an ideal animal model to uncover the cellular and molecular mechanisms that trigger the transition from acute to chronic pain. Indeed, inventors found that loss of MYO1A selectively impaired the ionotropic GABAergic signaling as injury-induced mechanical hypersensitivity in Myo1a KO mice could be transiently reversed by opioids, baclofen, pregabalin, TAFA4 and taurine but not by muscimol and diazepam. They also found that loss of MYO1A resulted in a constitutive upregulation of the α2 subunit of GABA.sub.A-Rs, suggesting a possible participation of the altered expression of this subunit in the process of injury-induced pain chronicity.

(130) Chronic pain is a serious and highly heterogeneous medical problem with a prevalence varying from 20 to 30% of the world population (Bouhassira et al., 2008; Breivik et al., 2006). Given that only a fraction of individuals develop chronic pain, the contribution of genetic factors has been postulated (Belfer et al., 2015; Devor, 2004; Macrae, 2008; Tegeder et al., 2006; Voscopoulos and Lema, 2010). Here, using four different pain paradigms, inventors showed that Myo1a KO mice developed irreversible chronic pain after injury, demonstrating a causal link between loss of MYO1A and the development of chronic pain. Very importantly, inventors found that loss of one copy of Myo1a gene in Myo1a.sup.+/− mice induced a long lasting and irreversible mechanical pain in the setting of inflammation, further supporting a contribution of Myo1a as a predisposition gene to develop injury-induced chronic pain (FIG. 7I).

(131) Using behavioral pharmacology, inventors showed that injury-induced mechanical hypersensitivity could not be reversed in Myo1a KO mice by muscimol. This impaired ionotropic GABAergic signaling was further demonstrated by their electrophysiological recordings in which they showed that under acute conditions, muscimol evoked a drastic increase in the excitatory glutamatergic activity of lamina II interneurons, whereas after inflammation, this effect was completely abolished. They also showed that the selective antagonist of GABA.sub.A-Rs biccuculine evoked similar mechanical hypersensitivity in naïve WT and Myo1a KO mice (FIG. 7J), demonstrating that GABA.sub.A-Rs are functional in Myo1a KO mice under acute conditions. Together, these data indicate that injury causes a shift of spinal GABA.sub.A-Rs from active to inactive state, further silencing the ionotropic GABAergic inhibitory neurotransmission in Myo1a KO mice, thus leading to the development of chronic pain. One plausible explanation to this phenomenon is that injury induces a massive internalization of GABA.sub.A-Rs in Myo1a KO mice. Indeed, decreases in synaptic GABA.sub.A-Rs, resulting from enhanced endocytosis, have been observed in animals in which the life-threatening refractory convulsive status epilepticus (SE) has been experimentally induced (Naylor et al., 2005; Terunuma et al., 2008). Interestingly, this decrease in surface receptors mainly targets GABA.sub.A-Rs containing benzodiazepine-sensitive subunits, which explains both the pharmaco-resistance of SE patients to benzodiazepines and the non-terminating nature of the seizures. Remarkably, inventors demonstrated that under injury conditions, Myo1a KO mice were totally insensitive to muscimol and DZP, and under these same conditions, once the injury-induced mechanical hypersensitivity is established; it becomes irreversible in these mice.

(132) Another possible explanation to the observed phenotype came from inventors' RNA deep sequencing data. They found that loss of MYO1A was accompanied by a massive and selective upregulation of Gabra2 both in DRG and SC neurons at steady state, indicating that this altered expression likely participate to the observed injury-induced pain chronicity. Although they confirmed that gabra2 upregulation resulted in a significant increase in GABRA2 protein, this increase has no effect on the amplitude of muscimol-evoked currents in Myo1a KO CLTMRs. Given that GABRA2 was the only GABA.sub.A-Rs subunit to be differentially expressed in DRG and SC neurons, inventors' data suggest that GABRA2 upregulation likely contribute to shifting the balance towards more GABA.sub.A-Rs containing α2 subunit. In this case, the α2/α1 ratio will be mainly impacted in large size primary afferent neurons (See FIG. 3D) as α2 and α1 are the main subunits expressed in DRG.

(133) In line with this hypothesis, a recent study demonstrated that patients with refractory convulsive status epilepticus and refractory epilepsy had significantly more α2-containing GABA.sub.A-Rs at the expense of α1-containing receptors (Loddenkemper et al., 2014). Future studies exploring whether α2-containing GABA.sub.A-Rs are prone to excessive internalization than GABA.sub.A-Rs containing other alpha subunits are warranted.

(134) In conclusion, although it did not decipher the precise mechanisms that impair GABA.sub.A-Rs function under injury conditions in Myo1a KO mice, inventors describe the first mouse model in which a loss-of-function mutation leads to an irreversible pain state after injury. They also provide strong arguments that Myo1a gene should be seriously considered as a predictive genetic factor for the development of injury-induced chronic pain and points out the ionotropic GABAergic system as the main mechanism that contributes to the transition from acute to chronic pain. Inventors' study also provides a powerful preclinical animal model that can be used (i) to deepen our understanding of the molecular and cellular mechanisms that trigger the transition from acute to chronic pain and (ii) to the design “á la carte” pharmacological therapies to prevent the establishment of chronic pain.

REFERENCES

(135) Ahmadi, S., Lippross, S., Neuhuber, W. L., and Zeilhofer, H. U. (2002). PGE(2) selectively blocks inhibitory glycinergic neurotransmission onto rat superficial dorsal horn neurons. Nat Neurosci 5, 34-40. Belfer, I., Dai, F., Kehlet, H., Finelli, P., Qin, L., Bittner, R., and Aasvang, E. K. (2015). Association of functional variations in COMT and GCH1 genes with postherniotomy pain and related impairment. Pain 156, 273-279. Bennett, G. J., and Xie, Y. K. (1988). A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain 33, 87-107. Bouhassira, D., Lanteri-Minet, M., Attal, N., Laurent, B., and Touboul, C. (2008). Prevalence of chronic pain with neuropathic characteristics in the general population. Pain 136, 380-387. Bourane, S., Duan, B., Koch, S. C., Dalet, A., Britz, O., Garcia-Campmany, L., Kim, E., Cheng, L., Ghosh, A., Ma, Q., and Goulding, M. (2015a). Gate control of mechanical itch by a subpopulation of spinal cord interneurons. Science 350, 550-554. Bourane, S., Grossmann, K. S., Britz, O., Dalet, A., Del Barrio, M. G., Stam, F. J., Garcia-Campmany, L., Koch, S., and Goulding, M. (2015b). Identification of a spinal circuit for light touch and fine motor control. Cell 160, 503-515. Braathen, G. J., Hoyer, H., Busk, O. L., Tveten, K., Skjelbred, C. F., and Russell, M. B. (2015). Variants in the genes DCTN2, DNAH10, LRIG3, and MYO1A are associated with intermediate Charcot-Marie-Tooth disease in a Norwegian family. Acta neurologica Scandinavica. Breivik, H., Collett, B., Ventafridda, V., Cohen, R., and Gallacher, D. (2006). Survey of chronic pain in Europe: prevalence, impact on daily life, and treatment. Eur J Pain 10, 287-333. Brennan, T. J. (1999). Postoperative Models of Nociception. ILAR journal/National Research Council, Institute of Laboratory Animal Resources 40, 129-136. Chaplan, S. R., Bach, F. W., Pogrel, J. W., Chung, J. M., and Yaksh, T. L. (1994). Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53, 55-63. Coull, J. A., Beggs, S., Boudreau, D., Boivin, D., Tsuda, M., Inoue, K., Gravel, C., Salter, M. W., and De Koninck, Y. (2005). BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain. Nature 438, 1017-1021. Coull, J. A., Boudreau, D., Bachand, K., Prescott, S. A., Nault, F., Sik, A., De Koninck, P., and De Koninck, Y. (2003). Trans-synaptic shift in anion gradient in spinal lamina I neurons as a mechanism of neuropathic pain. Nature 424, 938-942. Decosterd, I., and Woolf, C. J. (2000). Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87, 149-158. Delfini, M. C., Mantilleri, A., Gaillard, S., Hao, J., Reynders, A., Malapert, P., Alonso, S., Francois, A., Barrere, C., Seal, R., et al. (2013). TAFA4, a chemokine-like protein, modulates injury-induced mechanical and chemical pain hypersensitivity in mice. Cell Rep 5, 378-388. Devor, M. (2004). Evidence for heritability of pain in patients with traumatic neuropathy. Pain 108, 200-201; author reply 202. Donaudy, F., Ferrara, A., Esposito, L., Hertzano, R., Ben-David, O., Bell, R. E., Melchionda, S., Zelante, L., Avraham, K. B., and Gasparini, P. (2003). Multiple mutations of MYO1A, a cochlear-expressed gene, in sensorineural hearing loss. Am J Hum Genet 72, 1571-1577. Duan, B., Cheng, L., Bourane, S., Britz, O., Padilla, C., Garcia-Campmany, L., Krashes, M., Knowlton, W., Velasquez, T., Ren, X., et al. (2014). Identification of spinal circuits transmitting and gating mechanical pain. Cell 159, 1417-1432. Eisenberger, T., Di Donato, N., Baig, S. M., Neuhaus, C., Beyer, A., Decker, E., Murbe, D., Decker, C., Bergmann, C., and Bolz, H. J. (2014). Targeted and genomewide NGS data disqualify mutations in MYO1A, the “DFNA48 gene”, as a cause of deafness. Hum Mutat 35, 565-570. FASTQC (2010). FastQC: A quality control tool for high throughput sequence data v. 0.11.3 Worldwide Website: bioinformatics.bbsrc.ac.uk/projects/fastqc/, 2010). Foster, E., Wildner, H., Tudeau, L., Haueter, S., Ralvenius, W. T., Jegen, M., Johannssen, H., Hosli, L., Haenraets, K., Ghanem, A., et al. (2015). Targeted ablation, silencing, and activation establish glycinergic dorsal horn neurons as key components of a spinal gate for pain and itch. Neuron 85, 1289-1304. Gaillard, S., Lo Re, L., Mantilleri, A., Hepp, R., Urien, L., Malapert, P., Alonso, S., Deage, M., Kambrun, C., Landry, M., et al. (2014). GINIP, a Galphai-interacting protein, functions as a key modulator of peripheral GABAB receptor-mediated analgesia. Neuron 84, 123-136. Gilron, I., Jensen, T. S., and Dickenson, A. H. (2013). Combination pharmacotherapy for management of chronic pain: from bench to bedside. The Lancet Neurology 12, 1084-1095. Harvey, R. J., Depner, U. B., Wassle, H., Ahmadi, S., Heindl, C., Reinold, H., Smart, T. G., Harvey, K., Schutz, B., Abo-Salem, O. M., et al. (2004). GlyR alpha3: an essential target for spinal PGE2-mediated inflammatory pain sensitization. Science 304, 884-887. Hulse, R. P., Donaldson, L. F., and Wynick, D. (2012). Differential roles of galanin on mechanical and cooling responses at the primary afferent nociceptor. Mol Pain 8, 41. Kehlet, H., Jensen, T. S., and Woolf, C. J. (2006). Persistent postsurgical pain: risk factors and prevention. Lancet 367, 1618-1625. Kravtsov, D. V., Caputo, C., Collaco, A., Hoekstra, N., Egan, M. E., Mooseker, M. S., and Ameen, N. A. (2012). Myosin Ia is required for CFTR brush border membrane trafficking and ion transport in the mouse small intestine. Traffic 13, 1072-1082. Liao, Y., Smyth, G. K., and Shi, W. (2013). The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 41, e108. Liao, Y., Smyth, G. K., and Shi, W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930. Loddenkemper, T., Talos, D. M., Cleary, R. T., Joseph, A., Sanchez Fernandez, I., Alexopoulos, A., Kotagal, P., Najm, I., and Jensen, F. E. (2014). Subunit composition of glutamate and gamma-aminobutyric acid receptors in status epilepticus. Epilepsy research 108, 605-615. Love, M. I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. Macrae, W. A. (2008). Chronic post-surgical pain: 10 years on. Br J Anaesth 101, 77-86. Mazzolini, R., Dopeso, H., Mateo-Lozano, S., Chang, W., Rodrigues, P., Bazzocco, S., Alazzouzi, H., Landolfi, S., Hernandez-Losa, J., Andretta, E., et al. (2012). Brush border myosin Ia has tumor suppressor activity in the intestine. Proc Natl Acad Sci USA 109, 1530-1535. Muller, F., Heinke, B., and Sandkuhler, J. (2003). Reduction of glycine receptor-mediated miniature inhibitory postsynaptic currents in rat spinal lamina I neurons after peripheral inflammation. Neuroscience 122, 799-805. Munro, G., Ahring, P. K., and Mirza, N. R. (2009). Developing analgesics by enhancing spinal inhibition after injury: GABAA receptor subtypes as novel targets. Trends Pharmacol Sci 30, 453-459. Naylor, D. E., Liu, H., and Wasterlain, C. G. (2005). Trafficking of GABA(A) receptors, loss of inhibition, and a mechanism for pharmacoresistance in status epilepticus. J Neurosci 25, 7724-7733. Peirs, C., Williams, S. P., Zhao, X., Walsh, C. E., Gedeon, J. Y., Cagle, N. E., Goldring, A. C., Hioki, H., Liu, Z., Marell, P. S., and Seal, R. P. (2015). Dorsal Horn Circuits for Persistent Mechanical Pain. Neuron 87, 797-812. Petitjean, H., Pawlowski, S. A., Fraine, S. L., Sharif, B., Hamad, D., Fatima, T., Berg, J., Brown, C. M., Jan, L. Y., Ribeiro-da-Silva, A., et al. (2015). Dorsal Horn Parvalbumin Neurons Are Gate-Keepers of Touch-Evoked Pain after Nerve Injury. Cell reports 13, 1246-1257. Reynders, A., Mantilleri, A., Malapert, P., Rialle, S., Nidelet, S., Laffray, S., Beurrier, C., Bourinet, E., and Moqrich, A. (2015). Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell reports. Sandkuhler, J. (2009). Models and mechanisms of hyperalgesia and allodynia. Physiol Rev 89, 707-758. Reynders, A., Mantilleri, A., Malapert, P., Rialle, S., Nidelet, S., Laffray, S., Beurrier, C., Bourinet, E., and Moqrich, A. (2015). Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell reports. Shields, S. D., Eckert, W. A., 3rd, and Basbaum, A. I. (2003). Spared nerve injury model of neuropathic pain in the mouse: a behavioral and anatomic analysis. J Pain 4, 465-470. Tegeder, I., Costigan, M., Griffin, R. S., Abele, A., Belfer, I., Schmidt, H., Ehnert, C., Nejim, J., Marian, C., Scholz, J., et al. (2006). GTP cyclohydrolase and tetrahydrobiopterin regulate pain sensitivity and persistence. Nat Med 12, 1269-1277. Terunuma, M., Xu, J., Vithlani, M., Sieghart, W., Kittler, J., Pangalos, M., Haydon, P. G., Coulter, D. A., and Moss, S. J. (2008). Deficits in phosphorylation of GABA(A) receptors by intimately associated protein kinase C activity underlie compromised synaptic inhibition during status epilepticus. J Neurosci 28, 376-384. Tyska, M. J., Mackey, A. T., Huang, J. D., Copeland, N. G., Jenkins, N. A., and Mooseker, M. S. (2005). Myosin-1a is critical for normal brush border structure and composition. Mol Biol Cell 16, 2443-2457. Voscopoulos, C., and Lema, M. (2010). When does acute pain become chronic? Br J Anaesth 105 Suppl 1, i69-85. Wang, L., Wang, S., and Li, W. (2012). RSeQC: quality control of RNA-seq experiments. Bioinformatics 28, 2184-2185. Witschi, R., Punnakkal, P., Paul, J., Walczak, J. S., Cervero, F., Fritschy, J. M., Kuner, R., Keist, R., Rudolph, U., and Zeilhofer, H. U. (2011). Presynaptic alpha2-GABAA receptors in primary afferent depolarization and spinal pain control. J Neurosci 31, 8134-8142. Zeilhofer, H. U., Wildner, H., and Yevenes, G. E. (2012). Fast synaptic inhibition in spinal sensory processing and pain control. Physiol Rev 92, 193-235.