Nanocrystalline calcium hydroxyapatites, method for its manufacture and use thereof in regenerative medicine and theranostic

11180370 · 2021-11-23

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of manufacturing the calcium nanohydroxyapatite Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 structurally modified with Li.sup.+ ions (nHAP:Li.sup.+) Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 optionally doped with 1-2% mol of Eu.sup.3+ cations in the form of nanocrystalline powder and use of Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 in regenerative medicine as an agent improving of proliferative activity of progenitor cells and demonstrating an anti-apoptotic effect on progenitor cells and in addition use of Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 doped with 1-2% mol Eu.sup.3+ cations as an agent improving of proliferative activity of progenitor cells and demonstrating the luminescence signal used in diagnostic application.

Claims

1. A method of manufacturing calcium nanohydroxyapatite (Ca.sub.10(PO.sub.4).sub.6(OH).sub.2) structurally modified with Li.sup.+ ions to provide Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2, optionally doped with 1-2% mol of Eu.sup.3+ cations, in a form of a nanocrystalline powder as a final product, comprising the following steps: in a first step a solution of water soluble lithium nitrate is obtained by digestion of a stoichiometric amount of Li.sub.2CO.sub.3 in an excess of HNO.sub.3; in a second step, depending on the final product: for Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 as the final product, a solution of water soluble calcium nitrate is obtained by suspension of 73.35 g of Ca(OH).sub.2 in 200 ml of deionized water and subsequent digestion of calcium dioxide in an excess of 65% HNO.sub.3 and 170 g of polyvinylpyrrolidone is added to forma solution of calcium nitrate and polyvinylpyrrolidone or, for Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 doped with 1-2% mol of Eu.sup.3+ cations as the final product, pure europium (III) nitrate is obtained by suspending stoichiometric amounts 0.0352 g of Eu.sub.2O.sub.3 in distilled water and subsequent digestion of europium oxide in an excess of 65% HNO.sub.3 and subsequent three times re-crystallization, and a solution of 2.2434 g of Ca(NO.sub.3).sub.2.4H.sub.2O dissolved in MQ-water is added to the pure europium (III) nitrate to obtain a solution of calcium nitrate and europium (III) nitrate; in a third step an ammonium phosphate solution is obtained by dissolution of (NH.sub.4).sub.2HPO.sub.4 in water; in a fourth step the solutions prepared in the first and second steps are added to the ammonium phosphate solution obtained in the third step to form a mixture, leading to fast precipitation of a by-product; in a fifth step pH of the mixture is adjusted to 8-10 by addition of ammonium hydroxide NH.sub.4OH and the mixture is filtered under reduced pressure to obtain as a precipitate the by-product formed in the fourth step; in a sixth step the precipitate resulting from the fifth step is washed 5 times and dried at 90° C. for 20-24 h; and in a seventh step the washed and dried precipitate resulting from the sixth step is subjected to a thermal treatment by gradually heating at 400-500° C. in air atmosphere for 3-4 hours, at a heating rate of 5° C. per minute to obtain the final product.

2. The method according to claim 1, wherein for manufacturing Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 in the seventh step the precipitate resulting from the sixth step is subjected to a thermal treatment by gradually heating at 400° C. in air atmosphere for 4 hours, at a heating rate of 5° C. per minute to obtain the final product with a particle size distribution in the range of 30-50 nm and a surface area 40 m.sup.2/g or gradually heating at 500° C. in air atmosphere for 8 hours, at a heating rate of 20° C. per minute to obtain a particle size distribution in the range of 50-80 nm and a surface area 30 m.sup.2/g.

3. The method according to claim 1 wherein for manufacturing Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 doped with 1-2% mol of Eu.sup.3+ in the seventh step the precipitate resulted in the sixth step is subjected to a thermal treatment by gradually heating at 500° C. in air atmosphere for 3 hours, at a heating rate of 5° C. per minute to obtain fine graded white powder with elongated rod shaped particles with mean particle size being of 80 nm length and 15 nm width.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The invention is illustrated in the drawing, where

(2) FIG. 1 presents the results of the XRD measurement of all obtained samples and Rietveld refinement [26] of the nHAP:Li.sup.+ powders;

(3) FIG. 2 presents the result of the Rietveld analysis of the nHAP doped with 5 mol % Li.sup.+ heated at 500° C. (taking a view from the line located at the lowest position of an axis intensity in an upper direction), the column are the reference phase peaks position of Ca.sub.10(PO.sub.4).sub.6(OH).sub.2, the grey line is differential pattern, the black line refers to XRD pattern, partially covered with grey pattern which is fitted diffraction line;

(4) FIG. 3 presents the comparison of the FTIR spectra of pure nHAP (black line) with nHAP:Li.sup.+ (grey line) nanoparticles;

(5) FIG. 4 presents TEM and SAED images of the nHAP: 5 mol % Li+ nanoparticles

(6) FIG. 5 presents SEM image and elements mapping (Ca, P and O) of the nHAP:Li.sup.+ nanoparticles using SEM-EDS technique.

(7) FIG. 6 presents time dependent release of Li+ cations from the nHAP: 5 mol % Li+ pellets immersed in PBS buffer medium.

(8) FIG. 7 presents The characteristics of hOECs and hASCs used for the experiment. (A) The hOECs expressed neuron-specific markers p75.sup.NGF, GFAP and s-100. Additionally, the morphology of cells in cultures was shown. (B) The analysis of hASCs phenotype showed that obtained population was positive for CD44, CD73, CD90 and CD105 i.e. mesenchymal markers and did not expressed hematopoietic markers CD34 and CD45. The typical features of hASCs morphology in standard, adipogenic, osteogenic and chondrogenic cultures was shown. Characteristic features of differentiated hASC was revealed after specific staining—lipid-rich vacuoles in adipogenic cultures (Oil Red O), chondrogenic nodules (Sarfanin-O) and calcium deposits (Alizarin Red). The scale bar included in the pictures=100 μm.

(9) FIG. 8 presents the proliferative activity of hOECs and hASC cultured on nHAP, nHAP:Li.sup.+ and with Li.sup.+ addition after 24 h (A:D1), 72 h (B:D3), 120 h (C:D5) and results of population doubling time analysis (D). The statistically significant differences associated with increased proliferative activity were indicated with an asterisk (*??<0.05; **??<0.01; ***??<0.001), while related to the decrease with hashtag (.sup.#??<0.05; .sup.##?<0.01; .sup.###??<0.001).

(10) FIG. 9 presents the influence of nHAP:Li on hOECs (A) and hASCs (B) viability. The images from the epifluorescent microscope were prepared using 100× magnification (scale bar=100 μm). The viable cells are green stained (visualized with calcien-AM), while dead cells are stained with propidium ioide (red-stained cells). The quantitative analysis of images was performed using ImageJ software (NIH). The differences in transcripts level was determined using qRT-PCR technique. The results were presented as ratio of interested genes. The transcript level of genes was normalized to the reference gene expression (GAPDH). The statistically significant differences were indicated with an asterisk (*??<0.05; **??<0.01; ***??<0.001).

(11) FIG. 10 presents the morphology and growth pattern of hOECs and hASC cultures with investigated biomaterials (nHAP and nHAP:Li.sup.+) and Li.sup.+ addition. Scale bars presented in the images obtained using epifluroescent microscope are equal 100 μm, while scale bars in the microphotographs from SEM are equal 2 μm.

(12) FIG. 11 presents the results of biocompatibility analysis of nHAP:Li.sup.+ doped with europium(III). Culture dish—images of the nanohydroxyapatites (nHAP—1A, 2 A) doped with Li+ (2 mol % Li.sup.+:nHAP—1B, 2 B) and co-doped with Eu.sup.3+ ions (5% mol Li.sup.+, x % mol Eu.sup.3+:nHAP, where x is 1 (1C, 2C, 5C and 6C), x is 2 (1D, 2D, 5D and 6D)) combined with human adipose derived stromal steam cells and control sample (3A-D and 4A-D) without excitation (on top) as well as disc and UV-irradiation (on bottom). Images from the epifluorescent microscope presents results of live/dead staining. Percentage of dead cells stained with propidium ioide was determined and low expression of pro-apoptotic genes was noted. Confocal microscope revealed the internalization of Eu.sup.3+ ions in cells cytoplasm and in the perinuclear region. Cells propagated on investigated were also characterized by increased proliferative activity. The statistically significant differences between proliferation activity of cultures on nHAP:Li.sup.+ doped with Eu.sup.3+ ions and nHAP:Li.sup.+ were indicated with a hashtag (#??<0.05; ##??<0.01; ###??<0.001), while between 1 mol % Eu.sup.3+ and 2 mol % Eu.sup.3+ with an asterisk.

DETAILED DESCRIPTION

Example 1

(13) Calcium nanohydroxyapatite Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 structurally modified with Li.sup.+ ions (nHAP:Li.sup.+) Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 in the form of nanocrystalline powder is obtained in a multi-step process, in replacement of overall molar content of Ca.sup.2+ ions. Analytical grade calcium hydroxide Ca(OH).sub.2 (99% Acros Organics), diammonium phosphate NH.sub.4H.sub.2PO.sub.4 (99.995% Alfa Aesar), lithium carbonate Li.sub.2CO.sub.3 (99.9% Alfa Aesar), 65% nitric acid HNO.sub.3 (ultrapure Avantor Poland) and ammonium hydroxide NH.sub.4OH (99% Avantor Poland) for pH adjustment were used.
On the scale was weighed in sequence 73.35 g calcium hydroxide Ca(OH).sub.2 (analytical grade 99% Acros Organics), 79.234 g diammonium phosphate (NH.sub.4).sub.2HPO.sub.4 (99.995% Alfa Aesar), and 0.37 g lithium carbonate Li.sub.2CO.sub.3 (99.9% Alfa Aesar). All substances were placed into three separate beakers.
At first, the stoichiometric amount of the Li.sub.2CO.sub.3 was digested in an excess of HNO.sub.3 (65% ultrapure Avantor Poland) in order to transform lithium carbonate into the water soluble lithium nitrate.
Then the stoichiometric amounts of Ca(OH).sub.2 were suspended in 200 ml of deionized water and digested with stirring in an excess of 138.5 ml nitric acid HNO.sub.3 (65%, ultrapure Avantor Poland) to obtain water soluble calcium nitrates.
Subsequently, to a solution containing calcium nitrate, the final volume of about 340 ml, was added 170 g of polyvinylpyrrolidone (PVP) (50% relative to the weight of the calcium nitrate). In order to achieve complete dissolution of the PVP the process can be assisted by using a mechanical stirring and heating the mixture at 60° C. for 1 hour.
Then, the Afterwards, the solution was transferred to the beaker containing calcium nitrate and PVP.
Next, the stoichiometric amount of the (NH.sub.4).sub.2HPO.sub.4 was dissolved under vigorous stirring in an excess of 250 ml of H.sub.2O in order to obtain the ammonium phosphate solution.
Finally, all previously prepared solutions of calcium nitrate, lithium nitrate and PVP were added to the mixture of ammonium phosphate leading to the fast precipitation of the by-product. In the last step, the pH of the dispersion was modulated to 8-9 by addition of ammonium hydroxide NH.sub.4OH (99% Avantor Poland). After two hours of vigorous stirring at room temperature the mixture was filtrated using a conventional laboratory filtration system under reduced pressure.
The supernatant was removed, and the precipitate of white by-products was transferred from the filter into a beaker and refined with distilled water and filtered, respectively. The washing step was repeated five times. The wet powder was transferred from the filter to the drying chamber and dried at 90° C. for 24 h.
Formation of Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 with 30-50 nm Particle Size Distribution
The calcium hydroxyapatite powder Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 doped with 5 mol % of Li.sup.+ ions in amount of 100 g was added into a crucible and then into a muffle furnace and was gradually heated at 400° C. in air atmosphere, at a heating rate of 5° C. per minute.
The thermal treatment at 400° C. for 4 hours was the last step during materials preparation in order to crystallize the Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 with the particle size distribution in the range of 30-50 nm. The results of the high specific surface area using BET (Brunauer-Emmett-Teller) analysis of obtained powder was 40 m.sup.2/g.
Formation of Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 with 50-80 nm Particle Size Distribution
The calcium hydroxyapatite powder Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 doped with 5 mol % of Li.sup.+ ions in amount of 100 g was added into a crucible and then into a muffle furnace and was gradually heated at 500° C. in air atmosphere, at a heating rate of 20° C. per minute.
The thermal treatment at 500° C. for 8 hours was the last step during materials preparation in order to crystallize the Li.sub.0.1Ca.sub.9.9(PO.sub.4).sub.6(OH).sub.2 with the particle sized distribution in the range of 50-80 nm. The results of the high specific surface area using BET (Brunauer-Emmett-Teller) analysis of obtained powder was 30 m.sup.2/g.

Example 2

(14) Calcium nanohydroxyapatite Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 structurally modified with 5% mol of Li+ ions (nHAP:Li.sup.+) doped with 1-2% mol Eu.sup.3+ cations in the form of nanocrystalline powder is obtained using co-precipitation technique.

(15) Analytical grade calcium hydroxide Ca(NO.sub.3).sub.2.4H.sub.2O (99.98% Alfa Aesar), diammonium phosphate NH.sub.4H.sub.2PO.sub.4 (99.99% Sigma Aldrich), lithium carbonate Li.sub.2CO.sub.3 (99% Alfa Aesar), Eu.sub.2O.sub.3 (99.99% Alfa Aesar), nitric acid HNO.sub.3 (65% ultrapure Avantor Poland) and ammonium hydroxide NH.sub.4OH (99% Avantor Poland) for pH adjustment were used as the main substrates.
For preparation calcium nanohydroxyapatite structurally modified with 5% mol of Li.sup.+ ions doped with 1% mol Eu.sup.3+ cations, in the first step the water soluble lithium nitrate is obtained by digestion of the stoichiometric amount 0.185 g of Li.sub.2CO.sub.3 in an excess of HNO.sub.3 (65% ultrapure Avantor Poland).
Subsequently, the pure europium (III) nitrate is obtained by suspending stoichiometric amounts 0.0352 g of Eu.sub.2O.sub.3 in distilled water and subsequent digestion of europium oxide in an excess of 65% HNO.sub.3 and three times re-crystallization and solution of 2.2434 g of Ca(NO.sub.3).sub.2.4H.sub.2O dissolved in MQ-water is added
In a third step the ammonium phosphate solution is obtained by dissolution of (NH.sub.4).sub.2HPO.sub.4 in water.
Afterwards together with LiNO.sub.3 (obtained in the first step) and the pure europium (III) nitrate (obtained in the second step) subsequently 0.7923 g (6 mmol) of (NH.sub.4).sub.2HPO.sub.4 was added to the mixture resulting in a fast precipitation of the by-product. The solution pH was adjusted to 10 with NH.sub.4OH under constant and vigorous stirring at 90° C. for 4 hours. Finally, by-products were dried for 20 hrs at 90° C. and thermally treated at 500° C. for 3 hours resulting in formation of white, fine-grained powders.
The final product was the subject of high resolution transmission electron microscopy (HR-TEM) to confirm particle size and morphology. The HR-TEM shows, that particles of calcium nanohydroxyapatite Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 structurally modified with 5% mol of Li.sup.+ ions (nHAP:Li.sup.+) doped with 1-2% mol Eu.sup.3+ cations are of regular, elongated rod-like shapes with mean particle size being of 80 nm length and 15 nm width.

Example 3

(16) The In Vitro Li.sup.+ Release and its Determination

(17) The Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 containing 5 mol % of Li.sup.+ obtained in accordance with Example 1 were transformed into the form of pellets by using mechanical press. Pellets were put into bottles filled with phosphate buffer (PBS, pH 7.4, 100 ml). Afterwards, samples were incubated at 37° C. under constant stirring at 150 rpm. Each time and with specific time intervals 0.5 ml of solution containing nHAP:Li.sup.+ was withdrawn and diluted ten times with PBS and immediately replaced with 0.5 ml of fresh PBS medium. In that way a time dependent release study was carried out for 48 hours. Three independent measurements were carried out. Final determination of Li.sup.+ was done by means of ICP OES (coupled plasma optical emission spectrometry) technique using the 6-point calibration curves covering the concentration range between 50-2000 μg/ml.

Example 4

(18) The Physicochemical Characterization of nHAP:Li.sup.+ and nHAP:Li.sup.+, Eu.sup.3+

(19) The X-Ray Powder Diffraction and Rietveld Refinement

(20) The ion(s)-release process in nHAP strongly depends on the particle size and crystallinity of the material. Small particles in contrast to larger counterparts are characterized by the extended surface area and therefore, better contact with outer surrounding allowing for more effective ions release. In order to prevent from instantaneous outburst of ionic species high crystallinity of HAP is crucial. In fact, both factors mentioned above are strongly related to each other and one has to find a balance between them. Thus, since the formation of crystalline phase of the HAP nanoparticles is well described in the literature [27], annealing temperature of 500° C. was chosen as the most adequate in terms of particle size and crystallinity.
As shown in FIG. 1 the nHAP:Li.sup.+ powders exhibit a very good correspondence with the reference standard of the HAP hexagonal phase (ICSD 26204). The cell parameters (Table 1) were calculated using Rietveld method assuming incorporation of the Li.sup.+ ions at both Ca.sup.2+ sites (Ca(1) and Ca(2)) with even distribution between both cationic sites. The results of fitting leads to the final conclusion that nHAP:Li.sup.+ nanoparticles are of high purity without presence of any other phases and lithium cations are incorporated in the crystal structure of the nanohydroxyapatite presents the results of the XRD measurement of all obtained samples and Rietveld refinement [28] of the nHAP:Li.sup.+ powders.

(21) TABLE-US-00001 TABLE 1 Atomic parameters of the Ca.sub.10(PO.sub.4).sub.6(OH).sub.2 doped with 5 mol % of Li.sup.+ ions. Sample Ca.sub.10(PO.sub.4).sub.6 (OH).sub.2: 5% Li.sup.+; Z = 1 Space group Hexagonal P6.sub.3/m (176) Calculated cell a = 9.4306(24) Å parameters c = 6.8811(24) Å V = 529.99(27) Å.sup.3 R.sub.w 3.29% R.sub.wnb 3.06% R.sub.all 2.52% R.sub.nb 2.57% σ 1.93% Selected shortest contacts Ca|Li—Li|Ca 3.9384(9) Å Ca|Li—O 2.3933(5) Å P—O 1.5097(4) Å Ca|Li—O—Li|Ca 89.487(4)°  Wyckoff Occ. Atom positions X y z B.sub.iso (<1) O1 6h 0.3272 0.4837 0.25 0.023531 O2 6h 0.5836 0.4650 0.25 0.025321 O3 12i  0.3420 0.2567 0.06359 0.018173 P1 6h 0.3992 0.3617 0.25 0.017356 Ca1/Li1 4f 0.3332 0.6671 0.0043 0.09148 Ca2/Li2 6h 0.2452 0.9917 0.25 0.06772 O4 4e 0 0 0.1787 0.025 0.5 H1 4e 0 0 0.0695 0.014180 0.5
Fourier Transform Infrared Spectroscopy
The FT-IR spectra were recorded for purity and 5 mol % Li.sup.+ doped nHAP nanoparticles covering the spectral region of 500-1200 cm.sup.−1 at room temperature. The spectra (see FIG. 3) consists of typical vibrations of the PO.sub.4.sup.3− groups at 598 cm.sup.−1, 559 cm.sup.−1 (v.sub.4), 961 cm.sup.−1 (v.sub.1), 1088 cm.sup.−1 and 1018 cm.sup.−1 (v.sub.3) as well as OH vibration mode at 630 cm.sup.−1. In the case of pure nHAP one can individuate low intensity modes at 725 cm.sup.−1 and 1200 cm.sup.−1 usually attributed to the vibrations of the P.sub.2O.sub.7.sup.4− units connected with transformation of the HPO.sub.4.sup.2−. The last feature with low intensity is located at 875 cm.sup.−1 and its source is usually seen in surface absorption of CO.sub.2 from air or substitution of PO.sub.4.sup.3− with CO.sub.3.sup.2− groups [29]. These bands disappear completely upon doping with Li.sup.+ except for the CO.sub.3.sup.2− vibrations. The presence of small amount of carbonates is characteristic of biogenic hydroxyapatites and does not affect the final properties of the material [30]. Actually, the presence of CO.sub.3.sup.2− is desirable since such composition approximates much better the inorganic part of natural bone tissue (up to 8 wt. %) [31,32] increasing bioresorbtion [33] due to the fact of existence of structural distortion induced by CO.sub.3.sup.2− substitution [34].
HR-TEM Microscopy and SEM Elements Mapping
The final confirmation of particle size of the nHAP: 5 mol % Li.sup.+ powder was done utilizing HR-TEM microscopy (see FIG. 4). In accordance with TEM one can note that the particles are of regular, elongated rod-like shapes with mean particle size being of 80 nm length and 15 nm width. Analysis of SAED pattern revealed appearance of well developed rings with clear reflections at positions corresponding with reference standard of calcium hydroxyapatite.
Elements mapping and analysis was done using SEM-EDS microscopy (see FIG. 5) and ICP-OES technique (Table 2) in order to confirm the composition and homogenous distribution of the Ca, P and O. Lithium cations are to light to perform EDS analysis, therefore its content was confirmed directly by the ICP-OES analysis. All of the constituting elements were in a proper molar ratio confirming right stoichiometry of the final material. The ratio of the sum of Ca.sup.2+ and Li.sup.+ (since Li.sup.+ was incorporated at Ca(I) and Ca(II) sites) cations to the P.sup.5+ was 1.67 well matching with theoretical ratio of Ca/P in calcium hydroxyapatite.

(22) TABLE-US-00002 TABLE 2 Representative results of the ICP-MS analysis of the nHAP: 5 mol % Li.sup.+ nanoparticles. Li/ Sample Li Ca P Li Ca P (Ca + Li)/ (Ca + Li)* mass (g) (mg/ml) (mg/ml) (mg/ml) (mol) (mol) (mol) P 100% 0.0923 3.6 356.3 173.7 0.0518 0.8890 0.5607 1.678 5.512 3.67 356.9 175.6 0.0528 0.8905 0.5669 1.664 5.605 3.53 355.7 171.8 0.0508 0.8875 0.5546 1.692 5.420 Average 1.678 5.51
Li.sup.+ Time Release and its Concentration
Results of time dependent release study of the Li.sup.+ from solid sample containing nanoparticles of the nHAP: 5 mol % Li.sup.+ (see FIG. 6) can be divided into two main areas, the first one showing rather instantaneous release of the Li.sup.+ cations after immersion in PBS buffer solution at pH 7.4 and the second one covering long-time region until the equilibrium concentration of the Li.sup.+ is achieved in a given system. The curve was fitted using association exponential function showing that the quick release of Li.sup.+ lasts over one and a half hour until the system starts to slowly achieve its equilibrium and this second stage lasts for more than 17 hrs. The most important fact is that once the nHAP:Li.sup.+ sample is in contact with PBS solution the Li.sup.+ cations are starting to resorb quickly and free Li+ cations can be detected with concentration of 117 μg/ml. Further release is limited by the equilibrium state keeping the constant concentration of Li.sup.+ at 128 μg/ml in the solution in the steady system.

Example 5

(23) The experiments were conducted with the approval of the Second Local Bioethical Commission at the Department of Biology and Animal Breeding, at University of Environmental and Life Sciences in Wroclaw, Chelmonskiego 38C, Poland (dec. number 177/2010 from 11.15.2010).

(24) Isolation and characterization of human olfactory ensheathing glial cells (hOECs). Human olfactory bulbs and adipose tissues samples were collected post mortem from six healthy individuals (n=6), of average age 28±2 years, who died in traffic accidents. Olfactory bulb biopsies (˜8 mm.sup.2) were taken from the nasal septum in the superior region of the nasal cavity. The procedure of ensheathing glial cells isolation included: (i) washing of biopsies with Hank's balanced salt solution (HBSS); (ii) mincing with surgical scissors; (iii) incubation in collagenase solution (1 mg/mL, Sigma) for 10 min at 37° C. in CO.sub.2 incubator. The olfactory bulb samples were additionally mechanically homogenized using syringe needles (18 G, 20 G and 22 G), according to the previously described protocol [35]. Enzymatic activity of collagenase was inhibited by the addition of complete growth medium (CGM) containing fetal bovine serum (DMEM F12/Ham's with 10% of FBS and 1% of penicillin/streptomycin/amphotericin b; all purchased from Sigma Aldrich). The obtained homogenate was centrifuged at 300×g for 3 min, and cell pellet was re-suspended in fresh CGM and placed in T-25 flasks with a seeding concentration equal 5×10.sup.3 cells/cm.sup.2. The cultures of hOECs were maintained in 37° C. 5% CO.sub.2 humidified incubator for three days, then the medium was partially replaced (half of the medium volume was discarded and replaced with a fresh one), and cells were cultured for the next 2 days. When hOECs adopted their normal morphology on 5th day, they were harvested and placed in cultures with investigated biomaterials in 24-well plates at concentration of 1×10.sup.5 cells per well.

(25) Abdominal subcutaneous fat tissue samples (˜5 g biopsies) were placed into HBSS supplemented with 1% antibiotic-antimycotic solution (penicillin/streptomycin/amphotericin B solution, Sigma Aldrich) and washed extensively. Tissue fragments were cut into pieces using surgical scissors and then digested with 1 mg/mL collagenase type I for 40 minutes at 37° C. in CO.sub.2 incubator. Obtained suspension was centrifuged at 1200×g for 10 minutes. The supernatant was discarded, while pellet of cells was re-suspended in CGM and transferred to a culture flask. Before the experiment cells were passaged and transferred to 24-well plates coated with investigated biomaterials. Seeding density was 3×10.sup.5 cells per well.

(26) The Characterization of hOECs and hASCs Phenotype

(27) The identification of the cellular specific phenotype of hOECs and hASCs was performed after first passage, before the experiment of nanohydroxyapatite biocompatibility assessment. The phenotype of hOECs was characterized with immunofluorescence staining. For this purpose, cells were cultured on a 24-well plate, with seeding density of 2×10.sup.5 cells per well. Cells' phenotype was assessed when the cultures reached 70% confluence. For analysis cells were fixed using 4% paraformaldehyde for 45 minutes in room temperature, washed three times with HBSS and permeabilized for 15 minutes with HBSS containing 0.05% Triton X-100 and 5% of bovine serum. Following permeabilization, the cultures were washed again using HBSS. The incubation with primary anti-body was performed in HBSS overnight at 4° C.
The following rabbit polyclonal antibodies were used to detect specific hOECs: anti nerve growth factor receptor (NGFR-p75); anti-glial fibrillary acidic protein (GFAP) and anti-s100. All antibodies derived from Abcam, and were used at dilution 1:1000. After specific staining, cells were washed with HBSS and incubated for 1.5 h in room temperature with secondary antibody in HBSS—goat anti-rabbit IgG conjugated with Atto448 (1:800 dilution). After specific staining cultures were counterstained with DAPI (1:1000). Observations of stained cultures were performed using an inverted microscope (Zeiss, Axio Observer A.1) and documented using a Power Shot digital camera (Canon). Human ASCs were characterized by immunophenotyping using fluorochrome conjugated monoclonal antibodies specific for CD34, CD45, CD90, CD73b and CD105 (all antibodies purchased from BD Pharmingen). Isotype-matched antibodies were used as controls. The procedure was performed as it was described previously. Briefly, before staining cells were washed with HBSS containing 2% FBS, and re-suspended at total of 3×10.sup.5 cells/ml. Cells were incubated at 4° C. for 20 min with the specific antibodies preconjugated with allophycocyanin (APC), peridinin chlorophyll protein complex (PerCP), fluorescein isothiocyanate (FITC), or phycoerythrin (PE). At least ten thousand stained cells were acquired and analysed by Becton Dickinson FACS Calibur flow cytometer. The samples were analysed using FlowJo software (trial version). Additionally, multipotency of hASCs was evaluated by specific differentiation toward osteogenic, chondrogenic, and adipogenic precursors. For this purpose, cultures of hASCs were maintained in StemPro® differentiation media (Life Technologies), following manufacturer's instructions. In order to perform the test, the cells were seeded in a 24-well plate at the initial density of 3×10.sup.5 per well. Culture media (500 μl/per well) were changed every two days. Cultures propagated in the CGM were used as a control to establish the effectiveness of the differentiation process. Differentiation of hASCs towards osteoblasts lasted 21 days, while into adipocytes and chondrocytes 14 days. After experiment osteogenic cultures were stained with Alizarin Red, chondrogenic with Safranin 0 and adipogenic with Oil Red 0. All staining procedures were performed accordingly to the manufacturer's protocols described previously [36]. Preparations were analysed using inverted microscope (Zeiss, Axio Observer A.1) and documented using a Power Shot digital camera (Canon).

(28) The Proliferation Rate (PR), Morphology and Viability of hOECs and hASCs on nHAP Based Biomaterials

(29) Proliferative activity of hOECs and hASCs in cultures with the biomaterials was determined using resazurin based assay (TOX8, Sigma Aldrich). The test was performed at 24, 48 and 120 hour of hOECs and hASCs cultures. The dye was added to a CGM in amount equal to 10% of its volume. The cultures were incubated with the dye for 2 hours in a CO.sub.2 incubator, then supernatants were collected, placed in 96-well plate and measured with microplate spectroscopic reader (BMG Labtech). Proliferation rate (PR) in hOECs and hASCs cultures with nHAP, nHAP: Li.sup.+ and 5% addition of Li.sup.+ was presented as absorbance read at 600 nm and 690 nm, including blank sample i.e. CGM incubated without cells. In order to evaluate the influence of europium-doped nHAP: Li.sup.+ on hASCs metabolic activity the PR was presented as arbitrary unit—i.e. normative value evaluated with regards to cultures nHAP: Li.sup.+[37].

(30) The proliferative activity was also described with the population doubling time (PDT) parameter, determined using on-line calculator [38]. The calculated values were expressed in hours, reflecting time needed for hOBCs and hASCs to double their number since their inoculation on biomaterial. In case of hASCs cultures on europium-doped nHAP: Li.sup.+ the PDT was correlated with PDT of cells propagated on nHAP: Li.sup.+ and expressed as. The amount of cells was estimated based on the cells' growth curve designated during TOX8 test, performed at definite time intervals for cultures at propagated at density 1×10.sup.5; 2×10.sup.5; 3×10.sup.5; 6×10.sup.5; 9×10.sup.5 and 12×10.sup.5 cells per well.

(31) The morphology, growth pattern, as well as cellular attachment of the cultures propagated on investigated biomaterials was observed under epifluorescence microscope and using scanning electron microscope (SEM). The observations were performed on cultures fixed with 4% paraformaldehyde. For fluorescence imaging cell cultures were stained with atto-565-labeled phalloidin for cytoskeleton visualization and counterstained using diamidino-2-phenylindole (DAPI). Both dyes were diluted 1:1000 in HBSS, the details of the staining procedure were described previously. Observations were performed using fluorescence inverted microscope (Axio Observer A1, Zeiss), while documentation of stained cultures were performed using a PowerShotCamera (Canon). The SEM imaging microphotographs were performed according to well established methodology published previously [39]. Cultures were analyzed using SE1 detector at 10 kV filament tension (SEM, Zeiss Evo LS 15) and 5000× magnification.

(32) The cultures viability on biomaterials was investigated using a two-color fluorescence live/dead assay (Double Staining Kit, Sigma Aldrich). The staining procedure was performed in accordance to manufacturer's instructions.

(33) OECs Gene Expression Analysis

(34) Cells cultured on investigated materials were homogenized using TRI Reagent. Total RNA was isolated using the phenol-chloroform method. Quality and quantity of isolated total RNA were determined using nano-spectrometer (WPA Biowave II). Genomic DNA digestion and cDNA synthesis were performed using PrimeScript kit (Takara, Clontech). For each reaction, 500 ng of total RNA was used. Both processes were performed in accordance with the manufacturers' instructions using a T100 Thermal Cycler (Bio-Rad). The quantitative polymerase chain reaction (qPCR) reactions were performed using a CFX Connect™ Real-Time PCR Detection System (BioRad). Reaction mixture contained 2 μl of cDNA in a total volume of 20 μl using SensiFast SYBR & Fluorescein Kit (Bioline). The concentration of primers in each reaction equaled to 500 nM. Relative gene expression analysis (Qn) was calculated in relation to the GAPDH housekeeping gene (see Table 3).

(35) TABLE-US-00003 TABLE 3 The list of used primers in the quantitative polymerase chain reaction (qPCR). Amplicon  Ta lenght Gene Primer Sequence 5′-3′ Loci [° C.] [bp] Accesion no. Bax Forward ACCAAGAAGCTGAGCGAGTGTC  235-256 59.6 365 NM_001291428.1 Reverse ACAAAGATGGTCACGGTCTGCC  627-648 Bcl-2 Forward ATCGCCCTGTGGATGACTGAG 1010-1030 58.6 129 NM_000633.2 Reverse CAGCCAGGAGAAATCAAACAGAGG 1115-1138 p21 Forward AGAAGAGGCTGGTGGCTATTT   21-41 57.9 169 NM_001220777.1 Reverse CCCGCCATTAGCGCATCAC  171-189 p53 Forward AGATAGCGATGGTCTGGC  868-885 57.8 381 NM_001126118.1 Reverse TTGGGCAGTGCTCGCTTAGT 1229-1248 GAPDH Forward GTCAGTGGTGGACCTGACCT  894-913 59.1 256 NM_001289746.1 Reverse CACCACCCTGTTGCTGTAGC 1130-1149

(36) Confocal Microscopy

(37) Preparations were observed using the Live Imager (Zeiss) confocal microscope with spinning disk (Yokogawa CSU-X1A 500) using the 405 nm laser (Colibri). Samples were observed using 20× (NA=0.4 LD) objective, images were captured with EMCCD (QImaging Rolera EM-C2) camera. Collected z-stacks were merged using orthogonal projection mode.

(38) Statistical Analysis

(39) All experiments were triplicated. The analysis of data obtained in biological assays were analyzed with STATISTICA 10.0 software (StatSoft, Inc., Statistica for Windows, Tulsa, Okla., USA). The normality of the population data was determined using Shapiro-Wilk test, while equality of variances was assessed by Levene's test. Differences between groups were determined using one- or two-way analysis of variance (ANOVA).

(40) Results and Discussion

(41) Characterization of Cells Used in the Experiment

(42) The specific phenotype of human OECs and ASCs used in this experiment was confirmed in the course of cellular immunophenotyping tests. We showed that population of hOECs express following markers: NGF-p75, GFAP and s-100 (FIG. 7A). Obtained results are in stands in good agreement with the previous observations regarding heterogeneity of OECs population, both antigenically and morphologically, showing that olfactory glia may be a source of progenitors both for astrocyte-like cells and Schwann cell-like cells. The denser immunoreactivity of investigated markers was noted perinuclear localization. The obtained hOECs morphologically shared features both of Schwanna and astrocyte-like cells (FIG. 6A). The population of isolated hASCs was defined by the criteria established by International Society of Cellular Therapy [40]. In cultures the cells were distinguished by the fibroblast-like morphology and exhibited ability for the adhesion. Specific markers of mesenchymal cells were detected (CD44, CD73, CD90, CD105), while the expression of markers of hematopoietic origin was not observed. Additionally, obtained hASCs differentiated into adipocytes, osteoblast and chondrocytes, respectively. The results of multipotency assay, along with characteristics of hASCs immunophenotype are presented in the FIG. 7B.
The Positive Influence of nHAP_Li.sup.+ on Proliferative Activity of Progenitor Cells and their Viability Suppressing Apoptosis Via Down-Regulation of BAX/BCL-2 and Stabilization of p53/p21 Ratio.
Olfactory ensheathing glial cells belong to the cell population, that have limited proliferative potential and viability that strongly limited their clinical application, in turn the adipose-derived multipotent stromal cells exhibit great proliferative potential and prolonged lifespan in long-term cultures [41].
The phenotypic plasticity of OECs and ASCs, contributes to the fact that their growth and secretory activity strongly depend on the type of microenvironment, regulating their cytophysiology and influencing survival both, in vitro and in vivo. Thus, application of particular biomaterial designed as a carrier for progenitor cells, and dedicated to the nerve tissue regeneration requires possessing specific features. First of all, from neurosurgical point of view—relatively simple physical form of carrier, that would improve transplantation procedure, and second of all highly bio-reactive platform, that would enhance proliferation rate of cells, thus influencing on functionality of progenitor cell-based therapy. Here, we have found that proposed nHAP:Li.sup.+ fulfilled these criteria.
In order to determine the specific effect of nHAP:Li.sup.+ on cytophysiology of hOECs and hASCs, we evaluated individual effect of nHAP and Li.sup.+ ions addition onto the cultures. The results of the analysis was shown in the FIG. 8. We observed that proliferation activity of hOECs propagated on nHAP:Li.sup.+ was improved when compared to the cultures on nHAP without the Li.sup.+ incorporation. The increase of the hOECs proliferative activity in cultures on nHAP:Li.sup.+ maintained throughout the test, similarly to the hOECs activity in cultures with Li.sup.+ ions. In turn the acceleration of hASCs proliferation in cultures on nHAP:Li.sup.+ was observed only during the first 24 hours of the test, in the adaptive phase of cells growth. However, both in case of hOECs and hASCs the time required for population doubling of cultures on nHAP:Li.sup.+ had shortened in relation to the cultures on nHAP. Additionally, the results obtained for cultures on nHAP: Li.sup.+ closely corresponded with the PDT determined in cultures with lithium alone. This strongly indicates on pro-proliferative influence of lithium on cells activity, and corresponds with previous studies showing that neural progenitor cells [42,43] and multipotent stromal cells [12] treated with Li.sup.+ exert higher proliferative capacity.
Furthermore, the high proliferative state of hOECs and hASCs cultures on nHAP: Li.sup.+, corresponded with their high viability. The percentage of dead cells in nHAP:Li.sup.+ cultures was significantly lower than in cultures on nHAP (see FIG. 8). Cytoprotective effect of lithium was associated with its anti-apoptotic properties. The lithium was shown to increase the expression of anti-apoptotic molecule—B-cell lymphoma protein-2 (Bcl-2) and suppress the expression of pro-apoptotic genes: Bax and p53. This mechanism of lithium action was defined as a prominent in neuroprotection against excitotoxicity [44].

(43) Bearing in mind, mentioned above reports we decided to investigate the influence of lithium doped in nHAP on mRNA level of Bax, Bcl-2, p53 and p21 genes. Our results showed that the Bax/Bcl-2 ratio in hOECs is comparable in all investigated culture. The Bax/Bcl-2 index indicates on increased transcript levels of Bax, however the difference between Bax and Bcl-2 level are not statistically significant. The mRNA level for p53 was statistically increased in hOECs cultures with lithium, when compared with cultures on nHAP and nHAP:Li.sup.+. Moreover the lowest p53/p21 ratio indicating on constitutive level of these transcript was noted just in hOECs propagated on nHAP:Li.sup.+. The results considering the expression profile of apoptotic pathway genes obtained for hOECs are consistent with those determined on hASCs. The significant decrease of Bax expression was noted in nHAP:Li.sup.+ and the p53/p21 ratio was established suggesting that nHAP:Li.sup.+ did not alter its transcript level (see FIG. 9).

(44) Obtained results indicate that in terms of anti-apoptotic properties lithium, released form nHAP as well as added to the culture environment, has convergent effect on progenitor cells, both derived from olfactory bulb and from adipose tissue (FIG. 9).

(45) Next, to the influence on nHAP: Li.sup.+ on cells proliferation an viability, we determined the role of biomaterial topography on the cells morphology and spreading (FIG. 10). The observations made with epifluorescent microscope and SEM brought the undisputable evidence, on lithium role in maintaining proper morphology of investigated progenitor cells. Both hOECs and hASCs expressed better adhesion and spreading with their characteristic morphologies on nHAP:Li.sup.+ biomaterials than nHAP. Obtained results corresponds with the results of proliferation test, and suggest that Li released form nHAP and introduced directly to the culture has beneficial effect on hOECs and hASCs, although growth pattern of cultures on nHAP:Li.sup.+ differed when compared to cultures with Li.sup.+ ions. The hOECs propagated on nHAP:Li.sup.+ had proper morphology of neural nature, and covered the surface area more loosely than cultures with Li.sup.+ ions, and did not developed tight intracellular junctions. In turn, the hASCs in cultures with nHAP:Li.sup.+ formed cellular aggregates, thus it seems that nHAP:Li.sup.+ promoted not only cell-biomaterial interactions, but also initiated cell-cell contact in hASCs cultures. Indeed, lithium was proposed as a factor for inducing neural differentiation of MSCs [12]. Cell aggregation is associated with progression of progenitor cells in differentiation. It was shown that aggregate cultures of progenitor cells recapitulates crucial physical aspects of the cellular development, including cell-cell interactions that mediate also proliferation and apoptosis [45,46].
In general, our results seems to confirm the trend presented in literature about pro-proliferative and anti-apoptotic effects of lithium on progenitor cells, the novel aspect of this study is however the delivery method of Li.sup.+ ions, based on application of nHAP scaffolds. Presented concept was also investigated by the Wang et al., however in the context of possible use of Li-doped hydroxyapatite scaffolds for bone regeneration. Therefore, it seems that increased bioactivity of nHAP:Li.sup.+ may find various application in regenerative medicine.
nHAP: Li as a Potential Theranostic Agent/Vesicle—the Biocompatibility Analysis Using hASCs
The high biocompatibility of nHAP:Li.sup.+, showed using hOECs as well as hASCs in vitro model, prompt us to use this scaffold as a platform for highly luminescent of europium (III) ions. Bearing in mind convergent cellular response on nHAP:Li.sup.+, the evaluation of biological properties of nHAP:Li.sup.+ co-doped with Eu.sup.3+ ions was performed on cells exhibiting greater proliferation potential and cellular plasticity i.e. hASCs.
The analysis of proliferation activity of hASCs (see FIG. 11) showed that Eu.sup.3+ ions addition increased proliferation rate significantly regardless to its concentration (1 mol % or 2 mol %) during the first third days of test, but after 5 days of culture, the increased cellular activity was maintained in cultures with 2 mol % of Eu.sup.3+ ions. Nevertheless, the incorporation of Eu.sup.3+ ions had no significant effect on population doubling time, when compared with hASCs cultures on nHAP:Li.sup.+. Further, the addition of Eu.sup.3+ ions had also no significant influence on loss of cellular viability. The hASCs propagated on nHAP:Li.sup.+ co-doped with Eu.sup.3+ ions exhibited even more enhanced tendency for aggregation, therefore the slight increase in percentage of dead-cells may results from increased PI reaction within aggregates. Our results suggest, that the nHAP:Li.sup.+ co-doped with Eu.sup.3+ ions has gain increased anti-apoptotic properties. The Bax/Bcl-2 ratio significantly decreased in cultures on nHAP:Li.sup.+ co-doped with 2 mol % Eu.sup.3+ ions. Additionally, the results of p53/p21 ratio determination indicates on stability in those transcript levels. The analysis of cellular internalization showed perinuclear and cytoplasmic localization.
Obtained results indicate on great possibility of nHAP:Li.sup.+ application for theranostic usage in regenerative medicine, especially taking into account its potential to increase survival of progenitor cells [47] that can differentiate into neural lineage. Our concept fits in with the current trends used for spinal cord injuries treatment i.e. developing and seeking for effective cell-based delivery strategies, biomolecule delivery strategies as well as scaffold-based therapeutic strategies [48].

REFERENCES

(46) [1] Bracken, M. B., Shepard, M. J.; Collins, W. F., Jr.; Holford, T. R.; Baskin, D. S.; Eisenberg, H. M.; Flamm, E.; Leo-Summers, L.; Maroon, J. C.; Marshall, L. F. Methylprednisolone or naloxone treatment after acute spinal cord injury: 1-year follow-up data. Results of the second National Acute Spinal Cord Injury Study. J. Neurosurg. 76 (1992) 23-31. [2] Bracken, M. B., Shepard, M. J., Holford, T. R., LeoSummers, L., Aldrich, E. F., Fazl, M., Fehlings, M. G., Herr, D. L., Hitchon, P. W., Marshall, L. F., Nockels, R. P., Pascale, V., Perot, Jr., P. L., Piepmeier, J., Sonntag, V. K., Wagner, F., Wilberger, J. E., Winn, H. R., Young, W. Methylprednisolone or tirilazad mesylate administration after acute spinal cord injury: 1-year follow up. Results of the third National Acute Spinal Cord Injury randomized controlled trial. J. Neurosurg. 89 (1998) 699-706. [3] Chou, R. H., Lu, C. Y., Wei-Lee, Fan, J. R., Yu, Y. L., Shyu, W. C. The potential therapeutic applications of olfactory ensheathing cells in regenerative medicine. Cell Transplant. 23 (2014) 567-571. [4] Grosu-Bularda A., Manea C., Lascar I. The role of olfactory ensheating cells in regenerative medicine: review of the literature. Rom. J. Rhinol. 5 (2015) 75-80. [5] Dasari, V. R., Veeravalli, K. K. and Dinh D. H., Mesenchymal stem cells in the treatment of spinal cord injuries: A review, World J. Stem Cells 6 (2014) 120-133. [6] Tabakow, P., Jarmundowicz, W., Czapiga, B., Fortuna, W., Miedzybrodzki, R., Czyz, M., Huber, J., Szarek, D., Okurowski, S., Szewczyk, P., Gorski, A., Raisman, G. Transplantation of Autologous Olfactory Ensheathing Cells in Complete Human Spinal Cord Injury. Cell Transplantation. 22 (2013) 1591-1612. [7] Lu, J., Féron, F., Mackay-Sim, A., Waite, P. M. E. Olfactory ensheathing cells promote locomotor recovery after delayed transplantation into transected spinal cord. Brain. 125 (2002) 14-21. [8] Li, J., Lepski, G. Cell transplantation for spinal cord injury: a systematic review. Biomed. Res. Int. 2013 (2013) 786475. [9] Imaizumi, T., Lankford, K. L., Waxman, S. G., Greer C. A., Kocsis J. D. Transplanted olfactory ensheathing cells remyelinate and enhance axonal conduction in the demyelinated dorsal columns of the rat spinal cord. J. Neuroscience. 18 (1998) 6176-6185. [10] Moore T. J. and Abrahamse H., Neuronal Differentiation of Adipose Derived Stem Cells: Progress So Far, Int. J. Pharm. 2014 (2014) ID 827540. [11] Bae K. S., Park J. B., Kim H. S., Kim D. S., Park D. J., Kang S. J., Neuron-like differentiation of bone marrow-derived mesenchymal stem cells, Yonsei. Med. J. 52 (2011) 401-142. [12] Ivanov, S. Y., Mukhametshin, R. F., Muraev, A. A., Solodkaya, D. V. Synthetic materials used for the substitution of bone defects. Annals of Oral & Maxillofacial Surgery. 1 (2013) 1-4. [13] Ferraz, M. P., Monteiro, F. J., Manuel, C. M. Hydroxyapatite nanoparticles: A review of preparation methodologies. J. Appl. Biomater. Biomech. 2, (2004) 74-80. [14] Liu, H., Webster, T. J. Nanomedicine for implants: a review of studies and necessary experimental tools. Biomater. 28 (2007) 354-369. [15] Chandra A., Singh K., Singh S., Sivakumarb S. and Patra A. K., A luminescent europium(III)-platinum(II) heterometallic complex as a theranostic agent: a proof-of-concept study, Dalton Trans., 45 (2016) 494-497. [16] Venkatesan J., Lowe B., Anil S., Kim S. K., Shim M. S., Combination of NanoHydroxyapatite with Stem Cells for Bone Tissue Engineering, J. Nanosci. Nanotechnol., 16 (2016) 8881-8894. [17] Dong, B.-T., Tu, G.-J., Han, Y.-X., Che, Y. Lithium enhanced cell proliferation and differentiation of mesenchymal stem cells to neural cells in rat spinal cord. Int. J. Clin. Exp. Pathol. 8 (2015) 2473-2483. [18] Hashimoto, R., Senatorov, V., Kanai, H., Leeds, P., Chuang, D. M. Lithium stimulates progenitor proliferation in cultured brain neurons. Neuroscience. 117 (2003) 55-61. [19] Wang, W., Shi, D, Lian, J., Guo, Y., Liu, G., Wang, L., Ewing, R. C. Luminescent hydroxylapatite nanoparticles by surface functionalization. Appl. Phys. Lett. 89 (2006) 183106. [20] Yang, P., Quan, Z., Li, C. Kang, X., Lian, H., Lin, J. Bioactive, luminescent and mesoporous europium-doped hydroxyapatite as a drug carrier. Biomater. 29 (2008) 4341-4347. [21] Queiroz, A. C., Santos, J. D., Monteiro, F. J., Gibson, I. R., Knowles, J. C. Adsorption and release studies of sodium ampicillin from hydroxyapatite and glass-reinforced hydroxyapatite composites. Biomater. 22 (2001) 1393-1400. [22] K. Ravindranadh, B. Babu, V. Pushpa Manjari, G. Thirumala Rao, M. C. Rao, R. V. S. S. N. Ravikumar, J. Lumin., 159 (2015) 119 [23] Martin P., Carlot G., Chevarier A., Den-Auwer C., Panczer G., Mechanisms involved in thermal diffusion of rare earth elements in apatite, J. Nuclear. Mater. 275 (1999) 268-276. [24] Su H., Chu T. H., Wu W., Lithium enhances proliferation and neuronal differentiation of neural progenitor cells in vitro and after transplantation into the adult rat spinal cord, Exp. Neurol. 206 (2007) 296-307. [25] Sandhöfer B., Meckel M., Delgado-López J. M., Patricio T., Tampieri A., Rösch F. and Iafisco M., Synthesis and preliminary in vivo evaluation of well-dispersed biomimetic nanocrystalline apatites labeled with positron emission tomographic imaging agents, ACS Appl. Mater. Interfaces, 7 (2015) 10623-10633. [26] Rietveld, H. M., A profile refinement method for nuclear and magnetic structures. J. Appl. Cryst. 2 (1969) 65-71. [27] Wiglusz, R. J., Bednarkiewicz, A., Lukowiak, A. Synthesis and optical properties of Eu3+ ion doped nanocrystalline hydroxyapatites. Spectr. Lett. 43 (2010) 333-342. [28] Rietveld, H. M., A profile refinement method for nuclear and magnetic structures. J. Appl. Cryst. 2 (1969) 65-71. [29] Destainville, A., Champion, E., Bernasche-Assollant, D., Laborde, E. Synthesis, characterization and thermal behavior of apatitic tricalcium phosphate. Mater. Chem. Phys. 80 (2003) 269-277. [30] Abdulrahman, I., Tijani, H. I., Mohammed, B. A., Saidu, H., Yusuf, H., Jibrin, M. N., Mojammed, S. From Garbage to Biomaterials: An Overview on Egg Shell Based Hydroxyapatite. J. Mater. 2014 (2014) 802467 [31] Gibson I. R., Bonfield W. Novel synthesis and characterization of an AB-type carbonate-substituted hydroxyapatite. J. Biome. Res. 59 (2002) 697-708. [32] Kokubo, T., Kim, H. M., Kawashita, M., Novel bioactive materials with different mechanical properties. Biomater. 24 (2003) 2161-2175. [33] Kovaleva, E. S., Shabanov, M. P., Putlyaev, V. I., Tretyakov, Y. D., Ivanov, V. K., Silkin, N. I. Bioresorbable carbonated hydroxyapatite Ca10-xNax(PO4)6-x(CO3)x(OH)2 powders for bioactive materials preparation. Cent. Eur. J. Chem. 7, (2009) 168-174. [34] Filippov, Y. Y., Klimashina, E. S., Ankudinov, A. B., Putlayev, V. I., Carbonate substituted hydroxyapatite (CHA) powder consolidated at 450° C., J. Phys Conf. Series. 291 (2011) 012036. [35] Grzesiak, J., Fryczkowski, R., Lis, A., Szarek, D., Laska, J., Marycz, K. Characterization of Olfactory Ensheathing Glial Cells Cultured on Polyurethane/Polylactide Electrospun Nonwovens. Int. J. Polym. Sci. 2015 (2015) 908328. [36] Marycz K., Kornicka K., Basinska K. and Czyrek A., Equine metabolic syndrome affects viability, senescence, and stress factors of equine adipose-derived mesenchymal stromal stem cells: New insight into EqASCs isolated from EMS horses in the context of their aging, Oxid. Med. Cell. Longev. 2016 (2016) ID 4710326. [37] Glant, T. T., Jacobs, J. J., Molnar, G., Shanbhag, A. S., Valyon, M., Galante, J. O., Bone resorption activity of particulate-stimulated macrophages. J. Bone Min. Res. 8 (1993) 1071-1079. [38] http://www.doubling-time.com/compute.php. [39] Grzesiak, J., Marycz, K., Szarek, D., Bednarz, P., Laska, J. Polyurethane/polylactide-based biomaterials combined with rat olfactory bulb-derived glial cells and adipose-derived mesenchymal stromal cells for neural regenerative medicine applications. Mater. Sci. Eng. C52 (2015) 163-170. [40] Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315-317 [41] Mayeur, A., Duclos, C., Honoré, A., Gauberti, M., Drouot, L., do Rego J.-C., Bon Mardion, N., Jean, L., Vérin, E., Emery, E., Lemarchant, S., Vivien, D., Boyer, O., Marie, J.-P., Guérout, N., Potential of olfactory ensheathing cells from different sources for spinal cord repair. PLoS One. 8 (2013) e62860. [42] Zanni G., Di Martino E., Omelyanenko A., Andang M., Delle U., Elmroth K. and Blomgren K., Lithium increases proliferation of hippocampal neural stem/progenitor cells and rescues irradiation-induced cell cycle arrest in vitro, Oncotarget. 6 (2015) 37083-37097. [43] Yoneyama M., Shiba T., Hasebe S., Umeda K., Yamaguchi T. and Ogita K., Lithium promotes neuronal repair and ameliorates depression-like behavior following trimethyltin-induced neuronal loss in the dentate gyrus, PLoS One. 9 (2014) e87953. [44] Chen R. W., Chuang D. M., Long term lithium treatment suppresses p53 and Bax expression but increases Bcl-2 expression. A prominent role in neuroprotection against excitotoxicity, J Biol Chem. 274 (1999) 6039-6042. [45] Ghasemi-Mobarakeh L., Prabhakaran M. P., Tian L., Shamirzaei-Jeshvaghani E., Dehghani L. and Ramakrishna S., Structural properties of scaffolds: Crucial parameters towards stem cells differentiation, World J. Stem Cells. 7 (2015) 728-744. [46] Tchao J., Han L., Lin B., Yang L. and Tobita K., Combined biophysical and soluble factor modulation induces cardiomyocyte differentiation from human muscle derived stem cells, Sci. Rep. 4 (2014) 6614-6625. [47 Kempen P. J., Greasley S., Parker K. A., Campbell J. L., Chang H.-Y., Jones, 4 Robert Sinclair J. R., Gambhir S. S. and Jokerst J. V., Theranostic mesoporous silica nanoparticles biodegrade after pro-survival drug delivery and ultrasound/magnetic resonance imaging of stem cell, Theranostics. 5 (2015) 631-642. [48] Tsintou M., Dalamagkas K. and Seifalian A. M., Advances in regenerative therapies for spinal cord injury: a biomaterials approach, Neural Regen Res. 10 (2015) 726-742.