Whole cell vaccines

Abstract

The disclosure relates to attenuated bacterial cells expressing glycans and glycoconjugate antigens and their use in the manufacture of whole cell vaccines effective at preventing or treating bacterial infections in non-human species.

Claims

1. A vaccine or immunogenic composition, comprising: a live pathogenic Streptococcus suis bacterial cell consisting of a genetically inactivated or mutated sortase B gene wherein said sortase B gene prior to its genetic inactivation or mutation is encoded by: i) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1; or ii) a nucleic acid molecule comprising at least 95% sequence identity SEQ ID NO: 1, and encodes a sortase B, and an adjuvant.

2. The vaccine or immunogenic composition of claim 1, wherein said sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide molecule comprising at least 96% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and encodes a sortase B.

3. The vaccine or immunogenic composition of claim 1, wherein said sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide sequence comprising at least 97% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and encodes a sortase B.

4. The vaccine or immunogenic composition of claim 1, wherein said sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide sequence comprising at least 98% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and encodes a sortase B.

5. The vaccine or immunogenic composition of claim 1, wherein said sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide sequence comprising at least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and encodes a sortase B.

6. The vaccine or immunogenic composition of according to claim 1, wherein the sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide sequence comprising SEQ ID NO: 1.

7. The vaccine or immunogenic composition of claim 1, wherein the sortase B gene prior to its genetic inactivation or mutation is encoded by a nucleotide sequence consisting of SEQ ID NO: 1.

8. The vaccine or immunogenic composition of claim 1, wherein the mutated sortase B gene comprises a deletion of the sortase B gene.

9. A method to prevent a Streptococcus suis infection, comprising administering the vaccine or immunogenic composition according to claim 1 to an animal subject, thereby preventing Streptococcus suis infection in the animal subject.

10. The method according to claim 9, wherein said animal subject is a pig.

Description

BRIEF SUMMARY OF THE DRAWINGS

(1) An embodiment of the invention will now be described by example only and with reference to the following figures:

(2) FIGS. 1A and 1B illustrate a growth comparison in E. coli CLM24 following induction of expression of C. jejuni pgIB and CspgIB2. Growth curves were set up to monitor the optical density of the E. coli cells following induction of CspgIB1 or CspgIB2 (FIGS. 1A and B): We found that CspgIB2 and C. jejuni pgIB appeared to have very similar toxicity levels;

(3) FIG. 2 illustrates glycosylation efficiency test in E. coli CLM24 glycosylating exotoxin A carrying a single glycosylation site.

(4) FIG. 3 illustrates C. jejuni heptasaccharide glycosylation of CjaA from two independent clones of PoulvaC E. coli [bands B and C]. A) Anti-cMyc tag channel only; B) Anti C. jejuni heptasaccharide only; C) overlaid cMyc and C. jejuni heptasaccharide combined signals;

(5) FIG. 4 illustrates formation of a hybrid polysaccharide on the surface of PoulVac E. coli and Salmonella; and Streptococcus equi with the alteration that surface presentation would be via attachment to a phosphatidylglycerol membrane anchor instead of UndPP.

(6) FIG. 5 illustrates a prototype dual poultry glycoconjugate vaccine.

(7) FIG. 6 DNA sequence corresponding to constructs assembled. Green, pEXT21 sequence; purple, EcoRI restriction site; Yellow, 10 nucleotide insertion; red, C. sputorum pgIB sequence. Contig indicates the construct assembled whilst expected is the expected C. sputorum pgIB sequence;

(8) FIGS. 7A, 7B, and 7C: Schematic diagram representing the genetic loci manipulated by allele exchange, FIG. 7A the cps2E locus, FIG. 7B the srtB locus and FIG. 7C the srtF locus. The large arrows represent individual genes within the loci, those in blue represent the genes targeted for deletion. The small arrows represent the primer pairs used to construct the deletion cassettes;

(9) FIGS. 8A, 8B, and 8C: Deletion of FIG. 8A the cps2E gene, responsible for capsule production, FIG. 8B the srtB gene and FIG. 8C the srtF gene from S. suis P1/7. PCR screening was undertaken to confirm the deletion of the three targeted genes using primers spanning the targeted genes in S. suis P1/7 to identify deletions. FIG. 8A. PCR of the Δcps2E screening MW, Hyperladder I molecular weight marker; Δcps2E, csp2E deletion mutant DNA; R, revertant to wild type DNA; WT, wild type P1/7 DNA; water, water control. FIG. 8B. PCR of the ΔsrtB screening MW, Hyperladder I molecular weight marker; ΔsrtB, ΔsrtB deletion mutant DNA; WT, wild type P1/7 DNA. FIG. 8C. PCR of the ΔsrtF screening MW, Hyperladder I molecular weight marker; ΔsrtF, ΔsrtF deletion mutant DNA; WT, wild type P1/7 DNA. All deletions were confirmed by Sanger sequencing the PCR products;

(10) FIG. 9 DNA sequence corresponding to constructs assembled. Green, pEXT21 sequence; purple, EcoRI restriction site; Yellow, 10 nucleotide insertion; red, C. sputorum pgIB sequence. Contig indicates the construct assembled whilst expected is the expected C. sputorum pgIB sequence;

(11) FIG. 10 Growth curve of E. coli CLM24 carrying glycoengineering constructs. Orange pEXT21 coding for C. sputorum PgIB with the ATG start codon immediately after the EcoRI restriction site. Blue pEXT21 carrying C. jejuni pgIB;

(12) FIG. 11 Growth curve of E. coli CLM24 carrying glycoengineering constructs. Source of PgIB is pEXT21 coding for C. sputorum PgIB with a 10 base pair spacer before the ATG start codon immediately after the EcoRI restriction site; and

(13) FIG. 12: Serum antibody titre at day 0 and day 15 after challenge of pigs with the mutants.

SEQUENCE LISTING

(14) The Sequence Listing is submitted as an ASCII text file in the form of the file named “Sequence.txt” (˜60 kb), which was created on Sep. 2, 2019, and which is incorporated by reference herein.

(15) Materials and Methods

(16) Bacterial Strains and Growth Conditions

(17) Escherichia coli Top10 (Invitrogen) was grown in Luria-Bertani (LB) growth media supplemented with chloramphenicol (12.5 μg.Math.ml.sup.−1) where appropriate. The S. suis P1/7 strain was cultured at 37° C. in a 5% CO.sub.2 incubator and grown on BHI medium. Where appropriate media was supplemented with chloramphenicol (5 μg.Math.ml.sup.−1). Plasmids were transferred into S. suis by electroporation.

(18) General Molecular Biology Techniques

(19) Plasmids were extracted using a plasmid mini kit (Qiagen) and the genomic DNA with the DNeasy Blood and tissue kit (Qiagen) following treatment with lysozyme (10 mg.Math.ml.sup.−1 in phosphate-buffered saline at 37° C. for 30 min), then SDS (10% [wt/vol]) at 65° C. for 30 min) or chelex extraction (cell pellets vortexed in 5% chelex [Sigma] boiled for 10 min, pelleted and the supernatants removed and used). DNA was amplified for cloning using Phusion high fidelity polymerase (NEB), and for screening using Go-taq polymerase (Promega), both in accordance with the manufacturers' instructions. DNA was extracted from PCR reactions and agarose gels using the QIAquick PCR and gel extraction kits (Qiagen) respectively. Plasmids were constructed by restriction/ligation cloning using restriction endonucleases, Antarctic phosphatase and T4 ligase (NEB). Plasmids were confirmed by restriction analysis and Sanger sequencing (SourceBioscience).

(20) Construction of Allele Exchange Plasmids

(21) The modular plasmid pMTL82151 was used in this study as the backbone for all allele exchange plasmids. Allele exchange cassettes were assembled by SOE-PCR digested with restriction endonucleases and ligated with pMTL82151, linearized using the same restriction endonucleases. A list of all primers and their corresponding restriction endonucleases can be found in the Table 2. The internal SOE primers were designed to amplify the first three codons and the terminal five codons of the target gene from which regions of approximately 1200 bp were amplified upstream or downstream respectively.

(22) Mutagenesis

(23) Allele exchange plasmids were transferred to S. suis by electroporation and transformants were grown on BHI agar supplemented with chloramphenicol (Cm), to select for the plasmid borne catP gene. In the second part of the experiment, chloramphenicol selection was removed to allow growth of double-crossover clones lacking the plasmid marker catP. Single-crossover clones were sub-cultured daily for up to eight consecutive days on non-selective medium. At each sub-culture, several colonies were screened for loss of the plasmid-encoded Cm-resistance by replica-plating. Double-crossover events were detected by replica plating onto non-selective and Cm plates and mutants verified by PCR (see below).

(24) Confirmation of In-Frame Deletion Mutants

(25) In-frame deletion mutants were confirmed by PCR also using the chromosomal flanking primers. The sequences of the mutants were confirmed by Sanger sequencing (Sourcebioscience).

(26) Construction of C. sputorum pgIB2 Expression Plasmid pELLA1

(27) A codon optimised version of C. sputorum pgIB2 was generated by DNA synthesis in the cloning vector pUC57 km and designed to have EcoRI (GAATTC) restriction enzyme sites at the 5′ and 3′ end of the construct. The plasmid pEXT21 was grown in E. coli DH5α cells and purified by plasmid extraction (QIAGEN Ltd UK). 1 μg of pUC57 Km containing CsPgIB2 and 1 μg of pEXT21 were digested with EcoRIHF (New England Biolabs U.K.) cloned into the EcoRI site of the IPTG inducible expression vector pEXT21 to generate the vector pELLA1.

(28) Construction of pELLA2

(29) The gene coding for C. sputorum PgIB2 was amplified by PCR with the pTac promoter and Lacl repressor from plasmid pEXT21 as a template using accuprime Taq hifi with (SEQ ID NO: 13, 5′-TTTTGCGGCCGCTTCTACGTGTTCCGCTTCC-3′) as forward primer and (SEQ ID NO:14, 5′-TTTTGCGGCCGCATTGCGTTGCGCTCACTGC-3′) reverse primer using the following cycling conditions, 94° C./2 minutes followed by 35 cycles of 94° C. for 30 seconds, 56° C. for 30 seconds and 68° C. for 4 minutes. and ligated into the unique NotI site in pJCUSA1 a Zeocin® resistant transposon where the antibiotic marker is flanked by loxP sites allowing for downstream removal of antibiotic marker from the final target strain via the introduction of the CRE enzyme. It has a pMB1 origin of replication and thus can be maintained in any E. coli strain prior to being cut out and transferred along with the Zeocin® resistance cassette using Sfil restriction enzyme digestion and transfer into the pUT delivery vector thus generating a functional transposon. The sequence of the transposon is shown below (SEQ ID NO: 15):

(30) TABLE-US-00001 5′GGCCGCCTAGGCCGCGGCCGCCTACTTCGTATAGCATACATTATACGA AGTTATGTCTGACGCTCAGTGGAACGACGCGTAACTCACGTTAAGGGATT TTGGTCATGATCAGCACGTTGACAATTAATCATCGGCATAGTATATCGGC ATAGTATAATACGACAAGGTGAGGAACTAAAACATGGCCAAGTTGACCAG TGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCT GGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCC GGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCA GGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACG AGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCC TCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTT CGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGC AGGACTGAATAACTTCGTATAGCATACATTATACGAAGTTATGGCCGCCT AGGCC-3′.

(31) The insertion of CspgIB2 into this transposon and transfer into the pUT delivery vector resulted in plasmid pELLA2 and maintained in Transformax E. coli strain EC100D pir+ (Cambio U.K.).

(32) Bacterial Conjugation

(33) To enable transfer of the CspgIB2 transposon cargo into the chromosome of a recipient E. coli strain or any other bacterium the plasmids pELLA2 was transferred into E. coli MFD a diaminopimelic acid (DAP) auxotroph. Growth medium was supplemented with Zeocin® 100 μg/ml and ampicillin 100 μg/ml. Both donor and recipient bacteria were growth until late exponential phase. Bacterial cells were pelleted by centrifugation, washed 3 times with PBS and mixed together in a ratio of 1:3 recipient to donor and spotted on a dry LB agar plate with no antibiotics for 4-8 hrs. The cells were scraped and suspended in PBS and dilutions plated on LB agar with appropriate selection antibiotics to select for transconjugants. Individual colonies were picked up and screened for loss of the pUT backbone and for the presence of the transposon.

(34) Generation of Unmarked pgIB Insertion

(35) The transposon carrying CspgIB2 and loxP recombination sites around a Zeocin® resistance cassette was introduced into PouIVAc E. coli. Following selection for Zeocin® resistant colonies, the antibiotic selection marker was removed by introduction via electroporation, the temperature sensitive vector pCRE5 (Reference: Appl Environ Microbiol. 2008 February; 74(4): 1064-1075. Genetic Tools for Select-Agent-Compliant Manipulation of Burkholderia pseudomallei. Kyoung-Hee Choi, Takehiko Mima, Yveth Casart, Drew Rholl, Ayush Kumar, Ifor R. Beacham and Herbert P. Schweizer).

(36) PoulVAc E. coli was cultured at 28° C. in the presence of kanamycin 50 μg/ml, rhamnose was added to induce expression at 0.2% final concentration and the organism subcultured several times to select for colonies that had lost resistance to Zeocin® but maintained resistance to kanmaycin indicating that the bleomycin resistance gene had been flipped out of the chromosome.

(37) This E. coli mutant was then sub-cultured at 42° C. to cure out the pCRE5 plasmid. Screening for colonies that had once again become sensitive to kanamycin confirmed loss of pCRE5 and completed generation of an unmarked inducible copy of pgIB on the chromosome of E. coli.

(38) Construction of pELLA3

(39) The pgIB gene from C. sputorum was amplified using the primers CsPgIB1fwd: TTTT GAATTCGATTATCGCCATGGCGTCAAATTTTAATTTCGCTAAA (SEQ ID NO 16) and the reverse primer CsPgIB1 rev: TTTT GAATTC TTATTTTTTGAGTTTATAAATTTTAGTTGAT (SEQ ID NO 17) using Accuprime Taq Hifi and the following cycling conditions 94° C./30 s, followed by 24 cycles of the following conditions 94° C./30 s, 53° C./30 s, 68° C./2 min. The PCR product was cut with the restriction enzyme EcoRI HF for 16 hr at 37° C. The plasmid pEXT21 was also cut with the restriction enzyme EcoRI HF for 16 hr at 37° C. Both plasmid and PCR product were purified with a PCR purification kit (QIAGEN UK) and the plasmid pEXT21 was dephosphorylated by treating with Antarctic phosphatase (NEB UK Ltd) at 37° C. for 1 hr. The enzyme was heat inactivated by heating at 80° C. for 2 min before the plasmid and the insert were ligated together using T4 DNA ligase (Promega UK) and the reaction was incubated overnight at 4° C. The ligation reaction was transformed into E. coli Dh10β cells (NEB UK Ltd) and recovered on LB Spectinomycin plates (80 μg/ml). Constructs were then sequenced to confirm that the cloned C. sputorum PgIB had not gained any mutations during the cloning process. This new construct was named pELLA3.

(40) In another version of this glycoengineering tool a mariner Himar1 element was modified to carry a unique NotI site between the IR1 and IR2 ends of the transposon. This NotI site was used to enable the integration of the hyaluronan synthase gene and UDP-Glc dehydrogenase encoding genes from Streptococcus pneumoniae serotype 3 under control of the erm cassette contained within the Himar1 transposon. The vector used to make the Himar1 based insertions was a derivative of vector pCAM45 (May et al. FEMS Microbiology Letters 2004) with the modification that the R6k origin of replication was removed. This new transposon carrying vector was named pELLA4.

(41) Carrier Polypeptide

(42) Attenuated bacterial strains are transformed with the plasmid pGVXN150:GT-ExoA encoding a modified carrier polypeptide [GT-ExoA]. The GT-ExoA construct was engineered to express a modified version of P. aeruginosa Exotoxin A in the vector pGH and closed into a vector derived from pEC415 using the restriction enzymes NheI and EcoRI (NEB). The synthesized protein contains two internal modifications that allow glycosylation of the protein by PgI, as well as containing four N-glycosylation sequons at the N terminal and an additional 4 at the C terminals glycotags. In addition, a hexa-histidine tag was added to the C-terminus of the protein to facilitate putification and and an E. coli DsbA signal peptide was added to the N-terminal sequences enabling Sec-dependent secretion to the periplasm. pGVXN150: GT-ExoA is ampicillin resistant and L-(+)-Arabinose inducible. The construct sequence was then confirmed using Sanger sequences with the primers GTExoA NF (SEQ ID NO 18; GCGCTGGCTGGTTTAGTTT), GTExoA NR (SEQ ID NO 19; CGCATTCGTTCCAGAGGT), GTExoA CF (SEQ ID NO 20; GACAAGGAACAGGCGATCAG) and GTExoA CR (SEQ ID NO 21; TGGTGATGATGGTGATGGTC).

(43) Reducing the Toxicity of PgIB

(44) Protein glycan coupling technology requires the use of Campylobacter jejuni PgIB. This enzyme has 13 transmembrane domain and is toxic when overexpressed in E. coli. The pgIB gene was originally amplified by PCR with oligonucleotides PgIBEcoRI (EcoRI in bold) using the primers (SEQ ID NO 22: AAGAATTCATGTTGAAAAAAGAGTATTTAAAAAACCC) and PgIBNcoI-HA (SEQ ID NO 23: AACCATGGTTAAGCGTAATCTGGAACATCGTATGGGTAAATTTTAAGTTTAAAAACCTTAGC), using Pfu polymerase with pACYC(pgI) as template. Oligonucleotide PgIBNcoI-HA encodes an HA-tag to follow PgIB expression by Western blot. The PCR product was digested with EcoRI and NcoI and cloned in the same sites of vector pMLBAD. The plasmid obtained was named pMAF10. Arabinose-dependent expression of PgIB was confirmed by Western blot (Feldman et al. 2005). This construct has been subcloned into the EcoRI site of the vector pEXT21 allowing for IPTG dependant inducible expression of CjpgIB. This plasmid and ORF combination has been used for several years in order to produce several glycoconjugate vaccines. In a recent modification using PgIB from Campylobacter sputorum we have carried out tests and found that the ribosome binding site is encoded within the pEXT21 vector itself. This means that translational efficiency is partly controlled by the distance between the RBS and the ATG start codon of pgIB. We noticed that inserting the PgIB coding gene into the vector pEXT21 with an extended 10 base pairs of DNA sequence resulted in reduced toxicity of the enzyme and subsequently increased growth in the carrier E. coli strain as measured by optical density. Therefore it may be possible to reduce the toxicity of C. jejuni PgIB by the simple modification of insertion of additional nucleotides before the ATG start codon or alternatively clone the gene further away from the RBS carried within the expression plasmid.

(45) In Vitro Mutagenesis of the C. jejuni 81116 pgI Locus Cloned in pACYC184

(46) Mutagenesis of 11 genes in the C. jejuni 81116 glycosylation locus cloned in pACYC184 (pACYCpgI) was performed in vitro using a customised EZ::TNtransposon system (Epicentre, Madison, Wis., USA). Briefly, a kanamycin resistance cassette (Trieu-Cuot et al., 1985) lacking a transcriptional terminator and therefore unable to exert downstream polar effects was amplified by PCR and cloned into the multiple cloning site of the vector pMOD™<MCS> (Epicentre). This construct was linearized by ScaI digestion and the kanamycin resistance cassette along with flanking mosaic ends was amplified by PCR using primers FP-1 and RP-1 (Epicentre). The PCR product was combined with plasmid pACYCpgI (Wacker et al., 2002) in an in vitro transposition reaction performed according to manufacturer's instructions (Epicentre). The resultant pool of mutated pACYCpgI plasmids was electroporated into E. coli XL1-Blue MRF′ (Stratagene) and putative mutants were screened by PCR to identify the location and orientation of the kanamycin cassette. We only used those mutants having the kanamycin resistance cassette inserted with the same transcriptional orientation as the genes of the glycosylation locus, which were also confirmed by sequence analysis.

(47) Pathogenesis of Streptococcus suis Mutants and Wild Type P1/7 Strain in Pigs

(48) TABLE-US-00002 TABLE 1 Experimental Groups GROUP CHALLENGE NO PIG# 4E RM Group 1 Δ cps2E 5 1-5 7 Group 2 Δ srtB 5  6-10 9 Group 3 Δ srtF 5 11-15 11 Group 4 Δ 1476 5 16-20 13 Group 5 WT SS P1/7 (shared w/ 8 990-997 8-14 SRD121) (2 pigs/room)

(49) Nasal swaps and blood samples were taken from the pigs prior to intranasal challenge with Streptococcus suis mutant and wild type strains (day 0). The pigs were challenged with 2 ml (1 ml per nostril) of approx. 10.sup.9 CFU/ml in PBS of S. suis mutant and wild type strains (Table 3).

(50) TABLE-US-00003 TABLE 3 Titers of inocula: Δ cps2E (−5) tntc (−6) 250, 176 (−7) 15, 9 2.13 × 10.sup.9 CFU/ml Δ srtB (−5) tntc (−6) 122, 102 (−7) 16, 15 1.12 × 10.sup.9 CFU/ml Δ srtF (−5) tntc (−6) 146, 170 (−7) 16, 18 1.58 × 10.sup.9 CFU/ml Δ 1476 (−5) tntc (−6) 190, 189 (−7) 23, 20 1.90 × 10.sup.9 CFU/ml P1/7 (−5) tntc (−6) 63, 66 (−7) 6, 4 6.45 × 10.sup.8 CFU/ml

(51) On day 2, 5 and 7 either nasal or nasal and tonsil swabs were taken and immediately plated for bacterial count.

(52) Pigs were observed for clinical signs of severe disease, including lameness, lethargy, neurological symptoms. Samples at necropsy such as SST for blood, nasal swab, tonsil swab, swab of serosa (pericardium, thoracic cavity, abdominal cavity), joint tap or swab (affected joint or hock), CSF tap. Lung lavage was taken and either immediately cultured or frozen, gross lesions were recorded. Samples were collected in 2 ml PBS except lung lavage where 50 ml of PBS were instilled into the lung and collected with a pipette. 100 ul of the samples were plated on TSA blood agar plates.

(53) If presentation was severe enough (dyspneic, paddling and/or does not rise upon human entry into the pen), the pig was euthanized. Otherwise if no clinical signs show pigs were euthanize pigs at day 15 after infection. Serum antibody titre was measured after 15 days of exposure in pigs (FIG. 12).

EXAMPLE 1

(54) The construct pELLA1 was transformed into E. coli CLM24 cells alongside a pEC415 vector coding for Pseudomonas aeruginosa exotoxin A with a single internal glycosylation site and the plasmid pACYCpgIB::km coding for the entire C. jejuni heptasaccharide with a disruption in the pgIB gene by insertion of a miniTn5km2 element. As a comparison the exotoxin A and C. jejuni heptasaccharide coding constructs were transformed into an E. coli CLM24 cell carrying pEXT21pgIB from C. jejuni. 500 ml LB containing 30 μg/ml.sup.−1 cm, 100 μg/ml.sup.−1 amp, 80 μg/ml.sup.−1 spectinomycin were inoculated with 10 ml of an O/N culture of either CLM24 construct combination and incubated with shaking at 37° C. Optical density 600 nm reading were taken at hourly intervals and protein expression induced at an OD.sub.600 nm of 0.4 by the addition of IPTG 1 mM and L-arabinose 0.2% final concentration. 5 hr post initial induction, 0.2% L-arabinose was added and OD.sub.600 nm continued to be measured (FIG. 1A).

(55) The growth of E. coli CLM24 cells without any induction of protein expression was also measured. This was carried out in the same way as described above for the E. coli CLM24 cells carrying pELLA1 except that no IPTG or L-arabinose was added (FIG. 1B).

EXAMPLE 2

(56) E. coli CLM24 cultures carrying plasmids coding for singly glycosylatable exotoxinA, C. sputorum PgIB2 or C. jejuni PgIB were used to inoculate 500 ml of LB broth. Protein expression was induced as described in example 1 with the modification that the cultures were incubated for a further 16 hr after the second 0.2% L-arabinose addition. At this point cells were pelleted by centrifugation at 4000×g for 30 min and lysed using a high pressure cell homogeniser (Stansted Fluid power) HIS tagged exotoxinA was purified from CLM24 cells using NiNTA binding. Protein was separated on a 12% Bis-tris gel (Invitrogen) before transferring onto a nitrocellulose membrane. This was probed with primary rabbit hr6 anti-campy glycan antibody and mouse anti-HIS. Goat anti-rabbit and anti-mouse infrared dye labelled secondary antibodies were used to enable visualisation of glycoprotein using an Odyssey LI-COR scanner (LI-COR Biosciences UK Ltd) (FIG. 2).

EXAMPLE 3

(57) pACYCpgI was introduced into PouIVAC E. coli by electroporation alongside the plasmid pUA31 coding for a c-Myc tagged tetraglycosylatable L-arabinose inducible CjaA. After 2 inductions with 0.2% L-arabinose and a total of 24 hr incubation at 37° C. with shaking. 1 ml of culture was obtained and centrifuged at 10,000×g for 10 min. The supernatant was discarded and the pellet resuspended in 100 μl of 2×SDS PAGE loading dye. This was boiled for 10 min before 20 μl was loaded into a 12% Bis-Tris gel and transferring onto a nitrocellulose membrane. Samples were probed with mouse anti c-Myc antibody and rabbit hr6 antibody. Goat anti-rabbit and anti-mouse infrared dye labelled secondary antibodies were used to enable visualisation of glycoprotein using an Odyssey LI-COR scanner (LI-COR Biosciences UK Ltd) (FIG. 3).

EXAMPLE 4

(58) Salmonella Typhimurium strain SL3749 was transformed with pUA31 (coding for the acceptor protein CjaA), pACYCpgI(pgIB::km) (coding for C. jejuni heptasaccharide coding locus but with pgIB knocked out) and pMAF10 (coding for arabinose inducible C. jejuni PgIB). A 10 ml O/N 37° C. shaking culture was prepared and used to inoculate 200 ml of LB broth. This continue to be shaken 37° C. until an OD600 nm of 0.4 was reached. At this point 0.2% L-arabinose was added to induce CjaA and PgIB expression. After 4 hr of incubation L-arabinose was added again to 0.2% final concentration and culture incubated for a further 16 hr at 37° C. with shaking. Bacterial cultures were pelleted by centrifugation at 6000×g for 30 min and resuspended in 30 ml 25 mM Tris, 0.15 M NaCl pH 7.5 (TBS). Cells were lysed using a high pressure cell homogeniser. 2% SDS and 1% Triton X-100 were added and the lysed material incubated for 3 hr at 4° C. with mixing. The material was then centrifuged at 4000×g for 20 min. Pellet was discarded before 300 μl of c-Myc sepharose (Thermo Scientific USA) was added. This was allowed to incubate O/N at 4° C. with mixing. The material was then centrifuged at 4000×g for 10 min and the supernatant removed. 1 ml TBS was added with 0.05% Tween. This was washed 5 times by pulsing at 10,000×g. Protein elution was achieved by the addition of 300 μl 2XSDS loading buffer containing 3 μl DTT and boiled for 10 minutes. Western blot was carried out as described in example 3 (FIG. 5).

EXAMPLE 5

(59) We have used the transposon pELLA2 carrying an IPTG inducible copy of CspgIB to integrate this gene into the chromosomes of glycoengineering E. coli strains W3110, CLM24, CLM37, SΘ874, SCM7, SCM6, SCM3 as well as PouIVAc E. coli and S. typhimurium.

EXAMPLE 6

(60) The E. coli strain CLM24 carrying a plasmid coding for the Campylobacter jejuni heptasaccharide pACYCpgI (without a knock out in pgIB) and an acceptor protein as well as the construct pELLA1 were grown in 50 ml of LB broth containing Cm 30 μg/ml, Sp 80 μg/ml, Amp 100 μg/ml with shaking at 37° C. Optical density readings were taken at 600.sub.nm at hourly intervals. The growth was compared to that observed when pEXT21 carried C. jejuni pgIB. At an optical density of OD600.sub.nm of 0.4 IPTG was added at a final concentration of 1 mM and L-arabinose was added at 0.2% final concentration. Results are shown in FIG. 8 and are the average (mean) of three biological replicates.

EXAMPLE 7

(61) The E. coli strain CLM24 carrying a plasmid coding for the Campylobacter jejuni heptasaccharide pACYCpgI (without a knock out in pgIB) and an acceptor protein as well as the construct pELLA3 were grown in 50 ml of LB broth containing Cm 30 μg/ml, Sp 80 μg/ml, Amp 100 μg/ml with shaking at 37° C. Optical density readings were taken at 600.sub.nm at hourly intervals. The growth was compared to that observed when pEXT21 carried C. jejuni pgIB. At an optical density of OD600.sub.nm of 0.4 IPTG was added at a final concentration of 1 mM and L-arabinose was added at 0.2% final concentration. Results are shown in FIG. 9 and are the average (mean) of three biological replicates.

EXAMPLE 8

(62) Mutagenesis of the Swine and Human Pathogen Streptococcus suis Serotype 2 (ss2) in the Absence of a Counter-Selection Marker

(63) S. suis serotype 2, is a major pathogen of swine that has recently been reported to have crossed the species barrier, causing infections in humans. The presence of the polysaccharide capsule is considered the major virulence determinant and the gene cps2E is thought to be essential for capsule formation. Other genes of interest to us were the S. suis sortases of which there are 6 putative sortases, SrtA-F.

(64) First we identified a plasmid pMTL82151 which is non-replicative in S. suis and therefore suitable as a suicide plasmid in this organism. S. suis P1/7 competent cells transformed with pMTL82151 could not form colonies on selective plates, while cells transformed with the replicative plasmid pSET1 formed colonies as expected. Allele exchange cassettes for the deletion of the genes csp2E, srtB and srtF were then constructed, with approximately 1.2 kbp regions of homology (with the exception of srtF homology region 2 which contained a 700 bp region of homology to avoid cloning any whole genes which appeared to be toxic to E. coli). S. suis was transformed with the allele exchange plasmids and chloramphenicol (Cm) resistant single-crossover clones obtained. Single-crossover integrants were passaged without selection and each day colonies were patch plated to determine whether double recombination had occurred. This frequency was high enough that mutants could be easily isolated by the fifth and sixth passage without selection. Cm-sensitive clones were screened by PCR to determine whether they contained mutant or alleles revertant to wild type, mutants of cps2E, srtB and srtFwere isolated and confirmed by Sanger sequencing.

(65) TABLE-US-00004 TABLE 2 Primer name Sequence (5′-3′) Function (restriction site) cps2E R1 TTACTTACTTCCCTCTCTCAAT Amplify P1/7 cps2E HA1 ATTTCAATATTCATAGCTCCT (SEQ ID NO 24) cps2E F2 AGGAGCTATGAATATTGAAATA Amplify P1/7 cps2E HA2 TTGAGAGAGGGAAGTAAGTAA (SEQ ID NO 25) cps2E F1 TATATTGAATTCAATTACAAAG Amplify P1/7 cps2E HA1 -1200 ATTACAGGTTTG (SEQ ID NO bp (EcoRI) 26) cps2E R2 AGTTCAGGATCCTCCTTTAAAC Amplify P1/7 cps2E HA1 +1200 AACTTCTCATAC (SEQ ID NO bp (BamHI) 27) cps2E screen CTGCGGCTAGTCTCGCTATT PCR screen P1/7 Δcps2E F (SEQ ID NO 28) cps2E screen CATGCGCTTCAAATTCATTC PCR screen P1/7 Δcps2E R (SEQ ID NO 28) srtB F1 AGTTCACATATGCGGGTGGTA Amplify P1/7 srtB HA1 Forward TCGGTACACTT (SEQ ID NO 30) srtB R1 CCTTTTTGTTAATAAGAAAATC Amplify P1/7 srtB HA1 Reverse AGTTTCTGTATCATAATCCGAA CTTC (SEQ ID NO 31) srtB F2 GAAGTTCGGATTATGATACAGA Amplify P1/7 srtB HA2 Forward AACTGATTTTCTTATTAACAAAA AGG (SEQ ID NO 32) srtB R2 TTCGTATGGATCCAACTACGGT Amplify P1/7 srtB HA1 Reverse GACCGGCAAT (SEQ ID NO 33) srtB screen F GAGAATTGAAGGAAGTGATA PCR screen P1/7 ΔsrtB (SEQ ID NO 34) srtB screen R ATATAAGGAGTACAGGTTAG PCR screen P1/7 ΔsrtB (SEQ ID NO 35) srtF F1 AGTTCAGCTAGCGGGCAAAGA Amplify P1/7 srtF HA1 Forward ATTTCGGTACA (SEQ ID NO 36) srtF R1 CTTTCTGAGGTTCCATGGTAAG Amplify P1/7 srtF HA1 Reverse GAGCCATTTGATCATGAAAT (SEQ ID NO 37) srtF F2 ATTTCATGATCAAATGGCTCCT Amplify P1/7 srtF HA2 Forward TACCATGGAACCTCAGAAAG (SEQ ID NO 38) srtF R2 TTCGTATGGATCCGTAGTCCAA Amplify P1/7 srtF HA1 Reverse ATGAGCTACTTAC (SEQ ID NO 39) srtF screen F GACAAGCCAACTGAAACAAC PCR screen P1/7 ΔsrtF (SEQ ID NO 40) srtF screen R AGATTCCCCTGATTTAGCTA PCR screen P1/7 ΔsrtF (SEQ ID NO 41) M13F ACTGGCCGTCGTTTTACA PCR screen (SEQ ID NO 42) M13R CAGGAAACAGCTATGACC PCR screen (SEQ ID NO 43) HA = homology arm; bp = base pairs; F = Forward; R = Reverse. Underlined sequences correspond to recognition sequences for restriction endonuclease

EXAMPLE 9

(66) The pigs were challenged with the wild type strain of S. suis (P1/7), the cps2E mutant which was used as a non-disease-causing control, the srtB and srtF mutants and a mutation in ssu1476 which is a putative sorted protein. Challenge was intranasal, the natural route of infection in pigs.

(67) Onset of clinical signs/necropsy in groups 4-5 was between 3-8 days, whereas groups 1-3 showed no clinical symptoms 15 days after challenge.

(68) TABLE-US-00005 TABLE 4 Results - Strep culture at necropsy Onset of clinical signs/necropsy Nasal Tonsil Serosal Joint Pig day wash swab BALF swab fluid CSF Serum 1 NCS/15 ? ? — — — — — 2 NCS/15 ? ? — — — — — 3 NCS/15 ? ? — — — — — 4 NCS/15 ? ? — — — — — 5 NCS/15 ? ? — — — — — 6 NCS/15 ? ? — — — — — 7 NCS/15 ? ? — — — — — 8 NCS/15 ? ? — — — — — 9 NCS/15 ? ? — — — — — 10 NCS/15 ? ? — — — — — 11 NCS/15 ? ? — — — — — 12 NCS/15 ? ? — — — — — 13 NCS/15 ? ? — — — — — 14 NCS/15 ? ? — — — — — 15 NCS/15 ? ? — — — — — 16 6/6 + ? — — 27 tntc tntc 17 NCS/15 ? ? — — — — — 18 3/3 ? ? — 300  Tntc —  1 19 6/6 tntc ? — 2 — tntc tntc 20 6/6 100 ? — — — tntc — 990 5/6 100 ? 1 tntc Tntc tntc 148  991 4/4 ? ? — — Tntc — tntc 992 8/8 ? ? — 2 Tntc tntc 17 993 3/3 ? ? — — 10 tntc 95 994 NCS/15 ? ? — — — — — 995 8/8 ? ? — 10  Tntc tntc tntc 996 5/5 ? ? — — Tntc — 20 997 6/6 ? ? — — — tntc 72 CS = no clinical signs ? = too many contaminating bacteria to see whether or not Strep colonies were present, plan to do PCR. + = Strep present but difficult to estimate numbers with other bacteria present.

REFERENCES

(69) Development of an in vivo Himar1 transposon mutagenesis system for use in Streptococcus equi subsp. equi. May J P, Walker C A, Maskell D J, Slater J D. FEMS Microbiol Lett. 2004 September 15; 238(2):401-9. Mutagenesis of Streptococcus equi and Streptococcus suis by transposon Tn917. Slater J D, Allen A G, May J P, Bolitho S, Lindsay H, Maskell D J. Vet Microbiol. 2003 May 29; 93(3):197-206. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. Bentley S D.sup.1, Aanensen D M, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy L, Quail M A, Samuel G, Skovsted I C, Kaltoft M S, Barrell B, Reeves P R, Parkhill J, Spratt B G. PLoS Genet. 2006 March; 2(3):e31. Gene content and diversity of the loci encoding biosynthesis of capsular polysaccharides of the 15 serovar reference strains of Haemophilus parasuis. Howell K J, Weinert L A, Luan S L, Peters S E, Chaudhuri R R, Harris D, Angen O, Aragon V, Parkhill J, Langford P R, Rycroft A N, Wren B W, Tucker A W, Maskell D J; BRaDP1T Consortium. J Bacteriol. 2013 September; 195(18):4264-73. doi: 10.1128/JB.00471-13. Epub 2013 July 19. Exploitation of bacterial N-linked glycosylation to develop a novel recombinant glycoconjugate vaccine against Francisella tularensis. Cuccui J, Thomas R M, Moule M G, D'Elia R V, Laws T R, Mills D C, Williamson D, Atkins T P, Prior J L, Wren B W. Open Biol. 2013 May 22; 3(5):130002 Characterization of the structurally diverse N-linked glycans of Campylobacter species. Jervis A J, Butler J A, Lawson A J, Langdon R, Wren B W, Linton D. J Bacteriol. 2012 May; 194(9):2355-62