Recombinant virus products and methods for inducing DUX4 exon skipping

11180755 · 2021-11-23

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to methods for shifting the splicing profile of the DUX4 gene, a double homeobox gene on human chromosome 4q35. Recombinant adeno-associated viruses of the invention deliver DNAs encoding U7-based small nuclear RNAs to induce DUX4 exon-skipping and the expression of shortened forms of DUX4. The methods have application in the treatment of muscular dystrophies such as facioscapulohumeral muscular dystrophy.

Claims

1. A recombinant adeno-associated virus comprising one or more DUX4 U7-based snRNA constructs each construct comprising (a) the nucleotide sequence set out in SEQ ID NO: 1; (b) the nucleotide sequence set out in SEQ ID NO: 2; or (c) the nucleotide sequence set out in SEQ ID NO: 1 and SEQ ID NO: 2.

2. A composition comprising the recombinant adeno-associated virus of claim 1.

3. A polynucleotide comprising the hU7-EX1-AS1 DNA set out in SEQ ID NO: 1.

4. A polynucleotide comprising the hU7-EX1-SD DNA set out in SEQ ID NO: 2.

5. The recombinant adeno-associated virus of claim 1, wherein the virus lacks rep and cap genes.

6. The recombinant adeno-associated virus of claim 1, wherein the RNA encoded by the DUX4 U7-based snRNA construct is capable of inducing the expression of a non-toxic DUX4 short isoform in a cell.

7. The recombinant adeno-associated virus of claim 1, wherein the adeno-associated virus is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or AAVrh74.

Description

BRIEF DESCRIPTION OF THE DRAWING

(1) FIG. 1 shows the human DUX4 DNA sequence (SEQ ID NO: 5) in which nucleotides 1-300 are the 5′ UTR; nucleotides 301-1575 are DUX4 open reading frame (protein coding); nucleotides 1-1582 are Exon 1; nucleotides 1540-1571 are the 779 sequence binding site; nucleotides 1573-1607 are 778 sequence binding site; nucleotides1583-1718 are Intron 1; nucleotides 1719-1811 are Exon 2; nucleotides 1812-2174 are Intron 2; and nucleotides 2175-2347 are Exon 3 sequences ending at poly A site.

(2) FIGS. 2A-2C show the DUX4 gene structure and U7 snRNA antisense binding locations. FIG. 2A) DUX4 locus in chromosome 4. FIG. 2B) DUX4 transcripts arise from 3 exons (rectangles). DUX4 coding region is shown, where black boxes in exon 1 represent 2 DNA binding domains. Introns are represented by downward pointing lines, polyA signals are identified. FIG. 2C) Structures of the U7 snRNAs and the relative location of each binding sequence in the DUX4-FL transcript shown in B).

(3) FIGS. 3A-3B show the results of DUX4 cell death and expression assays. FIG. 2A) Full-length DUX4 (DUX4-FL) but not short forms of DUX4 (DUX4-s) caused apoptotic death of HEK293 cells in an Apo-ONE caspase-3/7 assay which measures caspase activity (fluorescent output). FIG. 2B) In an experiment treating HEK293 cells with U7-based snRNA constructs described herein, sequences 778 (hU7-EX1-SD) and 779 (hU7-EX1-AS1) reduced full-length DUX4 protein expression (western blot) and sequence 779 (hU7-EX1-AS1) significantly protected HEK293s from death using a caspase-3/7 assay readout to measure apoptosis.

EXAMPLES

(4) The role of DUX4 in FSHD pathogenesis can be explained as follows. First, D4Z4 repeats are not pseudogenes. The DUX4 locus produces 1.7 kb and 2.0 kb full-length mRNAs with identical coding regions, and D4Z4 repeats also harbor smaller sense and antisense transcripts, including some resembling microRNAs. Over-expressed DUX4 transcripts and a ˜50 kDa full-length DUX4 protein are found in biopsies and cell lines from FSHD patients. These data are consistent with a transcriptional de-repression model of FSHD pathogenesis. In addition, unlike pseudogenes, D4Z4 repeats and DUX4 likely have functional importance, since tandemly-arrayed D4Z4 repeats are conserved in at least eleven different placental mammalian species (non-placental animals lack D4Z4 repeats), with the greatest sequence conservation occurring within the DUX4 ORF. Second, over-expressed DUX4 is toxic to tissue culture cells and embryonic progenitors of developing lower organisms in vivo. This toxicity occurs at least partly through a pro-apoptotic mechanism, indicated by Caspase-3 activation in DUX4 transfected cells, and presence of TUNEL-positive nuclei in developmentally arrested Xenopus embryos injected with DUX4 mRNA at the two-cell stage. These findings are consistent with studies showing some pro-apoptotic proteins, including Caspase-3, are present in FSHD patient muscles. In addition to stimulating apoptosis, DUX4 may negatively regulate myogenesis. Human DUX4 inhibits differentiation of mouse C2C12 myoblasts in vitro, potentially by interfering with PAX3 and/or PAX7, and causes developmental arrest and reduced staining of some muscle markers when delivered to progenitor cells of zebrafish or Xenopus embryos. Finally, aberrant DUX4 function is directly associated with potentially important molecular changes seen in FSHD patient muscles. Specifically, full-length human DUX4 encodes an approximately 50 kDa double homeodomain transcription factor, and its only known target, Pitx1, was elevated in DUX4 over-expressing FSHD patient muscles. These data support that DUX4 catalyzes numerous downstream molecular changes that are incompatible with maintaining normal muscle integrity.

(5) Transcriptional de-repression of FSHD is associated with increased expression of the toxic DUX4 transcription factor (the full length, long form), arising from the chromosome 4q subtelomere. This region is normally embedded in heterochromatin and therefore suppressed.

(6) The treatment methods contemplated herein shift the DUX4 splicing profile to favor non-toxic DUX4 (short) forms. This is accomplished by using an antisense exon-skipping strategy designed to block production of toxic, full-length DUX4.

(7) Exemplary aspects and embodiments of the invention are illustrated by the following examples.

Example 1

U7-Based snRNA Constructs for DUX4 Exon Skipping

(8) As noted above, FSHD is associated with increased expression of the toxic DUX4 transcription factor from the chromosome 4q subtelomere. This region is normally embedded in heterochromatin and therefore suppressed; in FSHD, deletion of chromatin seeding repetitive elements called D4Z4 repeats (FSHD1; 95% of cases) or mutation in a chromatin modifier gene SMCHD1 (FSHD2; 5%) cause epigenetic changes that de-repress the 4q region and trigger expression of the DUX4 transcription factor (FIGS. 2A and B). Using DUX4 over-expression models, we found that full-length DUX4 (DUX4-FL) causes cell death in vitro and muscle damage in vivo, while a truncated, natural isoform of DUX4 (DUX4s) is non-toxic.

(9) We then designed U7-based snRNAs to prevent splicing of full-length DUX4, or inhibit its polyadenylation (FIG. 2C). U7 snRNA is normally involved in histone pre-mRNA 3′ end processing, but mutating the Sm/Lsm protein binding site allows U7 snRNA to become a versatile splicing modulation tool [Young et al., PLoS Genet 9(11):e1003947]. We generated U7-based snRNAs designed to block splicing of the DUX4-FL isoform (by masking splice enhancers, splice donors, or splice acceptors), or prevent polyadenylation and de-stabilize the transcript. The DUX4 gene is composed of three exons; the first encodes a full-length DUX4 ORF and the other two are untranslated exons. Exon 3 contains a non-canonical polyA signal that is utilized only in FSHD-permissive muscles. The full length DUX4 ORF encodes a protein containing two DNA binding domains and a C-terminal transactivation domain. This full length protein is toxic to muscles and other tissues/cells. A second isoform has been reported [Snider et al., Plos Genetics, 6(10):e1001181 (2010], called DUX4-s (DUX4-short) which arises from the same exon 1 ORF, but this shorter version utilizes an internal splice site which splices out the C-terminal transactivation domain. This shorter version is non-toxic.

(10) We designed U7-based snRNAs to shift the DUX4 splicing profile to favor the benign short form (DUX4s) over the toxic full-length (FL) form. Two U7-based snRNAs were targeted to the splice donor and splice enhancers at the exon 1/intron 1 junction (sequences 778 and 779 below), which will induce DUX4-s production. Sequence 780 was designed to mask the poly-A signal located in exon 3, which would destabilize the DUX4 transcript. We also designed a U7-based snRNA 781 to serve as a negative control. It targets the noncoding exon 3 splice acceptor site and is therefore not expected to affect DUX-FL splicing and toxicity. See FIG. 2. To produce the U7-based snRNAs, we cloned antisense sequences into the human U7 snRNA system used for dystrophin exon skipping [Goyenvalle et al, Science, 306(5702):1796-1799 (2004)].

(11) DNAs encoding the U7-based snRNA constructs are set out below. In the sequences, the U7 promoter sequence is double-underlined, the antisense sequences targeting DUX4 are bolded, the SmOPT sequence (binding site for Hnrnpa1) is underlined, the hairpin loop sequence from human U7 snRNA is dotted, and the remaining sequence is the loop structure of U7 transcript.

(12) Sequence 779: hU7-EX1-AS1 (SEQ ID NO: 1) (bolded antisense sequence binds to nucleotides 1540-1571 of DUX4 SEQ ID NO: 5)

(13) TABLE-US-00001 embedded image embedded image embedded image embedded image embedded image embedded image embedded image TGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCT TGGGGACTAGTTT3′

(14) Sequence 778: hU7-EX1-SD (SEQ ID NO: 2) (bolded antisense sequence binds to nucleotides 1573-1607 of DUX4 SEQ ID NO: 5)

(15) TABLE-US-00002 embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image CTGTGCAAAAATTATGGGTAGTTTGGTGGTCTTGATGCAGTTGTAAG CTTGGGGACTAGTTT3′

(16) Sequence 781: hU7EX3-AS1 (SEQ ID NO: 3) [WHY IS THE U7 PROMOTER SEQUENCE DIFFERENT IN THIS ONE?] (bolded antisense sequence binds to DUX4 SEQ ID NO: 5, atop the DUX4 intron 2/exon 3 splice junction)

(17) TABLE-US-00003 embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image TGTTTTCACTGTGCAAAAATTATGGTCTTGATGCAGTTGTAAGCTTG GGGACTAGTTT3′

(18) Sequence 780; hU7-pA-AS (SEQ ID NO: 4) (bolded antisense sequence binds to DUX4 SEQ ID NO: 5 atop the DUX4 polyA signal)

(19) TABLE-US-00004 embedded image embedded image embedded image embedded image embedded image embedded image embedded image CAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTG GGGACTAGTTT3′

(20) The constructs were each cloned into a pUC57 plasmid vector backbone.

Example 2

Treatment of Cells with U7-Based snRNA Constructs

(21) The pUC57 plasmid vectors expressing DUX4 and the therapeutic U7-based snRNA constructs were then delivered to HEK293 cells using Lipfectamine-2000, either individually or in combinations, and several outcome measures were examined, including assessment of apoptotic cell death, measurement of DUX4 full-length and DUX4-short gene expression, as well as DUX4-activated biomarkers.

(22) Treatment of DUX4-expressing HEK293 cells with hU7-EX1-AS1 or hU7-EX1-SD reduced full-length DUX4 protein expression as measured by Lowry assay, while hU7-EX1-AS1 significantly protected HEK293 cells from apoptotic cell death, as measured by caspase-3/7 assay (FIG. 2B).

Example 3

Production of rAAV Comprising U7-Based snRNA Constructs

(23) rAAV vector was produced by co-transfection in HEK293 cells of three plasmids [pAdhelper, AAV helper, and a rAAV genome containing DUX4 U7-based snRNA construct(s)], followed by cell-harvesting, vector purification, titration, and quality control assays.

(24) Plasmids: pAdhelper contains the adenovirus genes E2A, E4 ORF6, and VA I/II; AAV helper plasmids contain AAV rep2 and cap6 (for example, for an AAV serotype 6 preparation, the capsid gene would be called cap6); the rAAV plasmid contains AAV inverted terminal repeat (ITRs) sequences flanking the U7-based snRNA constructs to be packaged into the vector.

(25) Transfection: Plasmids were transfected into 293 cells (Corning 10-Stack) using CaPO.sub.4 at a 4:4:1 ratio (20 ug pAd helper: 20 ug AAV helper: 5 ug rAAV vector plasmid per plate.

(26) Cell harvesting: Forty-eight hr post-transfection, cells were harvested and resuspended in 20 mM Tris (pH 8.0), 1 mM MgCl.sub.2 and 150 mM NaCl (T20M1N150) at a density of 5×10.sup.6 cells/ml. Cells were lysed by four sequential freeze/thaw cycles and Benzonase nuclease (AIC, Stock: 250 U/ul) added to a final concentration of 90 U/ml before cell lysate clarification.

(27) Vector Purification and Titration: Clarified lysates were subjected to iodixanol step gradient purification as previously described (Xiao, X, et al. J. Virol 72:2224-32). The 40% iodixanol layer (containing rAAV) was diluted 5-fold with a no-salt dilution buffer (pH varying depending on serotype) and applied to a Hi-Trap HP-Q/S column. Upon elution with a NaCl salt gradient, peak 1 ml fractions (typically 3-5) were pooled, dialyzed with T20M1N200 (pH 8.0), then sterile filtered and supplemented with 0.001% Pluronic F68. Vector was stored at −80° C. Purified virus was titered for vg using Q-PCR as previously described [Schnepp and Clark, Methods Mol. Med., 69:427-443 (2002)].

Example 4

(28) The effects of the U7-based snRNAs described herein are demonstrated in an FSHD animal model in which the DUX4 gene (coding region+two downstream untranslated exons) is expressed in muscle using adeno-associated viral (AAV) vectors. The FSHD model recapitulates toxic muscle phenotypes that are useful as therapy outcome measures, including

(29) Histopathology—rapid development of muscle lesions; presence of central nuclei within 2 weeks, highly variable myofiber sizes

(30) Molecular/Biochemical—DUX4 expression; Caspase-3 expression1,4; downstream biomarker expression (e.g., ZSCAN4)

(31) Functional—muscle strength deficits (e.g., grip strength, specific force)

(32) rAAV comprising one or more U7-based snRNA constructs described herein are co-delivered to animals at 1:1 and 10:1 doses with AAV vectors expressing full-length DUX4 containing all three exons, using our previously published methods [Wallace et al., Ann. Neurol., 69: 540-442 (2011) and Mitsuhashi et al., Hum. Mol. Genet., 22: 568-577 (2012)]. At 1, 2, and 4 weeks following intramuscular injection, outcomes (listed above; initially with n=5 mice planned with additional injections possible) are assessed. The relative amount of DUX4 and DUX4-s is also assessed using real-time PCR approaches.

(33) While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.

(34) All documents referred to in this application are hereby incorporated by reference in their entirety.